>Feature sequence001 1598 897 gene locus_tag LOCUS_00010 1598 897 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550362.1 protein_id gnl|my_center|LOCUS_00010 1728 3050 gene locus_tag LOCUS_00020 gene hemN 1728 3050 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089823.1 protein_id gnl|my_center|LOCUS_00020 3088 3729 gene locus_tag LOCUS_00030 3088 3729 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036975.1 protein_id gnl|my_center|LOCUS_00030 5324 3726 gene locus_tag LOCUS_00040 5324 3726 CDS product amino acid ABC transporter ATP-binding/permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918646.1 protein_id gnl|my_center|LOCUS_00040 6958 5321 gene locus_tag LOCUS_00050 gene cydD 6958 5321 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918647.1 protein_id gnl|my_center|LOCUS_00050 7083 8633 gene locus_tag LOCUS_00060 7083 8633 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918648.1 protein_id gnl|my_center|LOCUS_00060 8647 9786 gene locus_tag LOCUS_00070 gene cydB 8647 9786 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918649.1 protein_id gnl|my_center|LOCUS_00070 9975 10685 gene locus_tag LOCUS_00080 gene fnrL 9975 10685 CDS product Crp/Fnr family transcriptional regulator FnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720880.1 protein_id gnl|my_center|LOCUS_00080 11280 10744 gene locus_tag LOCUS_00090 11280 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12401 11364 gene locus_tag LOCUS_00100 12401 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12588 14099 gene locus_tag LOCUS_00110 12588 14099 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921409.1 protein_id gnl|my_center|LOCUS_00110 14169 15203 gene locus_tag LOCUS_00120 gene adhP 14169 15203 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198321.1 protein_id gnl|my_center|LOCUS_00120 15254 16768 gene locus_tag LOCUS_00130 15254 16768 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921551.1 protein_id gnl|my_center|LOCUS_00130 16802 17341 gene locus_tag LOCUS_00140 16802 17341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17855 17514 gene locus_tag LOCUS_00150 17855 17514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19480 17900 gene locus_tag LOCUS_00160 19480 17900 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919439.1 protein_id gnl|my_center|LOCUS_00160 22148 19500 gene locus_tag LOCUS_00170 22148 19500 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057218.1 protein_id gnl|my_center|LOCUS_00170 22699 22388 gene locus_tag LOCUS_00180 22699 22388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339036.1 protein_id gnl|my_center|LOCUS_00180 25143 22696 gene locus_tag LOCUS_00190 gene ctaD 25143 22696 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339037.1 protein_id gnl|my_center|LOCUS_00190 25949 25140 gene locus_tag LOCUS_00200 25949 25140 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640905.1 protein_id gnl|my_center|LOCUS_00200 25839 26363 gene locus_tag LOCUS_00210 25839 26363 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004192.1 protein_id gnl|my_center|LOCUS_00210 26842 26333 gene locus_tag LOCUS_00220 26842 26333 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339039.1 protein_id gnl|my_center|LOCUS_00220 27549 26839 gene locus_tag LOCUS_00230 27549 26839 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383492.1 protein_id gnl|my_center|LOCUS_00230 27730 28737 gene locus_tag LOCUS_00240 27730 28737 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035337.1 protein_id gnl|my_center|LOCUS_00240 28730 30034 gene locus_tag LOCUS_00250 28730 30034 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112837.1 protein_id gnl|my_center|LOCUS_00250 30142 30046 gene locus_tag LOCUS_t00010 30142 30046 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 32320 30077 gene locus_tag LOCUS_00260 32320 30077 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081570352.1 protein_id gnl|my_center|LOCUS_00260 32593 32429 gene locus_tag LOCUS_00270 32593 32429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32667 32741 gene locus_tag LOCUS_t00020 32667 32741 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 32863 34155 gene locus_tag LOCUS_00280 32863 34155 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640148.1 protein_id gnl|my_center|LOCUS_00280 34227 36338 gene locus_tag LOCUS_00290 34227 36338 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042487594.1 protein_id gnl|my_center|LOCUS_00290 36862 38343 gene locus_tag LOCUS_00300 36862 38343 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971436.1 protein_id gnl|my_center|LOCUS_00300 38403 39404 gene locus_tag LOCUS_00310 38403 39404 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105702.1 protein_id gnl|my_center|LOCUS_00310 39401 40321 gene locus_tag LOCUS_00320 39401 40321 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927237.1 protein_id gnl|my_center|LOCUS_00320 41070 40231 gene locus_tag LOCUS_00330 41070 40231 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918939.1 protein_id gnl|my_center|LOCUS_00330 43351 41633 gene locus_tag LOCUS_00340 43351 41633 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 protein_id gnl|my_center|LOCUS_00340 43454 46093 gene locus_tag LOCUS_00350 gene pepN 43454 46093 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920339.1 protein_id gnl|my_center|LOCUS_00350 47151 46219 gene locus_tag LOCUS_00360 47151 46219 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921651.1 protein_id gnl|my_center|LOCUS_00360 47723 47358 gene locus_tag LOCUS_00370 47723 47358 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086810.1 protein_id gnl|my_center|LOCUS_00370 48381 47710 gene locus_tag LOCUS_00380 48381 47710 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_00380 49880 48435 gene locus_tag LOCUS_00390 49880 48435 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114902.1 protein_id gnl|my_center|LOCUS_00390 52032 49855 gene locus_tag LOCUS_00400 52032 49855 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114020.1 protein_id gnl|my_center|LOCUS_00400 52401 52826 gene locus_tag LOCUS_00410 52401 52826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 53088 52882 gene locus_tag LOCUS_00420 53088 52882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 53958 53089 gene locus_tag LOCUS_00430 53958 53089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970517.1 protein_id gnl|my_center|LOCUS_00430 54461 54093 gene locus_tag LOCUS_00440 54461 54093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 54815 54495 gene locus_tag LOCUS_00450 54815 54495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 >Feature sequence002 943 164 gene locus_tag LOCUS_00460 943 164 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037280.1 protein_id gnl|my_center|LOCUS_00460 1629 1054 gene locus_tag LOCUS_00470 1629 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 2685 1816 gene locus_tag LOCUS_00480 gene phhA 2685 1816 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919486.1 protein_id gnl|my_center|LOCUS_00480 2760 3395 gene locus_tag LOCUS_00490 2760 3395 CDS product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938028.1 protein_id gnl|my_center|LOCUS_00490 3392 4108 gene locus_tag LOCUS_00500 3392 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 4386 4087 gene locus_tag LOCUS_00510 4386 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 5417 4401 gene locus_tag LOCUS_00520 5417 4401 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921105.1 protein_id gnl|my_center|LOCUS_00520 5514 6050 gene locus_tag LOCUS_00530 5514 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 6047 7030 gene locus_tag LOCUS_00540 6047 7030 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339125.1 protein_id gnl|my_center|LOCUS_00540 7035 9275 gene locus_tag LOCUS_00550 7035 9275 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339126.1 protein_id gnl|my_center|LOCUS_00550 9275 10198 gene locus_tag LOCUS_00560 9275 10198 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_00560 10185 10808 gene locus_tag LOCUS_00570 gene pucB 10185 10808 CDS product xanthine dehydrogenase accessory protein PucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228645.1 protein_id gnl|my_center|LOCUS_00570 11982 10777 gene locus_tag LOCUS_00580 11982 10777 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069319778.1 protein_id gnl|my_center|LOCUS_00580 12716 11982 gene locus_tag LOCUS_00590 12716 11982 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 protein_id gnl|my_center|LOCUS_00590 14088 12703 gene locus_tag LOCUS_00600 14088 12703 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924854.1 protein_id gnl|my_center|LOCUS_00600 15563 14088 gene locus_tag LOCUS_00610 15563 14088 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_00610 17678 15681 gene locus_tag LOCUS_00620 17678 15681 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140126.1 protein_id gnl|my_center|LOCUS_00620 18874 17870 gene locus_tag LOCUS_00630 gene bioB 18874 17870 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921350.1 protein_id gnl|my_center|LOCUS_00630 21153 18889 gene locus_tag LOCUS_00640 gene scpA 21153 18889 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976251.1 protein_id gnl|my_center|LOCUS_00640 21976 21218 gene locus_tag LOCUS_00650 21976 21218 CDS product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919717.1 protein_id gnl|my_center|LOCUS_00650 22404 21985 gene locus_tag LOCUS_00660 gene mce 22404 21985 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919799.1 protein_id gnl|my_center|LOCUS_00660 22970 22401 gene locus_tag LOCUS_00670 22970 22401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 24521 22995 gene locus_tag LOCUS_00680 24521 22995 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_00680 24744 24532 gene locus_tag LOCUS_00690 24744 24532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 25741 24809 gene locus_tag LOCUS_00700 25741 24809 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383598.1 protein_id gnl|my_center|LOCUS_00700 26468 25731 gene locus_tag LOCUS_00710 26468 25731 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_00710 >Feature sequence003 89 1117 gene locus_tag LOCUS_00720 89 1117 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135179749.1 protein_id gnl|my_center|LOCUS_00720 >Feature sequence004 69 1580 gene locus_tag LOCUS_00730 gene istA 69 1580 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128955176.1 protein_id gnl|my_center|LOCUS_00730 1594 2295 gene locus_tag LOCUS_00740 gene istB 1594 2295 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090918.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00740 >Feature sequence005 149 73 gene locus_tag LOCUS_t00030 149 73 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 379 271 gene locus_tag LOCUS_r00010 379 271 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3304 533 gene locus_tag LOCUS_r00020 3304 533 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3687 3612 gene locus_tag LOCUS_t00040 3687 3612 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3774 3698 gene locus_tag LOCUS_t00050 3774 3698 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 5473 3988 gene locus_tag LOCUS_r00030 5473 3988 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence006 1265 42 gene locus_tag LOCUS_00750 1265 42 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066842340.1 protein_id gnl|my_center|LOCUS_00750 >Feature sequence007 1079 132 gene locus_tag LOCUS_00760 1079 132 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164736349.1 protein_id gnl|my_center|LOCUS_00760 >Feature sequence008 172 1443 gene locus_tag LOCUS_00770 172 1443 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014066.1 protein_id gnl|my_center|LOCUS_00770 >Feature sequence009 >Feature sequence010 >Feature sequence011 >Feature sequence012 76 474 gene locus_tag LOCUS_00780 76 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00780 408 830 gene locus_tag LOCUS_00790 408 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00790 >Feature sequence013 3627 322 gene locus_tag LOCUS_00800 3627 322 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414323.1 protein_id gnl|my_center|LOCUS_00800 3810 4592 gene locus_tag LOCUS_00810 3810 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 6258 4582 gene locus_tag LOCUS_00820 6258 4582 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918343.1 protein_id gnl|my_center|LOCUS_00820 6443 8875 gene locus_tag LOCUS_00830 6443 8875 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918342.1 protein_id gnl|my_center|LOCUS_00830 8991 9860 gene locus_tag LOCUS_00840 8991 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 10866 10168 gene locus_tag LOCUS_00850 10866 10168 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265853.1 protein_id gnl|my_center|LOCUS_00850 11584 10898 gene locus_tag LOCUS_00860 11584 10898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 14276 11691 gene locus_tag LOCUS_00870 14276 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 14408 14860 gene locus_tag LOCUS_00880 14408 14860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 14948 17134 gene locus_tag LOCUS_00890 14948 17134 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040346.1 protein_id gnl|my_center|LOCUS_00890 17146 18585 gene locus_tag LOCUS_00900 17146 18585 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994163.1 protein_id gnl|my_center|LOCUS_00900 18657 19181 gene locus_tag LOCUS_00910 18657 19181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 19248 20216 gene locus_tag LOCUS_00920 19248 20216 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338007.1 protein_id gnl|my_center|LOCUS_00920 20213 22723 gene locus_tag LOCUS_00930 gene ctaD 20213 22723 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338006.1 protein_id gnl|my_center|LOCUS_00930 22720 23097 gene locus_tag LOCUS_00940 22720 23097 CDS product transmembrane prediction inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615439.1 protein_id gnl|my_center|LOCUS_00940 23094 23672 gene locus_tag LOCUS_00950 23094 23672 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119893.1 protein_id gnl|my_center|LOCUS_00950 23696 24712 gene locus_tag LOCUS_00960 23696 24712 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061689.1 protein_id gnl|my_center|LOCUS_00960 24785 26149 gene locus_tag LOCUS_00970 24785 26149 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_00970 >Feature sequence014 >Feature sequence015 272 607 gene locus_tag LOCUS_00980 272 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00980 >Feature sequence016 421 62 gene locus_tag LOCUS_00990 421 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 698 844 gene locus_tag LOCUS_01000 698 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 >Feature sequence017 116 463 gene locus_tag LOCUS_01010 116 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 707 2047 gene locus_tag LOCUS_01020 707 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 2263 2643 gene locus_tag LOCUS_01030 2263 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 2926 5724 gene locus_tag LOCUS_01040 2926 5724 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275340.1 protein_id gnl|my_center|LOCUS_01040 5721 6752 gene locus_tag LOCUS_01050 5721 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 6901 8067 gene locus_tag LOCUS_01060 6901 8067 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706681.1 protein_id gnl|my_center|LOCUS_01060 8567 8319 gene locus_tag LOCUS_01070 8567 8319 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084405.1 protein_id gnl|my_center|LOCUS_01070 8643 9317 gene locus_tag LOCUS_01080 8643 9317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 >Feature sequence018 2089 422 gene locus_tag LOCUS_01090 2089 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 3514 2855 gene locus_tag LOCUS_01100 3514 2855 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086747.1 protein_id gnl|my_center|LOCUS_01100 4587 3544 gene locus_tag LOCUS_01110 4587 3544 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387999.1 protein_id gnl|my_center|LOCUS_01110 4759 4832 gene locus_tag LOCUS_t00060 4759 4832 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5151 7238 gene locus_tag LOCUS_01120 5151 7238 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036583.1 protein_id gnl|my_center|LOCUS_01120 9554 7278 gene locus_tag LOCUS_01130 9554 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 10689 10093 gene locus_tag LOCUS_01140 10689 10093 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_01140 10904 10758 gene locus_tag LOCUS_01150 10904 10758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 11294 11079 gene locus_tag LOCUS_01160 11294 11079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 12254 13306 gene locus_tag LOCUS_01170 12254 13306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 13303 13575 gene locus_tag LOCUS_01180 13303 13575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 >Feature sequence019 392 318 gene locus_tag LOCUS_t00070 392 318 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 727 455 gene locus_tag LOCUS_01190 727 455 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_01190 3354 928 gene locus_tag LOCUS_01200 gene lon 3354 928 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337791.1 protein_id gnl|my_center|LOCUS_01200 3491 5245 gene locus_tag LOCUS_01210 3491 5245 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640435.1 protein_id gnl|my_center|LOCUS_01210 6492 5365 gene locus_tag LOCUS_01220 6492 5365 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524106.1 protein_id gnl|my_center|LOCUS_01220 >Feature sequence020 405 1529 gene locus_tag LOCUS_01230 gene zapE 405 1529 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 protein_id gnl|my_center|LOCUS_01230 1651 2613 gene locus_tag LOCUS_01240 gene mdh 1651 2613 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382961.1 protein_id gnl|my_center|LOCUS_01240 2702 2992 gene locus_tag LOCUS_01250 2702 2992 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_01250 3072 3956 gene locus_tag LOCUS_01260 gene sucD 3072 3956 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918227.1 protein_id gnl|my_center|LOCUS_01260 4088 7069 gene locus_tag LOCUS_01270 4088 7069 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669772.1 protein_id gnl|my_center|LOCUS_01270 7157 8410 gene locus_tag LOCUS_01280 gene odhB 7157 8410 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083283.1 protein_id gnl|my_center|LOCUS_01280 8520 9914 gene locus_tag LOCUS_01290 gene lpdA 8520 9914 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_01290 >Feature sequence021 116 463 gene locus_tag LOCUS_01300 116 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 548 814 gene locus_tag LOCUS_01310 548 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 823 1548 gene locus_tag LOCUS_01320 823 1548 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138387483.1 protein_id gnl|my_center|LOCUS_01320 1538 2650 gene locus_tag LOCUS_01330 1538 2650 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257523.1 protein_id gnl|my_center|LOCUS_01330 >Feature sequence022 1011 241 gene locus_tag LOCUS_01340 1011 241 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919296.1 protein_id gnl|my_center|LOCUS_01340 1122 2645 gene locus_tag LOCUS_01350 1122 2645 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_01350 2716 3708 gene locus_tag LOCUS_01360 gene gguC 2716 3708 CDS product GguC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919295.1 protein_id gnl|my_center|LOCUS_01360 >Feature sequence023 1200 355 gene locus_tag LOCUS_01370 1200 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01370 >Feature sequence024 1077 331 gene locus_tag LOCUS_01380 gene tpiA 1077 331 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027509116.1 protein_id gnl|my_center|LOCUS_01380 1212 3158 gene locus_tag LOCUS_01390 1212 3158 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531737.1 protein_id gnl|my_center|LOCUS_01390 3145 4662 gene locus_tag LOCUS_01400 gene trpE 3145 4662 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_01400 5607 5173 gene locus_tag LOCUS_01410 5607 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 5799 6413 gene locus_tag LOCUS_01420 5799 6413 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 protein_id gnl|my_center|LOCUS_01420 6410 7405 gene locus_tag LOCUS_01430 gene trpD 6410 7405 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389649.1 protein_id gnl|my_center|LOCUS_01430 7402 8178 gene locus_tag LOCUS_01440 gene trpC 7402 8178 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919765.1 protein_id gnl|my_center|LOCUS_01440 8175 8642 gene locus_tag LOCUS_01450 gene moaC 8175 8642 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639855.1 protein_id gnl|my_center|LOCUS_01450 8690 9874 gene locus_tag LOCUS_01460 8690 9874 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_01460 9930 10610 gene locus_tag LOCUS_01470 gene lexA 9930 10610 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265748.1 protein_id gnl|my_center|LOCUS_01470 12933 10912 gene locus_tag LOCUS_01480 12933 10912 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_01480 13109 14533 gene locus_tag LOCUS_01490 gene gltX 13109 14533 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389476.1 protein_id gnl|my_center|LOCUS_01490 14536 15819 gene locus_tag LOCUS_01500 gene gltA 14536 15819 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531749.1 protein_id gnl|my_center|LOCUS_01500 15823 16032 gene locus_tag LOCUS_01510 15823 16032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 17417 16080 gene locus_tag LOCUS_01520 17417 16080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 18502 17423 gene locus_tag LOCUS_01530 18502 17423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 19668 18538 gene locus_tag LOCUS_01540 19668 18538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 20084 19779 gene locus_tag LOCUS_01550 20084 19779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 20174 22498 gene locus_tag LOCUS_01560 20174 22498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 23426 22704 gene locus_tag LOCUS_01570 23426 22704 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529578.1 protein_id gnl|my_center|LOCUS_01570 23703 23428 gene locus_tag LOCUS_01580 23703 23428 CDS product DUF1467 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087667.1 protein_id gnl|my_center|LOCUS_01580 25342 23708 gene locus_tag LOCUS_01590 25342 23708 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_01590 26263 25484 gene locus_tag LOCUS_01600 26263 25484 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919801.1 protein_id gnl|my_center|LOCUS_01600 26977 26273 gene locus_tag LOCUS_01610 26977 26273 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 protein_id gnl|my_center|LOCUS_01610 28446 26983 gene locus_tag LOCUS_01620 gene nuoN 28446 26983 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087671.1 protein_id gnl|my_center|LOCUS_01620 29999 28446 gene locus_tag LOCUS_01630 29999 28446 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011541594.1 protein_id gnl|my_center|LOCUS_01630 32091 30004 gene locus_tag LOCUS_01640 gene nuoL 32091 30004 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919805.1 protein_id gnl|my_center|LOCUS_01640 32405 32097 gene locus_tag LOCUS_01650 gene nuoK 32405 32097 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910101.1 protein_id gnl|my_center|LOCUS_01650 33013 32402 gene locus_tag LOCUS_01660 33013 32402 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389439.1 protein_id gnl|my_center|LOCUS_01660 33548 33063 gene locus_tag LOCUS_01670 gene nuoI 33548 33063 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719675.1 protein_id gnl|my_center|LOCUS_01670 34600 33545 gene locus_tag LOCUS_01680 gene nuoH 34600 33545 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389437.1 protein_id gnl|my_center|LOCUS_01680 36615 34597 gene locus_tag LOCUS_01690 gene nuoG 36615 34597 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389436.1 protein_id gnl|my_center|LOCUS_01690 37925 36615 gene locus_tag LOCUS_01700 gene nuoF 37925 36615 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531094.1 protein_id gnl|my_center|LOCUS_01700 38599 37925 gene locus_tag LOCUS_01710 38599 37925 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_01710 39834 38599 gene locus_tag LOCUS_01720 39834 38599 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531092.1 protein_id gnl|my_center|LOCUS_01720 40667 39831 gene locus_tag LOCUS_01730 40667 39831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 41248 40664 gene locus_tag LOCUS_01740 41248 40664 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707619.1 protein_id gnl|my_center|LOCUS_01740 41613 41239 gene locus_tag LOCUS_01750 41613 41239 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312714.1 protein_id gnl|my_center|LOCUS_01750 42623 41811 gene locus_tag LOCUS_01760 42623 41811 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_01760 43316 42753 gene locus_tag LOCUS_01770 gene efp 43316 42753 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529127.1 protein_id gnl|my_center|LOCUS_01770 44002 43391 gene locus_tag LOCUS_01780 44002 43391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 44175 43999 gene locus_tag LOCUS_01790 44175 43999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 45318 44629 gene locus_tag LOCUS_01800 gene thiE 45318 44629 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388835.1 protein_id gnl|my_center|LOCUS_01800 46340 45432 gene locus_tag LOCUS_01810 46340 45432 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390262.1 protein_id gnl|my_center|LOCUS_01810 46705 46379 gene locus_tag LOCUS_01820 46705 46379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 46947 46702 gene locus_tag LOCUS_01830 46947 46702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 47059 47583 gene locus_tag LOCUS_01840 47059 47583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 48936 47737 gene locus_tag LOCUS_01850 48936 47737 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066872.1 protein_id gnl|my_center|LOCUS_01850 49409 48933 gene locus_tag LOCUS_01860 49409 48933 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 protein_id gnl|my_center|LOCUS_01860 50419 49409 gene locus_tag LOCUS_01870 gene gap 50419 49409 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393620.1 protein_id gnl|my_center|LOCUS_01870 50611 50808 gene locus_tag LOCUS_01880 50611 50808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 50808 51122 gene locus_tag LOCUS_01890 50808 51122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 51351 51884 gene locus_tag LOCUS_01900 51351 51884 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965392.1 protein_id gnl|my_center|LOCUS_01900 51881 52084 gene locus_tag LOCUS_01910 51881 52084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 52316 52240 gene locus_tag LOCUS_t00080 52316 52240 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 52475 52399 gene locus_tag LOCUS_t00090 52475 52399 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 53762 52533 gene locus_tag LOCUS_01920 53762 52533 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528460.1 protein_id gnl|my_center|LOCUS_01920 54043 53867 gene locus_tag LOCUS_01930 54043 53867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 54162 55073 gene locus_tag LOCUS_01940 gene tesB 54162 55073 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036345.1 protein_id gnl|my_center|LOCUS_01940 56045 55074 gene locus_tag LOCUS_01950 gene bdlA 56045 55074 CDS product biofilm dispersion protein BdlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082971.1 protein_id gnl|my_center|LOCUS_01950 56345 57595 gene locus_tag LOCUS_01960 56345 57595 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921028.1 protein_id gnl|my_center|LOCUS_01960 57717 58196 gene locus_tag LOCUS_01970 57717 58196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 58253 58990 