COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..3291298 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(952..1101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1133..1441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1662..2702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(2948..3664) product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848059.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(3688..6435) product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096399.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(6445..6726) product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600171.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(6723..7355) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001446637.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(7468..7689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 8174..13201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 13593..14678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105449.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(14900..15109) product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112403.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(15099..15683) product DUF2857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937857.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(15700..15894) product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205185.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(16047..16961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039790.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 17065..17283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(17376..17648) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175413.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 17795..18109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 18294..18608 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114194633.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(18744..19859) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212753.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 tRNA complement(20177..20252) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(20363..21160) product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816639.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene mtfA CDS complement(21400..21786) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 21941..22108 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705362.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(22195..23598) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 24042..24851 product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(24924..25523) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707008.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(25624..26382) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene moeB CDS complement(26385..27620) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816750.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene moeA CDS 28294..30195 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065127.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 30221..31765 product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097435.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene gsiB CDS 31874..32794 product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936028.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene gsiC CDS 32804..33709 product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704838.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene gsiD CDS complement(33768..35465) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168296.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(35672..36562) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211969.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene cdd CDS complement(36736..37431) product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162334.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(37431..37838) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816723.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(38049..38843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(39119..40423) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816798.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene bioA CDS 40519..41556 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951213.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene bioB CDS 41596..42753 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210763.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene bioF CDS 42734..43495 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210764.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene bioC CDS 43488..44168 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044843.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene bioD CDS 45044..47056 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816794.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene uvrB CDS 47082..47516 product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383881.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 47634..48215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(48212..49120) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246034.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene yvcK CDS 49131..49346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 49543..50532 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168084.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene moaA CDS 50567..51085 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097493.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene moaB CDS 51104..51598 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097492.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene moaC CDS 51595..51840 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168089.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene moaD CDS 51843..52295 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210774.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene moaE CDS 52408..53115 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158923.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(53188..54324) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168094.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(54334..55509) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168097.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(55502..57244) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168099.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(57237..58265) product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158910.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene hlyD CDS 58785..60890 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 60880..61899 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267800.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 61896..62885 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267801.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 62878..63909 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 63922..64773 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372869.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 64763..65572 product IucA/IucC family C-terminal-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267803.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 65994..67409 product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168103.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene rhlE CDS complement(67449..68348) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170570.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 68464..69336 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298308.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(69419..70648) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705572.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene pepT CDS 70810..72384 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419397.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(72435..72998) product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096685.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 73316..74248 product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706102.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene dusC CDS 74436..75848 product S-methylmethionine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704529.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene mmuP CDS 75841..76788 product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081352.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene mmuM CDS 76802..77353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816577.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 77751..78293 product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene cyaB CDS 78351..78710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 78773..79282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 79432..80379 product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706096.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene pbpG CDS 80864..83170 product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871518.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene bglX CDS 83271..83810 product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene idi CDS complement(84084..84731) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095436.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(84784..85629) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095437.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 85812..87911 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene dinG CDS 88433..89863 product serralysin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405046.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 89918..90280 product protease inhibitor Inh/omp19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767369.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 90298..92025 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 92032..93381 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 93405..94751 product alkaline protease secretion protein AprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110827.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene aprF CDS 94992..95321 product putative holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793146.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 95323..95934 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104439.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 95924..96598 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264664.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 96588..96917 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777272.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 96943..97221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227700.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 97454..97921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 97918..98115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875309.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 98105..99532 product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729859.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 99532..100056 product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162832341.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 100113..100409 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143612.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 100549..100869 product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084228.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 101174..103591 product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135574.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 103591..104520 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458386.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 104510..104722 product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478224.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 104710..105870 product contractile injection system protein, VgrG/Pvc8 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808005.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 105867..106448 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148265.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 106583..106855 product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859114.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 106846..107949 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 107942..108523 product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138756.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 108526..110517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 110517..111137 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816093.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(111261..111485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 111733..112701 product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386551.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene ybiB CDS 112788..114656 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(114708..115430) product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569080.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene glnQ CDS complement(115427..116086) product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858462.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene glnP CDS complement(116113..116859) product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838671.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene glnH CDS complement(117250..117753) product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210233.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene dps CDS 118095..118646 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684771.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(118634..119461) product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168205.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene rhtA CDS 119898..120413 product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097460.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene ompX CDS 120690..121859 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193455.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(121904..123304) product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224723.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 123710..124246 product thiosulfate sulfurtransferase YgaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229472.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene ygaP CDS 124321..124650 product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(124734..125105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(125586..126326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(126316..127143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(127321..127527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(127742..127936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(127933..128262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(128555..128908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(128954..129238) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104666.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(129228..129473) product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740683.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 129764..133834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 133847..135457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(136192..138798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(138795..138962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(139628..139843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(140037..140663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(140840..142090) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101723.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 tRNA complement(142268..142344) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(142423..144171) product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene yejM CDS complement(144186..144416) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208836.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 144637..145647 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208835.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene yejK CDS complement(145728..146876) product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112330.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(146976..147260) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494192.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene rplY CDS complement(147520..149280) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815987.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(149283..149522) product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377224.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 149747..150442 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171454.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene rsuA CDS 150483..151673 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208831.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 152057..152401 product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171447.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(152442..154058) product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815989.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene yejF CDS complement(154060..155085) product microcin C ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002353954.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(155082..156179) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208826.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(156189..157997) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208825.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(158465..159046) product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208822.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene mepS CDS complement(159368..160069) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171423.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(160108..161109) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815993.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(161196..161768) product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene yeiP CDS complement(162195..163487) product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000552001.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene setB CDS 163708..164841 product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171391.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene fruB CDS 164838..165776 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208798.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene fruK CDS 165795..167486 product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171384.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene fruA CDS complement(167595..168440) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene nfo CDS complement(168531..169520) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208790.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 169723..170595 product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548316.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene yieE CDS 170731..172206 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208786.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 172548..174665 product bifunctional siderophore receptor/adhesin Iha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene iha CDS 175091..176080 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693583.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(176500..177495) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168379.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(177492..179003) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816711.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 179268..180356 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816710.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(180467..180613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(180892..181536) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817296.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(181719..182564) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816746.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene fghA CDS complement(182607..183788) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162256.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(183842..184618) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168253.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 185437..187116 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817182.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 187456..188118 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709152.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene folE CDS 188240..189415 product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816743.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene yeiB CDS complement(189425..190204) product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920064.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene sanA CDS complement(190387..191700) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049367.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene rimO CDS 191923..193089 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172946.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(193121..193738) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208781.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 193882..194727 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524312.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 194809..195825 product virulence-associated ABC transporter ATP-binding protein SfbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569655.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene sfbB CDS 195818..196477 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342247.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 196762..197967 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208774.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(198112..198885) product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208770.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene deoR CDS complement(198917..199585) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208769.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene deoC CDS complement(199924..201333) product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097376.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 201989..202360 product inner membrane protein YbjM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681108.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(202454..202720) product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208765.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 203029..203748 product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704853.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene nfsA CDS 203765..204676 product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene rimK CDS 204940..205422 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208763.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 205795..206904 product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208762.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene potF CDS 207042..208244 product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069299.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene potG CDS 208259..209224 product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816015.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene potH CDS 209221..210066 product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816016.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene potI CDS 210274..210726 product YbjO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208757.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 210852..211985 product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208756.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene rlmC CDS complement(212344..213075) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171154.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(213307..213975) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211370.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene artM CDS complement(213975..214691) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001691.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene artQ CDS complement(214703..215434) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211368.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene artJ CDS complement(215455..216204) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162824.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene artP CDS 216390..216713 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 216787..217602 product N-acetylmuramoyl-L-alanine amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255150.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene amiD CDS complement(217599..219035) product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211363.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(219236..220261) product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211360.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene hcr CDS complement(220400..222052) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816026.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene hcp CDS complement(222242..223141) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816027.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 223101..223340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 223455..225119 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816028.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(225233..225454) product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447499.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene cspD CDS 225877..226197 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211349.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene clpS CDS 226227..228500 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162786.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene clpA CDS 228740..229219 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813692.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(229220..230665) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815708.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(230816..231034) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211347.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene infA CDS complement(231147..231851) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene aat CDS complement(231886..233625) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171075.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene cydC CDS complement(233625..235391) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217690.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene cydD CDS complement(235629..236591) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537432.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene trxB CDS 237178..237672 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene lrp CDS 237787..241275 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171070.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 241525..242136 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211338.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene lolA CDS 242144..243487 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171047.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 243591..244886 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162747.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene serS CDS 245163..246362 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171044.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(246348..247289) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192567381.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 247565..248869 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893249.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 248907..250016 product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896855.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 250027..251595 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454432.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(251684..252424) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171041.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene pflA CDS complement(252694..254976) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292799.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene pflB CDS complement(255034..255894) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211331.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene focA CDS complement(256063..256296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(256333..258096) product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816035.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 258426..259511 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene serC CDS 259593..260882 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097306.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene aroA CDS 261105..261782 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211324.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene cmk CDS 261863..263572 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391091.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene rpsA CDS 263662..263946 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211322.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene ihfB CDS complement(264113..264745) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211889.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene hisIE CDS complement(264739..265515) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097847.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene hisF CDS complement(265497..266234) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211891.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene hisA CDS complement(266241..266831) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168362.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene hisH CDS complement(266831..267898) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168369.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene hisB CDS complement(267914..268987) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168372.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene hisC CDS complement(268984..269859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 note possible pseudo, frameshifted CDS complement(269859..270317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 note possible pseudo, frameshifted CDS complement(270317..271216) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388789.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene hisG CDS 271766..272602 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816712.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(272705..274657) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817438.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(275009..276943) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209615.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(277408..278109) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098687.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(278201..279796) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045909943.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 280216..281586 product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098685.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 281702..282586 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098684.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 282674..283738 product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098683.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene citC CDS 283762..284052 product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878103.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene citD CDS 284037..284927 product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878102.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene citE CDS 284981..286510 product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098680.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene citF CDS 286537..287064 product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098679.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene citX CDS 287042..287947 product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098678.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene citG CDS 288318..289082 product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167541.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 289495..289716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 289706..291076 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211902.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(291152..292579) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211904.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene sbcB CDS 292862..293827 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209581.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 293849..294811 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209582.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 294798..295805 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817159.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 295802..296560 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157194.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 296683..297000 product PTS system regulator TmaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217522.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene tmaR CDS 297345..299618 product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211321.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 299620..301404 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097303.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene msbA CDS 301401..302402 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704887.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene lpxK CDS 302772..302954 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211315.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 302951..303703 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816038.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene kdsB CDS 304009..305322 product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 305521..306414 product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170979.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(306366..307214) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899546.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene elyC CDS 307381..308166 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211311.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene cmoM CDS 308163..309488 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170970.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene mukF CDS 309496..310191 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050078444.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene mukE CDS 310211..314650 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170968.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene mukB CDS 315074..316786 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830416.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene ldtD CDS 316965..317513 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170957.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 317595..318242 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211304.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(318314..319504) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211303.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(319823..320935) product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097287.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene ompF CDS complement(321231..322631) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159985.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene asnS CDS complement(322824..324029) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene pncB CDS 324253..326868 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816045.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene pepN CDS 327314..328324 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159993.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene pyrD CDS 328526..329113 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816046.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(329186..330289) product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816047.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 330400..332517 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816048.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene rlmKL CDS 332521..334449 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816049.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(334446..334667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 334677..335921 product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026017889.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene pqiA CDS 335908..337548 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050078426.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene pqiB CDS 337548..338114 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211289.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene pqiC CDS 338988..340547 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 tRNA complement(340832..340921) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 341201..341938 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211221.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 341999..342577 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211220.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(342656..343222) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211218.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(343422..344069) product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780893.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene grxB CDS complement(344252..345457) product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816537.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene mdtH CDS 345773..346357 product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097146.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene rimJ CDS 346367..346999 product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877137.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 347025..347993 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517656.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 348121..349656 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene murJ CDS complement(349766..351496) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816530.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene argS CDS 352167..352715 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 353000..353758 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211209.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene cutC CDS complement(353915..354901) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816529.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene cmoB CDS complement(354898..355641) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365981.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene cmoA CDS complement(355809..356204) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(356360..357175) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211205.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(357264..358481) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706002.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 358958..360754 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene aspS CDS 360756..361199 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221460.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene nudB CDS 361223..361966 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165984.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 362047..362568 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211201.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene ruvC CDS 362660..363277 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580335.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene ruvA CDS 363285..364295 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163065.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene ruvB CDS complement(364366..365745) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094819.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(365910..366215) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500136.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(366374..367702) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171888.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 368163..369122 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815913.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(369193..369978) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571478.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene znuB CDS complement(369975..370733) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169189.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene znuC CDS 370810..371811 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816521.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene znuA CDS 371824..373146 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169193.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene mepM CDS 373310..374305 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816519.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene lpxM CDS complement(374459..375901) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169197.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene pyk CDS complement(376160..377029) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211192.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 377413..378888 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163030.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene zwf CDS 379060..379701 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800512.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene kdgA CDS complement(380015..381193) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816167.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene purT CDS 381394..383445 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211088.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(383794..384024) product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389928.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 384397..384903 product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211092.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene ftnA CDS 385185..385541 product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705946.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 386070..386282 product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210052.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene cspA CDS 386616..386762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(386805..387287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 387407..387589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 387525..388592 product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085701.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 388632..389327 product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095808.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(389347..389538) product YebW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457842.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(389664..391118) product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene rsmF CDS complement(391265..393904) product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816203.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(393907..394947) product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170219.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene yebS CDS 395495..396001 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816204.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 396086..396859 product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431372.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene proQ CDS 396879..398894 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170217.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene prc CDS complement(399013..399879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(399940..400572) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(400778..401821) product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759310.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene potD CDS complement(401922..402698) product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580310.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene potC CDS complement(402695..403555) product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097090.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene potB CDS complement(403539..404654) product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097089.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene potA CDS 405014..406246 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene pepT CDS complement(406324..407445) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816139.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(407583..409037) product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene phoQ CDS complement(409034..409723) product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367146.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene phoP CDS complement(409966..411336) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816141.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene purB CDS complement(411468..412106) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295971.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene hflD CDS complement(412109..413215) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170633.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene mnmA CDS complement(413360..413806) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(413799..414329) product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218214.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene rluE CDS 414556..415809 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170624.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene icd CDS complement(415861..416970) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818458.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(417439..417789) product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281695.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(418291..419040) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133087235.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 419428..419685 product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096243.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 420077..422245 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268364.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 422408..424153 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815872.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 424150..424899 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172160.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 425082..426305 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815871.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 426551..427852 product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028113.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene ugpB CDS 427883..428731 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973971.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 428817..429776 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170215.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene htpX CDS 430131..431297 product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210841.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene ogl CDS 431512..432303 product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164952.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene kdgR CDS 432559..432822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 432949..434349 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170536.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 434604..436532 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211836.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene thrS CDS 436736..437077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 437173..437370 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211834.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene rpmI CDS 437414..437770 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211833.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene rplT CDS 438089..439072 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161570.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene pheS CDS 439087..441474 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672332.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene pheT CDS 441479..441775 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229266.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene ihfA CDS complement(441836..442261) product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015479.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(442396..444114) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816152.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(444245..445138) product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705524.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene yddG CDS complement(445216..446040) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175037.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene nadE CDS 446265..446594 product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039301.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene osmE CDS complement(446691..448085) product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene tcyP CDS complement(448257..448832) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170172.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(448913..449866) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(450200..450916) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(451164..452456) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210835.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(452472..453599) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210834.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(453613..454518) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098571.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(454511..455401) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210832.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(455448..457079) product pectate disaccharide-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210831.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(457353..458114) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161658.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene kduD CDS complement(458198..458380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 458716..459048 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170147.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(459144..459809) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211848.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene hxpB CDS 460115..460663 product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170142.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(460751..461611) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(461883..462740) product iron/manganese ABC transporter permease subunit YfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211845.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene yfeD CDS complement(462737..463600) product iron/manganese ABC transporter permease subunit YfeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816221.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene yfeC CDS complement(463600..464490) product iron/manganese ABC transporter ATP-binding protein YfeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211843.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene yfeB CDS complement(464487..465401) product iron/manganese ABC transporter substrate-binding protein YfeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170110.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene yfeA CDS 466508..466717 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221949.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene cspE CDS 466840..467676 product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211061.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene rlmA CDS complement(467740..468312) product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene mntP CDS complement(468734..469192) product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(469254..470096) product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211067.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(470111..470908) product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406926.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene manY CDS 470926..471105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(471086..472054) product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211069.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene manX CDS 472623..474179 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170491.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(474287..475651) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419892.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene sdaA CDS complement(476047..476640) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705928.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(476637..478079) product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene pabB CDS 478222..478470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(478506..478850) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 479080..480999 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849399.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 481116..481817 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211184.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene tsaB CDS 481915..482538 product Slp family lipoprotein YeaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290578.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene yeaY CDS 482707..484425 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169210.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene fadD CDS 484638..485762 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211181.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene rnd CDS complement(486033..486302) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211180.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene minE CDS complement(486306..487118) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211179.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene minD CDS complement(487139..487825) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene minC CDS 487962..488219 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125718.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 488561..489217 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162993.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 489336..489782 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162992.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 490308..490505 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167868.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(490784..491314) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028084.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene dsbB CDS complement(491509..493089) product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211689.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene nhaB CDS 493320..494039 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162963.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene fadR CDS complement(494145..495704) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240763.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(495929..496762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(496866..497399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(497396..497833) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049932.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(497840..498118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(498163..499500) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(499514..499807) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(499818..500798) product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874659.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 501283..502536 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211686.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(502574..503773) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216508.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(503963..504373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(504513..505814) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219724.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(505824..507758) product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162916.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene yeaG CDS 508214..508963 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169267.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 509099..509950 product methylglyoxal reductase YeaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186361.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene yeaE CDS complement(510013..510882) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211679.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(510990..511985) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224141.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene gapA CDS 512330..512749 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211677.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene msrB CDS 512881..513159 product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217933.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(513211..513858) product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211676.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene pncA CDS complement(513877..514896) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211675.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene ansA CDS complement(515130..516980) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816426.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene sppA CDS 517249..517800 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211673.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 517897..519822 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211670.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 519819..520106 product DUF1496 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211669.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(520235..521041) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211667.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene xthA CDS 521460..522086 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703812.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 tRNA complement(522447..522531) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(522686..523534) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166151.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene purU CDS 524217..525122 product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096264.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene rssA CDS 525241..526257 product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169304.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene rssB CDS 526463..527374 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718997.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene galU CDS complement(527521..527928) product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169306.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene hns CDS 528592..529188 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816420.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(529343..532018) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816419.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene adhE CDS 533027..534697 product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene oppA CDS 534889..536526 product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene oppA CDS 536580..537500 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210654.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene oppB CDS 537512..538420 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164168.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene oppC CDS 538432..539427 product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene oppD CDS 539424..540458 product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994698.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene oppF CDS complement(540530..540853) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210649.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(540909..542369) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210648.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene cls CDS complement(542874..544547) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209853.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(544679..544975) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967602.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 545242..546000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(546103..546525) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210641.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene yciA CDS complement(546545..547114) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808667.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(547314..548066) product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169326.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 548416..549048 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164191.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene ompW CDS complement(549258..549989) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(550375..551181) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210634.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene trpA CDS complement(551181..552371) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076940213.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene trpB CDS complement(552388..553755) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050075568.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene trpCF CDS complement(553763..554830) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215980.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene trpD CDS complement(554845..555423) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215981.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(555423..557120) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 557342..558226 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098057497.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 558377..558997 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 559159..560043 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072081652.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene rluB CDS complement(560261..560851) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816403.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene cobO CDS complement(560869..561630) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210625.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 561984..563030 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene sohB CDS complement(563089..563358) product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165861.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 563728..566328 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210622.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene topA CDS 566708..567682 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005278296.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene cysB CDS complement(567814..569286) product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050958.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene dtpA CDS complement(570020..570655) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene nth CDS complement(570652..571359) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169892.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(571356..571985) product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210600.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene rsxG CDS complement(571996..573051) product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050901.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene rsxD CDS complement(573052..575313) product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705233.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene rsxC CDS complement(575306..575884) product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991806.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene rsxB CDS complement(575884..576465) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169884.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene rsxA CDS complement(577187..578692) product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210591.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene araA CDS complement(578729..580414) product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210590.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 580787..581770 product arabinose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 581882..583405 product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694981.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene araG CDS 583424..584410 product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210587.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene araH CDS 584475..585407 product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164778.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene araC CDS 585522..586568 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816290.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 586898..587890 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169841.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 588133..588597 product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(588677..589693) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816291.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene add CDS complement(589815..590792) product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810823.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(590887..592446) product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816295.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(592535..593707) product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816296.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene manA CDS 593947..595344 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169824.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene fumC CDS complement(595408..596355) product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816298.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene tus CDS complement(596510..597778) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816300.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 597893..598789 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816301.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 598971..600188 product ROK family transcriptional regulator Mlc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169799.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene mlc CDS 600322..600987 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096826.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene bioD CDS 601156..602577 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(602626..602925) product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165762.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(603030..603647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(603827..604177) product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169788.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(604466..605215) product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366753.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene ydfG CDS complement(605423..606607) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849007.