gene locus_tag LOCUS_01980 58253 58990 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970997.1 protein_id gnl|my_center|LOCUS_01980 59015 60349 gene locus_tag LOCUS_01990 59015 60349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 61837 60356 gene locus_tag LOCUS_02000 61837 60356 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265786.1 protein_id gnl|my_center|LOCUS_02000 62900 61869 gene locus_tag LOCUS_02010 62900 61869 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508157.1 protein_id gnl|my_center|LOCUS_02010 63107 65881 gene locus_tag LOCUS_02020 63107 65881 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920148.1 protein_id gnl|my_center|LOCUS_02020 66138 65887 gene locus_tag LOCUS_02030 66138 65887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 66038 67492 gene locus_tag LOCUS_02040 66038 67492 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920149.1 protein_id gnl|my_center|LOCUS_02040 67489 69282 gene locus_tag LOCUS_02050 67489 69282 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265787.1 protein_id gnl|my_center|LOCUS_02050 69282 70895 gene locus_tag LOCUS_02060 69282 70895 CDS product alpha glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640457.1 protein_id gnl|my_center|LOCUS_02060 70892 72970 gene locus_tag LOCUS_02070 70892 72970 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037605.1 protein_id gnl|my_center|LOCUS_02070 75173 73107 gene locus_tag LOCUS_02080 75173 73107 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_02080 75497 75306 gene locus_tag LOCUS_02090 75497 75306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 76285 75494 gene locus_tag LOCUS_02100 76285 75494 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525063.1 protein_id gnl|my_center|LOCUS_02100 77478 76390 gene locus_tag LOCUS_02110 77478 76390 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392444.1 protein_id gnl|my_center|LOCUS_02110 78439 77654 gene locus_tag LOCUS_02120 78439 77654 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039141.1 protein_id gnl|my_center|LOCUS_02120 80277 78550 gene locus_tag LOCUS_02130 gene nagE 80277 78550 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918426.1 protein_id gnl|my_center|LOCUS_02130 82724 80274 gene locus_tag LOCUS_02140 gene ptsP 82724 80274 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918425.1 protein_id gnl|my_center|LOCUS_02140 85680 82777 gene locus_tag LOCUS_02150 85680 82777 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_02150 86816 85677 gene locus_tag LOCUS_02160 gene nagA 86816 85677 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918422.1 protein_id gnl|my_center|LOCUS_02160 87853 86813 gene locus_tag LOCUS_02170 87853 86813 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918332.1 protein_id gnl|my_center|LOCUS_02170 88619 87846 gene locus_tag LOCUS_02180 88619 87846 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639963.1 protein_id gnl|my_center|LOCUS_02180 89446 88700 gene locus_tag LOCUS_02190 89446 88700 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067613.1 protein_id gnl|my_center|LOCUS_02190 89727 92501 gene locus_tag LOCUS_02200 89727 92501 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038012.1 protein_id gnl|my_center|LOCUS_02200 92802 93686 gene locus_tag LOCUS_02210 92802 93686 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215821.1 protein_id gnl|my_center|LOCUS_02210 93703 94731 gene locus_tag LOCUS_02220 93703 94731 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_02220 95127 96761 gene locus_tag LOCUS_02230 95127 96761 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391292.1 protein_id gnl|my_center|LOCUS_02230 96849 97856 gene locus_tag LOCUS_02240 96849 97856 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919988.1 protein_id gnl|my_center|LOCUS_02240 98065 100728 gene locus_tag LOCUS_02250 98065 100728 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038016.1 protein_id gnl|my_center|LOCUS_02250 100725 103241 gene locus_tag LOCUS_02260 100725 103241 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038017.1 protein_id gnl|my_center|LOCUS_02260 103238 104662 gene locus_tag LOCUS_02270 103238 104662 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275521.1 protein_id gnl|my_center|LOCUS_02270 104659 106971 gene locus_tag LOCUS_02280 104659 106971 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038019.1 protein_id gnl|my_center|LOCUS_02280 106995 108905 gene locus_tag LOCUS_02290 106995 108905 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036446.1 protein_id gnl|my_center|LOCUS_02290 109001 110065 gene locus_tag LOCUS_02300 109001 110065 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441684.1 protein_id gnl|my_center|LOCUS_02300 110145 110909 gene locus_tag LOCUS_02310 110145 110909 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770966.1 protein_id gnl|my_center|LOCUS_02310 111037 113052 gene locus_tag LOCUS_02320 111037 113052 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336886.1 protein_id gnl|my_center|LOCUS_02320 113049 114197 gene locus_tag LOCUS_02330 113049 114197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 114194 115108 gene locus_tag LOCUS_02340 114194 115108 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119848.1 protein_id gnl|my_center|LOCUS_02340 115105 116181 gene locus_tag LOCUS_02350 115105 116181 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119846.1 protein_id gnl|my_center|LOCUS_02350 116178 117092 gene locus_tag LOCUS_02360 116178 117092 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533312.1 protein_id gnl|my_center|LOCUS_02360 117089 117982 gene locus_tag LOCUS_02370 117089 117982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 118064 118936 gene locus_tag LOCUS_02380 gene yghU 118064 118936 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339567.1 protein_id gnl|my_center|LOCUS_02380 119217 121610 gene locus_tag LOCUS_02390 119217 121610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 122235 121789 gene locus_tag LOCUS_02400 122235 121789 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529998.1 protein_id gnl|my_center|LOCUS_02400 122349 122774 gene locus_tag LOCUS_02410 122349 122774 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083560.1 protein_id gnl|my_center|LOCUS_02410 124222 122861 gene locus_tag LOCUS_02420 124222 122861 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275186.1 protein_id gnl|my_center|LOCUS_02420 124359 126617 gene locus_tag LOCUS_02430 124359 126617 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_02430 127077 126625 gene locus_tag LOCUS_02440 127077 126625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 127254 128609 gene locus_tag LOCUS_02450 127254 128609 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_02450 128642 129769 gene locus_tag LOCUS_02460 gene sacB 128642 129769 CDS product levansucrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022105.1 protein_id gnl|my_center|LOCUS_02460 130807 129773 gene locus_tag LOCUS_02470 130807 129773 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919021.1 protein_id gnl|my_center|LOCUS_02470 132170 131241 gene locus_tag LOCUS_02480 132170 131241 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_02480 132916 132167 gene locus_tag LOCUS_02490 132916 132167 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973172.1 protein_id gnl|my_center|LOCUS_02490 134241 132931 gene locus_tag LOCUS_02500 134241 132931 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919955.1 protein_id gnl|my_center|LOCUS_02500 134687 134280 gene locus_tag LOCUS_02510 134687 134280 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640259.1 protein_id gnl|my_center|LOCUS_02510 136646 134850 gene locus_tag LOCUS_02520 136646 134850 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389063.1 protein_id gnl|my_center|LOCUS_02520 138992 136665 gene locus_tag LOCUS_02530 138992 136665 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389064.1 protein_id gnl|my_center|LOCUS_02530 140128 138992 gene locus_tag LOCUS_02540 140128 138992 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389065.1 protein_id gnl|my_center|LOCUS_02540 140322 142004 gene locus_tag LOCUS_02550 140322 142004 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389067.1 protein_id gnl|my_center|LOCUS_02550 141989 142390 gene locus_tag LOCUS_02560 141989 142390 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389066.1 protein_id gnl|my_center|LOCUS_02560 143898 142489 gene locus_tag LOCUS_02570 143898 142489 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532453.1 protein_id gnl|my_center|LOCUS_02570 144553 143888 gene locus_tag LOCUS_02580 144553 143888 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820363.1 protein_id gnl|my_center|LOCUS_02580 144654 145727 gene locus_tag LOCUS_02590 144654 145727 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198094.1 protein_id gnl|my_center|LOCUS_02590 145724 147214 gene locus_tag LOCUS_02600 145724 147214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 147258 148559 gene locus_tag LOCUS_02610 147258 148559 CDS product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096918.1 protein_id gnl|my_center|LOCUS_02610 148576 149229 gene locus_tag LOCUS_02620 148576 149229 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090105.1 protein_id gnl|my_center|LOCUS_02620 149630 149430 gene locus_tag LOCUS_02630 149630 149430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 150076 149690 gene locus_tag LOCUS_02640 150076 149690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 150291 151796 gene locus_tag LOCUS_02650 150291 151796 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037505.1 protein_id gnl|my_center|LOCUS_02650 152966 151806 gene locus_tag LOCUS_02660 gene lldD 152966 151806 CDS product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919035.1 protein_id gnl|my_center|LOCUS_02660 153293 153036 gene locus_tag LOCUS_02670 153293 153036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 153259 154440 gene locus_tag LOCUS_02680 gene nhaA 153259 154440 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528071.1 protein_id gnl|my_center|LOCUS_02680 154464 154853 gene locus_tag LOCUS_02690 154464 154853 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385268.1 protein_id gnl|my_center|LOCUS_02690 154894 155103 gene locus_tag LOCUS_02700 154894 155103 CDS product ParD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079039.1 protein_id gnl|my_center|LOCUS_02700 155105 155869 gene locus_tag LOCUS_02710 gene map 155105 155869 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114411.1 protein_id gnl|my_center|LOCUS_02710 156682 155996 gene locus_tag LOCUS_02720 gene kdpE 156682 155996 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_02720 159363 156682 gene locus_tag LOCUS_02730 159363 156682 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529647.1 protein_id gnl|my_center|LOCUS_02730 159932 159360 gene locus_tag LOCUS_02740 gene kdpC 159932 159360 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529646.1 protein_id gnl|my_center|LOCUS_02740 162099 160063 gene locus_tag LOCUS_02750 gene kdpB 162099 160063 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391516.1 protein_id gnl|my_center|LOCUS_02750 163818 162115 gene locus_tag LOCUS_02760 gene kdpA 163818 162115 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089518.1 protein_id gnl|my_center|LOCUS_02760 164880 164029 gene locus_tag LOCUS_02770 164880 164029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 165197 167245 gene locus_tag LOCUS_02780 165197 167245 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920867.1 protein_id gnl|my_center|LOCUS_02780 167332 169689 gene locus_tag LOCUS_02790 167332 169689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 169794 170360 gene locus_tag LOCUS_02800 169794 170360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919409.1 protein_id gnl|my_center|LOCUS_02800 174083 170655 gene locus_tag LOCUS_02810 174083 170655 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920645.1 protein_id gnl|my_center|LOCUS_02810 174348 175859 gene locus_tag LOCUS_02820 174348 175859 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920646.1 protein_id gnl|my_center|LOCUS_02820 175856 177328 gene locus_tag LOCUS_02830 175856 177328 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920646.1 protein_id gnl|my_center|LOCUS_02830 177325 178935 gene locus_tag LOCUS_02840 177325 178935 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918672.1 protein_id gnl|my_center|LOCUS_02840 178938 180731 gene locus_tag LOCUS_02850 178938 180731 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640442.1 protein_id gnl|my_center|LOCUS_02850 180792 182228 gene locus_tag LOCUS_02860 180792 182228 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084183.1 protein_id gnl|my_center|LOCUS_02860 >Feature sequence025 1521 163 gene locus_tag LOCUS_02870 1521 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 1763 2173 gene locus_tag LOCUS_02880 gene sdhC 1763 2173 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_02880 2173 2556 gene locus_tag LOCUS_02890 gene sdhD 2173 2556 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615499.1 protein_id gnl|my_center|LOCUS_02890 2556 4364 gene locus_tag LOCUS_02900 gene sdhA 2556 4364 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083345.1 protein_id gnl|my_center|LOCUS_02900 4748 5494 gene locus_tag LOCUS_02910 gene otsB 4748 5494 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038195.1 protein_id gnl|my_center|LOCUS_02910 5494 7272 gene locus_tag LOCUS_02920 5494 7272 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_02920 7269 8684 gene locus_tag LOCUS_02930 gene otsA 7269 8684 CDS product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338617.1 protein_id gnl|my_center|LOCUS_02930 9187 8921 gene locus_tag LOCUS_02940 9187 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 10509 9379 gene locus_tag LOCUS_02950 10509 9379 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193577.1 protein_id gnl|my_center|LOCUS_02950 11423 10728 gene locus_tag LOCUS_02960 11423 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 11559 12227 gene locus_tag LOCUS_02970 11559 12227 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974094.1 protein_id gnl|my_center|LOCUS_02970 12251 13594 gene locus_tag LOCUS_02980 12251 13594 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974093.1 protein_id gnl|my_center|LOCUS_02980 13614 15197 gene locus_tag LOCUS_02990 13614 15197 CDS product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705837.1 protein_id gnl|my_center|LOCUS_02990 15372 16655 gene locus_tag LOCUS_03000 15372 16655 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968998.1 protein_id gnl|my_center|LOCUS_03000 19192 16796 gene locus_tag LOCUS_03010 19192 16796 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640416.1 protein_id gnl|my_center|LOCUS_03010 19805 20032 gene locus_tag LOCUS_03020 19805 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 20300 20554 gene locus_tag LOCUS_03030 20300 20554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 23055 20797 gene locus_tag LOCUS_03040 23055 20797 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528054.1 protein_id gnl|my_center|LOCUS_03040 23188 23367 gene locus_tag LOCUS_03050 23188 23367 CDS product antitoxin protein relB-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265819.1 protein_id gnl|my_center|LOCUS_03050 23355 23630 gene locus_tag LOCUS_03060 23355 23630 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640512.1 protein_id gnl|my_center|LOCUS_03060 23641 26229 gene locus_tag LOCUS_03070 gene mutS 23641 26229 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101067096.1 protein_id gnl|my_center|LOCUS_03070 26934 27365 gene locus_tag LOCUS_03080 26934 27365 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920478.1 protein_id gnl|my_center|LOCUS_03080 27980 27528 gene locus_tag LOCUS_03090 gene mscL 27980 27528 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192898.1 protein_id gnl|my_center|LOCUS_03090 28089 28682 gene locus_tag LOCUS_03100 28089 28682 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921284.1 protein_id gnl|my_center|LOCUS_03100 28693 29589 gene locus_tag LOCUS_03110 28693 29589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 29591 30256 gene locus_tag LOCUS_03120 29591 30256 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528995.1 protein_id gnl|my_center|LOCUS_03120 30253 30786 gene locus_tag LOCUS_03130 30253 30786 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 protein_id gnl|my_center|LOCUS_03130 31511 31230 gene locus_tag LOCUS_03140 31511 31230 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171332.1 protein_id gnl|my_center|LOCUS_03140 33974 31524 gene locus_tag LOCUS_03150 gene hrpB 33974 31524 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968081.1 protein_id gnl|my_center|LOCUS_03150 35300 34290 gene locus_tag LOCUS_03160 35300 34290 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085318.1 protein_id gnl|my_center|LOCUS_03160 35410 35688 gene locus_tag LOCUS_03170 35410 35688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 35688 36359 gene locus_tag LOCUS_03180 35688 36359 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727970.1 protein_id gnl|my_center|LOCUS_03180 37362 36769 gene locus_tag LOCUS_03190 37362 36769 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528729.1 protein_id gnl|my_center|LOCUS_03190 39420 37417 gene locus_tag LOCUS_03200 39420 37417 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972154.1 protein_id gnl|my_center|LOCUS_03200 39977 39465 gene locus_tag LOCUS_03210 39977 39465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 40212 42257 gene locus_tag LOCUS_03220 40212 42257 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529393.1 protein_id gnl|my_center|LOCUS_03220 42268 42450 gene locus_tag LOCUS_03230 42268 42450 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460431.1 protein_id gnl|my_center|LOCUS_03230 42994 43191 gene locus_tag LOCUS_03240 42994 43191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 43202 43738 gene locus_tag LOCUS_03250 gene nusG 43202 43738 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088165.1 protein_id gnl|my_center|LOCUS_03250 45134 44562 gene locus_tag LOCUS_03260 45134 44562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 46321 45158 gene locus_tag LOCUS_03270 46321 45158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 47102 46332 gene locus_tag LOCUS_03280 47102 46332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 47345 47776 gene locus_tag LOCUS_03290 gene rplK 47345 47776 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531410.1 protein_id gnl|my_center|LOCUS_03290 47781 48473 gene locus_tag LOCUS_03300 gene rplA 47781 48473 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536190.1 protein_id gnl|my_center|LOCUS_03300 48651 49391 gene locus_tag LOCUS_03310 48651 49391 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918870.1 protein_id gnl|my_center|LOCUS_03310 51852 49627 gene locus_tag LOCUS_03320 gene katG 51852 49627 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence026 1113 100 gene locus_tag LOCUS_03330 1113 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 2213 1575 gene locus_tag LOCUS_03340 2213 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 3185 2250 gene locus_tag LOCUS_03350 gene dmeF 3185 2250 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806898.1 protein_id gnl|my_center|LOCUS_03350 3486 3211 gene locus_tag LOCUS_03360 3486 3211 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267062.1 protein_id gnl|my_center|LOCUS_03360 3647 4459 gene locus_tag LOCUS_03370 3647 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 4808 4449 gene locus_tag LOCUS_03380 4808 4449 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640519.1 protein_id gnl|my_center|LOCUS_03380 5437 4805 gene locus_tag LOCUS_03390 gene maiA 5437 4805 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921397.1 protein_id gnl|my_center|LOCUS_03390 6711 5434 gene locus_tag LOCUS_03400 gene hmgA 6711 5434 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920389.1 protein_id gnl|my_center|LOCUS_03400 7936 6875 gene locus_tag LOCUS_03410 gene hppD 7936 6875 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920390.1 protein_id gnl|my_center|LOCUS_03410 8018 8470 gene locus_tag LOCUS_03420 8018 8470 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640429.1 protein_id gnl|my_center|LOCUS_03420 9456 8449 gene locus_tag LOCUS_03430 9456 8449 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261595.1 protein_id gnl|my_center|LOCUS_03430 11048 9453 gene locus_tag LOCUS_03440 11048 9453 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261594.1 protein_id gnl|my_center|LOCUS_03440 12166 11045 gene locus_tag LOCUS_03450 12166 11045 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921587.1 protein_id gnl|my_center|LOCUS_03450 12830 12198 gene locus_tag LOCUS_03460 12830 12198 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970208.1 protein_id gnl|my_center|LOCUS_03460 12936 14159 gene locus_tag LOCUS_03470 12936 14159 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810338.1 protein_id gnl|my_center|LOCUS_03470 14179 17406 gene locus_tag LOCUS_03480 14179 17406 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067600.1 protein_id gnl|my_center|LOCUS_03480 17399 18868 gene locus_tag LOCUS_03490 17399 18868 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810342.1 protein_id gnl|my_center|LOCUS_03490 18985 19863 gene locus_tag LOCUS_03500 gene mtnP 18985 19863 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_03500 21159 19867 gene locus_tag LOCUS_03510 21159 19867 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992471.1 protein_id gnl|my_center|LOCUS_03510 22671 21307 gene locus_tag LOCUS_03520 22671 21307 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275403.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03520 24102 22780 gene locus_tag LOCUS_03530 24102 22780 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384606.1 protein_id gnl|my_center|LOCUS_03530 24307 26097 gene locus_tag LOCUS_03540 24307 26097 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171603.1 protein_id gnl|my_center|LOCUS_03540 26094 27437 gene locus_tag LOCUS_03550 gene dctD 26094 27437 CDS product C4-dicarboxylate transport transcriptional regulatory protein DctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529421.1 protein_id gnl|my_center|LOCUS_03550 27554 27721 gene locus_tag LOCUS_03560 27554 27721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 29050 27740 gene locus_tag LOCUS_03570 29050 27740 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946946.1 protein_id gnl|my_center|LOCUS_03570 29165 29719 gene locus_tag LOCUS_03580 gene pgsA 29165 29719 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_03580 29720 29977 gene locus_tag LOCUS_03590 gene moaD 29720 29977 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090205.1 protein_id gnl|my_center|LOCUS_03590 29974 30414 gene locus_tag LOCUS_03600 gene moaE 29974 30414 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 protein_id gnl|my_center|LOCUS_03600 31067 30465 gene locus_tag LOCUS_03610 31067 30465 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439348.1 protein_id gnl|my_center|LOCUS_03610 31801 31178 gene locus_tag LOCUS_03620 31801 31178 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439348.1 protein_id gnl|my_center|LOCUS_03620 32775 31873 gene locus_tag LOCUS_03630 32775 31873 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_03630 32933 33478 gene locus_tag LOCUS_03640 32933 33478 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014844498.1 protein_id gnl|my_center|LOCUS_03640 33596 34117 gene locus_tag LOCUS_03650 33596 34117 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084585.1 protein_id gnl|my_center|LOCUS_03650 34927 34166 gene locus_tag LOCUS_03660 34927 34166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 35096 35779 gene locus_tag LOCUS_03670 gene cysE 35096 35779 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476494.1 protein_id gnl|my_center|LOCUS_03670 35779 36111 gene locus_tag LOCUS_03680 35779 36111 CDS product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721547.1 protein_id gnl|my_center|LOCUS_03680 36534 36181 gene locus_tag LOCUS_03690 36534 36181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 37365 36673 gene locus_tag LOCUS_03700 gene phoB 37365 36673 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_03700 38062 37379 gene locus_tag LOCUS_03710 gene phoU 38062 37379 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_03710 38835 38074 gene locus_tag LOCUS_03720 gene pstB 38835 38074 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382998.1 protein_id gnl|my_center|LOCUS_03720 40115 38832 gene locus_tag LOCUS_03730 gene pstA 40115 38832 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_03730 41484 40108 gene locus_tag LOCUS_03740 gene pstC 41484 40108 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_03740 42527 41481 gene locus_tag LOCUS_03750 42527 41481 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_03750 43840 42599 gene locus_tag LOCUS_03760 43840 42599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 43931 44386 gene locus_tag LOCUS_03770 43931 44386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 44390 44668 gene locus_tag LOCUS_03780 44390 44668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 44683 45510 gene locus_tag LOCUS_03790 44683 45510 CDS product HprK-related kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_03790 45534 46523 gene locus_tag LOCUS_03800 45534 46523 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_03800 47175 46483 gene locus_tag LOCUS_03810 gene gph 47175 46483 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390779.1 protein_id gnl|my_center|LOCUS_03810 47240 48604 gene locus_tag LOCUS_03820 gene glmU 47240 48604 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626497.1 protein_id gnl|my_center|LOCUS_03820 48610 50433 gene locus_tag LOCUS_03830 gene glmS 48610 50433 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087378.1 protein_id gnl|my_center|LOCUS_03830 50510 52360 gene locus_tag LOCUS_03840 50510 52360 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119442.1 protein_id gnl|my_center|LOCUS_03840 53488 52376 gene locus_tag LOCUS_03850 gene dinB 53488 52376 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083683.1 protein_id gnl|my_center|LOCUS_03850 53814 56729 gene locus_tag LOCUS_03860 53814 56729 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_03860 56769 56984 gene locus_tag LOCUS_03870 56769 56984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 57930 56992 gene locus_tag LOCUS_03880 57930 56992 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919312.1 protein_id gnl|my_center|LOCUS_03880 58884 58012 gene locus_tag LOCUS_03890 58884 58012 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974598.1 protein_id gnl|my_center|LOCUS_03890 58980 61085 gene locus_tag LOCUS_03900 58980 61085 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992369.1 protein_id gnl|my_center|LOCUS_03900 61085 61654 gene locus_tag LOCUS_03910 61085 61654 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975835.1 protein_id gnl|my_center|LOCUS_03910 61664 62374 gene locus_tag LOCUS_03920 61664 62374 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966216.1 protein_id gnl|my_center|LOCUS_03920 62371 63696 gene locus_tag LOCUS_03930 62371 63696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 67074 64054 gene locus_tag LOCUS_03940 67074 64054 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973524.1 protein_id gnl|my_center|LOCUS_03940 66985 67191 gene locus_tag LOCUS_03950 66985 67191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 67886 67260 gene locus_tag LOCUS_03960 67886 67260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 68165 67977 gene locus_tag LOCUS_03970 68165 67977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 68846 68259 gene locus_tag LOCUS_03980 68846 68259 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969898.1 protein_id gnl|my_center|LOCUS_03980 71239 68843 gene locus_tag LOCUS_03990 gene treY 71239 68843 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035665.1 protein_id gnl|my_center|LOCUS_03990 73158 71263 gene locus_tag LOCUS_04000 gene malQ 73158 71263 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104396.1 protein_id gnl|my_center|LOCUS_04000 74849 73155 gene locus_tag LOCUS_04010 gene treZ 74849 73155 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766224.1 protein_id gnl|my_center|LOCUS_04010 76948 74846 gene locus_tag LOCUS_04020 gene glgX 76948 74846 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552916.1 protein_id gnl|my_center|LOCUS_04020 77314 77054 gene locus_tag LOCUS_04030 77314 77054 CDS product DUF2934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257319.1 protein_id gnl|my_center|LOCUS_04030 78543 77410 gene locus_tag LOCUS_04040 78543 77410 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479977.1 protein_id gnl|my_center|LOCUS_04040 78692 80497 gene locus_tag LOCUS_04050 78692 80497 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384729.1 protein_id gnl|my_center|LOCUS_04050 80543 82591 gene locus_tag LOCUS_04060 80543 82591 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266943.1 protein_id gnl|my_center|LOCUS_04060 82864 82592 gene locus_tag LOCUS_04070 82864 82592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 83360 82935 gene locus_tag LOCUS_04080 83360 82935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 84825 83491 gene locus_tag LOCUS_04090 84825 83491 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531507.1 protein_id gnl|my_center|LOCUS_04090 85064 86209 gene locus_tag LOCUS_04100 85064 86209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 86221 88215 gene locus_tag LOCUS_04110 gene cyoB 86221 88215 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082982.1 protein_id gnl|my_center|LOCUS_04110 88219 88857 gene locus_tag LOCUS_04120 gene cyoC 88219 88857 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531504.1 protein_id gnl|my_center|LOCUS_04120 88956 89261 gene locus_tag LOCUS_04130 88956 89261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 89261 89974 gene locus_tag LOCUS_04140 89261 89974 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392415.1 protein_id gnl|my_center|LOCUS_04140 89971 91281 gene locus_tag LOCUS_04150 89971 91281 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531508.1 protein_id gnl|my_center|LOCUS_04150 91281 91814 gene locus_tag LOCUS_04160 91281 91814 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082987.1 protein_id gnl|my_center|LOCUS_04160 93683 91854 gene locus_tag LOCUS_04170 93683 91854 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036537.1 protein_id gnl|my_center|LOCUS_04170 94344 93886 gene locus_tag LOCUS_04180 94344 93886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 94648 94400 gene locus_tag LOCUS_04190 94648 94400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 94998 94645 gene locus_tag LOCUS_04200 94998 94645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 95546 94995 gene locus_tag LOCUS_04210 95546 94995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 95707 96987 gene locus_tag LOCUS_04220 gene eno 95707 96987 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719649.1 protein_id gnl|my_center|LOCUS_04220 97011 97334 gene locus_tag LOCUS_04230 97011 97334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 98216 97392 gene locus_tag LOCUS_04240 98216 97392 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269056.1 protein_id gnl|my_center|LOCUS_04240 98404 100521 gene locus_tag LOCUS_04250 98404 100521 CDS product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923339.1 protein_id gnl|my_center|LOCUS_04250 100616 100975 gene locus_tag LOCUS_04260 100616 100975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 101634 101041 gene locus_tag LOCUS_04270 101634 101041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 104018 101721 gene locus_tag LOCUS_04280 104018 101721 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972026.1 protein_id gnl|my_center|LOCUS_04280 104232 104555 gene locus_tag LOCUS_04290 104232 104555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 104677 106317 gene locus_tag LOCUS_04300 104677 106317 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085806.1 protein_id gnl|my_center|LOCUS_04300 106380 107654 gene locus_tag LOCUS_04310 106380 107654 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183611247.1 protein_id gnl|my_center|LOCUS_04310 108181 107645 gene locus_tag LOCUS_04320 gene rsmD 108181 107645 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 protein_id gnl|my_center|LOCUS_04320 109632 108181 gene locus_tag LOCUS_04330 109632 108181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 109814 110245 gene locus_tag LOCUS_04340 109814 110245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 110312 111640 gene locus_tag LOCUS_04350 110312 111640 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198303.1 protein_id gnl|my_center|LOCUS_04350 112058 111630 gene locus_tag LOCUS_04360 112058 111630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 113469 112150 gene locus_tag LOCUS_04370 113469 112150 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_04370 114409 113555 gene locus_tag LOCUS_04380 gene accD 114409 113555 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721171.1 protein_id gnl|my_center|LOCUS_04380 115218 114406 gene locus_tag LOCUS_04390 gene trpA 115218 114406 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115801.1 protein_id gnl|my_center|LOCUS_04390 116486 115215 gene locus_tag LOCUS_04400 gene trpB 116486 115215 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067442.1 protein_id gnl|my_center|LOCUS_04400 117137 116496 gene locus_tag LOCUS_04410 117137 116496 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 protein_id gnl|my_center|LOCUS_04410 117847 117173 gene locus_tag LOCUS_04420 gene pyrF 117847 117173 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_04420 118184 117852 gene locus_tag LOCUS_04430 118184 117852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 120538 118256 gene locus_tag LOCUS_04440 120538 118256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 121233 120538 gene locus_tag LOCUS_04450 121233 120538 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338250.1 protein_id gnl|my_center|LOCUS_04450 121360 121286 gene locus_tag LOCUS_t00100 121360 121286 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 122243 121380 gene locus_tag LOCUS_04460 122243 121380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 123570 122224 gene locus_tag LOCUS_04470 123570 122224 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_04470 123691 124284 gene locus_tag LOCUS_04480 123691 124284 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391188.1 protein_id gnl|my_center|LOCUS_04480 124281 124571 gene locus_tag LOCUS_04490 124281 124571 CDS product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531327.1 protein_id gnl|my_center|LOCUS_04490 125720 124575 gene locus_tag LOCUS_04500 125720 124575 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918642.1 protein_id gnl|my_center|LOCUS_04500 125818 127191 gene locus_tag LOCUS_04510 gene radA 125818 127191 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388165.1 protein_id gnl|my_center|LOCUS_04510 127255 127809 gene locus_tag LOCUS_04520 127255 127809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 127806 128246 gene locus_tag LOCUS_04530 127806 128246 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719774.1 protein_id gnl|my_center|LOCUS_04530 128246 129997 gene locus_tag LOCUS_04540 128246 129997 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037333.1 protein_id gnl|my_center|LOCUS_04540 130000 130329 gene locus_tag LOCUS_04550 130000 130329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 130375 131931 gene locus_tag LOCUS_04560 gene metG 130375 131931 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296388.1 protein_id gnl|my_center|LOCUS_04560 131931 132707 gene locus_tag LOCUS_04570 131931 132707 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_04570 132704 133468 gene locus_tag LOCUS_04580 132704 133468 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 protein_id gnl|my_center|LOCUS_04580 133465 134034 gene locus_tag LOCUS_04590 133465 134034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 134172 134909 gene locus_tag LOCUS_04600 gene mazG 134172 134909 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384177.1 protein_id gnl|my_center|LOCUS_04600 136182 134890 gene locus_tag LOCUS_04610 gene hflX 136182 134890 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967571.1 protein_id gnl|my_center|LOCUS_04610 136670 136179 gene locus_tag LOCUS_04620 136670 136179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 138189 136813 gene locus_tag LOCUS_04630 138189 136813 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531496.1 protein_id gnl|my_center|LOCUS_04630 140442 138196 gene locus_tag LOCUS_04640 140442 138196 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967572.1 protein_id gnl|my_center|LOCUS_04640 141952 140495 gene locus_tag LOCUS_04650 gene ntrC 141952 140495 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531494.1 protein_id gnl|my_center|LOCUS_04650 143016 141949 gene locus_tag LOCUS_04660 143016 141949 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969237.1 protein_id gnl|my_center|LOCUS_04660 144001 143000 gene locus_tag LOCUS_04670 gene dusB 144001 143000 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014411626.1 protein_id gnl|my_center|LOCUS_04670 144093 145253 gene locus_tag LOCUS_04680 144093 145253 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_04680 145250 145780 gene locus_tag LOCUS_04690 145250 145780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 145780 146280 gene locus_tag LOCUS_04700 145780 146280 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971625.1 protein_id gnl|my_center|LOCUS_04700 146699 146241 gene locus_tag LOCUS_04710 146699 146241 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719940.1 protein_id gnl|my_center|LOCUS_04710 147622 146699 gene locus_tag LOCUS_04720 gene lipA 147622 146699 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971620.1 protein_id gnl|my_center|LOCUS_04720 147772 148428 gene locus_tag LOCUS_04730 147772 148428 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970569.1 protein_id gnl|my_center|LOCUS_04730 150330 148525 gene locus_tag LOCUS_04740 gene aspS 150330 148525 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975000.1 protein_id gnl|my_center|LOCUS_04740 150454 151677 gene locus_tag LOCUS_04750 gene rnd 150454 151677 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_04750 151674 151961 gene locus_tag LOCUS_04760 151674 151961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 153396 151948 gene locus_tag LOCUS_04770 gene ppx 153396 151948 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_04770 155603 153438 gene locus_tag LOCUS_04780 155603 153438 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171108.1 protein_id gnl|my_center|LOCUS_04780 156232 155624 gene locus_tag LOCUS_04790 156232 155624 CDS product regulatory inactivation of DnaA Hda protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390012.1 protein_id gnl|my_center|LOCUS_04790 157380 156229 gene locus_tag LOCUS_04800 157380 156229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 157548 158681 gene locus_tag LOCUS_04810 gene purM 157548 158681 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532445.1 protein_id gnl|my_center|LOCUS_04810 158671 159249 gene locus_tag LOCUS_04820 gene purN 158671 159249 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919571.1 protein_id gnl|my_center|LOCUS_04820 159246 159533 gene locus_tag LOCUS_04830 159246 159533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 159530 160129 gene locus_tag LOCUS_04840 159530 160129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 160658 160140 gene locus_tag LOCUS_04850 160658 160140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 161089 160658 gene locus_tag LOCUS_04860 gene ndk 161089 160658 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707487.1 protein_id gnl|my_center|LOCUS_04860 161739 161299 gene locus_tag LOCUS_04870 161739 161299 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390049.1 protein_id gnl|my_center|LOCUS_04870 163228 161762 gene locus_tag LOCUS_04880 163228 161762 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388213.1 protein_id gnl|my_center|LOCUS_04880 163493 165637 gene locus_tag LOCUS_04890 gene lptD 163493 165637 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388193.1 protein_id gnl|my_center|LOCUS_04890 165714 167078 gene locus_tag LOCUS_04900 165714 167078 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625938.1 protein_id gnl|my_center|LOCUS_04900 167075 168088 gene locus_tag LOCUS_04910 gene pdxA 167075 168088 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969073.1 protein_id gnl|my_center|LOCUS_04910 168090 168914 gene locus_tag LOCUS_04920 gene rsmA 168090 168914 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037431273.1 protein_id gnl|my_center|LOCUS_04920 169618 169118 gene locus_tag LOCUS_04930 169618 169118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 170831 169650 gene locus_tag LOCUS_04940 170831 169650 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_04940 172307 170850 gene locus_tag LOCUS_04950 gene guaB 172307 170850 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086749.1 protein_id gnl|my_center|LOCUS_04950 172435 173412 gene locus_tag LOCUS_04960 172435 173412 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038004.1 protein_id gnl|my_center|LOCUS_04960 173409 173858 gene locus_tag LOCUS_04970 173409 173858 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313449.1 protein_id gnl|my_center|LOCUS_04970 175603 173996 gene locus_tag LOCUS_04980 175603 173996 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968314.1 protein_id gnl|my_center|LOCUS_04980 175809 176516 gene locus_tag LOCUS_04990 gene chvI 175809 176516 CDS product two-component system response regulator ChvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970615.1 protein_id gnl|my_center|LOCUS_04990 176485 178050 gene locus_tag LOCUS_05000 176485 178050 CDS product stimulus-sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_05000 178059 178487 gene locus_tag LOCUS_05010 178059 178487 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 protein_id gnl|my_center|LOCUS_05010 178487 179398 gene locus_tag LOCUS_05020 gene rapZ 178487 179398 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470669.1 protein_id gnl|my_center|LOCUS_05020 179408 179824 gene locus_tag LOCUS_05030 179408 179824 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639920.1 protein_id gnl|my_center|LOCUS_05030 179821 180093 gene locus_tag LOCUS_05040 179821 180093 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067453.1 protein_id gnl|my_center|LOCUS_05040 180095 180907 gene locus_tag LOCUS_05050 180095 180907 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919071.1 protein_id gnl|my_center|LOCUS_05050 183020 181554 gene locus_tag LOCUS_05060 183020 181554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 183626 183105 gene locus_tag LOCUS_05070 gene def 183626 183105 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974268.1 protein_id gnl|my_center|LOCUS_05070 184393 183671 gene locus_tag LOCUS_05080 gene recR 184393 183671 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090836.1 protein_id gnl|my_center|LOCUS_05080 184322 185227 gene locus_tag LOCUS_05090 gene fmt 184322 185227 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252646.1 protein_id gnl|my_center|LOCUS_05090 185224 185973 gene locus_tag LOCUS_05100 gene truA 185224 185973 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391099.1 protein_id gnl|my_center|LOCUS_05100 187151 185955 gene locus_tag LOCUS_05110 187151 185955 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338785.1 protein_id gnl|my_center|LOCUS_05110 188538 187156 gene locus_tag LOCUS_05120 188538 187156 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389422.1 protein_id gnl|my_center|LOCUS_05120 188912 188535 gene locus_tag LOCUS_05130 188912 188535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 190620 188899 gene locus_tag LOCUS_05140 gene ilvD 190620 188899 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531283.1 protein_id gnl|my_center|LOCUS_05140 191062 190712 gene locus_tag LOCUS_05150 191062 190712 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038081.1 protein_id gnl|my_center|LOCUS_05150 193409 191088 gene locus_tag LOCUS_05160 193409 191088 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088552.1 protein_id gnl|my_center|LOCUS_05160 193333 193536 gene locus_tag LOCUS_05170 193333 193536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 195594 193567 gene locus_tag LOCUS_05180 195594 193567 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921333.1 protein_id gnl|my_center|LOCUS_05180 197720 195663 gene locus_tag LOCUS_05190 197720 195663 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921333.1 protein_id gnl|my_center|LOCUS_05190 198368 197793 gene locus_tag LOCUS_05200 198368 197793 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072737.1 protein_id gnl|my_center|LOCUS_05200 198880 198368 gene locus_tag LOCUS_05210 gene smpB 198880 198368 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087830.1 protein_id gnl|my_center|LOCUS_05210 198973 199875 gene locus_tag LOCUS_05220 198973 199875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 200167 199862 gene locus_tag LOCUS_05230 200167 199862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 201136 200264 gene locus_tag LOCUS_05240 gene dapA 201136 200264 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532595.1 protein_id gnl|my_center|LOCUS_05240 201253 203238 gene locus_tag LOCUS_05250 201253 203238 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389619.1 protein_id gnl|my_center|LOCUS_05250 203269 203751 gene locus_tag LOCUS_05260 gene greB 203269 203751 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_05260 203865 204656 gene locus_tag LOCUS_05270 203865 204656 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038849.1 protein_id gnl|my_center|LOCUS_05270 205844 204660 gene locus_tag LOCUS_05280 205844 204660 CDS product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089726.1 protein_id gnl|my_center|LOCUS_05280 207693 206014 gene locus_tag LOCUS_05290 gene ettA 207693 206014 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_05290 207802 209199 gene locus_tag LOCUS_05300 207802 209199 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_05300 209400 209666 gene locus_tag LOCUS_05310 209400 209666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 209811 209886 gene locus_tag LOCUS_t00110 209811 209886 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 210519 209899 gene locus_tag LOCUS_05320 210519 209899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 210674 211195 gene locus_tag LOCUS_05330 gene bfr 210674 211195 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035731.1 protein_id gnl|my_center|LOCUS_05330 212785 211412 gene locus_tag LOCUS_05340 gene der 212785 211412 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975953.1 protein_id gnl|my_center|LOCUS_05340 214208 212883 gene locus_tag LOCUS_05350 gene bamB 214208 212883 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370327.1 protein_id gnl|my_center|LOCUS_05350 214873 214205 gene locus_tag LOCUS_05360 214873 214205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 215856 214990 gene locus_tag LOCUS_05370 gene panB 215856 214990 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391068.1 protein_id gnl|my_center|LOCUS_05370 216250 215906 gene locus_tag LOCUS_05380 216250 215906 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067705.1 protein_id gnl|my_center|LOCUS_05380 216441 218531 gene locus_tag LOCUS_05390 216441 218531 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921446.1 protein_id gnl|my_center|LOCUS_05390 218643 219287 gene locus_tag LOCUS_05400 218643 219287 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807322.1 protein_id gnl|my_center|LOCUS_05400 220223 219294 gene locus_tag LOCUS_05410 220223 219294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05410 220618 220139 gene locus_tag LOCUS_05420 220618 220139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05420 221633 220629 gene locus_tag LOCUS_05430 221633 220629 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200388.1 protein_id gnl|my_center|LOCUS_05430 222932 221697 gene locus_tag LOCUS_05440 222932 221697 CDS product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027377.1 protein_id gnl|my_center|LOCUS_05440 222914 223234 gene locus_tag LOCUS_05450 222914 223234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 223928 223347 gene locus_tag LOCUS_05460 223928 223347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 224425 224006 gene locus_tag LOCUS_05470 224425 224006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 225216 224608 gene locus_tag LOCUS_05480 225216 224608 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974671.1 protein_id gnl|my_center|LOCUS_05480 225375 227711 gene locus_tag LOCUS_05490 225375 227711 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974023.1 protein_id gnl|my_center|LOCUS_05490 229078 227675 gene locus_tag LOCUS_05500 229078 227675 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039281.1 protein_id gnl|my_center|LOCUS_05500 229824 229114 gene locus_tag LOCUS_05510 229824 229114 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114953.1 protein_id gnl|my_center|LOCUS_05510 230738 229824 gene locus_tag LOCUS_05520 230738 229824 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807565.1 protein_id gnl|my_center|LOCUS_05520 232606 230804 gene locus_tag LOCUS_05530 232606 230804 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039109.1 protein_id gnl|my_center|LOCUS_05530 233632 232622 gene locus_tag LOCUS_05540 gene lhpD 233632 232622 CDS product bifunctional delta(1)-pyrroline-2-carboxylate/delta(1)-piperideine-2-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082545.1 protein_id gnl|my_center|LOCUS_05540 235977 233629 gene locus_tag LOCUS_05550 235977 233629 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037536.1 protein_id gnl|my_center|LOCUS_05550 236106 238850 gene locus_tag LOCUS_05560 236106 238850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 239263 238796 gene locus_tag LOCUS_05570 239263 238796 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388152.1 protein_id gnl|my_center|LOCUS_05570 239296 239490 gene locus_tag LOCUS_05580 239296 239490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 239617 239793 gene locus_tag LOCUS_05590 239617 239793 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820212.1 protein_id gnl|my_center|LOCUS_05590 240869 239919 gene locus_tag LOCUS_05600 240869 239919 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083023.1 protein_id gnl|my_center|LOCUS_05600 241782 240883 gene locus_tag LOCUS_05610 241782 240883 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529355.1 protein_id gnl|my_center|LOCUS_05610 243560 241779 gene locus_tag LOCUS_05620 243560 241779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 243741 243607 gene locus_tag LOCUS_05630 243741 243607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 243823 244365 gene locus_tag LOCUS_05640 243823 244365 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920844.1 protein_id gnl|my_center|LOCUS_05640 244362 245462 gene locus_tag LOCUS_05650 gene aroB 244362 245462 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577439.1 protein_id gnl|my_center|LOCUS_05650 247000 245696 gene locus_tag LOCUS_05660 247000 245696 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971478.1 protein_id gnl|my_center|LOCUS_05660 248015 247071 gene locus_tag LOCUS_05670 248015 247071 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921475.1 protein_id gnl|my_center|LOCUS_05670 248014 248994 gene locus_tag LOCUS_05680 248014 248994 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_05680 248997 249512 gene locus_tag LOCUS_05690 248997 249512 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338602.1 protein_id gnl|my_center|LOCUS_05690 249524 250435 gene locus_tag LOCUS_05700 249524 250435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 250496 251689 gene locus_tag LOCUS_05710 250496 251689 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919479.1 protein_id gnl|my_center|LOCUS_05710 251686 252705 gene locus_tag LOCUS_05720 251686 252705 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918468.1 protein_id gnl|my_center|LOCUS_05720 252711 253958 gene locus_tag LOCUS_05730 252711 253958 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918470.1 protein_id gnl|my_center|LOCUS_05730 254002 254220 gene locus_tag LOCUS_05740 254002 254220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 254270 255169 gene locus_tag LOCUS_05750 gene cysD 254270 255169 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385212.1 protein_id gnl|my_center|LOCUS_05750 255169 257082 gene locus_tag LOCUS_05760 gene cysN 255169 257082 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385211.1 protein_id gnl|my_center|LOCUS_05760 257079 257810 gene locus_tag LOCUS_05770 257079 257810 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061144.1 protein_id gnl|my_center|LOCUS_05770 257925 258632 gene locus_tag LOCUS_05780 257925 258632 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388218.1 protein_id gnl|my_center|LOCUS_05780 259529 258747 gene locus_tag LOCUS_05790 259529 258747 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027270.1 protein_id gnl|my_center|LOCUS_05790 260716 259541 gene locus_tag LOCUS_05800 260716 259541 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339042.1 protein_id gnl|my_center|LOCUS_05800 261303 260713 gene locus_tag LOCUS_05810 261303 260713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 262157 261438 gene locus_tag LOCUS_05820 262157 261438 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337109.1 protein_id gnl|my_center|LOCUS_05820 262699 263889 gene locus_tag LOCUS_05830 gene tatA 262699 263889 CDS product tyrosine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067706.1 protein_id gnl|my_center|LOCUS_05830 265425 264109 gene locus_tag LOCUS_05840 gene xylA 265425 264109 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400879.1 protein_id gnl|my_center|LOCUS_05840 266874 265426 gene locus_tag LOCUS_05850 gene xylB 266874 265426 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190065.1 protein_id gnl|my_center|LOCUS_05850 268026 266884 gene locus_tag LOCUS_05860 268026 266884 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_05860 268354 269439 gene locus_tag LOCUS_05870 268354 269439 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404739.1 protein_id gnl|my_center|LOCUS_05870 269439 271775 gene locus_tag LOCUS_05880 269439 271775 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_05880 271884 273806 gene locus_tag LOCUS_05890 271884 273806 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043775883.1 protein_id gnl|my_center|LOCUS_05890 273888 275021 gene locus_tag LOCUS_05900 273888 275021 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640594.1 protein_id gnl|my_center|LOCUS_05900 275018 276682 gene locus_tag LOCUS_05910 275018 276682 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 protein_id gnl|my_center|LOCUS_05910 276679 278235 gene locus_tag LOCUS_05920 276679 278235 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_05920 280000 278456 gene locus_tag LOCUS_05930 280000 278456 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 protein_id gnl|my_center|LOCUS_05930 283099 280070 