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(606917..608134) product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(608136..608990) product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097743.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(609288..609548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(609615..611453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(611482..612372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 612612..612842 product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096502.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene pptA CDS complement(612864..613775) product aromatic amino acid efflux DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198205.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene yddG CDS complement(613907..615403) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097917.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(615413..616795) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366536.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 617208..617441 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004853132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 617472..617807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370386.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(617856..619013) product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032715566.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(619157..619444) product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096563.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 619725..620510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(620418..621080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 621331..621585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 622657..623685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 623974..624924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 625067..625780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 626554..626760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 626800..630927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 631063..631317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(631715..632257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(633362..633769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(633780..634115) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704688.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 634271..634537 product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207634.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(634579..635460) product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525603.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(635645..637618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(637775..638275) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167543.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(638413..639609) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704846.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(639746..640300) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029670.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(640407..640793) product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368578.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene cybC CDS complement(641109..641537) product peroxiredoxin OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152305.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene osmC CDS 641857..642546 product expansin ExlX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231419.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene exlX CDS 642835..644241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 644244..647231 product virulence factor SrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816324.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 647228..649690 product virulence factor SrfC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816325.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 649946..650425 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263591.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 650567..651292 product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096718.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 651289..652518 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096717.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 652572..653096 product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167260.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(653163..654482) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210835.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(654594..655889) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167274874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 656435..656962 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211023.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene ogt CDS 657252..657998 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004862555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene fnr CDS 658189..659142 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262143.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene uspE CDS complement(659281..660669) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169667.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene pntB CDS complement(660680..662209) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211019.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene pntA CDS 662789..663742 product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene ydgH CDS complement(663780..664322) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039020.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(664383..665927) product catalase KatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094881.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene katB CDS complement(666304..667158) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene kdsA CDS complement(667234..668043) product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816540.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene sirB1 CDS complement(668046..668447) product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211234.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(668453..669298) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211235.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene prmC CDS complement(669298..670380) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096233.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene prfA CDS complement(670414..671670) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169107.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene hemA CDS 671831..672526 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816542.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene lolB CDS 672530..673402 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988253.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene ispE CDS 673540..674487 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004390739.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene prs CDS complement(674664..674933) product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096227.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene ychH CDS 675446..676033 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218168.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene pth CDS 676163..677254 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211245.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene ychF CDS complement(677436..677714) product biofilm development regulator YmgB/AriR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367639.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(677754..678110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(678223..678462) product regulatory protein YcgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367637.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene ycgZ CDS 678818..680038 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096959.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 680161..680895 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704784.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 681396..682595 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096774.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 682658..683758 product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056450.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(683974..684825) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097679.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 684742..684966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(685283..685876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 686376..687260 product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 687266..688411 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638288.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(688408..688836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 689129..689854 product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532307.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene aztA CDS 689854..690744 product zinc ABC transporter permease AztB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532308.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene aztB CDS 690751..691680 product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene aztC CDS 691708..692964 product zinc metallochaperone AztD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969726.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene aztD CDS complement(693017..694240) product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene zigA CDS 694537..695091 product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234684.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene zinT CDS complement(695201..695590) product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095417.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(695637..696437) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene hisN CDS complement(696660..698090) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(698131..699591) product PTS cellobiose/arbutin/salicin transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694763.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene ascF CDS 699964..700989 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815890.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 701099..701422 product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528914.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(701557..702177) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(702537..702764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(702947..703456) product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(703534..704514) product MsnO8 family LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 704941..706137 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(706474..707019) product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816246.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene rutF CDS 707411..708667 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096495.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 708690..709625 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096496.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 709695..710678 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096496.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 710763..711317 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096497.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 711400..712344 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268066.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 712369..713193 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366435.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(713273..713722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(713796..714518) product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096632.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene urtE CDS complement(714496..715368) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene urtD CDS complement(715361..716449) product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210794.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene urtC CDS complement(716449..718038) product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816780.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene urtB CDS complement(718095..719363) product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene urtA CDS complement(719360..720133) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267779.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(720187..723801) product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045751776.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene uca CDS complement(723794..725596) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene atzF CDS complement(725778..726785) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 726931..727107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(727117..728688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 729646..730464 product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770839.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 730585..731349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 731564..733300 product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209555.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(733502..734623) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227324.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(735046..735465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(735479..736030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(736164..736583) product immunity 63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214951.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(736585..738261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(738433..738738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(739199..739456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(739586..739987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 note possible pseudo, internal stop codon, frameshifted CDS complement(740045..740443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 note possible pseudo, internal stop codon CDS complement(740551..741048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(741045..760499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(760550..762247) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098821.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 762549..763214 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967933.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(763235..763657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(763693..768576) product AvrE-family type 3 secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266876.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 768750..770180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 770182..770505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(770633..771091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(771402..772472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(772617..772964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(772957..773148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(773176..775245) product type III secretion system outer membrane ring subunit SctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244827.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene sctC CDS complement(775238..775648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(775659..775883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(776030..776629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(776667..777296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(777293..778060) product type III secretion inner membrane ring lipoprotein SctJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763897.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene sctJ CDS complement(778067..778438) product type III secretion system inner rod subunit SctI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763898.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene sctI CDS complement(778508..778714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 779105..780640 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113692.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(780723..781778) product transcriptional regulator HrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103533.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene hrpR CDS complement(782157..782798) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341145.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(782835..784304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(784546..785088) product RNA polymerase sigma factor HrpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103538.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene hrpL CDS 785427..786635 product type III secretion system gatekeeper subunit SctW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409091.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene sctW CDS 786632..788734 product type III secretion system export apparatus subunit SctV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266893.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene sctV CDS 788744..789679 product type III secretion system inner membrane ring subunit SctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763855.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene sctD CDS 789679..791046 product type III secretion system ATPase HrcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763862.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene hrcN CDS 791036..791473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 791470..792003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 792000..793157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 793154..793807 product type III secretion system export apparatus subunit SctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406534.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene sctR CDS 793815..794075 product type III secretion system export apparatus subunit SctS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375712.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene sctS CDS 794082..794885 product type III secretion system export apparatus subunit SctT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339813.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene sctT CDS 794896..795975 product type III secretion system export apparatus subunit SctU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406538.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene sctU CDS complement(795986..796912) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532831.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 797055..798455 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939950.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(798554..798844) product increased serum survival lipoprotein Iss inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738422.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene iss CDS complement(799043..799852) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524312.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(799876..800046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(800140..801252) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398737.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene menC CDS complement(801294..801953) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342247.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(801946..802968) product virulence-associated ABC transporter ATP-binding protein SfbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569655.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene sfbB CDS 803572..804861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 805260..806786 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524029.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(806821..808122) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967935.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(808119..809243) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532988.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(809236..809970) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619926.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(810391..811209) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(811237..812505) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209787.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(812548..813627) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209788.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(813970..815436) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810134.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(815447..816712) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209789.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 816867..818360 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 818552..819646 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209791.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(819748..819996) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367020.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(820258..821103) product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252369.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene cho CDS complement(821100..822365) product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096856.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene umuC CDS complement(822365..822784) product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897378.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(822958..823581) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552471.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 823861..824835 product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090528.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 824845..825783 product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973448.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 825783..826925 product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973447.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(826983..827546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 827609..828481 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703345.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(828583..829272) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367083.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene narI CDS complement(829272..829991) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571684.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene narJ CDS complement(829984..831549) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702629.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene narH CDS complement(831549..835310) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705096.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(836097..837257) product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019827.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene narK CDS 837759..839630 product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816562.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene narX CDS 839623..840273 product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070487.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene narL CDS 840551..841828 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112774.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 842132..843172 product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(843253..843771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 844370..845173 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816565.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(845151..845303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 845499..846599 product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367104.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene chaA CDS 846764..848482 product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816539.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene dauA CDS complement(848501..848917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816341.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 849056..849778 product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096872.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene folM CDS 849848..850324 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367629.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 850321..851124 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(851174..851749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 852001..852738 product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169653.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene rstA CDS 852735..852950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 note possible pseudo, frameshifted CDS 852980..854050 product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192505.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene rstB note possible pseudo, frameshifted CDS 854225..854692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 855628..856494 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260855.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 856953..858731 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105049.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 858779..859618 product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106675.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(859635..863522) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072088404.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene hrpA CDS 863828..864433 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816349.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene azoR CDS complement(864511..864744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(864760..867351) product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981411.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 867724..869277 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189772.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 869645..871198 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526156.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 871317..872309 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210998.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(872912..873727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(874706..874978) product colicin immunity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214798.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(874975..877359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 877829..878764 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156215.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene ttcA CDS complement(878886..879062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(879556..880539) product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169583.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene zntB CDS complement(880663..882279) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169575.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 882445..883164 product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816358.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene mpaA CDS 883244..883747 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084394.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene tpx CDS complement(883797..885365) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210983.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene tyrR CDS complement(885502..887046) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(887206..888249) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138696.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(888246..889643) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169547.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 889932..891674 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210212.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 891686..892201 product toxin-activating lysine-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 892229..900028 product hemagglutinin repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224144836.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 900041..900523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 900667..901221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(901314..901679) product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050078551.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene pspC CDS complement(901679..901903) product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161022.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene pspB CDS complement(901984..902649) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene pspA CDS 902875..903864 product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816362.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene pspF CDS complement(903936..905309) product endo-1,4-beta-glucanase EglS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231540.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene eglS CDS complement(905302..905550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(905836..906324) product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402968.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(906321..906761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 906933..908621 product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816365.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene sapA CDS 908618..909583 product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169521.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene sapB CDS 909570..910460 product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210971.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene sapC CDS 910477..911469 product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169513.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene sapD CDS 911469..912284 product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169510.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene sapF CDS 912477..913265 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506501.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene fabI CDS complement(913336..914319) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097756.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(914435..917311) product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097757.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(917657..920023) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817010.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(920058..921368) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097445.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 921689..922759 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065355593.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(922750..923652) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816367.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 923824..926136 product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 926484..928418 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169906.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 928478..929395 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732615.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(929432..929935) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384987.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 930007..931188 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384988.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 931515..933578 product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169907.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(933775..934470) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210610.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene araD CDS 934805..935020 product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210611.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene osmB CDS complement(935078..935413) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816268.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene yciH CDS complement(935410..936153) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816267.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene pyrF CDS complement(936336..937505) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene lapB CDS complement(937518..937823) product lipopolysaccharide assembly protein LapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876284.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene lapA CDS 938075..938407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 note possible pseudo, frameshifted CDS 938451..939020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 note possible pseudo, frameshifted CDS complement(939102..940100) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529215.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(940200..941690) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167411.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(941693..942637) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209439.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(942630..943460) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(943602..944699) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209437.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(944701..946254) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167401.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(946254..946886) product DUF2291 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167399.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(946931..947872) product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(948208..948984) product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816261.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene pgpB CDS 949277..949870 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366227.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene ribA CDS complement(949942..951576) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097243.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 951872..952402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(952907..955579) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816260.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene acnA CDS complement(955876..957180) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114420.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(957659..957898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 958035..958643 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210962.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene gstA CDS complement(958682..959542) product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165910.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene pdxY CDS complement(959627..960904) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816372.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene tyrS CDS complement(961139..961822) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096909.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene pdxH CDS complement(961930..962247) product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218323.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(962345..963430) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165918.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene anmK CDS 963807..964274 product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597179.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene slyB CDS complement(964406..964843) product virulence master transcriptional regulator RovA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004706617.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene rovA CDS complement(965071..965310) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161798795.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 965600..966007 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165939.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene gloA CDS 966154..966825 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169454.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene rnt CDS complement(966929..967279) product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene grxD CDS 967726..968472 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210945.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 969052..970077 product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165644.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene purR CDS 970406..971557 product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816380.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene cfa CDS complement(971617..972252) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169439.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 972501..973874 product MdtK family multidrug efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366890.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene mdtK tRNA 974035..974111 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 974393..975946 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948686.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 975993..976712 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102123.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 976722..978143 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023919.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 978143..978838 product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370402.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(978918..979616) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461579.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(979658..979864) product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212949.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 979967..980821 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082949.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(980756..981220) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065598186.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 981302..981565 product DUF3861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209910.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(981637..983811) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene katG CDS complement(984124..985389) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267808.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 985469..986242 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095418.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(986291..987082) product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081584.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(987490..987804) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115842.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 tRNA 988150..988226 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 988483..988869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(988945..989832) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965283.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 989971..990933 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039561.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(991002..991646) product nitrate/nitrite response regulator protein NarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115500.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene narP CDS complement(991720..992034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 note possible pseudo, frameshifted CDS complement(992004..993443) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene narQ note possible pseudo, frameshifted CDS complement(993465..993680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 993793..994329 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene napF CDS 994326..994646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 994643..997045 product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778064.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene napA CDS 997137..997829 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene napG CDS 997816..998679 product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013515.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene napH CDS 998655..999128 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835177.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene napB CDS 999137..999739 product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528376.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene napC CDS complement(1000225..1001094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(1001091..1001549) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214855.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(1001546..1002103) product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824456.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene dsbE CDS complement(1002100..1004055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(1004052..1004534) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026418.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene ccmE CDS complement(1004531..1004752) product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006798167.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene ccmD CDS complement(1004749..1005519) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266008.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(1005558..1006214) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370111.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene ccmB CDS complement(1006202..1006834) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370110.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene ccmA CDS complement(1007025..1007882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(1007879..1008280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(1008273..1010147) product heme lyase NrfEFG subunit NrfEF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551709.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene nrfEF CDS complement(1010169..1011131) product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199631.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene nrfD CDS complement(1011128..1011799) product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220281.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene nrfC CDS complement(1011796..1012365) product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296647.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene nrfB CDS complement(1012414..1013832) product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101783.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene nrfA CDS complement(1014290..1015303) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(1015415..1016599) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(1016692..1018293) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703912.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(1018591..1019985) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706100.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene ascB CDS complement(1020021..1021922) product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene bglF CDS complement(1022235..1023098) product transcriptional antiterminator BglG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365726.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene bglG CDS complement(1023289..1023456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 1023741..1025153 product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816382.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene pykF CDS 1025467..1025703 product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002908860.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(1025887..1026909) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165628.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 1026975..1027154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(1027388..1027804) product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816383.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene sufE CDS complement(1027838..1029061) product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene sufS CDS complement(1029061..1030407) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211806.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene sufD CDS complement(1030382..1031128) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene sufC CDS complement(1031225..1032724) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169421.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene sufB CDS complement(1032738..1033109) product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211809.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene sufA CDS 1033536..1033937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(1034036..1034452) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169420.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(1034452..1037529) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169419.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 1037801..1038910 product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169418.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene ydiK CDS 1039437..1040483 product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406064.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene apbE CDS complement(1040656..1043034) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211813.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene ppsA CDS 1043299..1044156 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 1044360..1045406 product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082224.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene aroH CDS 1045889..1047589 product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene malL CDS complement(1047630..1048385) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635556.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 1048645..1050234 product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094793.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 1050237..1051559 product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 1051766..1052815 product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209061.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 1052812..1053630 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 1053627..1054631 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175607.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 1054624..1055421 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209058.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(1055441..1056892) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816391.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(1057069..1058085) product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209755.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene lplA CDS complement(1058133..1058588) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216102.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(1058790..1059566) product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050983.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene btuD CDS complement(1059567..1060118) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816397.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(1060185..1061222) product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816398.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene btuC CDS complement(1061358..1062122) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(1062183..1062524) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393515.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 1062641..1063357 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194557.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene fnr CDS complement(1063840..1064670) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816137.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene cobB CDS complement(1064682..1065596) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170645.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene nagK CDS complement(1065681..1066928) product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705054.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene lolE CDS complement(1066925..1067632) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158007.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene lolD CDS complement(1067625..1068827) product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097098.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene lolC CDS 1068970..1069992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 note possible pseudo, frameshifted CDS 1069971..1072424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 note possible pseudo, frameshifted CDS 1072647..1073999 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469694.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene yegD CDS complement(1074051..1074641) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113746.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 1074779..1075987 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113745.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 1076029..1077222 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026832.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(1077323..1077862) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170666.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(1078321..1079625) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(1079993..1080535) product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367178.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene ycfP CDS complement(1080564..1081592) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816133.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene nagZ CDS complement(1081665..1082549) product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227994.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene thiK CDS complement(1082530..1083111) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213089.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene lpoB CDS complement(1083133..1083513) product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170685.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(1083598..1083948) product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097111.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene hinT CDS complement(1084177..1085631) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388869.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 1085755..1086552 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388870.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(1086613..1088046) product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157966.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene ptsG CDS complement(1088360..1089157) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816079.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(1089177..1090187) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213083.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene holB CDS complement(1090187..1090846) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213082.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene tmk CDS complement(1090836..1091855) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816078.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene mltG CDS complement(1091870..1092688) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213080.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene pabC CDS complement(1092796..1094037) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213079.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene fabF CDS complement(1094120..1094356) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220787.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene acpP CDS complement(1094511..1095245) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210935.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene fabG CDS complement(1095260..1096189) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816075.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene fabD CDS complement(1096207..1097088) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170737.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1097167..1098228) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210932.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene plsX CDS complement(1098243..1098413) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210931.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene rpmF CDS complement(1098430..1098951) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709643.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene yceD CDS 1099092..1099676 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170743.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(1099754..1100710) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157930.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene rluC CDS 1101314..1104649 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705034.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene rne CDS complement(1104709..1105002) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170755.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 1105181..1106224 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816073.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene pyrC CDS 1106331..1106570 product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217754.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene dinI CDS 1106659..1106916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 1107158..1107412 product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157914.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene bssS CDS 1107872..1108426 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172055.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 1108453..1109031 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739886.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(1109105..1110184) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 1110401..1111495 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 1111682..1112674 product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816068.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(1112792..1115356) product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298322.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene mdoH CDS complement(1115349..1116917) product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816064.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 1117898..1119421 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098348.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(1119531..1121075) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(1122053..1122334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210614.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(1122475..1122792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1122948..1123133 product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170265.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(1123201..1123629) product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082296.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene uspF CDS complement(1123795..1124250) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769971.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(1124255..1124779) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(1124867..1125289) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630611.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 1125774..1126028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 tRNA complement(1126416..1126503) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 1126784..1127443 product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374046.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene yccA CDS 1127554..1127883 product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213046.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene tusE CDS complement(1127894..1128172) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213049.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene yccX CDS 1128399..1128707 product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367415.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene hspQ CDS complement(1128790..1129203) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 1129455..1129922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 1130060..1130518 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367424.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene mgsA CDS complement(1130596..1132653) product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816055.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene helD CDS 1132851..1133297 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261236.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 1133318..1135453 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816054.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene yccS CDS complement(1135468..1136088) product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213064.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1136312..1136818 product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213065.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene sulA CDS 1137181..1138266 product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704908.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene ompA CDS complement(1138419..1138877) product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877174.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene matP CDS 1139097..1140824 product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032900735.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1140916..1141434 product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227927.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene fabA CDS complement(1141529..1142182) product DUF533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816547.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(1142329..1144008) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220180.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene betA CDS complement(1144028..1145500) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218281.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene betB CDS complement(1145569..1146159) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218278.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene betI CDS 1146509..1148542 product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002430091.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 1148758..1149396 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965894.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 tRNA 1149614..1149703 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(1149967..1150755) product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212037.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene phoH CDS complement(1151287..1151802) product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160338.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene fliZ CDS complement(1152007..1152729) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211153.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 1152701..1152916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 1152916..1153167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(1153254..1154003) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096017.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(1154000..1154452) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096016.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(1154440..1155408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096015.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1155408..1156367) product glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028148.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(1156370..1157071) product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096013.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1157191..1158303) product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244389.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene vioA CDS complement(1158619..1161981) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096011.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(1162264..1163136) product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096009.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 1163405..1164829 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816592.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene fliD CDS 1164860..1165270 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160351.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene fliS CDS 1165270..1165650 product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204899.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene fliT CDS complement(1165921..1166235) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160376.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene fliE CDS 1166496..1168220 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816597.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene fliF CDS 1168217..1169209 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067735.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene fliG CDS 1169202..1169927 product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704954.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene fliH CDS 1169927..1171297 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018001.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene fliI CDS 1171306..1171752 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160389.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene fliJ CDS 1171749..1173044 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046695171.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 1173194..1173679 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367297.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene fliL CDS 1173685..1174698 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene fliM CDS 1174691..1175104 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160399.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene fliN CDS 1175188..1175526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 note possible pseudo, internal stop codon, frameshifted CDS 1175523..1176299 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704950.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene fliP CDS 1176320..1176589 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367302.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene fliQ CDS 1176592..1177377 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704949.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene fliR CDS complement(1177762..1178715) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704938.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene flgL CDS complement(1178747..1180441) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704937.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene flgK CDS complement(1180567..1181529) product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene flgJ CDS complement(1181529..1182638) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367323.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(1182655..1183308) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene flgH CDS complement(1183549..1184331) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192166.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene flgG CDS complement(1184359..1185114) product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009113335.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1185136..1186338) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034888230.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene flgE CDS complement(1186413..1186934) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020493.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene flgD CDS complement(1187112..1187516) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367329.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene flgC CDS complement(1187545..1187961) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene flgB CDS 1188127..1188795 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849222.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene flgA CDS 1188938..1189234 product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704933.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene flgM CDS 1189240..1189677 product flagellar export chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211107.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene flgN CDS complement(1189733..1190065) product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259575.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene flhe CDS complement(1190149..1192146) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816614.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene flhA CDS complement(1192139..1193290) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367336.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene flhB CDS complement(1193535..1194179) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164477.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene cheZ CDS complement(1194189..1194578) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene cheY CDS complement(1194617..1195669) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164481.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1195669..1196541) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080859.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene cheR CDS complement(1197054..1198739) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367342.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(1198875..1199372) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367343.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene cheW CDS complement(1199404..1201419) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene cheA CDS complement(1201447..1202502) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168761.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene motB CDS complement(1202499..1203386) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704927.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene motA CDS complement(1203521..1204099) product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164496.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene flhC CDS complement(1204103..1204453) product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164498.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene flhD CDS complement(1205166..1205366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(1205272..1206204) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170821.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 1206514..1208235 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816624.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1208395..1208598) product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210892.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene dsrB CDS 1208809..1210224 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704253.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 1210500..1210718 product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161573.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 1210942..1211298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(1211414..1212643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1212989..1213162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 1213222..1213386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1213754..1213948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(1214074..1214907) product DUF4942 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034461534.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(1215025..1215345) product type IV toxin-antitoxin system toxin YkfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854672.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene ykfI CDS complement(1215415..1215750) product type IV toxin-antitoxin system YeeU family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007869729.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(1215790..1216263) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene radC CDS complement(1216469..1217074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1217103..1217657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1217955..1218830) product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878129.