gene locus_tag LOCUS_05940 283099 280070 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185683234.1 protein_id gnl|my_center|LOCUS_05940 283365 284054 gene locus_tag LOCUS_05950 283365 284054 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640115.1 protein_id gnl|my_center|LOCUS_05950 284051 285055 gene locus_tag LOCUS_05960 284051 285055 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 protein_id gnl|my_center|LOCUS_05960 287527 285062 gene locus_tag LOCUS_05970 287527 285062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 287644 288876 gene locus_tag LOCUS_05980 287644 288876 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640418.1 protein_id gnl|my_center|LOCUS_05980 291264 288877 gene locus_tag LOCUS_05990 291264 288877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 292220 291279 gene locus_tag LOCUS_06000 292220 291279 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972993.1 protein_id gnl|my_center|LOCUS_06000 292720 292217 gene locus_tag LOCUS_06010 292720 292217 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388638.1 protein_id gnl|my_center|LOCUS_06010 296008 292862 gene locus_tag LOCUS_06020 296008 292862 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265524.1 protein_id gnl|my_center|LOCUS_06020 296296 297654 gene locus_tag LOCUS_06030 gene mgtE 296296 297654 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039061.1 protein_id gnl|my_center|LOCUS_06030 298518 297679 gene locus_tag LOCUS_06040 298518 297679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 299408 298605 gene locus_tag LOCUS_06050 299408 298605 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777089.1 protein_id gnl|my_center|LOCUS_06050 299650 300732 gene locus_tag LOCUS_06060 gene mgrA 299650 300732 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103110.1 protein_id gnl|my_center|LOCUS_06060 301247 303280 gene locus_tag LOCUS_06070 301247 303280 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895699.1 protein_id gnl|my_center|LOCUS_06070 303277 304656 gene locus_tag LOCUS_06080 303277 304656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 304717 305757 gene locus_tag LOCUS_06090 304717 305757 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313850.1 protein_id gnl|my_center|LOCUS_06090 305924 305848 gene locus_tag LOCUS_t00120 305924 305848 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 306038 305962 gene locus_tag LOCUS_t00130 306038 305962 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 306180 306710 gene locus_tag LOCUS_06100 306180 306710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 308911 306716 gene locus_tag LOCUS_06110 308911 306716 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966435.1 protein_id gnl|my_center|LOCUS_06110 310023 308941 gene locus_tag LOCUS_06120 gene hemB 310023 308941 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532258.1 protein_id gnl|my_center|LOCUS_06120 310022 310876 gene locus_tag LOCUS_06130 310022 310876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 312332 310890 gene locus_tag LOCUS_06140 312332 310890 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063168296.1 protein_id gnl|my_center|LOCUS_06140 313195 312329 gene locus_tag LOCUS_06150 313195 312329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 314088 313201 gene locus_tag LOCUS_06160 314088 313201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 316803 314119 gene locus_tag LOCUS_06170 gene alaS 316803 314119 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971929.1 protein_id gnl|my_center|LOCUS_06170 317581 316871 gene locus_tag LOCUS_06180 317581 316871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 318792 317536 gene locus_tag LOCUS_06190 gene mdpA 318792 317536 CDS product metallopeptidase MdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_06190 318870 320201 gene locus_tag LOCUS_06200 318870 320201 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180345374.1 protein_id gnl|my_center|LOCUS_06200 320845 320219 gene locus_tag LOCUS_06210 320845 320219 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_06210 322740 321904 gene locus_tag LOCUS_06220 322740 321904 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921324.1 protein_id gnl|my_center|LOCUS_06220 323889 322816 gene locus_tag LOCUS_06230 gene recA 323889 322816 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_06230 324819 323983 gene locus_tag LOCUS_06240 324819 323983 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110450429.1 protein_id gnl|my_center|LOCUS_06240 326402 324861 gene locus_tag LOCUS_06250 326402 324861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 328197 326428 gene locus_tag LOCUS_06260 328197 326428 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919211.1 protein_id gnl|my_center|LOCUS_06260 328227 328997 gene locus_tag LOCUS_06270 328227 328997 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171746.1 protein_id gnl|my_center|LOCUS_06270 328994 330865 gene locus_tag LOCUS_06280 328994 330865 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_06280 331069 331596 gene locus_tag LOCUS_06290 gene moaB 331069 331596 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388021.1 protein_id gnl|my_center|LOCUS_06290 331942 331598 gene locus_tag LOCUS_06300 331942 331598 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254609.1 protein_id gnl|my_center|LOCUS_06300 331983 333065 gene locus_tag LOCUS_06310 331983 333065 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974655.1 protein_id gnl|my_center|LOCUS_06310 333114 333248 gene locus_tag LOCUS_06320 333114 333248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 336974 333486 gene locus_tag LOCUS_06330 gene dnaE 336974 333486 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919792.1 protein_id gnl|my_center|LOCUS_06330 337065 337646 gene locus_tag LOCUS_06340 337065 337646 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172340.1 protein_id gnl|my_center|LOCUS_06340 338279 337800 gene locus_tag LOCUS_06350 338279 337800 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919598.1 protein_id gnl|my_center|LOCUS_06350 338869 338276 gene locus_tag LOCUS_06360 338869 338276 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037388.1 protein_id gnl|my_center|LOCUS_06360 339585 338866 gene locus_tag LOCUS_06370 339585 338866 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216122.1 protein_id gnl|my_center|LOCUS_06370 340828 339578 gene locus_tag LOCUS_06380 340828 339578 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018208662.1 protein_id gnl|my_center|LOCUS_06380 343792 341372 gene locus_tag LOCUS_06390 343792 341372 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639902.1 protein_id gnl|my_center|LOCUS_06390 344038 344514 gene locus_tag LOCUS_06400 344038 344514 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967943.1 protein_id gnl|my_center|LOCUS_06400 346970 345321 gene locus_tag LOCUS_06410 346970 345321 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975246.1 protein_id gnl|my_center|LOCUS_06410 347442 347077 gene locus_tag LOCUS_06420 347442 347077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 347682 348041 gene locus_tag LOCUS_06430 347682 348041 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533675.1 protein_id gnl|my_center|LOCUS_06430 347977 348351 gene locus_tag LOCUS_06440 347977 348351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 348348 349274 gene locus_tag LOCUS_06450 gene argC 348348 349274 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_06450 349298 350761 gene locus_tag LOCUS_06460 gene zwf 349298 350761 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530236.1 protein_id gnl|my_center|LOCUS_06460 350864 351574 gene locus_tag LOCUS_06470 gene pgl 350864 351574 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527053.1 protein_id gnl|my_center|LOCUS_06470 351571 353388 gene locus_tag LOCUS_06480 gene edd 351571 353388 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527741.1 protein_id gnl|my_center|LOCUS_06480 353410 354375 gene locus_tag LOCUS_06490 353410 354375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 354372 354989 gene locus_tag LOCUS_06500 354372 354989 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163029.1 protein_id gnl|my_center|LOCUS_06500 355206 355033 gene locus_tag LOCUS_06510 355206 355033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 355726 355430 gene locus_tag LOCUS_06520 355726 355430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 356187 355774 gene locus_tag LOCUS_06530 356187 355774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 356573 356226 gene locus_tag LOCUS_06540 356573 356226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 357123 356593 gene locus_tag LOCUS_06550 357123 356593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 357285 358160 gene locus_tag LOCUS_06560 gene blaBJP 357285 358160 CDS product subclass B3 metallo-beta-lactamase BJP-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088970.1 protein_id gnl|my_center|LOCUS_06560 359274 358306 gene locus_tag LOCUS_06570 gene mltG 359274 358306 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919550.1 protein_id gnl|my_center|LOCUS_06570 360947 359691 gene locus_tag LOCUS_06580 gene fabF 360947 359691 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086859.1 protein_id gnl|my_center|LOCUS_06580 361305 361069 gene locus_tag LOCUS_06590 361305 361069 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203723.1 protein_id gnl|my_center|LOCUS_06590 362209 361469 gene locus_tag LOCUS_06600 gene fabG 362209 361469 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919547.1 protein_id gnl|my_center|LOCUS_06600 362645 362223 gene locus_tag LOCUS_06610 362645 362223 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_06610 363651 362692 gene locus_tag LOCUS_06620 gene fabD 363651 362692 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388174.1 protein_id gnl|my_center|LOCUS_06620 363910 364320 gene locus_tag LOCUS_06630 363910 364320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 364320 364544 gene locus_tag LOCUS_06640 gene rpsR 364320 364544 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707461.1 protein_id gnl|my_center|LOCUS_06640 364558 365151 gene locus_tag LOCUS_06650 gene rplI 364558 365151 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919540.1 protein_id gnl|my_center|LOCUS_06650 365615 366889 gene locus_tag LOCUS_06660 365615 366889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 368614 366905 gene locus_tag LOCUS_06670 gene mutL 368614 366905 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090225.1 protein_id gnl|my_center|LOCUS_06670 368827 369867 gene locus_tag LOCUS_06680 368827 369867 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625945.1 protein_id gnl|my_center|LOCUS_06680 369892 370761 gene locus_tag LOCUS_06690 369892 370761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 370758 371282 gene locus_tag LOCUS_06700 370758 371282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 371285 373354 gene locus_tag LOCUS_06710 gene mrdA 371285 373354 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337401.1 protein_id gnl|my_center|LOCUS_06710 373351 374463 gene locus_tag LOCUS_06720 gene rodA 373351 374463 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_06720 374578 374653 gene locus_tag LOCUS_t00140 374578 374653 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 374735 375097 gene locus_tag LOCUS_06730 374735 375097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 375094 375765 gene locus_tag LOCUS_06740 375094 375765 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_06740 376078 375902 gene locus_tag LOCUS_06750 376078 375902 CDS product DUF4169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919404.1 protein_id gnl|my_center|LOCUS_06750 377451 376078 gene locus_tag LOCUS_06760 377451 376078 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003668.1 protein_id gnl|my_center|LOCUS_06760 377725 379164 gene locus_tag LOCUS_06770 377725 379164 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_06770 379657 379229 gene locus_tag LOCUS_06780 379657 379229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 379708 380316 gene locus_tag LOCUS_06790 379708 380316 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316393.1 protein_id gnl|my_center|LOCUS_06790 380461 380536 gene locus_tag LOCUS_t00150 380461 380536 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 380579 381247 gene locus_tag LOCUS_06800 380579 381247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483286.1 protein_id gnl|my_center|LOCUS_06800 382856 381249 gene locus_tag LOCUS_06810 382856 381249 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480502.1 protein_id gnl|my_center|LOCUS_06810 385822 383237 gene locus_tag LOCUS_06820 385822 383237 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036254.1 protein_id gnl|my_center|LOCUS_06820 385990 386943 gene locus_tag LOCUS_06830 385990 386943 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 protein_id gnl|my_center|LOCUS_06830 387469 386957 gene locus_tag LOCUS_06840 387469 386957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 387689 387492 gene locus_tag LOCUS_06850 387689 387492 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336845.1 protein_id gnl|my_center|LOCUS_06850 387908 388063 gene locus_tag LOCUS_06860 387908 388063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 389126 388734 gene locus_tag LOCUS_06870 389126 388734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 389746 389285 gene locus_tag LOCUS_06880 gene dksA 389746 389285 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531862.1 protein_id gnl|my_center|LOCUS_06880 390903 390490 gene locus_tag LOCUS_06890 390903 390490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 391200 390994 gene locus_tag LOCUS_06900 391200 390994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 391748 391233 gene locus_tag LOCUS_06910 391748 391233 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087415.1 protein_id gnl|my_center|LOCUS_06910 391839 393116 gene locus_tag LOCUS_06920 gene serS 391839 393116 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393416.1 protein_id gnl|my_center|LOCUS_06920 393116 393880 gene locus_tag LOCUS_06930 gene surE 393116 393880 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393414.1 protein_id gnl|my_center|LOCUS_06930 393881 395161 gene locus_tag LOCUS_06940 393881 395161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 395237 395659 gene locus_tag LOCUS_06950 395237 395659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 395769 396995 gene locus_tag LOCUS_06960 gene tyrS 395769 396995 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389785.1 protein_id gnl|my_center|LOCUS_06960 397612 397046 gene locus_tag LOCUS_06970 397612 397046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 398759 397827 gene locus_tag LOCUS_06980 398759 397827 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104189.1 protein_id gnl|my_center|LOCUS_06980 399215 400399 gene locus_tag LOCUS_06990 gene uxuA 399215 400399 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107776.1 protein_id gnl|my_center|LOCUS_06990 400396 401808 gene locus_tag LOCUS_07000 gene uxaC 400396 401808 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919364.1 protein_id gnl|my_center|LOCUS_07000 401805 403190 gene locus_tag LOCUS_07010 401805 403190 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529040.1 protein_id gnl|my_center|LOCUS_07010 403415 403140 gene locus_tag LOCUS_07020 403415 403140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 403894 404667 gene locus_tag LOCUS_07030 403894 404667 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975806.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence027 517 1053 gene locus_tag LOCUS_07040 517 1053 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085277.1 protein_id gnl|my_center|LOCUS_07040 1053 1508 gene locus_tag LOCUS_07050 1053 1508 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388118.1 protein_id gnl|my_center|LOCUS_07050 1544 2404 gene locus_tag LOCUS_07060 gene hemF 1544 2404 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918394.1 protein_id gnl|my_center|LOCUS_07060 2409 3002 gene locus_tag LOCUS_07070 2409 3002 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084228.1 protein_id gnl|my_center|LOCUS_07070 3733 2972 gene locus_tag LOCUS_07080 3733 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4602 3733 gene locus_tag LOCUS_07090 4602 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 4767 5438 gene locus_tag LOCUS_07100 gene lipB 4767 5438 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389749.1 protein_id gnl|my_center|LOCUS_07100 5530 5799 gene locus_tag LOCUS_07110 5530 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 6084 6803 gene locus_tag LOCUS_07120 6084 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 7003 8865 gene locus_tag LOCUS_07130 7003 8865 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365310.1 protein_id gnl|my_center|LOCUS_07130 9687 9409 gene locus_tag LOCUS_07140 9687 9409 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920053.1 protein_id gnl|my_center|LOCUS_07140 10161 9781 gene locus_tag LOCUS_07150 10161 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 10302 10703 gene locus_tag LOCUS_07160 10302 10703 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_07160 11476 10700 gene locus_tag LOCUS_07170 11476 10700 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886725.1 protein_id gnl|my_center|LOCUS_07170 11432 11632 gene locus_tag LOCUS_07180 11432 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 12737 11661 gene locus_tag LOCUS_07190 12737 11661 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038032.1 protein_id gnl|my_center|LOCUS_07190 15015 13174 gene locus_tag LOCUS_07200 gene typA 15015 13174 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_07200 18235 15275 gene locus_tag LOCUS_07210 18235 15275 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_07210 18436 19197 gene locus_tag LOCUS_07220 18436 19197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 19325 21121 gene locus_tag LOCUS_07230 19325 21121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 21219 21800 gene locus_tag LOCUS_07240 21219 21800 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337318.1 protein_id gnl|my_center|LOCUS_07240 21800 22390 gene locus_tag LOCUS_07250 21800 22390 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038689.1 protein_id gnl|my_center|LOCUS_07250 22398 23039 gene locus_tag LOCUS_07260 gene tsaB 22398 23039 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391510.1 protein_id gnl|my_center|LOCUS_07260 23039 23509 gene locus_tag LOCUS_07270 23039 23509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 23606 24028 gene locus_tag LOCUS_07280 23606 24028 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 protein_id gnl|my_center|LOCUS_07280 24028 24774 gene locus_tag LOCUS_07290 24028 24774 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086492769.1 protein_id gnl|my_center|LOCUS_07290 24957 26279 gene locus_tag LOCUS_07300 gene miaB 24957 26279 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339445.1 protein_id gnl|my_center|LOCUS_07300 26705 27703 gene locus_tag LOCUS_07310 26705 27703 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974256.1 protein_id gnl|my_center|LOCUS_07310 27718 27987 gene locus_tag LOCUS_07320 27718 27987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 27984 28397 gene locus_tag LOCUS_07330 27984 28397 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918525.1 protein_id gnl|my_center|LOCUS_07330 28394 28909 gene locus_tag LOCUS_07340 gene ybeY 28394 28909 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265493.1 protein_id gnl|my_center|LOCUS_07340 28919 29824 gene locus_tag LOCUS_07350 28919 29824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 29821 30267 gene locus_tag LOCUS_07360 29821 30267 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384944.1 protein_id gnl|my_center|LOCUS_07360 30878 32233 gene locus_tag LOCUS_07370 30878 32233 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268583.1 protein_id gnl|my_center|LOCUS_07370 32879 32250 gene locus_tag LOCUS_07380 32879 32250 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387809.1 protein_id gnl|my_center|LOCUS_07380 33368 33066 gene locus_tag LOCUS_07390 33368 33066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 33796 33365 gene locus_tag LOCUS_07400 33796 33365 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522995.1 protein_id gnl|my_center|LOCUS_07400 34030 35568 gene locus_tag LOCUS_07410 gene lnt 34030 35568 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391521.1 protein_id gnl|my_center|LOCUS_07410 35610 36809 gene locus_tag LOCUS_07420 gene metK 35610 36809 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917940.1 protein_id gnl|my_center|LOCUS_07420 37103 38281 gene locus_tag LOCUS_07430 37103 38281 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972778.1 protein_id gnl|my_center|LOCUS_07430 39135 38305 gene locus_tag LOCUS_07440 39135 38305 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187504868.1 protein_id gnl|my_center|LOCUS_07440 39200 39880 gene locus_tag LOCUS_07450 gene trmB 39200 39880 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391524.1 protein_id gnl|my_center|LOCUS_07450 40000 41241 gene locus_tag LOCUS_07460 40000 41241 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 protein_id gnl|my_center|LOCUS_07460 41331 42362 gene locus_tag LOCUS_07470 41331 42362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 42473 42670 gene locus_tag LOCUS_07480 42473 42670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 42674 42880 gene locus_tag LOCUS_07490 42674 42880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 42877 43248 gene locus_tag LOCUS_07500 42877 43248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 43245 43715 gene locus_tag LOCUS_07510 43245 43715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 43712 45814 gene locus_tag LOCUS_07520 43712 45814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 45904 46215 gene locus_tag LOCUS_07530 45904 46215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 46836 47654 gene locus_tag LOCUS_07540 46836 47654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 47654 48376 gene locus_tag LOCUS_07550 47654 48376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 48399 48632 gene locus_tag LOCUS_07560 48399 48632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 48632 51751 gene locus_tag LOCUS_07570 48632 51751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 53241 52084 gene locus_tag LOCUS_07580 53241 52084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 53696 53406 gene locus_tag LOCUS_07590 53696 53406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 54669 54271 gene locus_tag LOCUS_07600 54669 54271 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057679135.1 protein_id gnl|my_center|LOCUS_07600 55129 54926 gene locus_tag LOCUS_07610 55129 54926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 55334 55609 gene locus_tag LOCUS_07620 55334 55609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 55613 56182 gene locus_tag LOCUS_07630 55613 56182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 56186 56812 gene locus_tag LOCUS_07640 56186 56812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 56814 57107 gene locus_tag LOCUS_07650 56814 57107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 57109 57339 gene locus_tag LOCUS_07660 57109 57339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 57339 57608 gene locus_tag LOCUS_07670 57339 57608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 57661 57927 gene locus_tag LOCUS_07680 57661 57927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 57911 58507 gene locus_tag LOCUS_07690 57911 58507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 59260 58526 gene locus_tag LOCUS_07700 59260 58526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 59775 59572 gene locus_tag LOCUS_07710 59775 59572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 60968 60351 gene locus_tag LOCUS_07720 60968 60351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 61323 60961 gene locus_tag LOCUS_07730 61323 60961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 61846 61661 gene locus_tag LOCUS_07740 61846 61661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 61961 62416 gene locus_tag LOCUS_07750 61961 62416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 62497 62949 gene locus_tag LOCUS_07760 62497 62949 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 protein_id gnl|my_center|LOCUS_07760 62946 63347 gene locus_tag LOCUS_07770 62946 63347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 63371 64546 gene locus_tag LOCUS_07780 63371 64546 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528843.1 protein_id gnl|my_center|LOCUS_07780 64682 65041 gene locus_tag LOCUS_07790 64682 65041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 65140 67332 gene locus_tag LOCUS_07800 65140 67332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 67882 67511 gene locus_tag LOCUS_07810 67882 67511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 68010 68540 gene locus_tag LOCUS_07820 68010 68540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 69156 70370 gene locus_tag LOCUS_07830 69156 70370 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479620.1 protein_id gnl|my_center|LOCUS_07830 70375 71109 gene locus_tag LOCUS_07840 70375 71109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133495350.1 protein_id gnl|my_center|LOCUS_07840 72264 71239 gene locus_tag LOCUS_07850 gene ruvB 72264 71239 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529141.1 protein_id gnl|my_center|LOCUS_07850 72419 73312 gene locus_tag LOCUS_07860 72419 73312 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974076.1 protein_id gnl|my_center|LOCUS_07860 74005 73409 gene locus_tag LOCUS_07870 gene ruvA 74005 73409 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066857.1 protein_id gnl|my_center|LOCUS_07870 74212 74015 gene locus_tag LOCUS_07880 74212 74015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 74744 74232 gene locus_tag LOCUS_07890 gene ruvC 74744 74232 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388842.1 protein_id gnl|my_center|LOCUS_07890 75669 74926 gene locus_tag LOCUS_07900 75669 74926 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529113.1 protein_id gnl|my_center|LOCUS_07900 75812 77275 gene locus_tag LOCUS_07910 75812 77275 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969467.1 protein_id gnl|my_center|LOCUS_07910 77820 77365 gene locus_tag LOCUS_07920 77820 77365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 78273 78013 gene locus_tag LOCUS_07930 78273 78013 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529099.1 protein_id gnl|my_center|LOCUS_07930 78721 78419 gene locus_tag LOCUS_07940 78721 78419 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919372.1 protein_id gnl|my_center|LOCUS_07940 78794 80263 gene locus_tag LOCUS_07950 gene pyk 78794 80263 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123880295.1 protein_id gnl|my_center|LOCUS_07950 80650 84039 gene locus_tag LOCUS_07960 80650 84039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 84056 84988 gene locus_tag LOCUS_07970 gene cas1 84056 84988 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_07970 84985 85359 gene locus_tag LOCUS_07980 gene cas2 84985 85359 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040666777.1 protein_id gnl|my_center|LOCUS_07980 85433 86654 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agcatagccgctcagagattgcggtccagcgacaac >Feature sequence028 1152 562 gene locus_tag LOCUS_07990 1152 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265501.1 protein_id gnl|my_center|LOCUS_07990 1671 1252 gene locus_tag LOCUS_08000 1671 1252 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_08000 1776 2147 gene locus_tag LOCUS_08010 