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(1218904..1219725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 1220538..1221131 product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220727.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 1221321..1221527 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211310.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1222113..1222631 product type VI secretion system effector Hcp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705706.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene hcp1 CDS 1222753..1225062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 1225072..1225683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 1225670..1226080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 1226090..1227055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1227056..1227580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 1227627..1228391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 1228400..1228699 product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973769.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(1228691..1228945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 1229137..1230591 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 1230641..1231186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 1231314..1232150 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095399.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(1232246..1232494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 note possible pseudo, internal stop codon, frameshifted CDS complement(1233000..1236515) product helicase YjhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181238188.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene yjhR CDS 1236762..1237544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 1237655..1238857 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939034.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 1239341..1242367 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530591.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 1242364..1244166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(1244314..1245573) product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209313.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 tRNA complement(1245776..1245862) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(1245871..1245944) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(1245996..1246071) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(1246211..1246759) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220475.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene pgsA CDS complement(1246818..1248650) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283421.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene uvrC CDS complement(1248643..1249299) product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211176.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene uvrY CDS 1249943..1250167 product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160184.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(1250261..1250548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 tRNA complement(1251016..1251091) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 1251428..1252840 product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211170.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene cycA CDS complement(1253012..1253278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1253665..1253940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 tRNA 1254320..1254395 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 1254713..1255828 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212753.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1255962..1256276) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114194633.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1256462..1256818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 1256924..1257196 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175413.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 1257614..1258528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039790.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 1258682..1258876 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1258893..1259477 product DUF2857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937857.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1259467..1259676 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112403.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 1259962..1260750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(1260881..1261078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(1261136..1263322) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022963022.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1263820..1264041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1264110..1264775 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001446637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 1264772..1265053 product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600171.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 1265063..1267810 product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096399.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 1267834..1268550 product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848059.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 1268561..1268785 product EexN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949385.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 1268797..1269837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 1270058..1270741 product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394613.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 1270741..1271631 product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976329.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene virB9 CDS 1271628..1272851 product VirB10/TraB/TrbI family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039326147.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene virB10 CDS 1272841..1273857 product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125557.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene virB11 CDS 1273964..1274203 product TrbM/KikA/MpfK family conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044654.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 1274929..1276791 product TraM recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602685.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1276800..1277546 product MobC family replication-relaxation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909124.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene mobC CDS 1277874..1278419 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171812.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(1278416..1279282) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034357836.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 1279414..1279716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1279750..1280064) product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817079.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(1280067..1280303) product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817080.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1280623..1281567) product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155898.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 1281953..1282675 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208843.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1282853..1284280 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 1284325..1285686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1286292..1286876 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029670.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 1286957..1288153 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777113.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(1288388..1288939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 note possible pseudo, internal stop codon CDS 1289776..1289949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1290077..1290298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 1290183..1291070 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene ldtA CDS complement(1291376..1292395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 1292710..1293009 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165821.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 1293006..1293860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 note possible pseudo, frameshifted CDS complement(1294698..1295657) product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418304.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1295671..1296198) product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096714.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(1296195..1296704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096715.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(1296719..1297204) product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096716.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(1297201..1298421) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096717.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(1298418..1299140) product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096718.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(1299142..1300404) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096719.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1300401..1301120) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096720.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(1301117..1301551) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096721.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(1301780..1302508) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705067.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(1302607..1303497) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168564.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 1303788..1304123 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881834.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(1304251..1304562) product YmjA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097073.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 1304949..1305926 product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031350.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1305957..1306988 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973349.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(1307101..1307640) product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211926.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(1307820..1308302) product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705072.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(1308865..1309473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1309980..1311416) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362575.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(1311619..1312074) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388135.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1312141..1313376 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388134.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(1313426..1314061) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(1314118..1314543) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071058.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 1314621..1315025 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1315041..1315379) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975408.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 1315582..1316436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(1316474..1316776) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(1316781..1317134) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024360564.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 1317572..1318411 product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene yghU CDS complement(1318471..1319637) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 1319657..1319812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1319809..1321095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 1321278..1323467 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705755.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1323628..1324593) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168557.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 1325135..1325797 product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084032.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 1325960..1326469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 1326459..1327082 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315385.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 1327079..1328725 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400549.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1328722..1329366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1329344..1329958) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403787.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 1330575..1331312 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211859.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(1331330..1333102) product yersiniabactin ABC transporter ATP-binding/permease protein YbtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001608389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene ybtQ CDS complement(1333102..1334940) product yersiniabactin ABC transporter ATP-binding/permease protein YbtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene ybtP CDS 1335172..1336140 product yersiniabactin transcriptional regulator YbtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168685.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene ybtA CDS 1336254..1336676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 1336688..1337950 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762833.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1338148..1340157 product siderophore yersiniabactin receptor FyuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784549.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene fyuA CDS 1340390..1341145 product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369135.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 1341291..1342229 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105356.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(1342242..1343306) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 1343616..1345220 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106694.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1345217..1346023 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112653.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 1346040..1347833 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810317.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 1348008..1348904 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816232.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 1349062..1349937 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 1349934..1350770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 note possible pseudo, internal stop codon, frameshifted CDS 1350854..1352101 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420953.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 1352112..1353623 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031070.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 1353661..1355439 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031071.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1355596..1357056 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene amn CDS 1357163..1357402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1357482..1358984) product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817168.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene proP CDS complement(1359260..1360141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 1360320..1361306 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065518.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 1361532..1363076 product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966490.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(1363212..1364618) product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830312.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene ygjG CDS complement(1364950..1366374) product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163872.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene patD CDS complement(1366495..1366665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 1366962..1367471 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 1367571..1368524 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147971.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 1368784..1371483 product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174850069.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 1371604..1372191 product heme acquisition protein HasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene hasA CDS 1372521..1374380 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209483.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 1374445..1375803 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 1375806..1377161 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113107.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 1377893..1379233 product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368823.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene dcuB CDS complement(1379352..1380068) product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262121.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1380065..1381078) product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(1381100..1381903) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064397.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(1381900..1382673) product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212309.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene tauC CDS complement(1382680..1383693) product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528706.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene tauA CDS complement(1383759..1384781) product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085701.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 1385098..1386123 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 1386177..1387043 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 1387003..1387869 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010437567.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1387987..1389090 product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374033.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1389172..1390488) product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209033.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene gltP CDS 1390807..1390995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(1390983..1391936) product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816563.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene cbl CDS 1392298..1393131 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095315.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 1393255..1394232 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095314.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1394268..1394765) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132911.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1394752..1395468) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(1395473..1396612) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002353352.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(1396602..1397891) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816576.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(1397894..1399291) product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(1399446..1399973) product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132914.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1400093..1401943) product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168961.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(1402559..1404022) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817182.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 1404560..1404772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 1404775..1406925 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816737.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene fdhF CDS 1407741..1409054 product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038452.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 1409163..1410056 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016558605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 1410723..1412033 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114420.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(1412121..1413020) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207780.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 1413260..1413976 product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677245.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(1414121..1415065) product polysaccharide lyase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1415287..1416099) product lipoprotein NlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703853.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene nlpA CDS 1416336..1416992 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168584.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 1416996..1418570 product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168581.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 1418750..1419985 product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816657.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene uhpC CDS 1420146..1421036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 note possible pseudo, frameshifted CDS 1420946..1421182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 note possible pseudo, frameshifted CDS 1421381..1423459 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168575.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 1423465..1424523 product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene fbpC CDS 1424723..1425799 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816625.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 1426129..1429260 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214048.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 1429642..1430658 product lactose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291541.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene lacY tRNA 1430801..1430876 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 1431488..1453765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 note possible pseudo, internal stop codon, frameshifted CDS 1453765..1457217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 1457210..1478350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1478440..1480104 product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205070.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(1480486..1481124) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1481388..1482269 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173375.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(1482547..1483137) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243530.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 1483519..1483851 product DUF1971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706013.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 1483862..1484200 product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706012.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 1484665..1486530 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092480236.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 1486530..1487993 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092480235.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 1488088..1488927 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 1489161..1490210 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811185.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 1490194..1491891 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930454.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 1491913..1492602 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266874.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 1492680..1492958 product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975041.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 1492958..1493278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1493381..1494217) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098250.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene iolB CDS complement(1494305..1495195) product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene iolE CDS complement(1495229..1497133) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098252.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene iolC CDS complement(1497191..1498324) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098253.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1498354..1499385) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098254.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(1499398..1500945) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098255.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1501018..1501956) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098256.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(1502037..1503023) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene iolG CDS complement(1503778..1505709) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359655.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene iolD CDS complement(1505897..1507408) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098259.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1507736..1508593 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210296.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 1508641..1508946 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388148.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 1509273..1510376 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227324.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(1510493..1510945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089323.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(1511092..1511859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(1512371..1513207) product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene licT CDS complement(1513302..1514726) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(1515055..1516683) product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528841.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(1516702..1517133) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1517648..1519789) product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1519786..1520568) product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038092.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1520578..1521228) product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073045.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1521331..1521678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(1522070..1523476) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211888.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene gndA CDS complement(1523707..1524603) product UTP--glucose-1-phosphate uridylyltransferase GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183060.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene galF CDS 1524848..1525717 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706043.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene rfbA CDS 1525719..1526255 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261024.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene rfbC CDS 1526252..1527097 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene rfbD CDS complement(1527140..1528291) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973473.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene glf CDS complement(1528314..1529228) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101315.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1529283..1530281) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097856.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(1530269..1530517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 1530699..1530848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(1531476..1532150) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902370.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(1532215..1533129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(1533178..1534428) product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036849.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1534425..1535537) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963975.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(1535554..1536087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(1536077..1536484) product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(1536489..1537364) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211983.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene rfbA CDS complement(1537493..1539667) product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097881.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene wzc CDS complement(1539684..1540118) product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097882.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene wzb CDS complement(1540127..1541230) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014170829.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(1541389..1542465) product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176219.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene wecA CDS 1543114..1544700 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211875.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(1544783..1546135) product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene dcuC CDS complement(1546400..1548235) product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816716.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene asmA CDS complement(1548298..1548879) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211873.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene dcd CDS complement(1548986..1549627) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162352.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene udk CDS complement(1549816..1550925) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005448.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene apbC CDS 1551149..1553179 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816718.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene metG CDS 1553461..1556508 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723100.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene fdnG CDS 1556521..1557429 product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240581.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene fdnH CDS 1557422..1558057 product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045646.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene fdnI CDS 1558343..1559419 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082760.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 1559434..1560684 product LVIVD repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816721.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(1560739..1561737) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816799.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene pgl CDS 1561986..1562348 product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705325.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 tRNA complement(1562440..1562527) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 1562801..1563622 product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210759.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(1563692..1564657) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815870.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene glk CDS 1564845..1566089 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 1566220..1567290 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705008.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 1567287..1568438 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 1568563..1569543 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097688.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(1569620..1570483) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973789.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(1570721..1571779) product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210758.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene modC CDS complement(1571779..1572468) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene modB CDS complement(1572468..1573238) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210756.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene modA CDS complement(1573384..1573539) product AcrZ family multidrug efflux pump-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 1573736..1574527 product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168058.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene modE CDS 1574568..1576043 product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210753.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene modF CDS 1576242..1577261 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168055.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene galE CDS 1577447..1578493 product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168049.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene galM CDS 1578701..1579084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817189.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 1579267..1579512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 1579525..1580784 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817191.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 1580781..1582283 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817192.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 1582280..1585417 product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817193.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 1585555..1586307 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367652.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene gpmA CDS complement(1586453..1587520) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097523.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene aroG CDS 1587805..1588767 product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene zitB CDS complement(1588774..1589499) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168038.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene pnuC CDS complement(1589558..1590490) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210741.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene nadA CDS 1590842..1591240 product YjaA family stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298281.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(1591255..1591971) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816224.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 tRNA complement(1592366..1592441) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(1592487..1592562) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(1592738..1593514) product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165506.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene cpoB CDS complement(1593524..1594036) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393299.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene pal CDS complement(1594077..1595369) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165502.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene tolB CDS complement(1595508..1596683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(1596748..1597173) product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene tolR CDS complement(1597186..1597863) product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704769.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene tolQ CDS complement(1597869..1598261) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165498.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene ybgC CDS complement(1598407..1598700) product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034602.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene ybgE CDS complement(1598830..1599969) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210731.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene cydB CDS complement(1599983..1601551) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene cydA CDS complement(1602282..1603154) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210729.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene sucD CDS complement(1603154..1604320) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210728.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene sucC CDS complement(1604523..1605749) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210727.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene odhB CDS complement(1605765..1608572) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622290.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene sucA CDS complement(1608848..1609564) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210725.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1609581..1611347) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168015.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene sdhA CDS complement(1611347..1611694) product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700691.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene sdhD CDS complement(1611688..1612077) product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684965.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene sdhC CDS 1612730..1614016 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210721.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(1614071..1614496) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971133.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(1614512..1615303) product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113965.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene nei CDS complement(1615347..1616009) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816813.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene pcp CDS complement(1616024..1616761) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816815.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene pxpA CDS complement(1616751..1617695) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209658.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(1617689..1618345) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168006.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene pxpB CDS complement(1618502..1619245) product type 2 GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354507.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(1619238..1620716) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816818.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene phrB CDS complement(1620738..1621697) product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(1621982..1622188) product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209653.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 1622699..1624387 product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816819.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene kdpA CDS 1624403..1626547 product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816820.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene kdpB CDS 1626567..1627142 product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216363.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene kdpC CDS 1627245..1630007 product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209649.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene kdpD CDS 1630013..1630693 product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025470747.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene kdpE CDS 1630776..1631204 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167964.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1631267..1632910) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene pgm CDS complement(1632958..1633494) product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816824.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene seqA CDS 1633756..1634523 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215390.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene ybfF CDS 1634811..1635092 product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212202.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene ybfE CDS complement(1635257..1636924) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167953.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 1637809..1638336 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215386.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene fldA CDS 1638668..1639117 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131699.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene fur CDS complement(1639181..1640839) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210354.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene glnS CDS complement(1641028..1642524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 1642883..1643683 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene nagB CDS 1643687..1644847 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816828.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene nagA CDS 1644945..1646168 product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 1646372..1648036 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337047.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene asnB tRNA 1648256..1648332 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 1648341..1648425 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 1648482..1648556 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 1648592..1648666 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 1648720..1648796 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 1648803..1648877 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 1649615..1649935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 1650337..1650555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 1650574..1651530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 1651629..1652615 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098812.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 1653090..1653509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1653532..1654698) product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210347.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene ubiF CDS 1654926..1656350 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167929.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene miaB CDS 1656692..1657750 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210345.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 1657747..1658226 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158419.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene ybeY CDS 1658355..1659233 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210342.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene corC CDS 1659241..1660770 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167924.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene lnt CDS 1661177..1662073 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014883004.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 1662294..1663034 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367720.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 1663038..1663712 product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272799.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene gltK CDS 1663712..1664437 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167914.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(1664486..1664968) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816834.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 1665279..1667861 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene leuS CDS 1667876..1668430 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816836.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene lptE CDS 1668427..1669452 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167898.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene holA CDS 1669641..1670108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 1670303..1670620 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161670.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene rsfS CDS 1670622..1671092 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene rlmH CDS 1671126..1673030 product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167891.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene mrdA CDS 1673040..1674152 product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210325.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene mrdB CDS 1674166..1675284 product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167887.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene rlpA CDS 1675451..1676662 product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167886.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene dacA CDS 1676812..1677075 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858718.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene ybeD CDS 1677261..1677935 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene lipB CDS 1678163..1679128 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004712243.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene lipA CDS complement(1679211..1679408) product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097596.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene tatE CDS 1679843..1680226 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167877.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene crcB CDS complement(1680308..1680517) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012542460.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene cspE CDS 1680735..1681445 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209718.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 1681653..1683539 product esterase EstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115524.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene estA CDS 1684063..1684440 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703145.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 1684526..1685569 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208549.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene dapE CDS 1685566..1686240 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208550.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 1686243..1686437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(1686493..1687392) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818676.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1687609..1687770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 1687875..1689197 product citrate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 1689259..1690599 product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 1690599..1690898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 1691060..1691716 product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693165.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene atoD CDS 1691716..1692363 product acetate CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339065.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene atoA CDS 1692375..1693553 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene atoB CDS complement(1693640..1695310) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095313.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(1695584..1696201) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815824.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene ypfH CDS complement(1696365..1696592) product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972300.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 1696931..1699765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 1700133..1700897 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184045.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 1700935..1701306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(1701356..1703158) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527892.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(1703233..1705608) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530098.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 1706018..1706539 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114876.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 1706564..1707517 product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064096.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 1707659..1708540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 1708619..1709359 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188455.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 1709374..1709796 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705855.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 1709959..1711323 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188997.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene pmbA CDS 1711358..1712803 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene tldD CDS 1712868..1714133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1714166..1716238) product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208552.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(1716259..1716807) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172363.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(1716930..1717643) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703148.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(1717791..1718828) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208557.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene bamC CDS complement(1718845..1719723) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494019.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene dapA CDS 1720164..1720715 product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162088.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 1720778..1721245 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098229.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene bcp CDS 1721442..1722878 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217569.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 1722893..1723270 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815819.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene arsC CDS complement(1723308..1724054) product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208566.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene hda CDS complement(1724115..1725404) product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815817.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene uraA CDS complement(1725621..1726250) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370402.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene upp CDS 1726585..1727622 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209777.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene purM CDS 1727622..1728260 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209778.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene purN CDS 1728545..1729651 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1729644..1731758 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816920.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 1731926..1732501 product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene speG CDS 1732859..1733848 product IS110-like element IS1663 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930320.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(1734120..1736549) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561824.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(1736546..1737277) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208572.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 1737374..1737883 product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297298.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene tesA CDS 1737912..1738682 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816859.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 1738793..1739653 product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167772.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(1740075..1741268) product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171600.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 1741552..1742700 product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797555.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene tyrP CDS complement(1742902..1743441) product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049613007.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 1743690..1743902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(1743904..1745358) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210243.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene menE CDS complement(1745346..1746317) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210244.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene menC CDS complement(1746317..1747174) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639996.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene menB CDS complement(1747180..1747980) product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene menH CDS complement(1747968..1749650) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815959.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene menD CDS complement(1749871..1751193) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815958.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene menF CDS 1751536..1752705 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171553.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 1752722..1755406 product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815976.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene rcsD CDS 1755415..1756065 product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859405.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene rcsB CDS complement(1756103..1758958) product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene rcsC CDS complement(1759074..1761713) product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815974.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene gyrA CDS complement(1761996..1763408) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640497.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 1763631..1764350 product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365620.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene ubiG CDS 1764700..1766985 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815972.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene nrdA CDS 1767108..1768238 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815971.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene nrdB CDS 1768242..1768502 product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082045.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene yfaE CDS 1768643..1769557 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 1769557..1770012 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208577.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(1770049..1770456) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367894.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene cueR CDS 1770574..1773300 product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816861.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene copA CDS 1773475..1774293 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208580.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 1774363..1774842 product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167764.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene ybaK CDS complement(1775076..1776458) product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286021.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(1776740..1777726) product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368442.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene yjiA CDS complement(1777743..1777946) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887451.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(1778092..1780245) product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299714.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene btsT CDS complement(1780538..1782589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(1782755..1784764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(1784999..1786648) product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816863.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene ushA CDS 1787317..1789002 product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158223.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene ybaL CDS complement(1789109..1790071) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816874.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene hemH CDS complement(1790294..1790938) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220235.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene adk CDS complement(1791202..1793091) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354670.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene htpG CDS complement(1793266..1793871) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195026.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene recR CDS complement(1793871..1794200) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(1794241..1796313) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208605.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene dnaX CDS complement(1796388..1796945) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127348.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene apt CDS complement(1797160..1797555) product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167708.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 1797764..1798300 product primosomal replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167706.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 1798338..1798508 product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051146.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene rsmS CDS complement(1798565..1799206) product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167699.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene acrR CDS 1799372..1800565 product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095891.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene acrA CDS 1800594..1803722 product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208616.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene acrB CDS 1803955..1804203 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208617.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 1804273..1804455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 1804963..1805331 product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218472.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene tomB CDS 1805385..1805588 product expression modulating protein YmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208622.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene ymoA CDS 1805926..1806108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 1806330..1806650 product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032901164.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(1806670..1807251) product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779802.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 1807464..1808327 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208625.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene tesB CDS complement(1808467..1809759) product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167660.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene amtB CDS complement(1809793..1810131) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208627.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene glnK CDS complement(1810492..1812270) product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256201.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1812263..1814032) product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095869.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1814111..1814572) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163482.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 1814839..1815285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 1815441..1816517 product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167652.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 1816647..1817342 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704596.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene queC CDS complement(1817439..1817837) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167645.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(1817943..1818308) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680322.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(1818447..1820195) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167642.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene ppiD CDS complement(1820296..1820499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(1820596..1820868) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392663.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene hupB CDS complement(1821066..1823447) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067728.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene lon CDS complement(1823640..1824914) product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130305.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene clpX CDS complement(1825078..1825701) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene clpP CDS complement(1826236..1827540) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163508.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene tig CDS complement(1827855..1828169) product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973448.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene bolA CDS 1828494..1829072 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167631.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 1829132..1830619 product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167629.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene ampG CDS 1831044..1832006 product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167626.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene cyoA CDS 1832011..1834002 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163523.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene cyoB CDS 1833992..1834606 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163525.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 1834606..1834938 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 1834953..1835843 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095848.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene cyoE CDS 1836081..1837445 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849282.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(1837501..1837992) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167608.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 1838180..1839088 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167606.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene panE CDS 1839051..1839641 product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208657.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene yajL CDS complement(1839677..1841125) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095844.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene thiI CDS complement(1841145..1841360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 1841379..1841627 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124935.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene xseB CDS 1841624..1842535 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816905.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene ispA CDS 1842554..1844419 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816906.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene dxs CDS complement(1844492..1845028) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154044.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene pgpA CDS complement(1845003..1845983) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816909.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene thiL CDS complement(1846052..1846471) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208665.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene nusB CDS complement(1846496..1846972) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208666.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene ribE CDS complement(1847083..1848219) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132452414.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene ribD CDS complement(1848255..1848704) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890417.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene nrdR CDS 1848999..1849493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(1849566..1850540) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367999.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene secF CDS complement(1850550..1852364) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816910.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene secD CDS complement(1852425..1852757) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166605.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene yajC CDS complement(1852884..1854029) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208672.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene tgt CDS complement(1854316..1856184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(1856272..1857177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(1857240..1857425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(1857422..1857580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 1857668..1857919 product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170104.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 1857921..1858814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(1858832..1860976) product DNA transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029854.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(1860976..1862280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(1862280..1862945) product DNA transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960724.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(1862929..1863321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(1863331..1864179) product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228482.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(1864180..1865598) product packaged DNA stabilization protein gp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122394.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(1865605..1866066) product packaged DNA stabilization gp4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246749.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(1866047..1866271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005053303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(1866313..1867563) product P22 phage major capsid protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196946.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1867582..1868457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(1868551..1870764) product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070134174.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(1870766..1872184) product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200769.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1872181..1872642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113732.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(1872653..1872919) product DUF2560 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807788.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(1873034..1873285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(1873287..1873559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(1873699..1873893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(1874177..1874605) product lysis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097723.