1776 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 2268 2648 gene locus_tag LOCUS_08020 2268 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 2645 3793 gene locus_tag LOCUS_08030 2645 3793 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112824.1 protein_id gnl|my_center|LOCUS_08030 3914 5755 gene locus_tag LOCUS_08040 3914 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 6410 6336 gene locus_tag LOCUS_t00160 6410 6336 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7329 6550 gene locus_tag LOCUS_08050 7329 6550 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967522.1 protein_id gnl|my_center|LOCUS_08050 8345 7326 gene locus_tag LOCUS_08060 gene moaA 8345 7326 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388276.1 protein_id gnl|my_center|LOCUS_08060 8519 10132 gene locus_tag LOCUS_08070 8519 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 10120 10545 gene locus_tag LOCUS_08080 10120 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 14151 10684 gene locus_tag LOCUS_08090 gene mfd 14151 10684 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207791417.1 protein_id gnl|my_center|LOCUS_08090 14601 14335 gene locus_tag LOCUS_08100 14601 14335 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640346.1 protein_id gnl|my_center|LOCUS_08100 14680 16734 gene locus_tag LOCUS_08110 gene recG 14680 16734 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 protein_id gnl|my_center|LOCUS_08110 16769 17209 gene locus_tag LOCUS_08120 16769 17209 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940309.1 protein_id gnl|my_center|LOCUS_08120 19503 17206 gene locus_tag LOCUS_08130 19503 17206 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068664.1 protein_id gnl|my_center|LOCUS_08130 20855 19500 gene locus_tag LOCUS_08140 20855 19500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 21459 21073 gene locus_tag LOCUS_08150 21459 21073 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336897.1 protein_id gnl|my_center|LOCUS_08150 22711 21452 gene locus_tag LOCUS_08160 22711 21452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 24868 22826 gene locus_tag LOCUS_08170 24868 22826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08170 25475 24915 gene locus_tag LOCUS_08180 25475 24915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 27515 25602 gene locus_tag LOCUS_08190 27515 25602 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_08190 27727 27654 gene locus_tag LOCUS_t00170 27727 27654 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 28059 27853 gene locus_tag LOCUS_08200 28059 27853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 28285 28953 gene locus_tag LOCUS_08210 28285 28953 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967576.1 protein_id gnl|my_center|LOCUS_08210 28959 30479 gene locus_tag LOCUS_08220 28959 30479 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919195.1 protein_id gnl|my_center|LOCUS_08220 30518 31093 gene locus_tag LOCUS_08230 gene popZ 30518 31093 CDS product pole-organizing protein PopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919196.1 protein_id gnl|my_center|LOCUS_08230 31375 31118 gene locus_tag LOCUS_08240 31375 31118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 31302 32792 gene locus_tag LOCUS_08250 31302 32792 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037563.1 protein_id gnl|my_center|LOCUS_08250 33014 35686 gene locus_tag LOCUS_08260 33014 35686 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919197.1 protein_id gnl|my_center|LOCUS_08260 37596 35821 gene locus_tag LOCUS_08270 37596 35821 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 protein_id gnl|my_center|LOCUS_08270 37709 38158 gene locus_tag LOCUS_08280 37709 38158 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265682.1 protein_id gnl|my_center|LOCUS_08280 39659 38439 gene locus_tag LOCUS_08290 39659 38439 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920379.1 protein_id gnl|my_center|LOCUS_08290 39813 40535 gene locus_tag LOCUS_08300 39813 40535 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971370.1 protein_id gnl|my_center|LOCUS_08300 40539 41351 gene locus_tag LOCUS_08310 gene pssA 40539 41351 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_08310 41526 41287 gene locus_tag LOCUS_08320 41526 41287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 41895 42704 gene locus_tag LOCUS_08330 gene rpsB 41895 42704 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975301.1 protein_id gnl|my_center|LOCUS_08330 42864 43799 gene locus_tag LOCUS_08340 gene tsf 42864 43799 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389462.1 protein_id gnl|my_center|LOCUS_08340 44229 44975 gene locus_tag LOCUS_08350 gene pyrH 44229 44975 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919787.1 protein_id gnl|my_center|LOCUS_08350 44979 45536 gene locus_tag LOCUS_08360 gene frr 44979 45536 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171750.1 protein_id gnl|my_center|LOCUS_08360 45533 46294 gene locus_tag LOCUS_08370 45533 46294 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971573.1 protein_id gnl|my_center|LOCUS_08370 46291 47115 gene locus_tag LOCUS_08380 46291 47115 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969257.1 protein_id gnl|my_center|LOCUS_08380 47115 48272 gene locus_tag LOCUS_08390 47115 48272 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 protein_id gnl|my_center|LOCUS_08390 48269 49405 gene locus_tag LOCUS_08400 gene rseP 48269 49405 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312540.1 protein_id gnl|my_center|LOCUS_08400 49485 52214 gene locus_tag LOCUS_08410 gene bamA 49485 52214 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640362.1 protein_id gnl|my_center|LOCUS_08410 52214 52888 gene locus_tag LOCUS_08420 52214 52888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 52898 53389 gene locus_tag LOCUS_08430 gene fabZ 52898 53389 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389471.1 protein_id gnl|my_center|LOCUS_08430 53484 53714 gene locus_tag LOCUS_08440 gene rpmE 53484 53714 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529118.1 protein_id gnl|my_center|LOCUS_08440 53851 54165 gene locus_tag LOCUS_08450 53851 54165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 54246 55649 gene locus_tag LOCUS_08460 54246 55649 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223712.1 protein_id gnl|my_center|LOCUS_08460 56456 55659 gene locus_tag LOCUS_08470 56456 55659 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038982.1 protein_id gnl|my_center|LOCUS_08470 58183 56627 gene locus_tag LOCUS_08480 58183 56627 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813155.1 protein_id gnl|my_center|LOCUS_08480 59370 58183 gene locus_tag LOCUS_08490 59370 58183 CDS product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205096.1 protein_id gnl|my_center|LOCUS_08490 60776 59367 gene locus_tag LOCUS_08500 60776 59367 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064132.1 protein_id gnl|my_center|LOCUS_08500 61225 60773 gene locus_tag LOCUS_08510 61225 60773 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192835.1 protein_id gnl|my_center|LOCUS_08510 61414 62961 gene locus_tag LOCUS_08520 61414 62961 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919439.1 protein_id gnl|my_center|LOCUS_08520 63119 65257 gene locus_tag LOCUS_08530 63119 65257 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206648.1 protein_id gnl|my_center|LOCUS_08530 67789 65303 gene locus_tag LOCUS_08540 67789 65303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 68762 68124 gene locus_tag LOCUS_08550 68762 68124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 69093 68788 gene locus_tag LOCUS_08560 69093 68788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 69002 69694 gene locus_tag LOCUS_08570 69002 69694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 69802 70479 gene locus_tag LOCUS_08580 69802 70479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 72035 70671 gene locus_tag LOCUS_08590 72035 70671 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265722.1 protein_id gnl|my_center|LOCUS_08590 74473 72254 gene locus_tag LOCUS_08600 74473 72254 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037857.1 protein_id gnl|my_center|LOCUS_08600 75420 74470 gene locus_tag LOCUS_08610 75420 74470 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037858.1 protein_id gnl|my_center|LOCUS_08610 75956 75417 gene locus_tag LOCUS_08620 75956 75417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 76447 76791 gene locus_tag LOCUS_08630 76447 76791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 76906 78507 gene locus_tag LOCUS_08640 76906 78507 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918673.1 protein_id gnl|my_center|LOCUS_08640 80084 78498 gene locus_tag LOCUS_08650 80084 78498 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528784.1 protein_id gnl|my_center|LOCUS_08650 80803 80081 gene locus_tag LOCUS_08660 80803 80081 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528783.1 protein_id gnl|my_center|LOCUS_08660 82344 80800 gene locus_tag LOCUS_08670 82344 80800 CDS product DUF4173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528782.1 protein_id gnl|my_center|LOCUS_08670 82680 82769 gene locus_tag LOCUS_t00180 82680 82769 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 83171 84415 gene locus_tag LOCUS_08680 83171 84415 CDS product reverse transcriptase/maturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459234.1 protein_id gnl|my_center|LOCUS_08680 84647 85690 gene locus_tag LOCUS_08690 84647 85690 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148650970.1 protein_id gnl|my_center|LOCUS_08690 85674 86357 gene locus_tag LOCUS_08700 85674 86357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 86389 87561 gene locus_tag LOCUS_08710 86389 87561 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_08710 87566 88540 gene locus_tag LOCUS_08720 87566 88540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 89358 88651 gene locus_tag LOCUS_08730 89358 88651 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532529.1 protein_id gnl|my_center|LOCUS_08730 90809 89358 gene locus_tag LOCUS_08740 gene purF 90809 89358 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532528.1 protein_id gnl|my_center|LOCUS_08740 90954 91205 gene locus_tag LOCUS_08750 90954 91205 CDS product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_08750 91242 91604 gene locus_tag LOCUS_08760 gene hisI 91242 91604 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534698.1 protein_id gnl|my_center|LOCUS_08760 91601 92110 gene locus_tag LOCUS_08770 91601 92110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 92143 92553 gene locus_tag LOCUS_08780 92143 92553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 93806 92559 gene locus_tag LOCUS_08790 93806 92559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 94765 93845 gene locus_tag LOCUS_08800 gene cysK 94765 93845 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645000.1 protein_id gnl|my_center|LOCUS_08800 96114 94762 gene locus_tag LOCUS_08810 96114 94762 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265542.1 protein_id gnl|my_center|LOCUS_08810 96274 97329 gene locus_tag LOCUS_08820 gene pdhA 96274 97329 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087551.1 protein_id gnl|my_center|LOCUS_08820 97331 98761 gene locus_tag LOCUS_08830 97331 98761 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337522.1 protein_id gnl|my_center|LOCUS_08830 98851 99543 gene locus_tag LOCUS_08840 98851 99543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 99806 100315 gene locus_tag LOCUS_08850 99806 100315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 101618 100224 gene locus_tag LOCUS_08860 gene trmFO 101618 100224 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389510.1 protein_id gnl|my_center|LOCUS_08860 101693 102127 gene locus_tag LOCUS_08870 101693 102127 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088388.1 protein_id gnl|my_center|LOCUS_08870 103418 102132 gene locus_tag LOCUS_08880 103418 102132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 103847 103497 gene locus_tag LOCUS_08890 103847 103497 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046762792.1 protein_id gnl|my_center|LOCUS_08890 106594 103844 gene locus_tag LOCUS_08900 gene gyrA 106594 103844 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389497.1 protein_id gnl|my_center|LOCUS_08900 107757 107059 gene locus_tag LOCUS_08910 107757 107059 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974210.1 protein_id gnl|my_center|LOCUS_08910 108509 107754 gene locus_tag LOCUS_08920 gene yaaA 108509 107754 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420750.1 protein_id gnl|my_center|LOCUS_08920 108679 109965 gene locus_tag LOCUS_08930 108679 109965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 110016 110261 gene locus_tag LOCUS_08940 110016 110261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 110912 110502 gene locus_tag LOCUS_08950 110912 110502 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722321.1 protein_id gnl|my_center|LOCUS_08950 110811 111020 gene locus_tag LOCUS_08960 110811 111020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 111162 113003 gene locus_tag LOCUS_08970 111162 113003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 113006 114007 gene locus_tag LOCUS_08980 113006 114007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 115088 114045 gene locus_tag LOCUS_08990 115088 114045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 115241 116629 gene locus_tag LOCUS_09000 115241 116629 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_09000 116626 118659 gene locus_tag LOCUS_09010 116626 118659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 118705 119523 gene locus_tag LOCUS_09020 118705 119523 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531304.1 protein_id gnl|my_center|LOCUS_09020 119642 119718 gene locus_tag LOCUS_t00190 119642 119718 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 119792 120343 gene locus_tag LOCUS_09030 gene pnuC 119792 120343 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_09030 120325 120867 gene locus_tag LOCUS_09040 120325 120867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 120906 122717 gene locus_tag LOCUS_09050 gene lepA 120906 122717 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640125.1 protein_id gnl|my_center|LOCUS_09050 123119 122763 gene locus_tag LOCUS_09060 123119 122763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 126759 123352 gene locus_tag LOCUS_09070 126759 123352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 126957 127706 gene locus_tag LOCUS_09080 gene modA 126957 127706 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038306.1 protein_id gnl|my_center|LOCUS_09080 127714 128403 gene locus_tag LOCUS_09090 gene modB 127714 128403 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217231.1 protein_id gnl|my_center|LOCUS_09090 128393 128998 gene locus_tag LOCUS_09100 gene modC 128393 128998 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038308.1 protein_id gnl|my_center|LOCUS_09100 131247 129004 gene locus_tag LOCUS_09110 gene bglX 131247 129004 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640149.1 protein_id gnl|my_center|LOCUS_09110 132108 131326 gene locus_tag LOCUS_09120 132108 131326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 133086 132196 gene locus_tag LOCUS_09130 133086 132196 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640265.1 protein_id gnl|my_center|LOCUS_09130 133554 133727 gene locus_tag LOCUS_09140 133554 133727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 134372 133827 gene locus_tag LOCUS_09150 gene rpsI 134372 133827 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087725.1 protein_id gnl|my_center|LOCUS_09150 134851 134372 gene locus_tag LOCUS_09160 gene rplM 134851 134372 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532205.1 protein_id gnl|my_center|LOCUS_09160 136029 134974 gene locus_tag LOCUS_09170 136029 134974 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087731.1 protein_id gnl|my_center|LOCUS_09170 136137 136565 gene locus_tag LOCUS_09180 136137 136565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 136575 137042 gene locus_tag LOCUS_09190 gene zur 136575 137042 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707398.1 protein_id gnl|my_center|LOCUS_09190 137789 137244 gene locus_tag LOCUS_09200 137789 137244 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640141.1 protein_id gnl|my_center|LOCUS_09200 137868 139793 gene locus_tag LOCUS_09210 gene dxs 137868 139793 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175335.1 protein_id gnl|my_center|LOCUS_09210 139790 139975 gene locus_tag LOCUS_09220 139790 139975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 141318 140638 gene locus_tag LOCUS_09230 141318 140638 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920046.1 protein_id gnl|my_center|LOCUS_09230 141467 142201 gene locus_tag LOCUS_09240 141467 142201 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_09240 142290 142841 gene locus_tag LOCUS_09250 142290 142841 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 protein_id gnl|my_center|LOCUS_09250 142864 143145 gene locus_tag LOCUS_09260 142864 143145 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722325.1 protein_id gnl|my_center|LOCUS_09260 143284 143787 gene locus_tag LOCUS_09270 143284 143787 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_09270 143784 144584 gene locus_tag LOCUS_09280 gene proC 143784 144584 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391029.1 protein_id gnl|my_center|LOCUS_09280 145085 144588 gene locus_tag LOCUS_09290 145085 144588 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09290 145260 146240 gene locus_tag LOCUS_09300 145260 146240 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968435.1 protein_id gnl|my_center|LOCUS_09300 146303 146377 gene locus_tag LOCUS_t00200 146303 146377 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 146585 147898 gene locus_tag LOCUS_09310 146585 147898 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338075.1 protein_id gnl|my_center|LOCUS_09310 147983 148765 gene locus_tag LOCUS_09320 147983 148765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 148874 149176 gene locus_tag LOCUS_09330 148874 149176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 149628 149464 gene locus_tag LOCUS_09340 149628 149464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence029 3265 359 gene locus_tag LOCUS_09350 3265 359 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275368.1 protein_id gnl|my_center|LOCUS_09350 4601 3546 gene locus_tag LOCUS_09360 4601 3546 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_09360 5527 4598 gene locus_tag LOCUS_09370 5527 4598 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_09370 5830 6411 gene locus_tag LOCUS_09380 5830 6411 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 protein_id gnl|my_center|LOCUS_09380 6408 7619 gene locus_tag LOCUS_09390 6408 7619 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160926.1 protein_id gnl|my_center|LOCUS_09390 7700 8317 gene locus_tag LOCUS_09400 7700 8317 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227753.1 protein_id gnl|my_center|LOCUS_09400 8594 9841 gene locus_tag LOCUS_09410 8594 9841 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265576.1 protein_id gnl|my_center|LOCUS_09410 9870 12350 gene locus_tag LOCUS_09420 gene nirB 9870 12350 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918501.1 protein_id gnl|my_center|LOCUS_09420 12347 12700 gene locus_tag LOCUS_09430 gene nirD 12347 12700 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640019.1 protein_id gnl|my_center|LOCUS_09430 12834 15434 gene locus_tag LOCUS_09440 12834 15434 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 protein_id gnl|my_center|LOCUS_09440 15421 16212 gene locus_tag LOCUS_09450 gene cobA 15421 16212 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919002.1 protein_id gnl|my_center|LOCUS_09450 16304 16220 gene locus_tag LOCUS_t00210 16304 16220 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16624 16370 gene locus_tag LOCUS_09460 16624 16370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 18241 16727 gene locus_tag LOCUS_09470 18241 16727 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391336.1 protein_id gnl|my_center|LOCUS_09470 18627 19043 gene locus_tag LOCUS_09480 18627 19043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 19040 19258 gene locus_tag LOCUS_09490 gene yidD 19040 19258 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214730.1 protein_id gnl|my_center|LOCUS_09490 19277 20974 gene locus_tag LOCUS_09500 gene yidC 19277 20974 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391086.1 protein_id gnl|my_center|LOCUS_09500 20971 21645 gene locus_tag LOCUS_09510 gene yihA 20971 21645 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391087.1 protein_id gnl|my_center|LOCUS_09510 21751 22413 gene locus_tag LOCUS_09520 21751 22413 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_09520 22686 22525 gene locus_tag LOCUS_09530 22686 22525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 22846 23961 gene locus_tag LOCUS_09540 gene dapE 22846 23961 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918164.1 protein_id gnl|my_center|LOCUS_09540 24466 23939 gene locus_tag LOCUS_09550 24466 23939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 25871 24492 gene locus_tag LOCUS_09560 25871 24492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 26537 25887 gene locus_tag LOCUS_09570 26537 25887 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 protein_id gnl|my_center|LOCUS_09570 26731 27237 gene locus_tag LOCUS_09580 gene secB 26731 27237 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083468.1 protein_id gnl|my_center|LOCUS_09580 27251 28828 gene locus_tag LOCUS_09590 gene murJ 27251 28828 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_09590 28837 29844 gene locus_tag LOCUS_09600 gene trpS 28837 29844 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167073066.1 protein_id gnl|my_center|LOCUS_09600 32185 30650 gene locus_tag LOCUS_09610 gene dnaA 32185 30650 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387762.1 protein_id gnl|my_center|LOCUS_09610 32916 32653 gene locus_tag LOCUS_09620 gene rpsT 32916 32653 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721915.1 protein_id gnl|my_center|LOCUS_09620 33852 33004 gene locus_tag LOCUS_09630 gene mutM 33852 33004 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338891.1 protein_id gnl|my_center|LOCUS_09630 33925 34656 gene locus_tag LOCUS_09640 gene ubiE 33925 34656 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083584.1 protein_id gnl|my_center|LOCUS_09640 34699 36234 gene locus_tag LOCUS_09650 gene ubiB 34699 36234 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083583.1 protein_id gnl|my_center|LOCUS_09650 36237 37331 gene locus_tag LOCUS_09660 36237 37331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 37328 38521 gene locus_tag LOCUS_09670 gene coaBC 37328 38521 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923348.1 protein_id gnl|my_center|LOCUS_09670 38518 38967 gene locus_tag LOCUS_09680 gene dut 38518 38967 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968516.1 protein_id gnl|my_center|LOCUS_09680 38964 39383 gene locus_tag LOCUS_09690 38964 39383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 39380 40138 gene locus_tag LOCUS_09700 gene moeB 39380 40138 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083588.1 protein_id gnl|my_center|LOCUS_09700 40111 40482 gene locus_tag LOCUS_09710 40111 40482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 41680 40820 gene locus_tag LOCUS_09720 gene galU 41680 40820 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313444.1 protein_id gnl|my_center|LOCUS_09720 41793 42923 gene locus_tag LOCUS_09730 gene wecB 41793 42923 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703970.1 protein_id gnl|my_center|LOCUS_09730 42907 44175 gene locus_tag LOCUS_09740 gene vpsB 42907 44175 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase VpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482531.1 protein_id gnl|my_center|LOCUS_09740 44255 45013 gene locus_tag LOCUS_09750 44255 45013 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390859.1 protein_id gnl|my_center|LOCUS_09750 45175 45447 gene locus_tag LOCUS_09760 45175 45447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 46678 46166 gene locus_tag LOCUS_09770 46678 46166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 47096 46890 gene locus_tag LOCUS_09780 47096 46890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 47428 48903 gene locus_tag LOCUS_09790 gene cysS 47428 48903 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_09790 49303 48989 gene locus_tag LOCUS_09800 49303 48989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 51317 49467 gene locus_tag LOCUS_09810 51317 49467 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640680.1 protein_id gnl|my_center|LOCUS_09810 52479 51436 gene locus_tag LOCUS_09820 52479 51436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 52675 54048 gene locus_tag LOCUS_09830 52675 54048 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086559.1 protein_id gnl|my_center|LOCUS_09830 54172 54246 gene locus_tag LOCUS_t00220 54172 54246 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 55894 54506 gene locus_tag LOCUS_09840 55894 54506 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338979.1 protein_id gnl|my_center|LOCUS_09840 56250 55945 gene locus_tag LOCUS_09850 56250 55945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 56686 56258 gene locus_tag LOCUS_09860 56686 56258 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920951.1 protein_id gnl|my_center|LOCUS_09860 56839 57768 gene locus_tag LOCUS_09870 56839 57768 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086181.1 protein_id gnl|my_center|LOCUS_09870 59025 57823 gene locus_tag LOCUS_09880 gene pcaF 59025 57823 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402686.1 protein_id gnl|my_center|LOCUS_09880 59669 59022 gene locus_tag LOCUS_09890 59669 59022 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920264.1 protein_id gnl|my_center|LOCUS_09890 60379 59666 gene locus_tag LOCUS_09900 60379 59666 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640487.1 protein_id gnl|my_center|LOCUS_09900 61318 60428 gene locus_tag LOCUS_09910 gene pcaD 61318 60428 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337348.1 protein_id gnl|my_center|LOCUS_09910 62834 61347 gene locus_tag LOCUS_09920 62834 61347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 63810 62917 gene locus_tag LOCUS_09930 63810 62917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 64623 63841 gene locus_tag LOCUS_09940 64623 63841 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087565.1 protein_id gnl|my_center|LOCUS_09940 65600 64629 gene locus_tag LOCUS_09950 65600 64629 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085601.1 protein_id gnl|my_center|LOCUS_09950 66535 65600 gene locus_tag LOCUS_09960 66535 65600 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_09960 67358 66540 gene locus_tag LOCUS_09970 67358 66540 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_09970 67947 67387 gene locus_tag LOCUS_09980 67947 67387 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229034.1 protein_id gnl|my_center|LOCUS_09980 69239 67944 gene locus_tag LOCUS_09990 69239 67944 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480112.1 protein_id gnl|my_center|LOCUS_09990 69494 70420 gene locus_tag LOCUS_10000 69494 70420 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727136.1 protein_id gnl|my_center|LOCUS_10000 71542 70421 gene locus_tag LOCUS_10010 71542 70421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 73515 71545 gene locus_tag LOCUS_10020 73515 71545 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_10020 75962 73539 gene locus_tag LOCUS_10030 75962 73539 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_10030 76516 76100 gene locus_tag LOCUS_10040 76516 76100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 76832 77761 gene locus_tag LOCUS_10050 76832 77761 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114464.1 protein_id gnl|my_center|LOCUS_10050 77758 78558 gene locus_tag LOCUS_10060 77758 78558 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114463.1 protein_id gnl|my_center|LOCUS_10060 79672 78566 gene locus_tag LOCUS_10070 79672 78566 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090209.1 protein_id gnl|my_center|LOCUS_10070 81567 79669 gene locus_tag LOCUS_10080 81567 79669 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106714628.1 protein_id gnl|my_center|LOCUS_10080 82483 81713 gene locus_tag LOCUS_10090 82483 81713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 83912 82755 gene locus_tag LOCUS_10100 83912 82755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 83984 84490 gene locus_tag LOCUS_10110 83984 84490 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967076.1 protein_id gnl|my_center|LOCUS_10110 84487 85167 gene locus_tag LOCUS_10120 84487 85167 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970029.1 protein_id gnl|my_center|LOCUS_10120 86971 85175 gene locus_tag LOCUS_10130 86971 85175 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527892.1 protein_id gnl|my_center|LOCUS_10130 89286 86992 gene locus_tag LOCUS_10140 89286 86992 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928491.1 protein_id gnl|my_center|LOCUS_10140 92116 89372 gene locus_tag LOCUS_10150 92116 89372 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038616.1 protein_id gnl|my_center|LOCUS_10150 92216 93655 gene locus_tag LOCUS_10160 92216 93655 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185957.1 protein_id gnl|my_center|LOCUS_10160 94904 93645 gene locus_tag LOCUS_10170 94904 93645 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038798.1 protein_id gnl|my_center|LOCUS_10170 96340 94901 gene locus_tag LOCUS_10180 96340 94901 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038799.1 protein_id gnl|my_center|LOCUS_10180 97146 96337 gene locus_tag LOCUS_10190 97146 96337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038800.1 protein_id gnl|my_center|LOCUS_10190 99149 97389 gene locus_tag LOCUS_10200 99149 97389 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994202.1 protein_id gnl|my_center|LOCUS_10200 99334 101436 gene locus_tag LOCUS_10210 99334 101436 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919391.1 protein_id gnl|my_center|LOCUS_10210 101660 104062 gene locus_tag LOCUS_10220 101660 104062 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_10220 104095 105348 gene locus_tag LOCUS_10230 104095 105348 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_10230 105990 105439 gene locus_tag LOCUS_10240 105990 105439 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029670.1 protein_id gnl|my_center|LOCUS_10240 106087 106779 gene locus_tag LOCUS_10250 106087 106779 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268672.1 protein_id gnl|my_center|LOCUS_10250 106785 107333 gene locus_tag LOCUS_10260 106785 107333 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942408.1 protein_id gnl|my_center|LOCUS_10260 107330 108445 gene locus_tag LOCUS_10270 107330 108445 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784109.1 protein_id gnl|my_center|LOCUS_10270 108963 108442 gene locus_tag LOCUS_10280 108963 108442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 110027 108960 gene locus_tag LOCUS_10290 110027 108960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 110260 111483 gene locus_tag LOCUS_10300 110260 111483 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_10300 111625 112218 gene locus_tag LOCUS_10310 111625 112218 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265507.1 protein_id gnl|my_center|LOCUS_10310 112280 112741 gene locus_tag LOCUS_10320 112280 112741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 112809 114101 gene locus_tag LOCUS_10330 112809 114101 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639895.1 protein_id gnl|my_center|LOCUS_10330 114115 116274 gene locus_tag LOCUS_10340 114115 116274 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_10340 116315 116908 gene locus_tag LOCUS_10350 116315 116908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 118200 116842 gene locus_tag LOCUS_10360 118200 116842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 119654 118251 gene locus_tag LOCUS_10370 119654 118251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 120100 119651 gene locus_tag LOCUS_10380 120100 119651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 121437 120196 gene locus_tag LOCUS_10390 121437 120196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 122832 121450 gene locus_tag LOCUS_10400 122832 121450 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403725.1 protein_id gnl|my_center|LOCUS_10400 123082 123288 gene locus_tag LOCUS_10410 123082 123288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 123410 124480 gene locus_tag LOCUS_10420 123410 124480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 125560 124496 gene locus_tag LOCUS_10430 125560 124496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 125672 126553 gene locus_tag LOCUS_10440 125672 126553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 128074 126563 gene locus_tag LOCUS_10450 128074 126563 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528104.1 protein_id gnl|my_center|LOCUS_10450 128167 129225 gene locus_tag LOCUS_10460 128167 129225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 129319 130515 gene locus_tag LOCUS_10470 129319 130515 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061719.1 protein_id gnl|my_center|LOCUS_10470 130515 131228 gene locus_tag LOCUS_10480 130515 131228 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061718.1 protein_id gnl|my_center|LOCUS_10480 132515 131394 gene locus_tag LOCUS_10490 132515 131394 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878480.1 protein_id gnl|my_center|LOCUS_10490 132716 133681 gene locus_tag LOCUS_10500 132716 133681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 133681 134196 gene locus_tag LOCUS_10510 133681 134196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 136488 134335 gene locus_tag LOCUS_10520 136488 134335 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 protein_id gnl|my_center|LOCUS_10520 136627 139128 gene locus_tag LOCUS_10530 136627 139128 CDS product sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112851.1 protein_id gnl|my_center|LOCUS_10530 140221 139400 gene locus_tag LOCUS_10540 140221 139400 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200872.1 protein_id gnl|my_center|LOCUS_10540 141438 140290 gene locus_tag LOCUS_10550 141438 140290 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330392.1 protein_id gnl|my_center|LOCUS_10550 141437 141775 gene locus_tag LOCUS_10560 141437 141775 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369371.1 protein_id gnl|my_center|LOCUS_10560 143148 141925 gene locus_tag LOCUS_10570 143148 141925 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200876.1 protein_id gnl|my_center|LOCUS_10570 143447 143145 gene locus_tag LOCUS_10580 143447 143145 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361279.1 protein_id gnl|my_center|LOCUS_10580 144475 143444 gene locus_tag LOCUS_10590 144475 143444 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_10590 145359 144472 gene locus_tag LOCUS_10600 145359 144472 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027042.1 protein_id gnl|my_center|LOCUS_10600 146087 145356 gene locus_tag LOCUS_10610 146087 145356 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255254.1 protein_id gnl|my_center|LOCUS_10610 147399 146089 gene locus_tag LOCUS_10620 gene fucP 147399 146089 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039140.1 protein_id gnl|my_center|LOCUS_10620 148273 147518 gene locus_tag LOCUS_10630 148273 147518 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_10630 149327 148335 gene locus_tag LOCUS_10640 149327 148335 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969966.1 protein_id gnl|my_center|LOCUS_10640 150180 149335 gene locus_tag LOCUS_10650 150180 149335 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200879.1 protein_id gnl|my_center|LOCUS_10650 151026 150286 gene locus_tag LOCUS_10660 151026 150286 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640673.1 protein_id gnl|my_center|LOCUS_10660 151997 151023 gene locus_tag LOCUS_10670 151997 151023 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810126.1 protein_id gnl|my_center|LOCUS_10670 152203 153222 gene locus_tag LOCUS_10680 152203 153222 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_10680 155247 154219 gene locus_tag LOCUS_10690 155247 154219 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920901.1 protein_id gnl|my_center|LOCUS_10690 156991 155309 gene locus_tag LOCUS_10700 156991 155309 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537425.1 protein_id gnl|my_center|LOCUS_10700 157955 157122 gene locus_tag LOCUS_10710 157955 157122 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_10710 158542 157952 gene locus_tag LOCUS_10720 gene lacC 158542 157952 CDS product lactose 3-dehydrogenase subunit gamma LacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_10720 159354 158539 gene locus_tag LOCUS_10730 159354 158539 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_10730 160286 159366 gene locus_tag LOCUS_10740 160286 159366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 161587 160283 gene locus_tag LOCUS_10750 161587 160283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 162816 161749 gene locus_tag LOCUS_10760 162816 161749 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_10760 163202 162813 gene locus_tag LOCUS_10770 163202 162813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 163322 164494 gene locus_tag LOCUS_10780 163322 164494 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919503.1 protein_id gnl|my_center|LOCUS_10780 164588 165364 gene locus_tag LOCUS_10790 164588 165364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 165819 165370 gene locus_tag LOCUS_10800 165819 165370 CDS product DUF4126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275228.1 protein_id gnl|my_center|LOCUS_10800 165922 166119 gene locus_tag LOCUS_10810 165922 166119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 166127 167083 gene locus_tag LOCUS_10820 166127 167083 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195516.1 protein_id gnl|my_center|LOCUS_10820 167142 167537 gene locus_tag LOCUS_10830 167142 167537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 169540 167519 gene locus_tag LOCUS_10840 169540 167519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 171008 169617 gene locus_tag LOCUS_10850 171008 169617 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 protein_id gnl|my_center|LOCUS_10850 171193 172473 gene locus_tag LOCUS_10860 gene aceA 171193 172473 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527089.1 protein_id gnl|my_center|LOCUS_10860 172503 172661 gene locus_tag LOCUS_10870 172503 172661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 172955 173914 gene locus_tag LOCUS_10880 172955 173914 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_10880 173923 174600 gene locus_tag LOCUS_10890 173923 174600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 175178 174507 gene locus_tag LOCUS_10900 175178 174507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 175963 175178 gene locus_tag LOCUS_10910 175963 175178 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084304.1 protein_id gnl|my_center|LOCUS_10910 176088 176990 gene locus_tag LOCUS_10920 176088 176990 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267527.1 protein_id gnl|my_center|LOCUS_10920 178118 177135 gene locus_tag LOCUS_10930 178118 177135 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919882.1 protein_id gnl|my_center|LOCUS_10930 179467 178220 gene locus_tag LOCUS_10940 179467 178220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 179714 179789 gene locus_tag LOCUS_t00230 179714 179789 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 179893 180666 gene locus_tag LOCUS_10950 179893 180666 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920181.1 protein_id gnl|my_center|LOCUS_10950 180666 181397 gene locus_tag LOCUS_10960 180666 181397 CDS product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765937.1 protein_id gnl|my_center|LOCUS_10960 181978 181454 gene locus_tag LOCUS_10970 181978 181454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 182479 182192 gene locus_tag LOCUS_10980 182479 182192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 183320 182541 gene locus_tag LOCUS_10990 183320 182541 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109099858.1 protein_id gnl|my_center|LOCUS_10990 184143 183397 gene locus_tag LOCUS_11000 184143 183397 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508710.1 protein_id gnl|my_center|LOCUS_11000 184266 184826 gene locus_tag LOCUS_11010 gene thpR 184266 184826 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_11010 184819 185415 gene locus_tag LOCUS_11020 184819 185415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 185483 186145 gene locus_tag LOCUS_11030 185483 186145 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529016.1 protein_id gnl|my_center|LOCUS_11030 186732 186379 gene locus_tag LOCUS_11040 186732 186379 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390318.1 protein_id gnl|my_center|LOCUS_11040 187193 186735 gene locus_tag LOCUS_11050 187193 186735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 188395 187190 gene locus_tag LOCUS_11060 188395 187190 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958175.1 protein_id gnl|my_center|LOCUS_11060 189620 188541 gene locus_tag LOCUS_11070 gene sufD 189620 188541 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087113.1 protein_id gnl|my_center|LOCUS_11070 190500 189757 gene locus_tag LOCUS_11080 gene sufC 190500 189757 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919728.1 protein_id gnl|my_center|LOCUS_11080 190823 190500 gene locus_tag LOCUS_11090 190823 190500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 192286 190823 gene locus_tag LOCUS_11100 gene sufB 192286 190823 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_11100 192741 192286 gene locus_tag LOCUS_11110 192741 192286 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_11110 194025 192979 gene locus_tag LOCUS_11120 194025 192979 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919943.1 protein_id gnl|my_center|LOCUS_11120 194235 194159 gene locus_tag LOCUS_t00240 194235 194159 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 195022 194300 gene locus_tag LOCUS_11130 195022 194300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 195495 195022 gene locus_tag LOCUS_11140 195495 195022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 196589 195492 gene locus_tag LOCUS_11150 gene gspL 196589 195492 CDS product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038515.1 protein_id gnl|my_center|LOCUS_11150 197563 196574 gene locus_tag LOCUS_11160 gene gspK 197563 196574 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038516.1 protein_id gnl|my_center|LOCUS_11160 198245 197556 gene locus_tag LOCUS_11170 gene gspJ 198245 197556 CDS product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038517.1 protein_id gnl|my_center|LOCUS_11170 198670 198317 gene locus_tag LOCUS_11180 198670 198317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 199436 198846 gene locus_tag LOCUS_11190 199436 198846 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639898.1 protein_id gnl|my_center|LOCUS_11190 199888 199433 gene locus_tag LOCUS_11200 gene gspG 199888 199433 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038520.1 protein_id gnl|my_center|LOCUS_11200 201124 199901 gene locus_tag LOCUS_11210 gene gspF 201124 199901 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918064.1 protein_id gnl|my_center|LOCUS_11210 201515 201126 gene locus_tag LOCUS_11220 201515 201126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 203125 201512 gene locus_tag LOCUS_11230 gene gspE 203125 201512 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918063.1 protein_id gnl|my_center|LOCUS_11230 205340 203118 gene locus_tag LOCUS_11240 gene gspD 205340 203118 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918062.1 protein_id gnl|my_center|LOCUS_11240 206170 205337 gene locus_tag LOCUS_11250 206170 205337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 206276 206947 gene locus_tag LOCUS_11260 206276 206947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 210353 207513 gene locus_tag LOCUS_11270 210353 207513 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918060.1 protein_id gnl|my_center|LOCUS_11270 212098 210467 gene locus_tag LOCUS_11280 212098 210467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence030 1306 326 gene locus_tag LOCUS_11290 1306 326 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919530.1 protein_id gnl|my_center|LOCUS_11290 2240 1770 gene locus_tag LOCUS_11300 2240 1770 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975746.1 protein_id gnl|my_center|LOCUS_11300 2349 3485 gene locus_tag LOCUS_11310 2349 3485 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921657.1 protein_id gnl|my_center|LOCUS_11310 3482 5497 gene locus_tag LOCUS_11320 gene prlC 3482 5497 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209531.1 protein_id gnl|my_center|LOCUS_11320 5666 7126 gene locus_tag LOCUS_11330 5666 7126 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918316.1 protein_id gnl|my_center|LOCUS_11330 7735 7660 gene locus_tag LOCUS_t00250 7735 7660 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7886 7811 gene locus_tag LOCUS_t00260 7886 7811 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8297 7974 gene locus_tag LOCUS_11340 8297 7974 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388049.1 protein_id gnl|my_center|LOCUS_11340 8393 9724 gene locus_tag LOCUS_11350 gene aroA 8393 9724 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057817833.1 protein_id gnl|my_center|LOCUS_11350 9721 10356 gene locus_tag LOCUS_11360 gene cmk 9721 10356 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083564.1 protein_id gnl|my_center|LOCUS_11360 10742 12451 gene locus_tag LOCUS_11370 gene rpsA 10742 12451 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534399.1 protein_id gnl|my_center|LOCUS_11370 12596 12880 gene locus_tag LOCUS_11380 gene ihfB 12596 12880 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383532.1 protein_id gnl|my_center|LOCUS_11380 12991 13074 gene locus_tag LOCUS_t00270 12991 13074 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13212 14513 gene locus_tag LOCUS_11390 13212 14513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 14519 14938 gene locus_tag LOCUS_11400 14519 14938 CDS product DUF4112 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061781412.1 protein_id gnl|my_center|LOCUS_11400 15656 14949 gene locus_tag LOCUS_11410 15656 14949 CDS product ribonuclease T(2) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917920.1 protein_id gnl|my_center|LOCUS_11410 16048 15653 gene locus_tag LOCUS_11420 16048 15653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 16919 16083 gene locus_tag LOCUS_11430 gene nadC 16919 16083 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_11430 17902 16916 gene locus_tag LOCUS_11440 gene nadA 17902 16916 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_11440 18701 17958 gene locus_tag LOCUS_11450 18701 17958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 19546 18686 gene locus_tag LOCUS_11460 19546 18686 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965893.1 protein_id gnl|my_center|LOCUS_11460 21229 19625 gene locus_tag LOCUS_11470 21229 19625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 21594 21226 gene locus_tag LOCUS_11480 21594 21226 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921336.1 protein_id gnl|my_center|LOCUS_11480 22073 21750 gene locus_tag LOCUS_11490 gene grxD 22073 21750 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125804.1 protein_id gnl|my_center|LOCUS_11490 22346 22098 gene locus_tag LOCUS_11500 22346 22098 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088461.1 protein_id gnl|my_center|LOCUS_11500 22671 22348 gene locus_tag LOCUS_11510 22671 22348 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920348.1 protein_id gnl|my_center|LOCUS_11510 23698 23087 gene locus_tag LOCUS_11520 gene leuD 23698 23087 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721055.1 protein_id gnl|my_center|LOCUS_11520 25321 23885 gene locus_tag LOCUS_11530 gene leuC 25321 23885 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 protein_id gnl|my_center|LOCUS_11530 26184 25495 gene locus_tag LOCUS_11540 26184 25495 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532554.1 protein_id gnl|my_center|LOCUS_11540 26819 26184 gene locus_tag LOCUS_11550 26819 26184 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920264.1 protein_id gnl|my_center|LOCUS_11550 27676 26822 gene locus_tag LOCUS_11560 27676 26822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 28573 27872 gene locus_tag LOCUS_11570 28573 27872 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722857.1 protein_id gnl|my_center|LOCUS_11570 28720 30369 gene locus_tag LOCUS_11580 28720 30369 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925994.1 protein_id gnl|my_center|LOCUS_11580 30791 30597 gene locus_tag LOCUS_11590 30791 30597 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085193.1 protein_id gnl|my_center|LOCUS_11590 31880 30870 gene locus_tag LOCUS_11600 gene thiS 31880 30870 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390185.1 protein_id gnl|my_center|LOCUS_11600 31997 32431 gene locus_tag LOCUS_11610 gene aroQ 31997 32431 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533076.1 protein_id gnl|my_center|LOCUS_11610 32446 32934 gene locus_tag LOCUS_11620 gene accB 32446 32934 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087064.1 protein_id gnl|my_center|LOCUS_11620 32941 34293 gene locus_tag LOCUS_11630 gene accC 32941 34293 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 protein_id gnl|my_center|LOCUS_11630 34501 34836 gene locus_tag LOCUS_11640 gene arsC 34501 34836 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092775.1 protein_id gnl|my_center|LOCUS_11640 34997 35335 gene locus_tag LOCUS_11650 34997 35335 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 protein_id gnl|my_center|LOCUS_11650 35447 36859 gene locus_tag LOCUS_11660 gene glnA 35447 36859 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328343.1 protein_id gnl|my_center|LOCUS_11660 37632 40178 gene locus_tag LOCUS_11670 37632 40178 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265514.1 protein_id gnl|my_center|LOCUS_11670 40847 40230 gene locus_tag LOCUS_11680 40847 40230 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919214.1 protein_id gnl|my_center|LOCUS_11680 41981 41007 gene locus_tag LOCUS_11690 41981 41007 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921586.1 protein_id gnl|my_center|LOCUS_11690 46196 42030 gene locus_tag LOCUS_11700 46196 42030 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389851.1 protein_id gnl|my_center|LOCUS_11700 48202 46193 gene locus_tag LOCUS_11710 48202 46193 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626303.1 protein_id gnl|my_center|LOCUS_11710 48578 48315 gene locus_tag LOCUS_11720 48578 48315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 48688 48873 gene locus_tag LOCUS_11730 48688 48873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 49510 48893 gene locus_tag LOCUS_11740 49510 48893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 49606 49782 gene locus_tag LOCUS_11750 49606 49782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 49779 50144 gene locus_tag LOCUS_11760 49779 50144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 50216 52342 gene locus_tag LOCUS_11770 50216 52342 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037461425.1 protein_id gnl|my_center|LOCUS_11770 52481 53038 gene locus_tag LOCUS_11780 52481 53038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 53107 54291 gene locus_tag LOCUS_11790 53107 54291 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391687.1 protein_id gnl|my_center|LOCUS_11790 54437 55561 gene locus_tag LOCUS_11800 54437 55561 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061602.1 protein_id gnl|my_center|LOCUS_11800 55598 56155 gene locus_tag LOCUS_11810 55598 56155 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975277.1 protein_id gnl|my_center|LOCUS_11810 56285 57166 gene locus_tag LOCUS_11820 56285 57166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 57235 57921 gene locus_tag LOCUS_11830 57235 57921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 58009 59763 gene locus_tag LOCUS_11840 gene recJ 58009 59763 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_11840 59821 59895 gene locus_tag LOCUS_t00280 59821 59895 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 60307 60720 gene locus_tag LOCUS_11850 60307 60720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 60762 61553 gene locus_tag LOCUS_11860 60762 61553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 61715 62545 gene locus_tag LOCUS_11870 gene rlmJ 61715 62545 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402281.1 protein_id gnl|my_center|LOCUS_11870 65409 62665 gene locus_tag LOCUS_11880 gene secA 65409 62665 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529439.1 protein_id gnl|my_center|LOCUS_11880 65782 65522 gene locus_tag LOCUS_11890 65782 65522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 66396 67622 gene locus_tag LOCUS_11900 gene argJ 66396 67622 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388153.1 protein_id gnl|my_center|LOCUS_11900 67628 68239 gene locus_tag LOCUS_11910 67628 68239 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267140.1 protein_id gnl|my_center|LOCUS_11910 68794 68474 gene locus_tag LOCUS_11920 gene trxA 68794 68474 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921368.1 protein_id gnl|my_center|LOCUS_11920 72289 68843 gene locus_tag LOCUS_11930 gene addA 72289 68843 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_11930 75487 72533 gene locus_tag LOCUS_11940 gene addB 75487 72533 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_11940 76235 75480 gene locus_tag LOCUS_11950 76235 75480 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391183.1 protein_id gnl|my_center|LOCUS_11950 77224 76235 gene locus_tag LOCUS_11960 77224 76235 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_11960 77658 77212 gene locus_tag LOCUS_11970 gene tsaE 77658 77212 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921363.1 protein_id gnl|my_center|LOCUS_11970 80024 77655 gene locus_tag LOCUS_11980 80024 77655 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391190.1 protein_id gnl|my_center|LOCUS_11980 81581 80163 gene locus_tag LOCUS_11990 gene ahcY 81581 80163 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918146.1 protein_id gnl|my_center|LOCUS_11990 82440 81877 gene locus_tag LOCUS_12000 82440 81877 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440210.1 protein_id gnl|my_center|LOCUS_12000 82561 83040 gene locus_tag LOCUS_12010 82561 83040 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_12010 83138 83356 gene locus_tag LOCUS_12020 83138 83356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 83458 84894 gene locus_tag LOCUS_12030 83458 84894 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918153.1 protein_id gnl|my_center|LOCUS_12030 84957 85388 gene locus_tag LOCUS_12040 84957 85388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 87498 85642 gene locus_tag LOCUS_12050 87498 85642 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_12050 88333 87572 gene locus_tag LOCUS_12060 88333 87572 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225205.1 protein_id gnl|my_center|LOCUS_12060 89294 88518 gene locus_tag LOCUS_12070 89294 88518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 89826 90497 gene locus_tag LOCUS_12080 89826 90497 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640127.1 protein_id gnl|my_center|LOCUS_12080 91664 90639 gene locus_tag LOCUS_12090 91664 90639 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721972.1 protein_id gnl|my_center|LOCUS_12090 93071 91785 gene locus_tag LOCUS_12100 gene lysA 93071 91785 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388155.1 protein_id gnl|my_center|LOCUS_12100 93316 93068 gene locus_tag LOCUS_12110 93316 93068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 93747 93313 gene locus_tag LOCUS_12120 93747 93313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 94025 93762 gene locus_tag LOCUS_12130 94025 93762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 94395 94144 gene locus_tag LOCUS_12140 94395 94144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 95228 94512 gene locus_tag LOCUS_12150 95228 94512 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090491.1 protein_id gnl|my_center|LOCUS_12150 97627 95369 gene locus_tag LOCUS_12160 97627 95369 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920015.1 protein_id gnl|my_center|LOCUS_12160 97846 98499 gene locus_tag LOCUS_12170 97846 98499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 98616 99161 gene locus_tag LOCUS_12180 98616 99161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 99223 99477 gene locus_tag LOCUS_12190 99223 99477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 100575 99481 gene locus_tag LOCUS_12200 100575 99481 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389784.1 protein_id gnl|my_center|LOCUS_12200 100637 102034 gene locus_tag LOCUS_12210 gene rimO 100637 102034 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008101.1 protein_id gnl|my_center|LOCUS_12210 102407 102018 gene locus_tag LOCUS_12220 102407 102018 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972451.1 protein_id gnl|my_center|LOCUS_12220 102765 104150 gene locus_tag LOCUS_12230 102765 104150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 104147 105526 gene locus_tag LOCUS_12240 104147 105526 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188659038.