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(1874584..1875063) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816484.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1875063..1875347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(1875344..1875667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(1876164..1876466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(1876978..1877142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(1877710..1878015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1878008..1878190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1878343..1878900) product phage N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153280.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(1878897..1879199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(1879207..1879656) product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402092.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(1879657..1879923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(1879934..1880125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(1880195..1880431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(1880424..1880633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(1880660..1882036) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806597.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(1882033..1882851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(1882838..1883002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098068.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(1883011..1883304) product CII family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816498.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(1883413..1883601) product Cro/CI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098070.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 1883705..1884418 product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 1885139..1885399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 1885407..1885670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 1885730..1885936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 1886005..1886340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 1886378..1886596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 1886732..1887019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 1887082..1887468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120131214.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 1887482..1887673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 1887670..1888047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 1888072..1888584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 1888581..1889201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 1889205..1889618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809302.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 1889636..1889833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 1889826..1890419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 1890416..1890673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 1890654..1891076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 1891077..1891421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 1891418..1892185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 1893267..1893440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 1893696..1893917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 1893924..1894244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 1894655..1895167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(1895299..1896366) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208673.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene queA CDS 1896498..1897079 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167576.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 1897291..1897893 product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004707520.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 1898117..1899391 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210192.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1899622..1900998) product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167572.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene proY CDS complement(1901140..1902459) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208680.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene brnQ CDS complement(1902938..1904044) product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705310.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(1904287..1905225) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215524.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1905241..1906563) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208684.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene phoR CDS complement(1906591..1907280) product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208685.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene phoB CDS 1907575..1908813 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208687.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene sbcD CDS 1908810..1912493 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208688.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(1912512..1913423) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704548.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene mak CDS 1913731..1914639 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160563.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene rdgC CDS complement(1914732..1916522) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815979.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 1917060..1917806 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097911.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1917780..1918757) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012008.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(1918757..1919758) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846217.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(1919755..1921035) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858523.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(1921298..1921582) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208692.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene ppnP CDS complement(1921722..1922243) product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208693.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene aroL CDS complement(1922526..1923566) product asparaginase AnsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246337.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene ansZ CDS complement(1923782..1925428) product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098002.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 1926160..1940784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 1941312..1942718 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090505.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 1942758..1944896 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739071.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 1944908..1946077 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208471.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1946150..1947070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 1947198..1947350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 1947938..1948981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(1949083..1950279) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171409.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene uxuA CDS complement(1950691..1951425) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161827.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 1951688..1952830 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463327.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 1952915..1954159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 1954173..1954727 product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393747.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 1954729..1955181 product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 1955168..1955875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 1955954..1956850 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184803.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1956847..1957572) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112932.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(1958072..1959157) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene mltB CDS complement(1959296..1959637) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050530.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(1959758..1960663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 1961653..1962210 product RNA polymerase sigma factor FecI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283626.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene fecI CDS 1962207..1963163 product fec operon regulator FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068910.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene fecR CDS 1963256..1965604 product Fe(3+) dicitrate transport protein FecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188246.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene fecA CDS 1965694..1966608 product Fe(3+) dicitrate ABC transporter substrate-binding protein FecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879155.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene fecB CDS 1966605..1967600 product iron-dicitrate ABC transporter permease FecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125175.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene fecC CDS 1967600..1968559 product Fe(3+) dicitrate ABC transporter permease subunit FecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684852.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene fecD CDS 1968560..1969327 product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175457.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene fecE CDS 1970413..1970724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 1970756..1971955 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668791.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(1971960..1973141) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(1973198..1973749) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105108.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 1974394..1976958 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815614.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene mutS CDS complement(1977016..1977711) product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026017780.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene nlpE CDS complement(1977785..1978339) product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173162.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 1978580..1978780 product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212152.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 1978773..1979027 product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218374.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene rof CDS complement(1979137..1980489) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816961.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene tilS CDS complement(1980494..1980883) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901082.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(1981010..1981969) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391685.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene accA CDS complement(1981982..1985464) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228634.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene dnaE CDS complement(1985550..1986146) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212145.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene rnhB CDS complement(1986154..1987305) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139667.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene lpxB CDS complement(1987309..1988124) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173176.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene lpxA CDS complement(1988102..1988557) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212142.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene fabZ CDS complement(1988659..1989681) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173181.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene lpxD CDS complement(1989685..1990182) product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816966.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene skp CDS complement(1990322..1992751) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095659.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene bamA CDS complement(1992787..1994142) product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212138.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene rseP CDS complement(1994164..1995021) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173216.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene cdsA CDS complement(1995031..1995792) product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173219.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene ispU CDS complement(1995991..1997187) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212135.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene ispC CDS complement(1997432..1997953) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212134.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene frr CDS complement(1998126..1998851) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164053.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene pyrH CDS complement(1999007..1999858) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818114.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene tsf CDS complement(1999993..2000718) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095653.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene rpsB CDS 2001063..2001857 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266399.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene map CDS 2001972..2004686 product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173232.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene glnD CDS 2004715..2005542 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186650.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene dapD CDS 2005603..2006088 product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164058.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(2006160..2006615) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212126.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(2006683..2007468) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212125.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene truC CDS complement(2007461..2007811) product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212124.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(2007927..2008349) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222199.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(2008644..2010323) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111066.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(2011226..2011774) product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173239.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene syd CDS 2011845..2012693 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100463.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene queF CDS 2013011..2014375 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene ppnN CDS 2014447..2015229 product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215970.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene xni CDS complement(2015283..2016383) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212119.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene rlmM CDS complement(2016376..2016771) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203901.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(2016865..2017788) product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene gcvA CDS complement(2018326..2018547) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166349.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 2018731..2019936 product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703316.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene csdA CDS 2019940..2020395 product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816974.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene csdE CDS complement(2020411..2021229) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173260.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene tcdA CDS complement(2021298..2023556) product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816989.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(2023575..2024711) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228046.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene mltA tRNA 2024984..2025060 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 2025118..2025194 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 2025252..2025328 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(2025518..2026762) product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene amiC CDS 2027041..2028366 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173274.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene argA CDS complement(2028450..2029646) product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 2029988..2030983 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981551.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(2031109..2032974) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816976.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene recD CDS complement(2032971..2036552) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816977.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene recB CDS complement(2036549..2039485) product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene ptrA CDS complement(2039582..2042980) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211627.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene recC CDS complement(2043038..2043436) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(2043420..2043836) product YgdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211629.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(2043872..2044381) product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298794.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(2044492..2044959) product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 2045218..2045688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 2045793..2046029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(2046075..2046869) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211384.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene thyA CDS complement(2046906..2047775) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816984.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene lgt CDS complement(2047999..2050245) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816985.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene ptsP CDS complement(2050258..2050722) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165374.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene rppH note possible pseudo, frameshifted CDS 2051486..2052181 product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209838.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene mutH CDS 2052475..2053191 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173317.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 2053385..2053585 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758664.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 2053771..2054832 product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173327.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(2054890..2055603) product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817048.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(2055718..2056062) product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862421.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(2056064..2056783) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173629.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene trmB CDS 2056949..2058055 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847823.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene mutY CDS 2058052..2058324 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105744.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 2058386..2059450 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157159.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene mltC CDS 2059546..2060637 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705207.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(2060600..2061643) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215921.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(2061859..2062692) product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815345.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(2062706..2063929) product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176149.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 2064218..2064847 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080191.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 2064927..2065667 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040019001.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 2065978..2067429 product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212059.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene ansP CDS complement(2067651..2069804) product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173646.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene speF tRNA 2070479..2070554 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 2071150..2071404 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266521.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 2071490..2071738 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266521.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 2071753..2071980 product type II toxin-antitoxin system antitoxin CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813626.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene ccdA CDS 2072099..2072239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 note possible pseudo, internal stop codon CDS 2072526..2073317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 2073330..2074073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(2074147..2074281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(2074281..2075237) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 2075353..2076540 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(2077322..2078431) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(2078563..2079150) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390814.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 2079268..2079885 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064380616.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 2080126..2080692 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208449.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 2080778..2081179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 2081391..2081945 product copper-binding periplasmic metallochaperone CueP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211640.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene cueP CDS complement(2082051..2082944) product ABC transporter six-transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123623.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 2083038..2083610 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531971.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(2083687..2084157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(2084144..2084929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 2085622..2086170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 2086320..2088818 product PapC/FimD family outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703383.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 2088856..2089605 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095123.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 2089622..2090656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 2090708..2091253 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704492.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(2091359..2091850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(2091947..2092696) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065023.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 2092978..2094324 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267912.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 2094317..2095666 product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211753.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(2095754..2098018) product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097112.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene fhuE CDS complement(2098227..2099249) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(2099300..2100193) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723694.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 2100824..2101513 product PAS and helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175259.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 2101528..2102844 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175249.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 2102932..2103117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 2103092..2104894 product Svx/AvrXca family virulence/avirulence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039290.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 2105497..2106690 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095809.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 2106980..2107384 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345964.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 2107386..2108126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 2108217..2110457 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771478.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 2110543..2111226 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244178.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 2111297..2112559 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266685.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 2112581..2113954 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095441.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(2114021..2114707) product DNA-binding transcriptional regulator rspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215556.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene rspR CDS complement(2114994..2116277) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391962.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(2116274..2116753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(2116818..2117846) product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391960.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(2118081..2119103) product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869042.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene yiaK CDS complement(2119557..2121023) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705299.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(2121127..2122497) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419305.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(2122697..2123719) product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096790.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(2123749..2124963) product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295394.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene rspA CDS complement(2125255..2126157) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940939.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(2126174..2126335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 2126435..2126929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 note possible pseudo, frameshifted CDS 2127211..2127399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 2127896..2128594 product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220281.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene nrfC CDS 2128587..2129549 product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195162.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene nrfD CDS 2129550..2130926 product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene mdtD CDS 2130935..2131339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 2131407..2132936 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102053.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(2133020..2133676) product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365631.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene alkB CDS complement(2133673..2134788) product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154235330.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene ada CDS 2135030..2135809 product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098381.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 2135990..2136652 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064359.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(2136662..2137186) product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211616.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 2137273..2138151 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815868.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 2138642..2140285 product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209418.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene fumA CDS complement(2140353..2141891) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010723.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene norR CDS 2141890..2142072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 2142056..2143573 product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704147.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene norV CDS 2143584..2144720 product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064752.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene norW CDS 2144839..2145699 product SAM-dependent methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212046.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene tehB CDS complement(2145789..2146442) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817217.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene ribB CDS 2146948..2147229 product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098757.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene ubiK CDS complement(2147336..2147470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 note possible pseudo, frameshifted CDS complement(2147470..2148591) product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212192.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene yjeH CDS complement(2148721..2149776) product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227089.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene zipA CDS 2149983..2150813 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255008.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene cysZ CDS 2150976..2151944 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098198.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene cysK CDS 2152378..2152635 product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene ptsH CDS 2152681..2154408 product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208490.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene ptsI CDS 2154557..2155066 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522247.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene crr CDS complement(2155132..2156499) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815859.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(2156499..2157179) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172242.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 2157430..2158629 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815858.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 2158633..2160585 product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050129821.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(2160589..2161470) product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849665.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene cysM CDS complement(2161527..2162393) product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172255.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene cysW CDS complement(2162393..2163247) product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208511.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene cysT CDS complement(2163247..2164275) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365488.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 2164466..2164702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(2164586..2165485) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208519.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(2165657..2166256) product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(2166444..2168117) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161803513.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(2168114..2170888) product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244976.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(2170994..2173597) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084281.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(2173675..2174625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(2174963..2175388) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208525.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 2175570..2176502 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208526.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene hemF CDS 2176506..2176958 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208527.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(2177026..2178300) product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224390.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene mtr CDS complement(2178490..2180769) product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172316.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene maeB CDS complement(2181029..2181991) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209407.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(2182191..2183048) product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027214.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(2183076..2183903) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027215.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(2183920..2184699) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027216.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(2184696..2186468) product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027218.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(2186470..2187852) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978280.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(2187849..2188004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 2188397..2188855 product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209402.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene rpiB CDS 2189068..2190018 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072436.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene tal CDS 2190034..2192028 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209965.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene tkt CDS 2192343..2194247 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146623251.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 2194313..2195740 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 2195885..2196757 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219862.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 2196984..2198021 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969764.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(2198217..2199740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(2199952..2201037) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209902.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(2201074..2201886) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400847.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(2201888..2202769) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400851.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(2202833..2204098) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969763.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(2204480..2205061) product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815831.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene nudK CDS 2205403..2206560 product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922787.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(2206495..2206656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 2206760..2207926 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233270.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 2207940..2208143 product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388926.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(2208210..2209448) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815865.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(2209707..2210294) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210720.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene grpE CDS 2210426..2211322 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172782.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene nadK CDS 2211404..2213065 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene recN CDS 2213219..2213554 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703201.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene bamE CDS complement(2213793..2214083) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848491.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(2214064..2214510) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815744.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 2214666..2215148 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210714.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene smpB tmRNA 2215199..2215561 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 2215760..2216956 product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210713.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(2216953..2218656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 2218900..2219079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(2219030..2219275) product ogr/Delta-like zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468230.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(2219275..2220012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 2220627..2220812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 2220809..2221033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 2221389..2221586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 note possible pseudo, frameshifted CDS 2221579..2221791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 2221802..2224129 product primase-like DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017694613.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 2224240..2224815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 2224940..2225191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 2225742..2226008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 2226010..2226525 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 2227251..2227502 product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943075.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 2227492..2227776 product type II toxin-antitoxin system mRNA interferase RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323025.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene relE CDS complement(2227952..2228536) product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816099.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(2228526..2229020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 2229581..2230159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 2230526..2231308 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197330.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 2231576..2232202 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070529.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(2232248..2232745) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704946.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 2232778..2233788 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096683.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(2233873..2234298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 2234687..2238220 product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816353.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene nifJ CDS 2238540..2239076 product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096695.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene cybB CDS 2239098..2239895 product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097597.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 2240081..2241154 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689864.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene ldtB CDS complement(2241217..2242497) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071339.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 2242818..2244305 product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815994.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(2244298..2244672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 2245056..2246582 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208870.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(2246705..2247715) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105224.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(2247886..2248833) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070694233.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(2248830..2249354) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088185.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(2249527..2251896) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478019.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(2252619..2253011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 2253914..2255875 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209031.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene acs CDS 2256001..2256312 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014565.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 2256309..2257967 product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175651.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene actP CDS 2258146..2259054 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235943.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(2259196..2260893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(2261251..2263380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(2263383..2264723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(2264735..2265490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(2265490..2265837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(2265774..2267297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(2267428..2276979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(2277037..2278656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(2278852..2279466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(2279459..2280007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(2280007..2280858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(2280949..2281908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(2281923..2282903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(2282922..2284325) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011854072.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(2284365..2285564) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193520.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(2285579..2286145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(2286287..2287726) product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937576.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(2287807..2288751) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205080.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene cpaB CDS complement(2288798..2289349) product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968379.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(2289356..2289577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(2289890..2291389) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974841.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(2291367..2292077) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527354.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(2292436..2294082) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174376.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 2294015..2294203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 2294187..2294387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(2294363..2295718) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210039.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 2296083..2296349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(2296541..2297500) product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097229.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene puuE CDS complement(2297515..2298252) product allantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097230.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene hpxA CDS complement(2298249..2298971) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097231.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 2299123..2300607 product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366599.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(2300674..2301597) product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174358.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene lpxP CDS 2301974..2303044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(2303138..2303536) product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173442.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 tRNA complement(2303800..2303873) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(2303955..2304638) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541383.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(2304701..2305456) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111539.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(2305741..2307258) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene lysS CDS complement(2307267..2308313) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817019.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene prfB CDS complement(2308480..2310240) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173449.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene recJ CDS complement(2310247..2310963) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817020.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene dsbC CDS complement(2311101..2312000) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173453.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene xerD CDS 2312312..2313640 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099207.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 2313845..2314231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 2314574..2315092 product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209934.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene fldB CDS 2315127..2315444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(2315510..2316445) product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704819.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene rlmF CDS complement(2316514..2316888) product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244781.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(2316908..2317174) product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004390965.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene sdhE CDS 2317410..2318411 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209940.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene ygfZ CDS complement(2318466..2319095) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250274.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 2319537..2320145 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817027.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 2320200..2321204 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099344.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 2321414..2323558 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420832.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 2323651..2324913 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099342.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(2324958..2326265) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704225.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(2326258..2327346) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704226.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(2327346..2328170) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704227.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(2328206..2329111) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704228.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(2329101..2329973) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368525.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(2330152..2330622) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018329.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(2330766..2333639) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817028.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene gcvP CDS complement(2333758..2334150) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173499.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene gcvH CDS complement(2334210..2335325) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209949.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene gcvT CDS 2335888..2337039 product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene fucO CDS complement(2337083..2338546) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817405.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(2338681..2340360) product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174788.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene alsS CDS complement(2340382..2341164) product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174786.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene budA CDS 2341294..2342196 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174784.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 2342354..2342593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 note possible pseudo, frameshifted tRNA complement(2342729..2342815) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(2342878..2342964) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(2343039..2343125) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(2343229..2344146) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298429.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 2344248..2345240 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815513.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(2345243..2345794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 note possible pseudo, frameshifted CDS complement(2345803..2346294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 note possible pseudo, frameshifted CDS 2346454..2346867 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166902.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 2346836..2347279 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092461.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene rimI CDS 2347485..2347964 product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157355.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 2348225..2348767 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089775.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 2348764..2349726 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269199.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 2349878..2352373 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112989.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 2352422..2354170 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161803513.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(2354223..2354942) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209217.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene deoD CDS complement(2354990..2356213) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209216.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene deoB CDS complement(2356303..2357631) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815519.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene deoA CDS complement(2357822..2358601) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216078.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene deoC CDS complement(2359163..2360641) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066658.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 2360828..2361127 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209274.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(2361152..2361694) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175351.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(2361688..2362212) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 2362569..2363564 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309783.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 2363576..2364454 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209269.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 2364621..2365628 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815448.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(2365716..2367599) product DEAD/DEAH family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815447.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(2367774..2368616) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156264.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene nlpI CDS complement(2368799..2370919) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209259.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene pnp CDS complement(2371169..2371438) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098914.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene rpsO CDS complement(2371561..2372505) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098915.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene truB CDS complement(2372505..2372903) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175393.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene rbfA CDS complement(2372978..2375677) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223151.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene infB CDS complement(2375703..2377232) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098917.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene nusA CDS complement(2377254..2377676) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300397.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene rimP tRNA complement(2377925..2378001) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(2378312..2378926) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703753.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 2379357..2379956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 2379949..2380410 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 2380467..2380898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(2381146..2384244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 2384569..2385198 product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095607.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 2385330..2386841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 note possible pseudo, internal stop codon, frameshifted CDS 2386852..2387124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 note possible pseudo, internal stop codon, frameshifted CDS 2387224..2387496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 2387638..2393139 product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152825375.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 2393217..2397290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 2397355..2397981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 2398034..2399050 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816621.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 tRNA complement(2399113..2399199) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(2399224..2399556) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389230.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene secG CDS complement(2399806..2401143) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175398.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene glmM CDS complement(2401152..2401985) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815445.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene folP CDS complement(2402103..2404052) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369514.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene ftsH CDS complement(2404100..2404729) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175402.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene rlmE CDS 2404873..2405166 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918374.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene yhbY CDS complement(2405295..2405756) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148008.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene greA CDS 2406040..2407473 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217314.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene dacB CDS complement(2407543..2408715) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156290.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene cgtA CDS complement(2408975..2409937) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175407.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(2410027..2410284) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434222.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene rpmA CDS complement(2410304..2410615) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703604.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene rplU CDS 2410860..2411843 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175409.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene ispB CDS complement(2411922..2412296) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210176.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(2412545..2412931) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210176.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 2413119..2413382 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210175.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(2413452..2414390) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295272.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene mdh CDS 2414861..2415331 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369474.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene argR CDS complement(2415442..2416455) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369630.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene tsaD CDS 2416683..2416898 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene rpsU CDS 2417053..2418807 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817223.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene dnaG CDS 2418962..2420797 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174140.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene rpoD CDS complement(2420895..2421398) product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703525.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene mug tRNA 2421539..2421614 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 2421690..2422061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(2422070..2422972) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528259.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 2423152..2423916 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193030647.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(2423949..2424140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 2424212..2425600 product 6-phospho-beta-glucosidase BglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643228.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene bglB CDS complement(2425675..2427369) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(2427426..2428649) product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017936.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(2428756..2430204) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(2430101..2430319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(2430441..2432171) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668529.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(2432238..2434160) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721858.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(2434477..2434839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(2434910..2436163) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096608.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 note possible pseudo, frameshifted CDS complement(2436573..2437061) product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705764.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene spy CDS complement(2437256..2437552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 2437767..2439842 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817236.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(2439937..2441076) product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210402.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene rlmG CDS 2441238..2442236 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098856.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 2442490..2443443 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703564.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 2443430..2443621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 2443767..2445119 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174187.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene sstT CDS complement(2445202..2445732) product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174190.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(2445822..2447312) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174191.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(2447332..2448798) product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210409.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(2449001..2450410) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene uxaC CDS 2450825..2452126 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002353699.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 2452336..2453112 product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174195.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene exuR CDS 2453614..2454297 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174197.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 2454426..2454695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 2454701..2455090 product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210416.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 2455267..2455572 product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164648.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 2455586..2455981 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785626.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 2455978..2456268 product YqjK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817245.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 2456542..2456937 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391987.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 2457046..2458041 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817247.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(2458124..2459020) product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041009.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene yhaJ CDS 2459133..2459831 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633552.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 2459976..2460485 product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174547.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene zur CDS complement(2460541..2460750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(2461199..2461807) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095053.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene lexA CDS complement(2461918..2462283) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002902.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 2462411..2464888 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214644.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene plsB CDS complement(2465028..2465891) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455227.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene ubiA CDS complement(2465926..2466435) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209087.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene ubiC CDS complement(2466699..2468345) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368665.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene groL CDS complement(2468391..2468684) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(2468938..2469420) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175568.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene fxsA CDS 2469934..2471373 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855923.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene aspA CDS 2471495..2472796 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095257.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 2472928..2473260 product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209122.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene cutA CDS 2473236..2474966 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815414.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 2475001..2475576 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209117.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 tRNA 2475703..2475778 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(2475866..2476105) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 2476226..2476486 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114194633.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 2476590..2476856 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114194633.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 2476858..2477505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(2477631..2479415) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387067.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(2479427..2480479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(2481352..2482254) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036387.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 2482383..2482646 product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036386.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(2482791..2482943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 2482912..2483109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 2483501..2484205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 2484202..2485530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 2485527..2487632 product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921556.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 2487909..2488718 product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188582106.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 2489075..2498131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 2498240..2499748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(2499829..2501931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(2501928..2508281) product amonabactin biosynthesis non-ribosomal peptide synthetase AmoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043761210.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene amoG CDS complement(2508304..2509086) product amonabactin biosynthesis protein AmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706306.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene amoA CDS complement(2509080..2512223) product amonabactin biosynthesis non-ribosomal peptide synthetase AmoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706307.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene amoF CDS complement(2512220..2513095) product enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367768.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene entB CDS complement(2513106..2514731) product amonabactin biosynthesis (2,3-dihydroxybenzoyl)adenylate synthase AmoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706309.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene amoE CDS complement(2514728..2515924) product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309338.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene entC CDS 2516256..2517518 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817711.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 2517614..2519587 product siderophore amonabactin TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705839.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(2519636..2520352) product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213120.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(2520502..2521779) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209214.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(2522082..2522879) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704323.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(2522994..2523182) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813568.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(2523337..2523498) product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176651.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(2523649..2524257) product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209210.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene osmY CDS complement(2524762..2526351) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166905.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene prfC CDS 2526643..2527578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(2527632..2528327) product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209218.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 2528484..2529461 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704324.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene serB CDS 2529478..2530860 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029698.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene radA CDS 2530978..2532231 product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209221.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene nadR CDS complement(2532228..2532716) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209955.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(2533174..2533503) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004706812.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene zapA CDS 2533696..2534283 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173516.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 2534284..2535666 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209952.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene pepP CDS 2535712..2536890 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052899460.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene ubiH CDS 2536919..2538130 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817030.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene ubiI CDS 2538600..2539028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 2539569..2540048 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209806.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 2540101..2540787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208561.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 2540930..2541196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(2541680..2542717) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113689.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(2542812..2543318) product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439337.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 2543644..2544678 product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209111.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene rhaT CDS complement(2544981..2545595) product YagU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019920.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 2546335..2547948 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495702.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 2547926..2548885 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384277.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 2548878..2549744 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537723.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 2549741..2551450 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384275.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(2551510..2551776) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071641.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(2551803..2552093) product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071642.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(2552155..2553009) product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296618.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene rhaR CDS complement(2553034..2553873) product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209108.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene rhaS CDS 2554210..2555700 product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209105.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene rhaB CDS 2555697..2556959 product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703942.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene rhaA CDS 2556925..2557788 product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209103.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene rhaD CDS 2557878..2558192 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099341.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene rhaM CDS 2558612..2560189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 2560675..2563386 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210890.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene mgtA CDS 2563824..2565773 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 2566387..2567022 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368521.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 2567019..2568488 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368522.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(2568539..2569636) product DUF1615 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166493634.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 2569789..2570574 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(2570585..2571928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(2571945..2573180) product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704030.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 2573372..2574949 product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704028.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene rtcR CDS 2575110..2575379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175303.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 2575393..2575737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 2575839..2576156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 2576720..2577055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(2577218..2578048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(2578045..2579691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(2579709..2581226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 2581956..2582951 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930973.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 2583203..2584642 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175569.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene aspA CDS 2585039..2586460 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171281526.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 2586457..2587455 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707257.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 2587458..2588570 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707256.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 2588564..2589757 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707255.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(2589802..2590938) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206752.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(2591236..2592357) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816845.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(2592448..2592876) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354403.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 tRNA complement(2593187..2593271) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(2593505..2594581) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175277.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene lptG CDS complement(2594581..2595696) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368544.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene lptF CDS 2595980..2597491 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175279.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene pepA CDS complement(2597447..2597584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 2597617..2598066 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209309.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 2598079..2600934 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815475.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 2601126..2601776 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368017.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(2601951..2602097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(2602188..2602433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(2602423..2603319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 2603204..2603482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 2603541..2604083 product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069602.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene kptA CDS complement(2604084..2604479) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417647.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(2604483..2604728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(2604815..2605138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(2605191..2612276) product hemagglutinin repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704285.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(2612348..2614126) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210212.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(2614377..2615996) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205290.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(2616207..2617307) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267847.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(2617638..2618675) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209176.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(2618685..2619866) product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209177.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 2620291..2620794 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223170.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(2620904..2621329) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209303.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene rraB CDS 2621491..2622498 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012925.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene argF CDS complement(2623222..2623905) product PAS and helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815266.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(2624273..2624737) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175289.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 2625174..2626109 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704213.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene pyrB CDS 2626125..2626589 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392342.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene pyrI CDS 2626688..2627074 product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162498.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene ridA CDS 2627337..2628734 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817265.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 2628728..2629657 product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174267.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 2629654..2630475 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817266.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 2630499..2631236 product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 2631639..2633777 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815468.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene nrdD CDS 2633859..2634323 product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106222.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene nrdG CDS complement(2634335..2635018) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098901.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(2635093..2635539) product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209282.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(2635549..2635995) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926470.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 2636134..2637405 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206250.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 2637447..2638799 product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229277.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(2638894..2639352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(2639557..2639973) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097659.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(2639970..2640281) product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074398.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(2640440..2640991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 2641465..2642388 product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815509.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 2642587..2644122 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815508.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 2644203..2645573 product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166879.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 2645573..2646982 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815507.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 2647013..2648032 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815506.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(2648142..2648567) product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369671.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene exbD CDS complement(2648571..2649575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 2650240..2651217 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051196.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 2651332..2651838 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168610.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 2651854..2653146 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168608.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 2653592..2654782 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174070.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene metC CDS 2655112..2655771 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160739.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(2655801..2656829) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174073.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(2656845..2657012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 2657044..2657784 product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964037.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 2657788..2658951 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212174.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene yqhD CDS 2659234..2660061 product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013149.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene dkgA CDS complement(2660109..2660783) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097911.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(2661233..2662648) product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817210.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene ftsP CDS complement(2662751..2663488) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369660.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene plsC CDS complement(2663639..2665909) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817211.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene parC CDS complement(2666096..2667229) product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094925.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene lldD CDS complement(2667226..2668002) product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369184.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene lldR CDS complement(2667999..2669654) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369185.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene lldP CDS complement(2670126..2670275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 2670385..2671935 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314234.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 2671985..2672464 product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355546.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 2672478..2672792 product fructose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028073.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 2672818..2673909 product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662199.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 2673921..2674772 product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457129.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 2674862..2675722 product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961378.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 2675937..2676980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384064.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(2677078..2678973) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817213.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene parE CDS complement(2679058..2679639) product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077091.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene yqiA CDS complement(2679639..2680466) product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817215.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene cpdA CDS complement(2680574..2681026) product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862516.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(2681010..2681642) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212184.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene nudF CDS 2681979..2683370 product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098744.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene tolC CDS 2683641..2684315 product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357252.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 2684327..2685487 product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212188.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(2685556..2686341) product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene ygiD CDS complement(2687145..2688032) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210149.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene rsmI CDS 2688094..2690115 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817253.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 2690232..2690468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 2690532..2691122 product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861754.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene diaA CDS 2691134..2691706 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098899.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene dolP CDS complement(2691829..2693124) product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816770.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(2693195..2693929) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162387.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene mtgA CDS complement(2693926..2694579) product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174227.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene elbB CDS complement(2694726..2694899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(2695087..2697456) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210142.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene arcB CDS complement(2697568..2697960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 note possible pseudo, frameshifted CDS complement(2697963..2698499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 note possible pseudo, frameshifted CDS 2699152..2703612 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077010.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene gltB CDS 2703622..2705040 product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210138.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 2705309..2706082 product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366942.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(2706141..2706644) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366126.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene sspB CDS complement(2706650..2707291) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene sspA CDS complement(2707712..2708956) product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918420.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(2709292..2709996) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966866.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 2710177..2710950 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971598.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS 2711061..2712107 product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197411.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene idnD CDS 2712322..2713650 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047042816.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(2713736..2714128) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene rpsI CDS complement(2714144..2714572) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene rplM CDS complement(2714811..2715968) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817257.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene zapE CDS 2716184..2716588 product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162428.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene zapG CDS 2716847..2718217 product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817258.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene degQ CDS 2718355..2719452 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174240.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene degS CDS complement(2719569..2720831) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357265.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene murA CDS complement(2720915..2721169) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210126.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene ibaG CDS complement(2721304..2721606) product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817260.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene mlaB CDS complement(2721608..2722237) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210124.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene mlaC CDS complement(2722250..2722816) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817261.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene mlaD CDS complement(2722821..2723603) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210122.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene mlaE CDS complement(2723611..2724423) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032898349.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene mlaF CDS 2724713..2725678 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162457.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 2725734..2726825 product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817263.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene kdsD CDS 2726845..2727411 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369496.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene kdsC CDS 2727408..2727974 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174254.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene lptC CDS 2727955..2728527 product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669770.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene lptA CDS 2728531..2729256 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224099.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene lptB CDS 2729306..2730739 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210115.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene rpoN CDS 2730763..2731050 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162480.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene hpf CDS 2731119..2731619 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162484.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene ptsN CDS 2731783..2732640 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162486.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene rapZ CDS 2732672..2732944 product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162489.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene npr CDS 2733115..2733525 product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174306.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene rnk CDS complement(2733626..2734966) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210100.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene pmbA CDS 2735262..2735813 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174310.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene yjgA CDS complement(2735922..2737376) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098976.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(2737516..2739477) product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210095.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene aaeB CDS complement(2739516..2740481) product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174322.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene aaeA CDS complement(2740489..2740692) product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210093.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene aaeX CDS 2741045..2741962 product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174326.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene aaeR CDS 2742114..2742410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 2742420..2743013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(2743098..2744543) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174328.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene tldD CDS complement(2744600..2748430) product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817280.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene yhdP CDS complement(2748472..2749941) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174333.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene rng CDS complement(2749931..2750524) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817281.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(2750533..2751021) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210077.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene mreD CDS complement(2751018..2752001) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163136.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene mreC CDS complement(2752175..2753218) product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228205.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene mreB CDS complement(2753211..2753369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(2753535..2755472) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210075.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene csrD CDS 2755651..2756628 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210074.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 2756799..2757800 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050115893.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene msrP CDS 2757879..2758478 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174342.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene msrQ CDS 2758733..2759185 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210071.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene aroQ CDS 2759210..2759677 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163113.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene accB CDS 2759689..2761032 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369455.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene accC CDS complement(2761105..2763096) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640133.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(2763193..2764041) product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576821.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene modD CDS complement(2764038..2764859) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903995.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(2764915..2765673) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173325.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(2765670..2766665) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261262.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(2766662..2767639) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123164.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(2768101..2768529) product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301062.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 2769058..2769300 product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163104.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 2769290..2770741 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817285.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene panF CDS 2770759..2771646 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817286.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene prmA CDS 2771822..2772556 product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 2772951..2773868 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210062.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene dusB CDS 2773892..2774188 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene fis CDS 2774431..2775207 product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098370.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 2775191..2776036 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098369.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 note possible pseudo, internal stop codon CDS complement(2776336..2776737) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096735.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(2776806..2777951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 2778267..2779034 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330185.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 2779077..2779742 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812020.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 2780104..2781129 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174361.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 2781196..2782374 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019643.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 2782383..2783477 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299298.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 2783486..2784247 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099005.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 rRNA complement(2784530..2784640) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA complement(2784784..2787687) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 tRNA complement(2787917..2787992) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 rRNA complement(2788134..2789671) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS complement(2790066..2790605) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215920.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene hemG CDS complement(2790627..2792078) product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176271.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene trkH CDS complement(2792121..2792732) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295262.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(2792732..2794063) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211547.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene pepQ CDS 2794249..2796438 product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815377.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene fadB CDS 2796450..2797613 product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438736.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene fadA CDS complement(2797711..2798412) product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807928.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene fre CDS complement(2798465..2799961) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215917.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene ubiD CDS 2800162..2800650 product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192407.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene rfaH CDS complement(2800794..2801816) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211541.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene hemB CDS complement(2801834..2802616) product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815374.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene tatD CDS complement(2802723..2803475) product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211538.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene tatC CDS complement(2803479..2804072) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703995.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene tatB CDS complement(2804076..2804336) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508972.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene tatA CDS complement(2804419..2806059) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187543.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene ubiB CDS complement(2806056..2806679) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215928.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(2806692..2807447) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224024.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene ubiE CDS complement(2807580..2809142) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211532.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene rmuC CDS complement(2809362..2810735) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815303.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene argH CDS complement(2810797..2811570) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084401.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene argB CDS complement(2811608..2812612) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815301.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene argC CDS 2812821..2813966 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099301.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene argE CDS 2814021..2814734 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385220.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(2814738..2815937) product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971515.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 2816260..2817648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 2817891..2820530 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209491.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene ppc CDS complement(2820614..2821396) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815367.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(2821633..2822403) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211528.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene udp CDS 2822736..2823563 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084317.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(2823666..2825327) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478457.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(2826010..2827638) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478457.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(2828302..2830566) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153961.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene metE CDS 2830671..2831606 product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211525.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene metR CDS complement(2831512..2832411) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215597.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 2832454..2832633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 2832706..2833164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(2833394..2834032) product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170942738.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene pagP CDS complement(2834339..2835160) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815280.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene cysE CDS complement(2835303..2836322) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815279.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene gpsA CDS complement(2836322..2836792) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164715.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene secB CDS complement(2837012..2837443) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815278.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 2837689..2838990 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815277.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene envC CDS 2838993..2839940 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135520.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(2839992..2841023) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175928.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene tdh CDS complement(2841034..2842230) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208982.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 2842473..2843405 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815275.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene rfaD CDS 2843429..2844478 product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815274.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene rfaF CDS 2844475..2845458 product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208985.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene rfaC CDS 2845485..2846738 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602581.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 2846951..2848021 product lipopolysaccharide core heptosyltransferase RfaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360397.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene rfaQ CDS 2848018..2849142 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261571.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 2849217..2850236 product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080643.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene waaO CDS 2850295..2851254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 2851315..2852214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 2852284..2853054 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175942.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 2853152..2853556 product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 2853624..2854724 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963975.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 2854711..2855775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 2855780..2855992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 2856288..2857565 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172601538.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene waaA CDS 2857601..2858092 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171888.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene coaD CDS complement(2858098..2859087) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212312.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(2859144..2859953) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208989.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene mutM CDS complement(2860169..2860336) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208990.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene rpmG CDS complement(2860348..2860584) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164747.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene rpmB CDS complement(2860822..2861487) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175951.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene radC CDS 2861677..2862918 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628128.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene coaBC CDS 2862896..2863354 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011566231.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene dut CDS 2863528..2864079 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004714376.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene slmA CDS complement(2864133..2864774) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844529.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene pyrE CDS complement(2864832..2865548) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175960.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene rph CDS 2865750..2866718 product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304405.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene ycjG CDS 2866699..2868633 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065127.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 2868722..2870263 product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367555.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene gsiB CDS 2870282..2871202 product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813715.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene gsiC CDS 2871211..2872110 product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236051.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene gsiD CDS 2872119..2873195 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065131.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 2873222..2874043 product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065132.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 2874103..2875050 product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065126.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 2875263..2876171 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479800.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 2876271..2877134 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369148.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 2877533..2878306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 2878581..2878904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 2878953..2879174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 2879171..2879554 product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816307.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 2879718..2880275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(2880318..2880830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 2880995..2881381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 2881413..2881775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(2881842..2883011) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365665.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(2883105..2883605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(2883726..2884886) product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211919.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene lldD CDS complement(2885007..2886446) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115944.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene aldA CDS complement(2886730..2887659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(2887719..2888819) product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048209.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(2888816..2889955) product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048209.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(2889948..2891072) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281624.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(2891077..2891733) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304425.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(2891730..2893016) product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211273.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(2893013..2893819) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074140.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(2893812..2894840) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211275.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(2894837..2895850) product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304427.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 2896178..2896519 product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366825.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(2896639..2897043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(2897040..2897969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(2898320..2898709) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271101.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 2898829..2899824 product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265949.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene ftrA CDS 2899829..2901031 product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091577.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 2901379..2902107 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211655.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(2902091..2902741) product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211858.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(2903009..2904355) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207682.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene argG CDS 2904767..2905342 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369700.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(2905413..2906591) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209588.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(2906728..2907909) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817423.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene gguB CDS complement(2907887..2909428) product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817424.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(2909549..2910457) product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175009.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene xylF CDS 2910897..2912219 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830210.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene xylA CDS 2912413..2913870 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050158375.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene xylB CDS complement(2913902..2914894) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209600.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(2915113..2916648) product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183976.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene aldB CDS 2916869..2917702 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753589.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene fdhD CDS 2917938..2918564 product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817437.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene sodA CDS 2918870..2920756 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817438.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(2920852..2921214) product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161962.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(2921341..2921871) product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703790.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene mtlR CDS complement(2922025..2923173) product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817444.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(2923235..2925142) product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175076.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(2925579..2926295) product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175086.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(2926624..2928693) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209623.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene glyS CDS complement(2928703..2929617) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene glyQ CDS complement(2929745..2930551) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 2930863..2931426 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817446.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 2931423..2931896 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209627.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(2931917..2933890) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817438.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 2934174..2935181 product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209630.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene ghrB CDS complement(2935298..2935642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 2935906..2936097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(2936214..2937416) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047054668.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 2937737..2939374 product TIGR04028 family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705506.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 2939395..2940339 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705507.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 2940336..2941196 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705508.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 2941193..2942866 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537751.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 2942882..2943916 product putative FMN-dependent luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965649.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 2943913..2945046 product alkylhydroperoxidase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705511.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(2945103..2945612) product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369282.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 2945715..2946587 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420773.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(2946631..2947254) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096586.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 2947436..2948140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 2948210..2948965 product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704726.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene dsbG CDS complement(2948999..2949904) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 2950158..2950409 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172325.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 2950406..2950693 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172322.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(2950813..2952177) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703747.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene gorA CDS complement(2952294..2953136) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209533.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 2953355..2954083 product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367017.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 2954083..2956800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(2956845..2958536) product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367863.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene hscC CDS 2958757..2959032 product DUF2623 family protein YghW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059139.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene yghW CDS complement(2959062..2959883) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046052102.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(2960084..2961073) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070694233.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(2961070..2961582) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038677.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(2961762..2964311) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815963.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 2964563..2966674 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099196.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 gene prlC CDS 2966671..2967417 product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174842.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene rsmJ CDS 2967618..2969465 product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816811.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(2969568..2970935) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931585.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(2971055..2972398) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209529.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene gdhA CDS complement(2972690..2973127) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157389.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene uspA CDS 2973681..2974016 product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209527.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene uspB CDS complement(2974139..2975644) product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157393.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene pitA CDS 2975923..2977122 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215486.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 2977215..2978822 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868284.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(2978866..2979390) product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 tRNA complement(2979826..2979902) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(2980034..2981467) product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209571.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene eptB CDS complement(2981969..2983660) product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215674.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene ligB CDS 2983982..2984605 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004704191.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene gmk CDS 2984659..2984934 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene rpoZ CDS 2984953..2987052 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176016.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene spoT CDS 2987058..2987750 product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070187.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene trmH CDS 2987750..2989831 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703814.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene recG CDS 2989998..2991386 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815268.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 2991544..2993235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815267.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(2993607..2994548) product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297068.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene fabY CDS complement(2994702..2995139) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209009.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene dtd CDS complement(2995204..2995815) product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209011.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene yihX CDS complement(2995978..2997801) product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175744.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene typA CDS 2998171..2999580 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392048.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene glnA CDS 2999845..3000831 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175750.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene glnL CDS 3000840..3002252 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175753.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene glnG CDS 3002396..3002533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(3002588..3002836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(3002894..3004267) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099379.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene hemN CDS complement(3004593..3005147) product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213158.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene yihI CDS complement(3005158..3005349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 3005351..3005986 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213160.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene yihA CDS complement(3006402..3009077) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175760.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene polA CDS complement(3009570..3010193) product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175761.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene dsbA CDS complement(3010218..3011204) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175762.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(3011283..3011552) product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175764.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 3011763..3012341 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213171.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene mobA CDS 3012331..3012852 product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217538.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene mobB rRNA complement(3013064..3013174) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA complement(3013318..3016221) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 tRNA complement(3016439..3016514) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(3016557..3016633) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 rRNA complement(3016708..3018245) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS complement(3018678..3019673) product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175187.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene rbsR CDS complement(3019677..3020603) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212251.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene rbsK CDS complement(3020675..3021562) product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175185.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene rbsB CDS complement(3021588..3022556) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815254.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene rbsC CDS complement(3022564..3024069) product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099396.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene rbsA CDS complement(3024077..3024496) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161210.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene rbsD CDS complement(3024812..3025207) product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731552.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 3025452..3026114 product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369657.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene qseB CDS 3026111..3027460 product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098726.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene qseC CDS complement(3027599..3029467) product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175182.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene kup CDS 3029819..3031318 product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212254.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene ravA CDS 3031325..3032803 product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099400.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene viaA CDS complement(3032800..3033792) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815250.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene asnA CDS 3033945..3034406 product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161192.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene asnC CDS 3034496..3034939 product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212258.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene mioC CDS 3035330..3037219 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499882.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene mnmG CDS 3037302..3037922 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212261.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene rsmG CDS 3038546..3038929 product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212262.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene atpI CDS 3038952..3039752 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228150.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene atpB CDS 3039802..3040041 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene atpE CDS 3040105..3040575 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099406.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene atpF CDS 3040590..3041123 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175171.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene atpH CDS 3041136..3042677 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161175.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene atpA CDS 3042730..3043593 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817476.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene atpG CDS 3043641..3045023 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190499.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene atpD CDS 3045043..3045462 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024912932.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(3045747..3047981) product exopolygalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482823.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 3048306..3049676 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215550.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene glmU CDS 3049866..3051698 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215552.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene glmS CDS 3051965..3052351 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301470.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 3052441..3053508 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273200.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 3053562..3054290 product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301843.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 3054283..3055074 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099156.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 3055094..3055360 product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148686.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 3055384..3055632 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173115.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 3055645..3056208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703716.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 3056205..3057560 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703717.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 3057547..3057936 product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703718.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 3057927..3059639 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703719.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 3059642..3060064 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369298.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 3060061..3060666 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670562.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 3060638..3062959 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180184.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 3062956..3063531 product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597700.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 3063533..3064690 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301690.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 3064683..3065165 product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815697.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 3065183..3065935 product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703724.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 3065935..3067161 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198470.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 3067186..3068616 product DUF4026 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453709.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 3068828..3069868 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817473.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene pstS CDS 3070031..3070990 product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215558.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene pstC CDS 3070990..3071877 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175158.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene pstA CDS 3071964..3072737 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004713904.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene pstB CDS 3072750..3073478 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817472.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene phoU CDS complement(3073523..3074089) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705566.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 3074181..3075392 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816265.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 3075463..3076500 product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241036.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 3076625..3077461 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215568.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 3077560..3078303 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215571.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 3078305..3079033 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817468.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(3079112..3079777) product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175148.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene yieH CDS 3080023..3081360 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215577.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(3081416..3082159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099416.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(3082349..3082870) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816736.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(3082867..3084420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 3085318..3085989 product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215847.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 3086008..3086367 product DUF4810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215846.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 3086364..3087023 product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172128.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(3087146..3088648) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112356.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 3088752..3089303 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813206.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(3089334..3089744) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084622.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 3089858..3090712 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170580.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 3091223..3091768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 3092163..3093188 product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019212714.