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence031 3032 327 gene locus_tag LOCUS_12250 gene ppdK 3032 327 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640245.1 protein_id gnl|my_center|LOCUS_12250 4577 3135 gene locus_tag LOCUS_12260 4577 3135 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042595882.1 protein_id gnl|my_center|LOCUS_12260 5761 4628 gene locus_tag LOCUS_12270 gene lldD 5761 4628 CDS product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035364.1 protein_id gnl|my_center|LOCUS_12270 6537 5758 gene locus_tag LOCUS_12280 gene pdhR 6537 5758 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331771.1 protein_id gnl|my_center|LOCUS_12280 8207 6534 gene locus_tag LOCUS_12290 gene lldP 8207 6534 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208063.1 protein_id gnl|my_center|LOCUS_12290 8589 9389 gene locus_tag LOCUS_12300 8589 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 9616 10314 gene locus_tag LOCUS_12310 gene istB 9616 10314 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_12310 10717 11367 gene locus_tag LOCUS_12320 10717 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 11590 11342 gene locus_tag LOCUS_12330 11590 11342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 12623 11886 gene locus_tag LOCUS_12340 gene tpiA 12623 11886 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027509116.1 protein_id gnl|my_center|LOCUS_12340 14125 12626 gene locus_tag LOCUS_12350 gene glpK 14125 12626 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389762.1 protein_id gnl|my_center|LOCUS_12350 14955 14143 gene locus_tag LOCUS_12360 14955 14143 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035613.1 protein_id gnl|my_center|LOCUS_12360 15112 16674 gene locus_tag LOCUS_12370 15112 16674 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243665.1 protein_id gnl|my_center|LOCUS_12370 16687 17493 gene locus_tag LOCUS_12380 16687 17493 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330015.1 protein_id gnl|my_center|LOCUS_12380 17686 18051 gene locus_tag LOCUS_12390 17686 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 18530 18189 gene locus_tag LOCUS_12400 18530 18189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 18956 18699 gene locus_tag LOCUS_12410 18956 18699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12410 19072 19440 gene locus_tag LOCUS_12420 19072 19440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 19491 19814 gene locus_tag LOCUS_12430 19491 19814 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_12430 19811 20719 gene locus_tag LOCUS_12440 19811 20719 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302187.1 protein_id gnl|my_center|LOCUS_12440 21157 20756 gene locus_tag LOCUS_12450 21157 20756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 21182 21421 gene locus_tag LOCUS_12460 21182 21421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 22000 21548 gene locus_tag LOCUS_12470 22000 21548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 22418 22026 gene locus_tag LOCUS_12480 22418 22026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 22469 22648 gene locus_tag LOCUS_12490 22469 22648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 22656 22967 gene locus_tag LOCUS_12500 22656 22967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 23295 24497 gene locus_tag LOCUS_12510 23295 24497 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228796.1 protein_id gnl|my_center|LOCUS_12510 25249 24620 gene locus_tag LOCUS_12520 25249 24620 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_12520 25343 28240 gene locus_tag LOCUS_12530 25343 28240 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138082.1 protein_id gnl|my_center|LOCUS_12530 28678 29061 gene locus_tag LOCUS_12540 28678 29061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 30523 29186 gene locus_tag LOCUS_12550 30523 29186 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339149.1 protein_id gnl|my_center|LOCUS_12550 31197 30520 gene locus_tag LOCUS_12560 31197 30520 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339150.1 protein_id gnl|my_center|LOCUS_12560 32581 31205 gene locus_tag LOCUS_12570 32581 31205 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063896.1 protein_id gnl|my_center|LOCUS_12570 35700 32578 gene locus_tag LOCUS_12580 35700 32578 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144156.1 protein_id gnl|my_center|LOCUS_12580 36677 35700 gene locus_tag LOCUS_12590 36677 35700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 36786 37598 gene locus_tag LOCUS_12600 36786 37598 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024697047.1 protein_id gnl|my_center|LOCUS_12600 37837 38526 gene locus_tag LOCUS_12610 37837 38526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 38965 39291 gene locus_tag LOCUS_12620 38965 39291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 40382 41065 gene locus_tag LOCUS_12630 40382 41065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 41632 41189 gene locus_tag LOCUS_12640 41632 41189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 41991 41545 gene locus_tag LOCUS_12650 41991 41545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 42375 42031 gene locus_tag LOCUS_12660 42375 42031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 42757 42428 gene locus_tag LOCUS_12670 42757 42428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 42671 42883 gene locus_tag LOCUS_12680 42671 42883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 43632 43006 gene locus_tag LOCUS_12690 43632 43006 CDS product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169574787.1 protein_id gnl|my_center|LOCUS_12690 44491 43856 gene locus_tag LOCUS_12700 44491 43856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 45314 44799 gene locus_tag LOCUS_12710 45314 44799 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533377.1 protein_id gnl|my_center|LOCUS_12710 45885 45463 gene locus_tag LOCUS_12720 45885 45463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 46127 45885 gene locus_tag LOCUS_12730 46127 45885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 47024 46188 gene locus_tag LOCUS_12740 47024 46188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 50552 47319 gene locus_tag LOCUS_12750 50552 47319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 52897 50552 gene locus_tag LOCUS_12760 gene traD 52897 50552 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947791.1 protein_id gnl|my_center|LOCUS_12760 53087 52887 gene locus_tag LOCUS_12770 53087 52887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 53748 53969 gene locus_tag LOCUS_12780 53748 53969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 54334 54149 gene locus_tag LOCUS_12790 54334 54149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 54549 54331 gene locus_tag LOCUS_12800 54549 54331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 55114 55464 gene locus_tag LOCUS_12810 55114 55464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 55474 57309 gene locus_tag LOCUS_12820 55474 57309 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230338.1 protein_id gnl|my_center|LOCUS_12820 57306 57950 gene locus_tag LOCUS_12830 57306 57950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 58508 58119 gene locus_tag LOCUS_12840 58508 58119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 58501 58710 gene locus_tag LOCUS_12850 58501 58710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 59367 58900 gene locus_tag LOCUS_12860 59367 58900 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086743.1 protein_id gnl|my_center|LOCUS_12860 60483 59422 gene locus_tag LOCUS_12870 60483 59422 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267673.1 protein_id gnl|my_center|LOCUS_12870 60576 60956 gene locus_tag LOCUS_12880 60576 60956 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972365.1 protein_id gnl|my_center|LOCUS_12880 61074 60925 gene locus_tag LOCUS_12890 61074 60925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 61517 61098 gene locus_tag LOCUS_12900 61517 61098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 62167 61550 gene locus_tag LOCUS_12910 62167 61550 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640623.1 protein_id gnl|my_center|LOCUS_12910 62276 63103 gene locus_tag LOCUS_12920 62276 63103 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_12920 63106 63939 gene locus_tag LOCUS_12930 63106 63939 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967744.1 protein_id gnl|my_center|LOCUS_12930 64106 65110 gene locus_tag LOCUS_12940 64106 65110 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337935.1 protein_id gnl|my_center|LOCUS_12940 65131 65355 gene locus_tag LOCUS_12950 65131 65355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 65365 65565 gene locus_tag LOCUS_12960 65365 65565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 66532 65663 gene locus_tag LOCUS_12970 66532 65663 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_12970 66604 66918 gene locus_tag LOCUS_12980 66604 66918 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265860.1 protein_id gnl|my_center|LOCUS_12980 66923 67441 gene locus_tag LOCUS_12990 66923 67441 CDS product rhodanese family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703230.1 protein_id gnl|my_center|LOCUS_12990 67449 68228 gene locus_tag LOCUS_13000 67449 68228 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920702.1 protein_id gnl|my_center|LOCUS_13000 68483 68851 gene locus_tag LOCUS_13010 68483 68851 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958106.1 protein_id gnl|my_center|LOCUS_13010 68953 69441 gene locus_tag LOCUS_13020 68953 69441 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066940.1 protein_id gnl|my_center|LOCUS_13020 69444 70310 gene locus_tag LOCUS_13030 69444 70310 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_13030 70388 72412 gene locus_tag LOCUS_13040 70388 72412 CDS product glycoside hydrolase family 92 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048697949.1 protein_id gnl|my_center|LOCUS_13040 72518 75037 gene locus_tag LOCUS_13050 72518 75037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 75043 76131 gene locus_tag LOCUS_13060 75043 76131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 76486 76157 gene locus_tag LOCUS_13070 76486 76157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 76630 76881 gene locus_tag LOCUS_13080 76630 76881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 77341 76997 gene locus_tag LOCUS_13090 77341 76997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 77636 77346 gene locus_tag LOCUS_13100 77636 77346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 77937 77557 gene locus_tag LOCUS_13110 77937 77557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 78262 77942 gene locus_tag LOCUS_13120 78262 77942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640079.1 protein_id gnl|my_center|LOCUS_13120 78396 78863 gene locus_tag LOCUS_13130 78396 78863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 79119 80096 gene locus_tag LOCUS_13140 79119 80096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 80130 80660 gene locus_tag LOCUS_13150 80130 80660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 82406 81174 gene locus_tag LOCUS_13160 82406 81174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 83586 82537 gene locus_tag LOCUS_13170 83586 82537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 84848 83652 gene locus_tag LOCUS_13180 gene repA 84848 83652 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891622.1 protein_id gnl|my_center|LOCUS_13180 85234 84935 gene locus_tag LOCUS_13190 85234 84935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 85185 85409 gene locus_tag LOCUS_13200 85185 85409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 85974 85519 gene locus_tag LOCUS_13210 85974 85519 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228480.1 protein_id gnl|my_center|LOCUS_13210 86686 86066 gene locus_tag LOCUS_13220 86686 86066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 86625 86918 gene locus_tag LOCUS_13230 86625 86918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 87551 86970 gene locus_tag LOCUS_13240 87551 86970 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_13240 87899 99349 gene locus_tag LOCUS_13250 87899 99349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 92060 91968 gene locus_tag LOCUS_t00290 92060 91968 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 99897 99535 gene locus_tag LOCUS_13260 99897 99535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 102621 100135 gene locus_tag LOCUS_13270 102621 100135 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920983.1 protein_id gnl|my_center|LOCUS_13270 103682 102774 gene locus_tag LOCUS_13280 103682 102774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 104303 103695 gene locus_tag LOCUS_13290 104303 103695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 104832 104377 gene locus_tag LOCUS_13300 104832 104377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 105250 104885 gene locus_tag LOCUS_13310 105250 104885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 105464 106105 gene locus_tag LOCUS_13320 105464 106105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 106179 106586 gene locus_tag LOCUS_13330 106179 106586 CDS product DUF4383 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530043.1 protein_id gnl|my_center|LOCUS_13330 106583 107662 gene locus_tag LOCUS_13340 106583 107662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530042.1 protein_id gnl|my_center|LOCUS_13340 107652 107969 gene locus_tag LOCUS_13350 107652 107969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 109504 107897 gene locus_tag LOCUS_13360 109504 107897 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530038.1 protein_id gnl|my_center|LOCUS_13360 109850 111235 gene locus_tag LOCUS_13370 109850 111235 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284325.1 protein_id gnl|my_center|LOCUS_13370 111256 111810 gene locus_tag LOCUS_13380 111256 111810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 113343 111835 gene locus_tag LOCUS_13390 113343 111835 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039202.1 protein_id gnl|my_center|LOCUS_13390 114056 113340 gene locus_tag LOCUS_13400 114056 113340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 116966 114126 gene locus_tag LOCUS_13410 116966 114126 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640062.1 protein_id gnl|my_center|LOCUS_13410 119613 117433 gene locus_tag LOCUS_13420 119613 117433 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533213.1 protein_id gnl|my_center|LOCUS_13420 119773 120807 gene locus_tag LOCUS_13430 119773 120807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 120804 121796 gene locus_tag LOCUS_13440 120804 121796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 121793 122437 gene locus_tag LOCUS_13450 121793 122437 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143042.1 protein_id gnl|my_center|LOCUS_13450 122434 123081 gene locus_tag LOCUS_13460 122434 123081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 123191 125503 gene locus_tag LOCUS_13470 123191 125503 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771478.1 protein_id gnl|my_center|LOCUS_13470 125506 126645 gene locus_tag LOCUS_13480 125506 126645 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035915.1 protein_id gnl|my_center|LOCUS_13480 126714 127190 gene locus_tag LOCUS_13490 gene pnuC 126714 127190 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035913.1 protein_id gnl|my_center|LOCUS_13490 128256 127348 gene locus_tag LOCUS_13500 128256 127348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 129347 128253 gene locus_tag LOCUS_13510 129347 128253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 129743 129540 gene locus_tag LOCUS_13520 129743 129540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 129670 131415 gene locus_tag LOCUS_13530 129670 131415 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920412.1 protein_id gnl|my_center|LOCUS_13530 132302 131388 gene locus_tag LOCUS_13540 132302 131388 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088296.1 protein_id gnl|my_center|LOCUS_13540 132399 133502 gene locus_tag LOCUS_13550 132399 133502 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531761.1 protein_id gnl|my_center|LOCUS_13550 135349 133529 gene locus_tag LOCUS_13560 135349 133529 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265756.1 protein_id gnl|my_center|LOCUS_13560 135989 135426 gene locus_tag LOCUS_13570 135989 135426 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_13570 136400 137755 gene locus_tag LOCUS_13580 136400 137755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 138546 137842 gene locus_tag LOCUS_13590 138546 137842 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315869.1 protein_id gnl|my_center|LOCUS_13590 138638 139210 gene locus_tag LOCUS_13600 138638 139210 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974531.1 protein_id gnl|my_center|LOCUS_13600 139686 139234 gene locus_tag LOCUS_13610 139686 139234 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115857.1 protein_id gnl|my_center|LOCUS_13610 139797 140714 gene locus_tag LOCUS_13620 139797 140714 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528172.1 protein_id gnl|my_center|LOCUS_13620 141176 140817 gene locus_tag LOCUS_13630 141176 140817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 141285 141620 gene locus_tag LOCUS_13640 141285 141620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 144119 141672 gene locus_tag LOCUS_13650 144119 141672 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_13650 144597 144214 gene locus_tag LOCUS_13660 144597 144214 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728673.1 protein_id gnl|my_center|LOCUS_13660 144683 145417 gene locus_tag LOCUS_13670 144683 145417 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529053.1 protein_id gnl|my_center|LOCUS_13670 146152 145442 gene locus_tag LOCUS_13680 146152 145442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 147169 146498 gene locus_tag LOCUS_13690 147169 146498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence032 71 256 gene locus_tag LOCUS_13700 71 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 465 1469 gene locus_tag LOCUS_13710 465 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1466 2944 gene locus_tag LOCUS_13720 1466 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2989 3267 gene locus_tag LOCUS_13730 2989 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 4158 3331 gene locus_tag LOCUS_13740 4158 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 4414 4148 gene locus_tag LOCUS_13750 4414 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 5239 4427 gene locus_tag LOCUS_13760 gene prmC 5239 4427 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388509.1 protein_id gnl|my_center|LOCUS_13760 6487 5414 gene locus_tag LOCUS_13770 gene prfA 6487 5414 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529461.1 protein_id gnl|my_center|LOCUS_13770 7806 6484 gene locus_tag LOCUS_13780 gene hisS 7806 6484 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388506.1 protein_id gnl|my_center|LOCUS_13780 8433 7855 gene locus_tag LOCUS_13790 8433 7855 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247139.1 protein_id gnl|my_center|LOCUS_13790 8585 9238 gene locus_tag LOCUS_13800 8585 9238 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389412.1 protein_id gnl|my_center|LOCUS_13800 9332 11260 gene locus_tag LOCUS_13810 9332 11260 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640643.1 protein_id gnl|my_center|LOCUS_13810 11373 11951 gene locus_tag LOCUS_13820 gene ppa 11373 11951 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310823.1 protein_id gnl|my_center|LOCUS_13820 12701 12222 gene locus_tag LOCUS_13830 12701 12222 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_13830 13591 12698 gene locus_tag LOCUS_13840 13591 12698 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530053.1 protein_id gnl|my_center|LOCUS_13840 13731 14495 gene locus_tag LOCUS_13850 13731 14495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 14801 14496 gene locus_tag LOCUS_13860 14801 14496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 15633 15220 gene locus_tag LOCUS_13870 15633 15220 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268734.1 protein_id gnl|my_center|LOCUS_13870 16706 15630 gene locus_tag LOCUS_13880 gene ispG 16706 15630 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388505.1 protein_id gnl|my_center|LOCUS_13880 16818 17984 gene locus_tag LOCUS_13890 16818 17984 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967105.1 protein_id gnl|my_center|LOCUS_13890 18027 18953 gene locus_tag LOCUS_13900 18027 18953 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_13900 18965 19825 gene locus_tag LOCUS_13910 18965 19825 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 protein_id gnl|my_center|LOCUS_13910 20879 20355 gene locus_tag LOCUS_13920 gene pal 20879 20355 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527588.1 protein_id gnl|my_center|LOCUS_13920 22340 20934 gene locus_tag LOCUS_13930 gene tolB 22340 20934 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388849.1 protein_id gnl|my_center|LOCUS_13930 23389 22352 gene locus_tag LOCUS_13940 23389 22352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 23832 23389 gene locus_tag LOCUS_13950 gene tolR 23832 23389 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089889.1 protein_id gnl|my_center|LOCUS_13950 24538 23846 gene locus_tag LOCUS_13960 gene tolQ 24538 23846 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089890.1 protein_id gnl|my_center|LOCUS_13960 25005 24535 gene locus_tag LOCUS_13970 gene ybgC 25005 24535 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529144.1 protein_id gnl|my_center|LOCUS_13970 25104 25526 gene locus_tag LOCUS_13980 25104 25526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 25523 25729 gene locus_tag LOCUS_13990 25523 25729 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761125.1 protein_id gnl|my_center|LOCUS_13990 26533 25739 gene locus_tag LOCUS_14000 26533 25739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 27785 26748 gene locus_tag LOCUS_14010 27785 26748 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 protein_id gnl|my_center|LOCUS_14010 29212 27962 gene locus_tag LOCUS_14020 29212 27962 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388501.1 protein_id gnl|my_center|LOCUS_14020 29333 30007 gene locus_tag LOCUS_14030 gene ubiG 29333 30007 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538043.1 protein_id gnl|my_center|LOCUS_14030 30040 31422 gene locus_tag LOCUS_14040 30040 31422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 31495 32232 gene locus_tag LOCUS_14050 31495 32232 CDS product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112786.1 protein_id gnl|my_center|LOCUS_14050 32682 32233 gene locus_tag LOCUS_14060 32682 32233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 33152 32679 gene locus_tag LOCUS_14070 33152 32679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 34420 33236 gene locus_tag LOCUS_14080 34420 33236 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265617.1 protein_id gnl|my_center|LOCUS_14080 34982 34431 gene locus_tag LOCUS_14090 34982 34431 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066809188.1 protein_id gnl|my_center|LOCUS_14090 35914 34979 gene locus_tag LOCUS_14100 35914 34979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091743154.1 protein_id gnl|my_center|LOCUS_14100 36145 37275 gene locus_tag LOCUS_14110 36145 37275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 38289 37219 gene locus_tag LOCUS_14120 38289 37219 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119917.1 protein_id gnl|my_center|LOCUS_14120 39263 38295 gene locus_tag LOCUS_14130 gene lepB 39263 38295 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383416.1 protein_id gnl|my_center|LOCUS_14130 39670 39260 gene locus_tag LOCUS_14140 gene acpS 39670 39260 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971345.1 protein_id gnl|my_center|LOCUS_14140 40532 39804 gene locus_tag LOCUS_14150 40532 39804 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389607.1 protein_id gnl|my_center|LOCUS_14150 41113 40529 gene locus_tag LOCUS_14160 gene pyrE 41113 40529 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919429.1 protein_id gnl|my_center|LOCUS_14160 41354 42538 gene locus_tag LOCUS_14170 41354 42538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 42542 44215 gene locus_tag LOCUS_14180 gene ctaD 42542 44215 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971136.1 protein_id gnl|my_center|LOCUS_14180 44421 46145 gene locus_tag LOCUS_14190 44421 46145 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_14190 46145 47548 gene locus_tag LOCUS_14200 46145 47548 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_14200 47794 48858 gene locus_tag LOCUS_14210 47794 48858 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410204.1 protein_id gnl|my_center|LOCUS_14210 49093 49992 gene locus_tag LOCUS_14220 49093 49992 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971137.1 protein_id gnl|my_center|LOCUS_14220 50123 50662 gene locus_tag LOCUS_14230 50123 