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene rhuM CDS complement(3093398..3094762) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981435.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene mnmE CDS complement(3094892..3096526) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817459.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene yidC CDS 3096876..3097073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 3098013..3099341 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220732.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene dnaA CDS 3099346..3100446 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209645.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene dnaN CDS 3100496..3101581 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817457.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene recF CDS 3101600..3104017 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072047.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene gyrB CDS complement(3104233..3105423) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083825.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 3105588..3105956 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071172.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(3106009..3107925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(3107987..3108166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(3108278..3109291) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420952.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 3109548..3109808 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417897.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 3109825..3111138 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704317.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 3111128..3111472 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261351.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 3111503..3112945 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171472.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 3113101..3113916 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209641.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene yidA CDS complement(3114061..3114957) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065702830.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 3115100..3116650 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064762.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 3116720..3117604 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090007.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 3117708..3118661 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970851.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 3118663..3119634 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527657.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 3119634..3120611 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762408.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 3120608..3121516 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040797.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 3121556..3123355 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974102.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(3123392..3123691) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212552.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(3123678..3124049) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024360564.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 3124387..3125085 product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861109.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene dgoR CDS 3125082..3125978 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127048.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene dgoK CDS 3125962..3126579 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094785.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 3126576..3127724 product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705012.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene dgoD CDS 3128077..3129366 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496901.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(3129474..3129731) product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097471.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene ybiJ CDS complement(3129904..3130704) product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210036.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene ssuB CDS complement(3130701..3131495) product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213853.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene ssuC CDS complement(3131506..3132648) product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210034.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene ssuD CDS complement(3132708..3133721) product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210033.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 3134058..3134234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 3134209..3134472 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094822.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 3134469..3135791 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171888.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 3135817..3137229 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270464.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(3137413..3137670) product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816765.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 3138075..3139187 product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817455.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(3139223..3139579) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175118.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 3139847..3140260 product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209636.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene ibpA CDS 3140427..3140879 product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209635.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene ibpB CDS 3141055..3142713 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209634.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 3143285..3144697 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817290.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 3144889..3146517 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168935.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 3146510..3147232 product two-component system response regulator DcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168932.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene dcuR CDS 3147359..3147706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 3147690..3147956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 3148073..3148966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 3148950..3149225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(3149373..3150716) product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816580.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 3152186..3153793 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817398.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 3154025..3155044 product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002921786.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene dppB CDS 3155058..3155960 product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209563.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene dppC CDS 3155974..3156954 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174903.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene dppD CDS 3156951..3157961 product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107036.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene dppF CDS complement(3158234..3158521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(3158754..3159296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(3159304..3159744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(3160239..3160652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(3160657..3165006) product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289110.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(3165018..3165425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(3165434..3167287) product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705728.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene tssI CDS complement(3167378..3167896) product type VI secretion system effector Hcp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705706.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene hcp1 CDS complement(3168433..3169683) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228155.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 3170067..3171284 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096422.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 3171447..3172358 product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096629.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene eamA CDS 3172572..3174350 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816913.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene ggt CDS complement(3174452..3175459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(3175680..3176006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(3176123..3176611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(3176608..3181671) product contact-dependent inhibition toxin CdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298438.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene cdiA CDS complement(3181710..3183392) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704133.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(3183651..3188231) product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817392.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene bcsC CDS complement(3188213..3189328) product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817393.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene bcsZ CDS complement(3189335..3191653) product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018077.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene bcsB CDS complement(3191728..3194427) product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817395.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene bcsA CDS complement(3194424..3195161) product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174891.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene bcsQ CDS complement(3195164..3195373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 3195714..3197318 product cellulose biosynthesis protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817396.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene bcsE CDS 3197315..3197533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 3197535..3199193 product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174899.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene bcsG CDS 3199563..3200714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 3201034..3202326 product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858212.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene dctA CDS 3202669..3204186 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817388.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(3204269..3205201) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209549.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(3205349..3206365) product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157374.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene yhjD CDS 3206495..3207691 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300943.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(3207740..3208306) product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245277.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(3208493..3209170) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211495.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 3209404..3209646 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833603.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene tusA CDS complement(3209706..3211766) product zinc/cadmium/mercury/lead-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815354.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(3212164..3212793) product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176373.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 3212985..3213305 product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211499.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 3213305..3213664 product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420764.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(3213668..3213946) product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163952.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(3213973..3214431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 3214897..3216408 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176365.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene ftsY CDS 3216414..3217085 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211504.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene ftsE CDS 3217075..3218043 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084329.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene ftsX CDS 3218376..3219233 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163942.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene rpoH CDS complement(3219298..3219747) product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176356.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene panM CDS 3220152..3221264 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211508.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 3221422..3222348 product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211509.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene livH CDS 3222345..3223169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 note possible pseudo, frameshifted CDS 3223163..3223621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 note possible pseudo, frameshifted CDS 3223618..3224388 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176349.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene livG CDS 3224394..3225095 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176347.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene livF CDS 3225125..3226315 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098395.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(3226406..3228088) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536557.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(3228436..3230094) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536557.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(3230471..3231829) product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104433.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(3232015..3232803) product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168948.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(3232836..3233492) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168943.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(3233489..3234763) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298110.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(3234760..3235674) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665973.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 3236013..3236771 product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212058.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene ygbI CDS complement(3236793..3237122) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280945.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(3237073..3237498) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539521.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 3237997..3238296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 note possible pseudo, frameshifted CDS 3238326..3238691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 note possible pseudo, frameshifted CDS 3238645..3239109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213101.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 3239138..3239497 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801912.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 3239488..3239970 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301452.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 3240103..3241437 product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028113.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene ugpB CDS 3241510..3242397 product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004703935.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene ugpA CDS 3242423..3243268 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211522.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene ugpE CDS 3243543..3244616 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211523.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 3244616..3245365 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211524.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene ugpQ CDS 3245477..3246433 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815364.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(3246447..3246743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 3247054..3247518 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074146.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene trmL CDS complement(3247581..3248954) product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703879.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene uhpT CDS complement(3249091..3250431) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369066.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(3250441..3251946) product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001330988.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene uhpB CDS complement(3251946..3252536) product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633668.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 gene uhpA CDS complement(3252595..3253353) product DUF3142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707337.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(3253365..3255539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209914.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(3255733..3257103) product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175902.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene cpxA CDS complement(3257100..3257798) product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862004.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene cpxR CDS 3257952..3258476 product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080295.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene cpxP CDS 3258875..3260062 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154617.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 3260141..3261046 product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815283.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene fieF CDS 3261271..3262215 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099327.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene pfkA CDS complement(3262300..3262467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 3262681..3263313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 note possible pseudo, frameshifted CDS 3263442..3263612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(3263599..3264327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(3264327..3267110) product Tat pathway signal sequence domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136207739.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(3267115..3269307) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(3269483..3270463) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112655.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 3270936..3271814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 3271825..3272541 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083979.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 3272543..3272944 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106175.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 3272966..3274561 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106694.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 3274579..3275337 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112653.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 3275662..3276546 product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209979.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene aguB CDS 3276550..3277653 product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209980.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene aguA CDS complement(3277791..3278558) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208959.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene tpiA CDS complement(3278724..3279323) product DUF1454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215864.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 3279561..3279983 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815287.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(3280002..3280748) product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796330.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene fpr CDS complement(3280866..3281885) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815289.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene glpX CDS complement(3282141..3283652) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175870.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene glpK CDS complement(3283706..3284545) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208954.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 3285115..3285354 product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208953.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene zapB CDS complement(3285473..3285958) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208945.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene rraA CDS complement(3286093..3287010) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298879.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(3287155..3288486) product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175854.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene hslU CDS complement(3288496..3288909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29020 note possible pseudo, frameshifted CDS complement(3288851..3289027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 note possible pseudo, frameshifted CDS complement(3289170..3289853) product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815291.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene ftsN note possible pseudo, frameshifted CDS complement(3290168..3290341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(3290647..3290811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 note possible pseudo, frameshifted sequence2 source 1..1061612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000976329.1:P-type conjugative transfer protein VirB9 locus_tag LOCUS_29070 CDS 517..1740 product VirB10/TraB/TrbI family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039326147.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene virB10 CDS 1730..2746 product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125557.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene virB11 CDS 2853..3092 product TrbM/KikA/MpfK family conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044654.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 3818..5680 product TraM recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602685.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 5689..6435 product MobC family replication-relaxation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909124.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene mobC CDS 6570..7337 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112421.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 7577..8116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 8462..9463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(9820..10134) product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817079.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(10137..10373) product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817080.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(10694..11638) product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155898.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 12601..14961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 14958..16958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(17012..17854) product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(17855..21178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(21168..22106) product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 23141..24169 product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189895.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(24319..25518) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039416.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(25634..28723) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267494.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(28720..29829) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267493.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(29906..30508) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267492.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 30653..32125 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267491.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 32194..32979 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104937.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 33250..35049 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene lepA CDS 35232..36731 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004712888.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(36717..37667) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(37664..38659) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533422.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(38662..39525) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724711.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(39527..40483) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972897.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(40496..42061) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972898.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(42113..43330) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501370.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(43807..44613) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089929.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(44603..45484) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974391.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(45481..46578) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089842.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(46575..47660) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086070.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(47689..49683) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538267.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(49680..51761) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368527.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 52008..53501 product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537832.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 53491..54225 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225832.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 54267..55448 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229000.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 55840..56646 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090839.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(56682..58091) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243160.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 58242..58919 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 58928..59593 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 59615..60463 product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245567.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene yecC CDS 60486..61403 product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 61506..63560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(63886..64803) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707466.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(65866..66045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 66492..67124 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090854.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(67800..68276) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096727.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(68337..68906) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(69144..70196) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705234.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(70198..70893) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390679.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 71028..72155 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182976012.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 72186..75284 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705231.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 75335..75742 product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366733.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene marA CDS complement(75789..76877) product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103986.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 76965..77270 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267489.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 77440..78987 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168723.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 78984..80012 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168721.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(80062..81003) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816635.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(81080..82078) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298829.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(82075..83067) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168716.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(83064..84611) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816637.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(84615..85544) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816638.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 85835..86356 product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087656.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 86441..86905 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950409.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(87020..87421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(87440..88273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(88299..91007) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705092.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(91004..95194) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277852.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene nirB CDS complement(95211..96005) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096250.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(96016..96930) product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene ntrB CDS complement(96943..98202) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882726.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(98863..100152) product nitrate regulatory protein NasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096246.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene nasR CDS 100408..100644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 101195..102772 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168026.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene cydA CDS 102787..103926 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210731.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene cydB CDS 104219..104584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 104588..104908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(105015..105944) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161934.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene fdhE CDS complement(106181..107632) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816561.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(107741..108463) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039158.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(108675..109151) product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214045.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(109312..109941) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175599.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(109938..110438) product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020040.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene hutX CDS complement(110453..111766) product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209066.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 gene hutW CDS 112349..114343 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966626.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 114355..115179 product heme ABC transporter substrate-binding protein ShuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302516.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene shuT CDS complement(115346..116938) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227996.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 117056..117952 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185969.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 117966..118526 product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366387.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene rimL CDS 119102..120520 product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215779.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene treB CDS 120591..122288 product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817267.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene treC CDS complement(122368..122679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(122941..124398) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815945.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene nuoN CDS complement(124405..125940) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210269.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene nuoM CDS complement(126041..127888) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815943.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene nuoL CDS complement(127885..128187) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159229.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene nuoK CDS complement(128184..128744) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393522.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene nuoJ CDS complement(128754..129296) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365590.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene nuoI CDS complement(129314..130288) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210274.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene nuoH CDS complement(130285..133020) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815941.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene nuoG CDS complement(133198..134547) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210276.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene nuoF CDS complement(134544..135089) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545042.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene nuoE CDS complement(135092..136891) product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815938.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene nuoC CDS complement(136990..137664) product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913178.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene nuoB CDS complement(137682..138122) product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391650.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene nuoA CDS complement(138800..139615) product virulence transcriptional regulator RovM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171734.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 gene rovM CDS 140252..141466 product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074540.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 gene alaA CDS 141611..142210 product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171739.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene yfbR CDS complement(142240..144072) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227880.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(144249..144905) product sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019083548.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(144927..145421) product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159196.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(145587..146042) product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171754.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene yfbV CDS 146485..147687 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365576.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene ackA CDS 147767..149905 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082007.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene pta CDS 150024..150884 product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971962.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(150957..151625) product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815932.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene yfcD CDS complement(151749..152291) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098124.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene yfcE CDS 152563..153189 product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566559.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene yfcG CDS 153315..153686 product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098127.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene folX CDS 153706..154611 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815929.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(154978..155751) product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171791.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 gene hisP CDS complement(155769..156485) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171793.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(156478..157167) product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209736.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(157308..158087) product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158461.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene hisJ CDS complement(158502..159074) product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171802.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(159290..160807) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158469.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene purF CDS complement(160829..161329) product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209732.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene cvpA CDS complement(161661..162419) product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209731.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene dedD CDS complement(162409..163677) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209730.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene folC CDS complement(163781..164698) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815925.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene accD CDS complement(164923..165585) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365553.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(165780..166631) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283586.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene truA CDS complement(166631..167641) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209726.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(167755..168891) product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706175.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene pdxB CDS complement(169015..169197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS 169175..170053 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171845.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 170158..171405 product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815916.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene flk CDS complement(171520..172737) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817178.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene fabB CDS 172890..174938 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815908.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene mnmC CDS complement(175005..175289) product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209715.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(175323..175868) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365544.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(175883..176683) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815907.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(176693..177538) product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171929.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene mepA CDS complement(177545..178630) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171931.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene aroC CDS complement(178706..179638) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171935.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene prmB CDS 179810..180352 product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171938.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene smrB CDS complement(180440..180823) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158598.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene sixA CDS 182076..182624 product spore coat protein U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705943.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(182729..183070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 182967..183344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 183368..184153 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114703.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 184212..186578 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114701.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 186583..187590 product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099330.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(187583..189799) product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661366.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene fadJ CDS complement(189796..191109) product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815905.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene fadI CDS 191322..191810 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053623.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 191803..192567 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113396.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(192671..192967) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171954.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 193356..194657 product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392784.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene fadL CDS complement(194834..195220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(195503..197086) product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097999.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene mqo CDS complement(197449..198210) product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209701.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene mlaA CDS 198625..199563 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377769.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 tRNA 199640..199714 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 199891..200016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 200271..200891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 200914..201711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 201708..202511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(202620..203117) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706109.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 203473..204387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30800 note possible pseudo, frameshifted CDS 204995..205738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 205945..206130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS complement(206375..207166) product NPP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031599.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(207398..208183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(208285..208551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 209077..209616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(209699..210283) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704572.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(210344..211726) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816168.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene dbpA CDS complement(211847..212581) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705136.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(212578..213348) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705137.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(213350..214369) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705138.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(214366..215430) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705139.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 215741..216766 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096845.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(217359..218204) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(218313..219059) product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817146.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(219049..219543) product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004187.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(219540..220817) product GspL family type II secretion system protein ExeL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704547.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene exeL CDS complement(220814..221800) product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776550.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene gspK CDS complement(221797..222429) product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082782.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene gspJ CDS complement(222447..222794) product GspI family T2SS minor pseudopilin variant ExeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704544.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene exeI CDS complement(222809..223375) product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082929.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene gspH CDS complement(223490..223960) product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231211.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene gspG CDS complement(223993..225219) product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173152.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene gspF CDS complement(225221..226717) product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092338.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene gspE CDS complement(226714..228753) product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001358887.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene gspD CDS complement(228755..229618) product GspC family type II secretion system variant ExeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704539.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene exeC CDS complement(229669..231648) product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815325.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(231788..233356) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244025.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 233854..234450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(234447..234896) product GspS family T2SS pilot lipoprotein variant EptO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971918.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene eptO CDS complement(234982..236223) product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172146.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene alaC CDS 236601..237572 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722599.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 237615..238469 product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336969.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(238556..241009) product DUF3772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298473.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 tRNA 241407..241483 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 242115..242420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215253.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(242512..243615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(243626..245326) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100193.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(245326..246798) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001540814.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(246871..249303) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819018.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS complement(249513..250946) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945937.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(250943..251821) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205355.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(252065..252286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(252304..253737) product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040545.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(253734..254852) product membrane-bound O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040546.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(254982..256118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(256945..257331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(257438..258331) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817251.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 258663..259064 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070690482.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(259166..259489) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261351.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS 259989..261005 product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815879.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 261158..262735 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215840.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 262738..263808 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815877.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(263840..264232) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211819.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene arnF CDS complement(264232..264573) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211820.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 gene arnE CDS complement(264570..266240) product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169390.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene arnT CDS complement(266258..267151) product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211822.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 gene arnD CDS complement(267148..269181) product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211823.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene arnA CDS complement(269178..270161) product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816394.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene arnC CDS complement(270154..271302) product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211825.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene arnB CDS complement(271515..272681) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene ugd CDS complement(272827..273099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 273230..274777 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038812.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 274914..275777 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367875.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene folD CDS 275810..276022 product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190278.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene ybcJ CDS complement(276111..277496) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222677.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene cysS CDS complement(277764..278195) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704866.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 278617..279111 product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158275.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene ppiB CDS 279122..279844 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167787.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 280023..280532 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208569.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene purE CDS 280529..281599 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816855.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene purK CDS 282117..283406 product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215443.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 283474..284841 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419892.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene sdaA CDS complement(284943..285380) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876815.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(285512..286327) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209780.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene pstB CDS complement(286343..287989) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214668.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene pstA CDS complement(287986..290154) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214670.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 290372..292444 product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370393.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene ppk1 CDS 292444..293979 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072076535.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene ppx CDS 294211..294399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(295052..295330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS complement(295330..295575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(295572..296849) product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084435.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(296852..297856) product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene trbG CDS complement(297853..298557) product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084433.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene trbF CDS complement(298587..299978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(299975..300289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(300302..301045) product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533266.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene trbJ CDS complement(301042..303492) product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533267.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 gene trbE CDS complement(303505..303774) product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388564.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(303771..304157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(304154..305224) product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388566.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 gene trbB CDS complement(305221..305709) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(305706..307712) product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 307632..307910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(307947..308213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(308210..309154) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213173803.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(309259..309645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(309720..310340) product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028021.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(310488..311603) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029671.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(311688..314381) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036288.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(314720..315904) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(316222..316926) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206659.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 317039..317962 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967095.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(318114..320102) product DUF3363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538232.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(320551..321150) product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533277.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(321147..321692) product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(321689..321985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082881.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(321973..322611) product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene parA CDS complement(322901..323725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 note possible pseudo, frameshifted CDS complement(323776..324057) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490270.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(324133..324939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(324989..325189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(325261..325608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 325874..326164 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003282197.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 326217..327728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(327768..328082) product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061950.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(328858..329037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(329125..331209) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176021.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(331291..332118) product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234445.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(332150..332347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 332427..332627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 332690..333703 product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167364873.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 333713..335440 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 335589..336455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(336598..337497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(337657..338859) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(339125..339550) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817404.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(339738..340187) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035518.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 340405..341883 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209784.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene mgtE CDS complement(341963..343126) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene galK CDS complement(343136..344176) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097520.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene galT CDS 344641..345651 product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816990.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene galR CDS 346139..347446 product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097211.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(347960..349042) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209902.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 349532..350767 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209901.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(350847..351098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 351009..352172 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097216.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 352185..353033 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209899.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 353069..354283 product arabinogalactan endo-beta-1,4-galactanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209898.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 354511..356571 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209897.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 356723..357064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(357148..358905) product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706094.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene dld CDS complement(358976..359941) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107361.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS 360200..361396 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172189.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 361641..362876 product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678979.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene mdtA CDS 362876..365998 product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815801.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 365995..369075 product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815800.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene mdtC CDS 369694..371091 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130875.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 371099..372466 product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162191.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene baeS CDS 372492..373220 product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137847.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 gene baeR CDS 373242..373895 product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071891.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 373950..374501 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083119.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 374670..375629 product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391216.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 375842..377203 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172489.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene yegQ CDS 377634..378533 product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209799.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene yegS CDS complement(378562..378969) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705335.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene psiE CDS complement(379178..379981) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172521.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene thiD CDS complement(379978..380772) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694556.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 gene thiM CDS 381066..382085 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098954.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 382229..383152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(383478..384170) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114755.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(384332..384568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 384473..385375 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807817.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(385392..386165) product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311931.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 386771..387475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 387676..389721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(389863..390066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(390038..390169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 390606..392075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 392365..392709 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 392711..393028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(393117..393332) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 393643..393987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS 393992..394330 product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095863.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(394420..395022) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974547.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 395140..396063 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002415541.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 396093..396971 product pyridoxine 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097798.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene pdxI CDS complement(397098..398675) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815789.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene guaA CDS complement(398794..400260) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370334.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene guaB CDS 400432..401826 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815788.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene xseA CDS 402057..403100 product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098268.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 403097..403444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098269.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(403450..403674) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209811.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(403677..404120) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723831.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(404334..405293) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172553.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(405422..406909) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172557.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene der CDS complement(407052..408233) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209814.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene bamB CDS complement(408244..408864) product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172568.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(408878..410152) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159557.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene hisS CDS complement(410290..411411) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172591.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene ispG CDS complement(411452..412450) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090832.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene rodZ CDS complement(412440..413195) product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209819.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene pilW CDS complement(413426..414682) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003317.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(414924..415352) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172605.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene ndk CDS 415836..416708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 note possible pseudo, frameshifted CDS 416696..417418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 note possible pseudo, frameshifted CDS 417432..418793 product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098287.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 418897..419766 product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098288.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene sseA CDS 419807..420595 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098289.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(420630..421424) product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098290.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene sseB CDS complement(421477..422784) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081828.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene pepB CDS complement(422999..423199) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523621.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene iscX CDS complement(423221..423556) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124466.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene fdx CDS complement(423558..425408) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172623.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene hscA CDS complement(425484..426002) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209833.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene hscB CDS complement(426074..426397) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209834.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene iscA CDS complement(426478..426864) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860661.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene iscU CDS complement(426889..428103) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775265.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene iscS CDS complement(428372..428866) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004707916.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene iscR CDS complement(428986..429711) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815777.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene trmJ CDS 429854..430657 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213305.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene suhB CDS 430830..431948 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166886.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS 431955..433037 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215451.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS 433034..433834 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161751.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(433959..434282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(434368..436035) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(436032..436208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(436481..437608) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527856.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(437727..438827) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081833.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(438818..439426) product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815775.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(439521..440681) product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815773.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(441053..442306) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919178.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 442666..443856 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370304.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 gene hmpA CDS 444225..445883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 445977..447083 product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209202.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(447262..447600) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231018.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 gene glnB CDS complement(447708..449045) product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene glrR CDS complement(449042..449824) product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211557.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene qseG CDS complement(449912..451291) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216114.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(452055..455942) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815763.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene purL CDS 456222..457667 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172712.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene mltF CDS complement(457708..458214) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050413802.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene tadA CDS complement(458296..458934) product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253562.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene yfhb CDS complement(458966..459892) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211565.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene murQ CDS 460047..460736 product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083022.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 460746..462698 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(462848..463192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(463252..472443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 note possible pseudo, frameshifted CDS complement(472406..476977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 note possible pseudo, frameshifted CDS 477360..478712 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464216.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS 478791..481025 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS 481012..482373 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(482418..483932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(484720..485355) product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013650597.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 gene pdeH CDS 485982..486242 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370294.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(486261..486641) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172734.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 gene acpS CDS complement(486641..487372) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815755.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene pdxJ CDS complement(487453..488190) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172741.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene recO CDS complement(488202..489107) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159414.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene era CDS complement(489104..489784) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860711.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene rnc CDS complement(490076..491041) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002542.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene lepB CDS complement(491058..492857) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172749.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene lepA CDS complement(493154..493606) product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209675.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene rseC CDS complement(493603..494565) product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098322.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 gene rseB CDS complement(494565..495212) product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209673.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 gene rseA CDS complement(495272..495847) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159396.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 gene rpoE CDS 496224..497825 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159392.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 gene nadB CDS complement(497882..498628) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098325.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS 498763..500088 product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209669.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene srmB CDS complement(500159..500542) product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166327.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene grcA CDS 500934..501620 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209663.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene ung tRNA complement(501784..501859) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(501907..501982) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 502264..503118 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533591.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(503187..504602) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815864.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene gltX tRNA 504894..504969 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 505023..505098 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 505154..505229 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA 505237..505312 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(505464..506570) product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919990.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 506942..507376 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170794.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(507457..508449) product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084237.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(508439..509320) product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380253.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene cysW CDS complement(509333..510145) product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401602.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene cysT CDS complement(510303..511313) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084243.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(511704..512924) product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929458.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 gene cdaR CDS complement(513094..514542) product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167236.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 gene degP CDS complement(514732..516243) product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209369.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene dgt CDS 516365..517063 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167232.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 gene mtnN CDS 517168..517896 product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175631671.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene btuF CDS 518129..518407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(518547..518894) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278668.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene erpA CDS 519162..520442 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704436.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene hemL CDS 520605..521228 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267729.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(521236..522702) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817442.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS 522838..523428 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050076557.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(523471..525489) product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209361.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene fhuB CDS complement(525482..526408) product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704434.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene fhuD CDS complement(526425..527222) product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158929.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 gene fhuC CDS complement(527565..530042) product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815593.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene mrcB CDS complement(530145..532607) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298481.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene hrpB CDS 532700..533230 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209356.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 gene thpR CDS 533268..533972 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298442.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene sfsA CDS 534241..534696 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007373199.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene dksA CDS 534825..535757 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228220.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene gluQRS CDS 535951..537309 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815589.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene pcnB CDS 537306..537839 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209351.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene folK CDS 537944..538741 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167163.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene panB CDS 538822..539676 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815587.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene panC CDS 539693..540073 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156780.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene panD CDS complement(540280..541050) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095617.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(541047..541985) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167154.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS 542123..542764 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651604.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene can CDS complement(542824..543360) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167149.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene hpt CDS 543510..543944 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(543945..545030) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277486.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(545035..546657) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262596.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 547147..547494 product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228215.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 547602..548465 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209338.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 gene speE CDS 548507..549301 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156788.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 gene speD CDS 550014..550253 product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815707.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS 550263..550670 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815706.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene nrdI CDS 550667..552829 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694643.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene nrdE CDS 552854..553816 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212211.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene nrdF tRNA complement(553938..554014) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(554187..554924) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077294168.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene dnaQ CDS 554980..555444 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210699.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 gene rnhA CDS 555929..556132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 556218..556973 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210697.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene gloB CDS 557044..558417 product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018127.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene mltD CDS complement(558485..559105) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095684.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 tRNA complement(559508..559584) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 rRNA complement(559640..559750) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA complement(559894..562797) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 tRNA complement(563015..563090) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(563133..563209) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 rRNA complement(563284..564821) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 CDS complement(565314..567890) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167451.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene clpB CDS complement(568024..568749) product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815687.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene yfiH CDS complement(568793..569770) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209470.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene rluD CDS 569905..570639 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209469.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 gene bamD CDS 570962..571300 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209468.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 gene raiA CDS 571649..572809 product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815647.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 gene pheA CDS complement(572891..574012) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225204.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene tyrA CDS complement(574019..575092) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167443.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS 575342..576058 product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815646.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 gene btsR CDS 576105..576452 product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098344.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS 576715..577653 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809215.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(577916..578263) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914145.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene rplS CDS complement(578326..579081) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393426.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene trmD CDS complement(579120..579668) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene rimM CDS complement(579687..579935) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209458.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene rpsP CDS complement(580093..581454) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167432.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene ffh CDS 581625..582419 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209455.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(582492..583007) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209453.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 gene luxS CDS complement(583161..584714) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209452.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene gshA CDS complement(584797..585225) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815644.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(585222..585788) product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167426.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 gene yqaB tRNA complement(586177..586253) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(586306..586382) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(586454..586530) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(586539..586631) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS complement(586925..587110) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209449.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 gene csrA CDS complement(587435..590062) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209448.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene alaS CDS complement(590201..590695) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167422.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene recX CDS complement(590741..591814) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209446.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene recA CDS complement(591922..592416) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132240.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene pncC CDS 592515..592703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(592649..592984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096037.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS 593465..593953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS 594036..594710 product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096626.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 594891..596489 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 596976..597611 product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780921.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene grxB CDS complement(597709..598047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(597986..598156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS complement(598237..598398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(598466..599425) product isocyanide synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707054.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(599913..600236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(600330..601067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(601185..601556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(601565..606676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(606697..607614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS complement(607611..608567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(608726..609505) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994131.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(609505..610875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS complement(610885..612921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(613118..613636) product type VI secretion system effector Hcp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705706.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 gene hcp1 CDS complement(614255..615610) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819810.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(615639..617075) product VasL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705726.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS complement(617128..620625) product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705725.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene tssM CDS complement(620650..622074) product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705724.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene tssA CDS complement(622086..622646) product type VI secretion system-associated protein VasI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705723.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene vasI CDS complement(622646..624184) product sigma-54-dependent transcriptional regulator VasH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705722.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene vasH CDS complement(624187..626784) product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705721.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene tssH CDS complement(626798..627574) product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634228.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 gene icmH CDS complement(627590..628927) product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705719.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene tssK CDS complement(628930..629451) product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705718.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 gene tssJ CDS complement(629451..630671) product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705717.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene tagH CDS complement(630674..631672) product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705716.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene tssG CDS complement(631636..633402) product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705715.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene tssF CDS complement(633405..633836) product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705714.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene tssE CDS complement(633842..635320) product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819811.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 gene tssC CDS complement(635353..635856) product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705712.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 gene tssB CDS 637066..637698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(637804..637962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(638351..640840) product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS complement(640849..641835) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 tRNA complement(642301..642376) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS 642903..643322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS complement(643631..644884) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032901182.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene proA CDS complement(644895..645998) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167536.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene proB CDS complement(646122..646496) product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174696.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene crl CDS complement(646611..648710) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071195.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(648722..650752) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071195.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 650925..651260 product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458871.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(651341..652588) product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208703.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 gene frsA CDS complement(652849..653307) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863205.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 gene gpt CDS 653638..655098 product beta-Ala-His dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167527.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene pepD CDS complement(655165..656223) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208708.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 gene dinB CDS complement(656299..657099) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522540.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 657329..658102 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816922.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS 658371..659105 product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208718.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene dpaA CDS complement(659076..659843) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208719.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS complement(660001..660582) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284051.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene lpcA CDS 660933..663380 product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214691.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene fadE CDS 663479..663829 product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974818.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene yajD CDS complement(663895..665097) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816942.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 gene mtnK CDS 665216..666250 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816943.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene mtnA CDS complement(666611..667156) product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167484.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(667153..667842) product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167481.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 gene mtnC CDS complement(667839..668456) product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167480.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 668637..669794 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816945.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS 669782..670549 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111965864.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(670577..671839) product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097219.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 gene hpxK CDS complement(671836..673080) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419062.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(673174..673917) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097221.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS complement(673898..674551) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208733.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(674551..675216) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705412.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(675229..676035) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446864.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(676641..677480) product MurR/RpiR family transcriptional regulator HpxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097225.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene hpxU CDS 677680..679266 product oxamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705415.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene hpxW CDS 679269..679490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 679487..680905 product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208739.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 680895..681281 product oxalurate catabolism protein HpxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097228.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 gene hpxZ CDS complement(681331..681723) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 682393..683595 product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173037.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene proV CDS 683588..684841 product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098424.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene proW CDS 684866..685873 product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370071.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene proX CDS complement(685933..687093) product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267724.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS 687252..688472 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298533.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS 688678..689409 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208742.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 689406..689735 product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208743.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene ygaH CDS 689925..690440 product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378431.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 gene mprA CDS 690714..691889 product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208745.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene emrA CDS 691907..693442 product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816951.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene emrB CDS 693648..694832 product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176010.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(694883..695317) product DUF3574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051944.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(695387..696538) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208747.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS 696788..697207 product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098330.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene trxC CDS 697354..698103 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208749.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS 698136..700784 product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208750.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 700982..702340 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018051.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene pssA CDS complement(702449..703441) product alpha-ketoglutarate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841107.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 gene kgtP rRNA complement(704034..704144) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 tRNA complement(704184..704259) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 rRNA complement(704281..704391) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 rRNA complement(704532..707435) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 tRNA complement(707665..707740) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 rRNA complement(707882..709419) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 CDS complement(709805..710368) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220062.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 gene gmhB CDS 710549..711580 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368136.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 gene metN CDS 711597..712226 product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856130.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 712291..713106 product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163992.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS 713225..713635 product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816957.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene rcsF CDS 713632..714348 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212157.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene tsaA CDS 714494..716212 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163997.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene proS CDS complement(716317..717312) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081550.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 gene rpoS CDS complement(717366..718400) product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209396.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 gene nlpD CDS complement(718747..719373) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167299.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(719513..720559) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815611.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 gene truD CDS complement(720650..721147) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209392.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 gene ispF CDS complement(721201..721914) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209391.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene ispD CDS complement(721918..722253) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167289.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 gene ftsB CDS 722585..723370 product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705157.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS 723504..724268 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705158.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 724246..724977 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705159.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(725038..725385) product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209389.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS complement(725429..726046) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209388.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 gene cysC CDS complement(726048..727538) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172666017.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene cysN CDS complement(727550..728458) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499613.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 gene cysD CDS complement(728468..729910) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209385.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene cysG CDS 730336..731715 product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075682.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 731851..732885 product HTH-type transcriptional regulator EutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753690.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 gene eutR CDS 733039..734076 product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642447.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 gene adhP CDS 734205..736349 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098116.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 gene pta CDS complement(736390..737124) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167272.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(737137..738870) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815605.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 gene cysI CDS complement(738870..740699) product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815604.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene cysJ CDS complement(740989..742713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS 743257..743997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS 744203..745885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703156.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(745968..747260) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210835.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS 747834..749168 product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703154.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 749263..749625 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010434567.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene queD CDS complement(749710..750390) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199961.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene queE CDS 750584..751567 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967956.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 751576..752322 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098620.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(752556..753695) product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989908.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(753739..755298) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096070.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(755600..756490) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524196.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 756660..758078 product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919715.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 758123..758803 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS complement(758891..759967) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965288.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS complement(759973..762168) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268707.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS complement(762624..763919) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164105.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene eno CDS complement(764018..765655) product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209376.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene pyrG CDS complement(765882..766694) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167245.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene mazG CDS complement(767084..769054) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167242.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 gene relA CDS complement(769033..769320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35650 note possible pseudo, frameshifted CDS complement(769374..770723) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167240.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 gene rlmD CDS 770841..773636 product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186405.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene barA CDS 773933..775219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35680 note possible pseudo, frameshifted CDS 775210..776370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35690 note possible pseudo, frameshifted CDS 776384..777010 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211603.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 gene dmsB CDS 777003..777779 product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544919.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 777831..778424 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112218.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 778637..778966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(779143..780288) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098521.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(780467..781351) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297159.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene garR CDS complement(781441..782211) product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098883.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 gene garL CDS complement(782281..783621) product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107119.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene gudD CDS complement(783658..785010) product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211789.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS complement(785752..787035) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703312.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS complement(787010..787243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS 787649..789223 product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273719.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 gene garD CDS 789934..791424 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210907.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 791593..792018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(792108..792314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS 792217..792576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(792669..792890) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213369.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(792895..794949) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172221.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene ligA CDS complement(795086..796522) product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817219.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene hldE CDS complement(796643..799498) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817220.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 gene glnE CDS complement(799551..800888) product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817221.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS 801210..801830 product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212196.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS 801940..803184 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817222.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS complement(803253..804071) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212198.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 gene bacA CDS complement(804219..804572) product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212199.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 gene folB CDS 804699..805334 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160822.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 gene plsY CDS complement(805389..806924) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815441.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS 807224..807754 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055075.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene ppa CDS complement(807874..808230) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156325.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS complement(808233..812270) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210167.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS complement(812267..813982) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046695507.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS 814441..815079 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175425.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 gene msrA CDS 815228..816556 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815438.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS complement(816633..816839) product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689229.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 817188..817757 product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815436.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(817776..818516) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220539.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 gene cysQ CDS 818721..820673 product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815434.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(820732..821115) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088578.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS 821306..821860 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179442.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(821932..822354) product DUF2502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815866.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS 822654..824321 product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081721.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS 824424..825089 product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210159.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 gene ytfE CDS complement(825165..825785) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156348.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS 826142..826855 product LysM-like peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815433.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS complement(826852..827214) product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164450.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS complement(827344..827796) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210156.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene rplI CDS complement(827838..828065) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210155.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 gene rpsR CDS complement(828070..828390) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210154.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 gene priB CDS complement(828396..828788) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004098001.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 gene rpsF CDS complement(828970..829722) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815429.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 gene yjfP CDS 830016..831956 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095297.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS 832194..833315 product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114117.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 833312..833935 product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602086.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 gene prfH CDS 834091..834360 product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368621.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene bsmA CDS complement(834464..834862) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547753.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS 835230..835508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 835484..835762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS complement(835819..836550) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209161.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 gene rlmB CDS complement(836655..839111) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815426.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 gene rnr CDS complement(839153..839578) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217229.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene nsrR CDS 839887..841458 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095343.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS 841988..843820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(843789..844805) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703454.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS 844826..845539 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173610.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 845628..846455 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817046.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene proC CDS 846504..847058 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157142.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 847055..847345 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277205.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene yggU CDS 847363..847956 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174735.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 847949..849091 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817047.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 gene hemW CDS 849332..849580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 849531..849869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(850021..851343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(851434..851619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS complement(852391..852846) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420256.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS complement(852867..854090) product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816987.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene lplT CDS complement(854087..856258) product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209843.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 gene aas CDS complement(857252..857725) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098560.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS complement(857728..858495) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098561.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(858630..858947) product lactose/cellobiose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990040.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS complement(858977..860413) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098562.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS complement(860438..861775) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098563.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS 862030..862374 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261351.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 862508..863521 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161798777.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(863575..864168) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368954.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS 864292..865248 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529130.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS complement(865245..866507) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209846.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 gene lysA CDS 866658..867581 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173367.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(867610..868530) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209849.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS 868638..869519 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209850.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 869507..870163 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816993.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 870326..870889 product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969473.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 870925..871218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS 871337..872119 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070651736.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 872286..872873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098290.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 873316..874338 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095060.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 gene dusA CDS 874504..874776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(875261..876559) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(876591..876788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(877029..878015) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209094.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS 878143..879549 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209095.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene dnaB CDS 879591..880673 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209096.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 gene alr CDS 880666..881304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 881558..882037 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967454.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 882280..882903 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464880.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 882968..884161 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209097.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS 884245..884742 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369584.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS 885014..885361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(885411..885620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS complement(885864..886292) product DUF1240 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209746.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS complement(886726..887583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 887668..887820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36800 repeat_region 887835..888702 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctatacggcagtgaac CDS 888998..889978 product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 gene cas1f CDS 889975..893271 product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 gene cas3f CDS 893295..894629 product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene csy1 CDS 894626..895558 product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene csy2 CDS 895572..896582 product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene csy3 CDS 896592..897146 product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene cas6f repeat_region 897276..897843 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgtataggcagcttagaaa CDS complement(897882..898091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36870 note possible pseudo, frameshifted CDS complement(898091..898300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36880 note possible pseudo, frameshifted CDS complement(898316..901150) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357724.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene uvrA CDS 901225..901419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS 901400..901942 product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168299.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene ssb1 CDS 902069..903064 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362338.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS complement(903243..904568) product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194527.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 gene cscA CDS complement(904678..905943) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703337.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 906279..906737 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168562.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 906799..907212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS 907409..908857 product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287699.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS 908871..909473 product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287700.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS complement(909935..910972) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047175.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS complement(910972..912024) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092773148.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(912033..913031) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393183.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS complement(913055..914146) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393211.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 gene ugpC CDS complement(914149..915255) product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973962.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(915257..917719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393207.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS 918173..919480 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393181.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 919477..920028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 920025..920930 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479072.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS 920941..922779 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969597.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 923362..924072 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816887.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 924072..924923 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816886.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 924965..925843 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816885.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 925951..926421 product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173494.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS complement(926449..927264) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096615.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS complement(927422..928402) product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705322.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS complement(928395..929714) product D-threonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783298.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 929959..931095 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234754.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 931135..932022 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096619.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 932087..933037 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814047.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 933101..934429 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769658.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS 934698..935951 product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096620.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 935955..937142 product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096621.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 937203..937670 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705316.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 937722..938411 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419408.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 938960..939904 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816034.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(939975..941165) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166809.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS 941470..941913 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166808.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS 941936..942223 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004714840.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 942238..943497 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815933.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS 943549..944217 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169909.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 gene fsa CDS complement(944318..944677) product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384314.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 gene yacL CDS complement(944881..947478) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095602.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 gene acnB CDS 947949..948431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS complement(948575..949378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS complement(949314..949568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 949829..950140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS complement(950246..952540) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019083965.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 952964..953947 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815581.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 954055..955383 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972972.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS complement(955516..957228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS complement(957342..958520) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(958688..959386) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095098.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS complement(959517..960701) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268090.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS complement(960698..961861) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113087.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 962012..962908 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113086.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(962971..964395) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102483.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 gene lpdA CDS complement(964610..966499) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095598.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 gene aceF CDS complement(966514..969177) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095597.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 gene aceE CDS complement(969319..970083) product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216080.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene pdhR CDS 970766..972124 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815579.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 972314..973747 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704413.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS 973722..974681 product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704412.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(974718..975572) product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209326.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 gene ampE CDS complement(975572..976144) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051592.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene ampD CDS 976649..977461 product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295827.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 gene tsx CDS 977606..978496 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209324.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 gene nadC CDS 978824..979270 product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360691.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 gene ppdD CDS 979273..980769 product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050163663.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 gene gspE CDS 980766..981971 product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209321.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 gene hofC CDS complement(982080..983120) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167093.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 983415..984041 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815573.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 gene coaE CDS 984034..984786 product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167091.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 gene zapD CDS 984861..985055 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856332.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 gene yacG CDS complement(985114..985509) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210424.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 gene mutT CDS complement(985599..988301) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905803.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 gene secA CDS complement(988414..988860) product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156845.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 gene secM CDS 988956..989483 product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210428.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS complement(989502..990419) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095578.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene lpxC CDS complement(990524..991675) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389003.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene ftsZ CDS complement(991744..993000) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210431.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene ftsA CDS complement(993054..993899) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167080.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene ftsQ CDS complement(993901..994821) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210432.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS complement(994830..996290) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815569.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene murC CDS complement(996353..997444) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210434.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 gene murG CDS complement(997441..998643) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156865.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 gene ftsW CDS complement(998643..999959) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167071.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene murD CDS complement(999963..1001045) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210437.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene mraY CDS complement(1001039..1002400) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815567.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene murF CDS complement(1002397..1003884) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785125.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 gene murE CDS complement(1003871..1005634) product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156878.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS complement(1005658..1005978) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156880.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 gene ftsL CDS complement(1005975..1006919) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815565.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 gene rsmH CDS complement(1006922..1007380) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210443.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene mraZ CDS 1008270..1008707 product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026017956.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(1008774..1009778) product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815563.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 gene cra CDS complement(1010047..1010538) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388986.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 gene ilvN CDS complement(1010541..1012259) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815562.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 gene ilvI CDS complement(1012621..1014348) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815561.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS 1014837..1016435 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095562.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene leuA CDS 1016435..1017526 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210454.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene leuB CDS 1017529..1018929 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167044.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 gene leuC CDS 1018943..1019545 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704393.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene leuD CDS complement(1019607..1019918) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088669.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(1019915..1020583) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207242.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(1020755..1021591) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207243.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS complement(1021805..1023424) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816624.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 1024125..1024364 product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817080.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 1024367..1024675 product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160966.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS complement(1024839..1025003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS 1025094..1026752 product HTH-type transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815554.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene sgrR CDS complement(1026803..1027732) product aromatic alcohol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814344.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS 1028017..1028922 product putative multidrug efflux transcriptional regulator CeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188318.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 gene ceoR CDS 1029241..1030257 product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214274.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene thiB CDS 1030221..1031840 product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051607.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 gene thiP CDS 1031827..1032537 product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051608.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 gene thiQ CDS complement(1032542..1034164) product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035406.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS 1034673..1036337 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298157.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 gene ilvB CDS 1036337..1036654 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211026.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 gene ilvN CDS complement(1036690..1037460) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156936.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS 1037813..1039471 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 1039585..1041951 product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815549.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 1042114..1045017 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167013.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 gene rapA CDS 1045443..1046096 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210485.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene rluA CDS complement(1046180..1047070) product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210486.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 gene djlA CDS 1047232..1049619 product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815546.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 gene lptD CDS 1049716..1051011 product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167006.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 gene surA CDS 1051011..1052012 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210489.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 gene pdxA CDS 1052005..1052823 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704372.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 gene rsmA CDS 1052836..1053213 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156966.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 gene apaG CDS 1053216..1054073 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815544.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 gene apaH CDS complement(1054114..1054308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(1054450..1054974) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836250.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS 1055085..1055990 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113148.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(1056073..1056555) product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080544.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 gene folA CDS complement(1056654..1057124) product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005180751.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(1057115..1057936) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210499.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 1058094..1058708 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166992.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS complement(1058806..1059174) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529579.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS complement(1059272..1059964) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971211.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 misc_feature complement(1060122..>1061612) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005166990.1:carbamoyl-phosphate synthase large subunit locus_tag LOCUS_38290 sequence3 source 1..432914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 1146..1222 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA 1264..1339 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 rRNA 1557..4458 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 rRNA 4599..4709 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 tRNA 4765..4841 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA 4896..4971 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 CDS 5411..6367 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162730.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS 6558..8078 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212023.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS 8065..9075 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176101.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 9075..10037 product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815317.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 gene yjfF CDS complement(10059..10898) product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176097.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 gene hdfR CDS 11007..11345 product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162718.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS complement(11403..12929) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212018.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 13657..15222 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212017.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 gene ilvG CDS 15301..15561 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176090.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 gene ilvM CDS 15587..16513 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176088.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS 16587..18437 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127404.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 gene ilvD CDS 18437..19987 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176085.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 gene ilvA CDS 20093..20836 product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(20855..21655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS complement(21652..22581) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176081.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 gene ilvY CDS 22710..24188 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176079.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 gene ilvC CDS complement(24260..24922) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 25024..25911 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388220.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS complement(25955..27421) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211164.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 gene putP CDS 27636..31604 product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211162.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 gene putA CDS complement(31697..31978) product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004704164.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene ppiC CDS 32139..34160 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211993.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 gene rep CDS complement(34181..35677) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032900842.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene ppx CDS complement(35684..36973) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228177.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 gene rhlB CDS 37092..37418 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene trxA CDS 37913..39172 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054528.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene rho CDS 39394..40476 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176219.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene wecA CDS 40498..41544 product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080212.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene wzzE CDS 41612..42742 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176215.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene wecB CDS 42855..44117 product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815329.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene wecC CDS 44114..45181 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216798.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 gene rffG CDS 45219..45950 product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848112.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene rffC CDS 45955..47085 product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612043.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene rffA CDS 47087..48337 product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176202.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene wzxE CDS 48334..49419 product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815333.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS 49416..50804 product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815334.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene wzyE CDS 50801..51550 product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211977.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 gene wecG CDS 51857..53248 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220976.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 tRNA 53388..53464 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA 53586..53661 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA 53704..53790 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA 53833..53909 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 CDS complement(54033..55340) product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703371.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS 55588..56952 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345327.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 gene purB CDS 56962..57504 product sulfur-containing aminoacid acetyltransferase SnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242734.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene snaB CDS 57501..58292 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227109.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS 58439..59122 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243465.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS 59132..59893 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243284.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS 59971..61128 product N-acetyl-sulfur-metabolite deacetylase SndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243840.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 gene sndB CDS complement(61811..63010) product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815337.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene hemY CDS complement(63007..64137) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176188.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 gene hemX CDS complement(64161..64901) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815338.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 gene hemD CDS complement(64898..65839) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211465.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 gene hemC CDS complement(66021..66206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS 66321..68735 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815339.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS 68782..69954 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037154163.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS complement(69989..70309) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211469.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 gene cyaY CDS 70369..70554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 70632..71456 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160654.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 gene dapF CDS 71453..72157 product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176169.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS 72154..73089 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211473.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 gene xerC CDS 73089..73805 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099256.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 gene yigB CDS 73886..76048 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383400.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 gene uvrD CDS 76193..76939 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485222.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 77350..78300 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166238.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 gene corA CDS 78489..79547 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122050.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(79513..80442) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211481.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 gene rarD CDS complement(80545..80985) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211482.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 81303..82175 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211483.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 gene pldA CDS 82324..84150 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211484.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 gene recQ CDS 84193..84816 product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176129.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 gene rhtC CDS complement(84886..85506) product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176125.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 gene rhtB CDS 85637..86674 product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176123.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 gene pldB CDS 86777..87577 product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099247.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 gene yigL CDS complement(87650..88717) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098017.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 gene glpQ CDS complement(88793..90142) product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098018.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 gene glpT CDS complement(90315..90500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 90454..92124 product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815350.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 gene glpA CDS 92114..93376 product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211492.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 gene glpB CDS 93373..94584 product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211493.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 gene glpC CDS 94952..95647 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174799.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS 95866..96804 product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209514.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 gene gntR CDS complement(96814..97326) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174793.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS 97485..98861 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478622.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS complement(99309..99893) product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209508.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 100202..101305 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174790.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 gene asd CDS 101409..101894 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS complement(101974..103692) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174778.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS 104079..106256 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174776.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 gene glgB CDS 106257..108233 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174773.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 gene glgX CDS 108269..109546 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817364.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene glgC CDS 109575..111014 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197646.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 gene glgA CDS 111090..113537 product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209497.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 gene glgP CDS complement(113627..115126) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174768.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 gene glpD CDS 115447..115770 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208928.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 gene glpE CDS 115839..116672 product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174723.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 gene glpG CDS 116697..117455 product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157500.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS 117498..120020 product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817356.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 gene malP CDS 120033..122117 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817357.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 gene malQ CDS complement(122187..122762) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159611.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 gene nfuA CDS complement(122823..123314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 123608..124375 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817359.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 gene bioH CDS 124557..127673 product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263083.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 gene acrD CDS 127820..128434 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929111.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 128541..129524 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533329.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 129649..131394 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389044.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS 131407..131886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389045.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS 131895..132587 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389046.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS 132584..134023 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389047.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS 134417..135151 product LuxR family transcriptional regulator YenR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170826.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 gene yenR CDS 135333..136844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS 136847..137599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS 137614..138435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS 138490..139620 product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS 139620..139898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 139892..140758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 140748..141281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 141278..141832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS complement(141926..142975) product asparaginase AnsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246337.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 gene ansZ CDS complement(143278..144114) product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210829.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 gene kduI CDS complement(144127..145083) product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166063.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 gene kdgT CDS complement(145437..146225) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894191.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS complement(146448..148781) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703676.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS 149127..150413 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210721.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(150473..152140) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536557.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS complement(152230..152466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(152604..154307) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704534.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS 154481..154960 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458979.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 gene greB CDS complement(155046..155927) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925778.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 156178..158079 product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255482.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 158079..158288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS 158308..160374 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209600593.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 160416..161819 product Y4yA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002161.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS 161833..162849 product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877081.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS 162860..163279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39600 note possible pseudo, internal stop codon, frameshifted CDS 163288..164031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39610 note possible pseudo, frameshifted CDS 164092..165342 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255481.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS 165335..166495 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050577584.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 166564..166974 product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877438.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS 167338..168057 product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 gene ompR CDS 168057..169415 product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174760.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 gene envZ CDS complement(169494..169874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39670 note possible pseudo, frameshifted CDS complement(169849..171114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39680 note possible pseudo, frameshifted CDS complement(171312..172181) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703666.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 gene hslO CDS complement(172297..172707) product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159667.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 gene hslR CDS complement(172826..173512) product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208909.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 gene yrfG CDS complement(173630..175777) product intracellular growth attenuator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817351.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS 176015..176197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS 176216..176773 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208907.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 gene nudE CDS 177005..178429 product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918393.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS complement(178521..181076) product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817350.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 gene mrcA CDS 181188..182039 product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208905.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 gene pilM CDS 182042..182611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 182604..183188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS 183185..183562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 183613..183765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS 183755..184936 product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208900.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 gene hofQ CDS 185288..185809 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391482.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 gene aroK CDS 185945..186946 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174702.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 gene aroB CDS 187112..188128 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208897.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS 188208..189020 product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174698.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 gene dam CDS 189133..189810 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369389.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 gene rpe CDS 189803..190507 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208892.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS 190504..191508 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099067.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 gene trpS CDS complement(191584..193041) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385764.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS complement(193136..194005) product nopaline ABC transporter substrate-binding protein NocT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891637.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 gene nocT CDS complement(194082..194846) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262157.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS complement(194843..195577) product nopaline ABC transporter permease NocM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523894.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene nocM CDS complement(195577..196293) product nopaline ABC transporter permease NocQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891638.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 gene nocQ CDS complement(196781..198160) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349881.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 gene cysG CDS complement(198187..198555) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208887.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 gene nirD CDS complement(198552..201104) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817340.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 gene nirB CDS 201714..202895 product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010210634.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS 202995..204605 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104458.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS 204737..205777 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010220797.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS 205774..206697 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245922.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS 206732..207556 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104459.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS 207568..208377 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104460.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 208573..209145 product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477225.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 gene ppiA CDS complement(209232..210509) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS complement(210686..211810) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037941.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS complement(212521..213648) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037941.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS complement(214317..215441) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037941.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS 216294..216548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS 216902..217477 product aminodeoxychorismate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174674.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS 217597..218823 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174672.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(219046..219678) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 gene crp CDS 220053..220460 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212298.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS complement(220574..221443) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212300.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS complement(221567..221803) product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369405.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS complement(221800..222840) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174664.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS 222947..223549 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174663.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS complement(223616..225523) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174650.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS 225649..226200 product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081510.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 gene kefG CDS 226202..228013 product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212314.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 gene kefB CDS 228026..228232 product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159805.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS 228353..228937 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861345.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 gene slyD CDS complement(229054..229272) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212317.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS 229555..230373 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174645.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 gene fkpA CDS complement(230511..232004) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388898.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS 232108..232920 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 232953..234221 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073318.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS complement(234295..235389) product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210182.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 gene pmrB CDS complement(235386..236054) product two-component system response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098925.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 gene pmrA CDS complement(236051..237679) product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602647.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 gene eptA CDS 237875..238597 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212319.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS 238597..238986 product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817322.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 gene tusD CDS 238996..239355 product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212321.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 gene tusC CDS 239373..239660 product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903373.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 gene tusB CDS 239792..240166 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212323.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 gene rpsL CDS 240263..240733 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212324.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 gene rpsG CDS 240830..242944 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099032.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene fusA CDS 243014..244198 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094997.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 gene tuf CDS 244403..244597 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817319.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 gene bfd CDS 244670..245143 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675504.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 gene bfr CDS complement(245170..245325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS 245448..245759 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 gene rpsJ CDS 245792..246421 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579833.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 gene rplC CDS 246432..247037 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174626.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 gene rplD CDS 247034..247336 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617546.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 gene rplW CDS 247354..248175 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213425.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 gene rplB CDS 248192..248470 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138115.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 gene rpsS CDS 248485..248817 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223844.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 gene rplV CDS 248835..249536 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 gene rpsC CDS 249549..249959 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919759.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 gene rplP CDS 249959..250150 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218942.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 gene rpmC CDS 250150..250404 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 gene rpsQ CDS 250518..250937 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613954.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 gene rplN CDS 250948..251262 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391420.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 gene rplX CDS 251277..251816 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096200.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 gene rplE CDS 251830..252135 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213330.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 gene rpsN CDS 252169..252561 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213332.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 gene rpsH CDS 252574..253107 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159860.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 gene rplF CDS 253117..253470 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358960.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 gene rplR CDS 253485..253985 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940115.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 gene rpsE CDS 253985..254170 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140434.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 gene rpmD CDS 254174..254608 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369426.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 gene rplO CDS 254616..255947 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213344.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 gene secY CDS 256244..256600 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213346.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 gene rpsM CDS 256617..257006 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003031137.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 gene rpsK CDS 257037..257657 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218949.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 gene rpsD CDS 257683..258672 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438685.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 gene rpoA CDS 258713..259105 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391407.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 gene rplQ CDS 259313..259525 product alternative ribosome-rescue factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174609.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS complement(259556..259969) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022450.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 gene mscL CDS complement(260061..261437) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209018.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 gene trkA CDS complement(261494..262783) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215705.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 gene rsmB CDS complement(262851..263570) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209020.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 gene fmt CDS complement(263822..264334) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099013.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 gene def CDS 264490..265584 product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209022.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 gene dprA CDS 265556..266029 product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369440.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 gene smg CDS 266050..266607 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369441.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS 266600..267169 product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174593.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 gene tsaC CDS 267189..268016 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174590.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 gene aroE CDS 268013..268270 product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070570.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS complement(268255..268803) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174588.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 rRNA 269311..270848 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 tRNA 270990..271065 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 rRNA 271295..274197 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 rRNA 274341..274451 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 CDS 274692..275621 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212076.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 gene metA CDS 275904..277502 product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704021.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 gene aceB CDS 277534..278841 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212078.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 gene aceA CDS 278891..280687 product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174579.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 gene aceK CDS complement(280940..281770) product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174577.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 gene iclR CDS 281964..285647 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817311.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 gene metH CDS 286195..287151 product ferrioxamine uptake transcriptional regulator FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074609.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 gene foxR CDS 287343..289448 product ferrioxamine B receptor FoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127727.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 gene foxA CDS complement(289520..290974) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818491.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS 291263..292909 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956807.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS complement(292950..294326) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849837.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 gene lysC CDS 294807..296456 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817308.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 gene pgi CDS 296500..296844 product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175566.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS complement(296907..297914) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815416.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 gene epmB CDS 298001..298567 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257282.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 gene efp CDS complement(299383..299967) product outer membrane lipoprotein Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175561.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 gene blc CDS complement(300091..300447) product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609663.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 gene frdD CDS complement(300462..300860) product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208763.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 gene frdC CDS complement(300871..301608) product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175554.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS complement(301601..303397) product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815417.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 gene frdA CDS 303872..304849 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209139.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 gene epmA CDS complement(304901..308224) product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080723.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 gene mscM CDS complement(308281..309309) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095278.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 gene asd CDS complement(309454..310503) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041976.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 gene rsgA CDS 310687..311229 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704162.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 gene orn tRNA 311446..311521 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 tRNA 311598..311673 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 CDS 312134..312679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(312731..313366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS complement(313353..313535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS 313709..313906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS 314175..315314 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268090.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS 315311..316006 product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875906.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS complement(316131..316460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS complement(316429..316716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS complement(316851..318566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS 318844..319863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS 319879..320643 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS 320640..321458 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530817.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS complement(321529..322695) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446417.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS complement(322714..323604) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114007.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS 323850..324467 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114008.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 324775..325824 product NADPH-dependent aldehyde reductase YahK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692754.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 gene yahK CDS 326029..326571 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209691.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS 326576..328633 product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209690.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS 328701..330407 product DUF6138 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494815.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS 330477..331403 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267100.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS 331625..333103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41270 tRNA 333403..333478 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 CDS 333704..335038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS complement(335044..335346) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114194633.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS complement(335416..335679) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114194633.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS 335785..336030 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS complement(337213..338517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS 339696..340016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS 340104..340739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS complement(341124..341285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS 341657..342358 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112804.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS 342351..343598 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112805.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS 343591..345057 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103137.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS 345050..346315 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112807.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS complement(346481..347278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463848.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS complement(347376..347828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS 348351..350000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS 350111..350674 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501015.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 gene ahpC CDS 350802..352364 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887645.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 gene ahpF CDS complement(352893..354074) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815421.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 gene queG CDS 354179..355744 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815422.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 gene nnr CDS 355750..356232 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 gene tsaE CDS 356229..357899 product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232017.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 gene amiB CDS 357951..359960 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209148.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 gene mutL CDS 359953..360894 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175510.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 gene miaA CDS 361008..361307 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209151.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 gene hfq CDS 361402..362682 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209152.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 gene hflX CDS 362779..364038 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095289.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 gene hflK CDS 364042..365037 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156425.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 gene hflC CDS 365162..365362 product DUF2065 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175502.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 CDS 365450..366760 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175500.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(366870..368255) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210171.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 gene mpl CDS 368425..369429 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216946.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 gene fbp CDS complement(369512..369931) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157116.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 gene ruvX CDS complement(369931..370494) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817044.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS complement(370578..371537) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209976.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 gene gshB CDS complement(371549..372283) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369736.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 gene rsmE CDS complement(372401..373099) product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173574.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 gene endA CDS complement(373196..373666) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173572.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS complement(373831..374982) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004149807.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 gene metK CDS 375541..375699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS 375692..377674 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209969.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 gene speA CDS complement(377734..377928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS complement(378955..379707) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209967.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS 380118..382112 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209965.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 gene tkt CDS 382427..383443 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209964.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 gene epd CDS 383516..384679 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209963.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 gene pgk CDS 384817..385893 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004144748.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 gene fbaA CDS 386029..386889 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817032.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 gene mscS CDS 387093..387707 product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626880.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 gene argO CDS 387911..388651 product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173525.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(388757..389650) product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163344.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS 389891..390550 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209957.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 gene rpiA CDS 390845..392077 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703434.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 gene serA CDS complement(392132..393133) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815524.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS 393270..394178 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166937.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS 394433..396136 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816624.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS complement(396216..397883) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095500.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 gene ettA CDS 398229..398831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41840 note possible pseudo, frameshifted CDS 398804..400165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41850 note possible pseudo, frameshifted CDS 400238..400585 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815529.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 gene trpR CDS complement(400589..401128) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815530.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 gene yjjX CDS 401179..401829 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704328.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 gene gpmB CDS complement(401818..402705) product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166950.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 gene robA CDS 402928..403392 product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368367.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 gene creA CDS complement(403449..404165) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004706052.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 gene arcA CDS 404917..405603 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223164.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS 406029..408488 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209237.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 gene thrA CDS 408491..409420 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166953.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 gene thrB CDS 409424..410713 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209239.1 transl_table 11 codon_start 1 locus_tag LOCUS_41950 gene thrC CDS complement(410897..411670) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906193.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 gene yaaA CDS 411974..412927 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157047.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 gene tal CDS complement(413004..414092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS 414482..415069 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166957.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 gene mog CDS 415193..416530 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815535.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS complement(416645..417220) product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815537.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 gene satP CDS 417703..419610 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815538.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 gene dnaK CDS 419719..420855 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118476.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 gene dnaJ CDS 421139..422335 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220711.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 gene nhaA CDS 422368..423282 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062880.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 gene nhaR CDS complement(423320..423583) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220715.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 gene rpsT CDS 424009..424950 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210510.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 gene ribF CDS 424982..427795 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210509.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 gene ileS CDS 427795..428307 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083385.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 gene lspA CDS 428307..428780 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228112.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 gene fkpB CDS 428761..429711 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210506.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 gene ispH CDS 430051..430872 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704365.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 gene dapB CDS 431318..432466 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166988.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 gene carA sequence4 source 1..74941 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42140 note possible pseudo, internal stop codon, frameshifted CDS complement(384..548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42150 note possible pseudo, frameshifted CDS complement(694..915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42160 note possible pseudo, frameshifted CDS complement(1000..1476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42170 note possible pseudo, frameshifted CDS complement(1478..1759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42180 note possible pseudo, frameshifted CDS complement(1950..2993) product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815292.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 gene cytR CDS complement(3302..5314) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815293.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 gene priA CDS 5775..5990 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216737.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 gene rpmE CDS complement(6087..6497) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552310.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS complement(6525..6704) product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893919.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 CDS complement(6788..7798) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033652390.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS complement(7795..8757) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705828.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS complement(8767..9564) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040904057.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS complement(9798..10115) product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392248.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 gene metJ CDS 10303..11463 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368924.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 gene metB CDS 11466..13901 product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208934.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS 14357..15253 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815297.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 gene metF CDS 15877..16785 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099297.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 gene oxyR CDS complement(16777..18183) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209477.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 gene sthA CDS 18396..19025 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470429.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 gene fabR CDS 19061..19447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS complement(19490..20593) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209474.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 gene trmA CDS 21022..22899 product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228170.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 gene btuB CDS 22844..23701 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201804.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 gene murI rRNA 24085..25622 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00190 tRNA 25764..25839 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 rRNA 26069..28972 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00200 rRNA 29116..29226 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00210 CDS 29276..30421 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016661.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 gene murB CDS 30418..31377 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654624.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 gene birA CDS complement(31416..32366) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165813.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 gene coaA CDS complement(32578..33126) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815380.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 tRNA 33458..33533 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA 33548..33631 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 tRNA 33763..33837 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 tRNA 33844..33919 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 CDS 34027..35211 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094997.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 gene tuf CDS 35449..35832 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210670.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 gene secE CDS 35834..36379 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862341.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 gene nusG CDS 36542..36970 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210672.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 gene rplK CDS 36974..37678 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095000.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 gene rplA CDS 37995..38492 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207203.1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 gene rplJ CDS 38559..38924 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028882.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 gene rplL CDS 39252..43280 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263103.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 gene rpoB CDS 43387..47610 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175699.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 gene rpoC CDS 47861..49258 product shikimate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706015.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 gene shiA CDS complement(49355..49546) product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394280.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS 49720..51156 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095421.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS complement(51436..52557) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210678.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 gene thiH CDS complement(52557..53339) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815385.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS complement(53341..53541) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815386.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 gene thiS CDS complement(53538..54317) product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815387.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS complement(54319..54960) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849921.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 gene thiE CDS complement(54957..56912) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298956.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 gene thiC CDS complement(57304..57765) product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934311.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 gene rsd CDS 57874..58656 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166081.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 gene nudC CDS 58805..59869 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137652.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 gene hemE CDS 59885..60574 product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362359.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 gene nfi CDS 60652..61242 product DUF416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166074.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS 61447..61719 product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166072.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 gene hupA CDS 61811..62410 product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355296.1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS complement(62482..63768) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210691.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 gene purD CDS complement(63786..65375) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095020.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 gene purH rRNA 65982..67519 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00220 tRNA 67594..67670 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 tRNA 67713..67788 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 rRNA 68006..70908 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00230 rRNA 71049..71159 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00240 tRNA 71215..71290 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 tRNA 71346..71421 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 CDS 71862..72194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42690 note possible pseudo, frameshifted CDS 72224..72820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42700 note possible pseudo, frameshifted CDS 73011..73532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42710 note possible pseudo, frameshifted CDS 73510..73662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42720 note possible pseudo, frameshifted CDS 73673..73834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42730 note possible pseudo, frameshifted CDS 73934..74152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42740 note possible pseudo, internal stop codon, frameshifted CDS 74526..74684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42750 note possible pseudo, frameshifted sequence5 source 1..9979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 57..236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS complement(462..1304) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298879.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS complement(1525..2856) product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175854.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 gene hslU CDS complement(2866..3396) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368930.1 transl_table 11 codon_start 1 locus_tag LOCUS_42790 gene hslV CDS complement(3480..4238) product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815291.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 gene ftsN CDS complement(4429..5472) product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815292.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 gene cytR CDS complement(5781..7706) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815293.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 gene priA CDS complement(7787..7981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42830 note possible pseudo, frameshifted CDS complement(9496..9831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42840 note possible pseudo, internal stop codon, frameshifted sequence6 source 1..6002 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(236..853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42850 note possible pseudo, frameshifted CDS 1424..1663 product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208953.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 gene zapB CDS complement(1782..2267) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208945.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 gene rraA CDS complement(2402..3319) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298879.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS complement(3464..4795) product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175854.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 gene hslU CDS complement(4805..5335) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368930.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 gene hslV CDS complement(5478..5909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42910 note possible pseudo, frameshifted sequence7 source 1..3839 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@