50662 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392602.1 protein_id gnl|my_center|LOCUS_14230 50700 51611 gene locus_tag LOCUS_14240 50700 51611 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974725.1 protein_id gnl|my_center|LOCUS_14240 51676 52008 gene locus_tag LOCUS_14250 51676 52008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14250 52005 52625 gene locus_tag LOCUS_14260 52005 52625 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383578.1 protein_id gnl|my_center|LOCUS_14260 52639 54027 gene locus_tag LOCUS_14270 gene thrC 52639 54027 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337015.1 protein_id gnl|my_center|LOCUS_14270 54037 54906 gene locus_tag LOCUS_14280 54037 54906 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640170.1 protein_id gnl|my_center|LOCUS_14280 55888 55118 gene locus_tag LOCUS_14290 55888 55118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 56530 55892 gene locus_tag LOCUS_14300 56530 55892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 57117 56527 gene locus_tag LOCUS_14310 gene ccmA 57117 56527 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387801.1 protein_id gnl|my_center|LOCUS_14310 57533 57114 gene locus_tag LOCUS_14320 57533 57114 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265965.1 protein_id gnl|my_center|LOCUS_14320 57590 57880 gene locus_tag LOCUS_14330 57590 57880 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083363.1 protein_id gnl|my_center|LOCUS_14330 59052 58051 gene locus_tag LOCUS_14340 59052 58051 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920388.1 protein_id gnl|my_center|LOCUS_14340 59327 60700 gene locus_tag LOCUS_14350 59327 60700 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_14350 61002 61226 gene locus_tag LOCUS_14360 61002 61226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 63365 61401 gene locus_tag LOCUS_14370 63365 61401 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639885.1 protein_id gnl|my_center|LOCUS_14370 63491 64153 gene locus_tag LOCUS_14380 gene pdeM 63491 64153 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000237.1 protein_id gnl|my_center|LOCUS_14380 64826 64161 gene locus_tag LOCUS_14390 gene msrA 64826 64161 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089780.1 protein_id gnl|my_center|LOCUS_14390 66572 65373 gene locus_tag LOCUS_14400 66572 65373 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919408.1 protein_id gnl|my_center|LOCUS_14400 68375 66627 gene locus_tag LOCUS_14410 gene pabB 68375 66627 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_14410 68374 69147 gene locus_tag LOCUS_14420 68374 69147 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265678.1 protein_id gnl|my_center|LOCUS_14420 69343 69729 gene locus_tag LOCUS_14430 69343 69729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14430 69648 70289 gene locus_tag LOCUS_14440 69648 70289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14440 71949 70321 gene locus_tag LOCUS_14450 71949 70321 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275546.1 protein_id gnl|my_center|LOCUS_14450 72383 71949 gene locus_tag LOCUS_14460 72383 71949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 72590 72769 gene locus_tag LOCUS_14470 gene rpmF 72590 72769 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_14470 72810 73838 gene locus_tag LOCUS_14480 gene plsX 72810 73838 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389356.1 protein_id gnl|my_center|LOCUS_14480 73835 74803 gene locus_tag LOCUS_14490 73835 74803 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327909.1 protein_id gnl|my_center|LOCUS_14490 74893 75192 gene locus_tag LOCUS_14500 74893 75192 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529278.1 protein_id gnl|my_center|LOCUS_14500 75176 75544 gene locus_tag LOCUS_14510 75176 75544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 76218 75697 gene locus_tag LOCUS_14520 76218 75697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 77804 76278 gene locus_tag LOCUS_14530 77804 76278 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918954.1 protein_id gnl|my_center|LOCUS_14530 78880 77999 gene locus_tag LOCUS_14540 78880 77999 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193666682.1 protein_id gnl|my_center|LOCUS_14540 81236 78873 gene locus_tag LOCUS_14550 gene pheT 81236 78873 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397262.1 protein_id gnl|my_center|LOCUS_14550 82330 81233 gene locus_tag LOCUS_14560 gene pheS 82330 81233 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391270.1 protein_id gnl|my_center|LOCUS_14560 82599 83747 gene locus_tag LOCUS_14570 82599 83747 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966314.1 protein_id gnl|my_center|LOCUS_14570 83794 84261 gene locus_tag LOCUS_14580 83794 84261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 85657 84446 gene locus_tag LOCUS_14590 85657 84446 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390164.1 protein_id gnl|my_center|LOCUS_14590 85778 87493 gene locus_tag LOCUS_14600 gene phaC 85778 87493 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_14600 87577 88410 gene locus_tag LOCUS_14610 87577 88410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 88648 89070 gene locus_tag LOCUS_14620 88648 89070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 89058 90026 gene locus_tag LOCUS_14630 gene ribD 89058 90026 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389578.1 protein_id gnl|my_center|LOCUS_14630 90028 90630 gene locus_tag LOCUS_14640 90028 90630 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_14640 90620 91771 gene locus_tag LOCUS_14650 gene ribB 90620 91771 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561762.1 protein_id gnl|my_center|LOCUS_14650 91771 92190 gene locus_tag LOCUS_14660 91771 92190 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312824.1 protein_id gnl|my_center|LOCUS_14660 92187 92735 gene locus_tag LOCUS_14670 92187 92735 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_14670 92732 93181 gene locus_tag LOCUS_14680 92732 93181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 94218 93292 gene locus_tag LOCUS_14690 94218 93292 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_14690 95006 94215 gene locus_tag LOCUS_14700 95006 94215 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921580.1 protein_id gnl|my_center|LOCUS_14700 95617 95003 gene locus_tag LOCUS_14710 gene rsmG 95617 95003 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923358.1 protein_id gnl|my_center|LOCUS_14710 97332 95614 gene locus_tag LOCUS_14720 gene mnmG 97332 95614 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391372.1 protein_id gnl|my_center|LOCUS_14720 98817 97531 gene locus_tag LOCUS_14730 gene mnmE 98817 97531 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083461.1 protein_id gnl|my_center|LOCUS_14730 99044 98820 gene locus_tag LOCUS_14740 99044 98820 CDS product DUF6489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921584.1 protein_id gnl|my_center|LOCUS_14740 99115 99816 gene locus_tag LOCUS_14750 99115 99816 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 protein_id gnl|my_center|LOCUS_14750 101493 99922 gene locus_tag LOCUS_14760 101493 99922 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083952.1 protein_id gnl|my_center|LOCUS_14760 101955 104612 gene locus_tag LOCUS_14770 101955 104612 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_14770 104609 105142 gene locus_tag LOCUS_14780 104609 105142 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_14780 105946 105419 gene locus_tag LOCUS_14790 105946 105419 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389354.1 protein_id gnl|my_center|LOCUS_14790 106479 105943 gene locus_tag LOCUS_14800 106479 105943 CDS product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975022.1 protein_id gnl|my_center|LOCUS_14800 106625 107116 gene locus_tag LOCUS_14810 106625 107116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 108838 107582 gene locus_tag LOCUS_14820 gene rho 108838 107582 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391366.1 protein_id gnl|my_center|LOCUS_14820 109205 108972 gene locus_tag LOCUS_14830 109205 108972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 109826 109365 gene locus_tag LOCUS_14840 gene hemJ 109826 109365 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528731.1 protein_id gnl|my_center|LOCUS_14840 110824 109826 gene locus_tag LOCUS_14850 gene hemE 110824 109826 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085186.1 protein_id gnl|my_center|LOCUS_14850 111164 111982 gene locus_tag LOCUS_14860 111164 111982 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639851.1 protein_id gnl|my_center|LOCUS_14860 111979 112566 gene locus_tag LOCUS_14870 111979 112566 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917893.1 protein_id gnl|my_center|LOCUS_14870 112578 113390 gene locus_tag LOCUS_14880 gene aroE 112578 113390 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214199776.1 protein_id gnl|my_center|LOCUS_14880 113387 113980 gene locus_tag LOCUS_14890 gene coaE 113387 113980 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639852.1 protein_id gnl|my_center|LOCUS_14890 113988 114686 gene locus_tag LOCUS_14900 gene dnaQ 113988 114686 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_14900 114741 115331 gene locus_tag LOCUS_14910 gene raiA 114741 115331 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721597.1 protein_id gnl|my_center|LOCUS_14910 115400 115867 gene locus_tag LOCUS_14920 gene ptsN 115400 115867 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_14920 115854 116309 gene locus_tag LOCUS_14930 115854 116309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 116314 116640 gene locus_tag LOCUS_14940 116314 116640 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 protein_id gnl|my_center|LOCUS_14940 116797 117453 gene locus_tag LOCUS_14950 116797 117453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 117517 118005 gene locus_tag LOCUS_14960 117517 118005 CDS product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183417335.1 protein_id gnl|my_center|LOCUS_14960 119645 118128 gene locus_tag LOCUS_14970 119645 118128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 119844 123074 gene locus_tag LOCUS_14980 gene lacZ 119844 123074 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_14980 123131 124693 gene locus_tag LOCUS_14990 123131 124693 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275414.1 protein_id gnl|my_center|LOCUS_14990 124693 126060 gene locus_tag LOCUS_15000 124693 126060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 128652 126292 gene locus_tag LOCUS_15010 128652 126292 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268745.1 protein_id gnl|my_center|LOCUS_15010 128787 129734 gene locus_tag LOCUS_15020 128787 129734 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920114.1 protein_id gnl|my_center|LOCUS_15020 130429 129731 gene locus_tag LOCUS_15030 130429 129731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 131244 130438 gene locus_tag LOCUS_15040 131244 130438 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144011.1 protein_id gnl|my_center|LOCUS_15040 132000 131248 gene locus_tag LOCUS_15050 132000 131248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 132652 132119 gene locus_tag LOCUS_15060 132652 132119 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719580.1 protein_id gnl|my_center|LOCUS_15060 133354 133013 gene locus_tag LOCUS_15070 133354 133013 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067320.1 protein_id gnl|my_center|LOCUS_15070 133704 133384 gene locus_tag LOCUS_15080 133704 133384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 136412 133917 gene locus_tag LOCUS_15090 136412 133917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 136635 138107 gene locus_tag LOCUS_15100 136635 138107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 139772 138126 gene locus_tag LOCUS_15110 139772 138126 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531038.1 protein_id gnl|my_center|LOCUS_15110 140610 139846 gene locus_tag LOCUS_15120 140610 139846 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533664.1 protein_id gnl|my_center|LOCUS_15120 141575 140607 gene locus_tag LOCUS_15130 141575 140607 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383655.1 protein_id gnl|my_center|LOCUS_15130 142863 141895 gene locus_tag LOCUS_15140 142863 141895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 144239 142860 gene locus_tag LOCUS_15150 144239 142860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 144422 145627 gene locus_tag LOCUS_15160 144422 145627 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966287.1 protein_id gnl|my_center|LOCUS_15160 146804 145581 gene locus_tag LOCUS_15170 146804 145581 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_15170 147076 146798 gene locus_tag LOCUS_15180 147076 146798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 148246 147317 gene locus_tag LOCUS_15190 148246 147317 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_15190 148992 148243 gene locus_tag LOCUS_15200 148992 148243 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973172.1 protein_id gnl|my_center|LOCUS_15200 150348 149149 gene locus_tag LOCUS_15210 gene sucC 150348 149149 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918226.1 protein_id gnl|my_center|LOCUS_15210 150526 151077 gene locus_tag LOCUS_15220 150526 151077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 151103 151435 gene locus_tag LOCUS_15230 151103 151435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 152545 151619 gene locus_tag LOCUS_15240 152545 151619 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972147.1 protein_id gnl|my_center|LOCUS_15240 152640 153977 gene locus_tag LOCUS_15250 gene gltX 152640 153977 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531892.1 protein_id gnl|my_center|LOCUS_15250 154050 154961 gene locus_tag LOCUS_15260 gene trxA 154050 154961 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917999.1 protein_id gnl|my_center|LOCUS_15260 154968 155573 gene locus_tag LOCUS_15270 154968 155573 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 protein_id gnl|my_center|LOCUS_15270 155570 155737 gene locus_tag LOCUS_15280 155570 155737 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917997.1 protein_id gnl|my_center|LOCUS_15280 156441 155869 gene locus_tag LOCUS_15290 156441 155869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 156853 156425 gene locus_tag LOCUS_15300 156853 156425 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808385.1 protein_id gnl|my_center|LOCUS_15300 158074 156860 gene locus_tag LOCUS_15310 158074 156860 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639881.1 protein_id gnl|my_center|LOCUS_15310 158212 160533 gene locus_tag LOCUS_15320 158212 160533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 161593 160808 gene locus_tag LOCUS_15330 161593 160808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 162283 161675 gene locus_tag LOCUS_15340 gene fixJ 162283 161675 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918644.1 protein_id gnl|my_center|LOCUS_15340 163935 162280 gene locus_tag LOCUS_15350 163935 162280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 164965 163997 gene locus_tag LOCUS_15360 164965 163997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 165645 164962 gene locus_tag LOCUS_15370 165645 164962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 166565 165654 gene locus_tag LOCUS_15380 gene hemC 166565 165654 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139943.1 protein_id gnl|my_center|LOCUS_15380 166631 167656 gene locus_tag LOCUS_15390 gene tsaD 166631 167656 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299077.1 protein_id gnl|my_center|LOCUS_15390 167653 168630 gene locus_tag LOCUS_15400 167653 168630 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215352211.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence033 1154 291 gene locus_tag LOCUS_15410 1154 291 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918705.1 protein_id gnl|my_center|LOCUS_15410 1969 1184 gene locus_tag LOCUS_15420 gene xylB 1969 1184 CDS product D-xylose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918706.1 protein_id gnl|my_center|LOCUS_15420 3129 1984 gene locus_tag LOCUS_15430 3129 1984 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640070.1 protein_id gnl|my_center|LOCUS_15430 3309 3695 gene locus_tag LOCUS_15440 3309 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 5564 3768 gene locus_tag LOCUS_15450 5564 3768 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919297.1 protein_id gnl|my_center|LOCUS_15450 6672 5578 gene locus_tag LOCUS_15460 6672 5578 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919294.1 protein_id gnl|my_center|LOCUS_15460 6856 8166 gene locus_tag LOCUS_15470 gene fucP 6856 8166 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_15470 8298 8909 gene locus_tag LOCUS_15480 8298 8909 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269410.1 protein_id gnl|my_center|LOCUS_15480 9672 8914 gene locus_tag LOCUS_15490 9672 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 11849 10050 gene locus_tag LOCUS_15500 11849 10050 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265648.1 protein_id gnl|my_center|LOCUS_15500 12448 11882 gene locus_tag LOCUS_15510 12448 11882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 12888 12445 gene locus_tag LOCUS_15520 12888 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 13169 12885 gene locus_tag LOCUS_15530 13169 12885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 13422 14519 gene locus_tag LOCUS_15540 13422 14519 CDS product GDP-mannose--glycolipid 4-beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037588.1 protein_id gnl|my_center|LOCUS_15540 15129 15647 gene locus_tag LOCUS_15550 15129 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 15649 16290 gene locus_tag LOCUS_15560 15649 16290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 16287 16685 gene locus_tag LOCUS_15570 16287 16685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 16755 17255 gene locus_tag LOCUS_15580 16755 17255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 17423 18328 gene locus_tag LOCUS_15590 17423 18328 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054418.1 protein_id gnl|my_center|LOCUS_15590 18335 19528 gene locus_tag LOCUS_15600 18335 19528 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040680916.1 protein_id gnl|my_center|LOCUS_15600 20430 20233 gene locus_tag LOCUS_15610 20430 20233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 21474 21959 gene locus_tag LOCUS_15620 21474 21959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 22097 22558 gene locus_tag LOCUS_15630 22097 22558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 24843 22978 gene locus_tag LOCUS_15640 24843 22978 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681134.1 protein_id gnl|my_center|LOCUS_15640 25532 26830 gene locus_tag LOCUS_15650 25532 26830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 27266 28174 gene locus_tag LOCUS_15660 27266 28174 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081159696.1 protein_id gnl|my_center|LOCUS_15660 28268 31372 gene locus_tag LOCUS_15670 28268 31372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 31508 31969 gene locus_tag LOCUS_15680 31508 31969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 32361 32098 gene locus_tag LOCUS_15690 32361 32098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 32871 34187 gene locus_tag LOCUS_15700 32871 34187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 34221 34592 gene locus_tag LOCUS_15710 34221 34592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 34589 35833 gene locus_tag LOCUS_15720 34589 35833 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_15720 36132 37442 gene locus_tag LOCUS_15730 36132 37442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 37710 37636 gene locus_tag LOCUS_t00300 37710 37636 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 38151 37756 gene locus_tag LOCUS_15740 38151 37756 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006199474.1 protein_id gnl|my_center|LOCUS_15740 38233 39090 gene locus_tag LOCUS_15750 38233 39090 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090455.1 protein_id gnl|my_center|LOCUS_15750 39958 39419 gene locus_tag LOCUS_15760 39958 39419 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_15760 40748 39963 gene locus_tag LOCUS_15770 40748 39963 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_15770 42237 40813 gene locus_tag LOCUS_15780 42237 40813 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971098.1 protein_id gnl|my_center|LOCUS_15780 42346 42747 gene locus_tag LOCUS_15790 42346 42747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 42835 44289 gene locus_tag LOCUS_15800 42835 44289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 44295 44516 gene locus_tag LOCUS_15810 44295 44516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 45458 44691 gene locus_tag LOCUS_15820 45458 44691 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082972.1 protein_id gnl|my_center|LOCUS_15820 45811 48753 gene locus_tag LOCUS_15830 45811 48753 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037353.1 protein_id gnl|my_center|LOCUS_15830 48818 50245 gene locus_tag LOCUS_15840 48818 50245 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037352.1 protein_id gnl|my_center|LOCUS_15840 50273 51052 gene locus_tag LOCUS_15850 50273 51052 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_15850 52237 51347 gene locus_tag LOCUS_15860 gene rarD 52237 51347 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044965.1 protein_id gnl|my_center|LOCUS_15860 52512 52282 gene locus_tag LOCUS_15870 52512 52282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 53989 52688 gene locus_tag LOCUS_15880 53989 52688 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067043.1 protein_id gnl|my_center|LOCUS_15880 55049 53991 gene locus_tag LOCUS_15890 55049 53991 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089248.1 protein_id gnl|my_center|LOCUS_15890 55204 55046 gene locus_tag LOCUS_15900 55204 55046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 56484 55189 gene locus_tag LOCUS_15910 56484 55189 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970297.1 protein_id gnl|my_center|LOCUS_15910 58702 56729 gene locus_tag LOCUS_15920 58702 56729 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039172.1 protein_id gnl|my_center|LOCUS_15920 59773 58928 gene locus_tag LOCUS_15930 59773 58928 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_15930 59964 62066 gene locus_tag LOCUS_15940 59964 62066 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919391.1 protein_id gnl|my_center|LOCUS_15940 62857 62174 gene locus_tag LOCUS_15950 62857 62174 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528491.1 protein_id gnl|my_center|LOCUS_15950 65264 62877 gene locus_tag LOCUS_15960 65264 62877 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037900.1 protein_id gnl|my_center|LOCUS_15960 65619 68300 gene locus_tag LOCUS_15970 65619 68300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 68970 68278 gene locus_tag LOCUS_15980 68970 68278 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918247.1 protein_id gnl|my_center|LOCUS_15980 69251 72004 gene locus_tag LOCUS_15990 69251 72004 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920761.1 protein_id gnl|my_center|LOCUS_15990 72145 72657 gene locus_tag LOCUS_16000 72145 72657 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265673.1 protein_id gnl|my_center|LOCUS_16000 72650 73654 gene locus_tag LOCUS_16010 72650 73654 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919014.1 protein_id gnl|my_center|LOCUS_16010 73832 75097 gene locus_tag LOCUS_16020 73832 75097 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_16020 75146 76777 gene locus_tag LOCUS_16030 75146 76777 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919299.1 protein_id gnl|my_center|LOCUS_16030 76774 77148 gene locus_tag LOCUS_16040 76774 77148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 78468 77152 gene locus_tag LOCUS_16050 78468 77152 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037785.1 protein_id gnl|my_center|LOCUS_16050 78633 79013 gene locus_tag LOCUS_16060 78633 79013 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038770.1 protein_id gnl|my_center|LOCUS_16060 79038 79364 gene locus_tag LOCUS_16070 79038 79364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767805.1 protein_id gnl|my_center|LOCUS_16070 79428 80423 gene locus_tag LOCUS_16080 79428 80423 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172171.1 protein_id gnl|my_center|LOCUS_16080 81895 80405 gene locus_tag LOCUS_16090 81895 80405 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918886.1 protein_id gnl|my_center|LOCUS_16090 82917 81892 gene locus_tag LOCUS_16100 82917 81892 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640116.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16100 83611 82910 gene locus_tag LOCUS_16110 83611 82910 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640115.1 protein_id gnl|my_center|LOCUS_16110 86921 83670 gene locus_tag LOCUS_16120 86921 83670 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918883.1 protein_id gnl|my_center|LOCUS_16120 89314 87065 gene locus_tag LOCUS_16130 89314 87065 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919624.1 protein_id gnl|my_center|LOCUS_16130 89428 90651 gene locus_tag LOCUS_16140 89428 90651 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919916.1 protein_id gnl|my_center|LOCUS_16140 91835 90573 gene locus_tag LOCUS_16150 91835 90573 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 protein_id gnl|my_center|LOCUS_16150 92985 91879 gene locus_tag LOCUS_16160 92985 91879 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207409.1 protein_id gnl|my_center|LOCUS_16160 94109 92982 gene locus_tag LOCUS_16170 94109 92982 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760823.1 protein_id gnl|my_center|LOCUS_16170 95146 94106 gene locus_tag LOCUS_16180 95146 94106 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087251.1 protein_id gnl|my_center|LOCUS_16180 96684 95143 gene locus_tag LOCUS_16190 96684 95143 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207407.1 protein_id gnl|my_center|LOCUS_16190 97058 96807 gene locus_tag LOCUS_16200 97058 96807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 97873 97157 gene locus_tag LOCUS_16210 97873 97157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 98273 97962 gene locus_tag LOCUS_16220 98273 97962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 99039 98440 gene locus_tag LOCUS_16230 99039 98440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 99736 99134 gene locus_tag LOCUS_16240 99736 99134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 99857 100273 gene locus_tag LOCUS_16250 99857 100273 CDS product DUF3597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171860.1 protein_id gnl|my_center|LOCUS_16250 100434 100931 gene locus_tag LOCUS_16260 100434 100931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 102719 100941 gene locus_tag LOCUS_16270 102719 100941 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640680.1 protein_id gnl|my_center|LOCUS_16270 105238 102770 gene locus_tag LOCUS_16280 105238 102770 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920983.1 protein_id gnl|my_center|LOCUS_16280 106438 105335 gene locus_tag LOCUS_16290 106438 105335 CDS product DUF2332 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265912.1 protein_id gnl|my_center|LOCUS_16290 108666 106531 gene locus_tag LOCUS_16300 108666 106531 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920983.1 protein_id gnl|my_center|LOCUS_16300 109022 108585 gene locus_tag LOCUS_16310 109022 108585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16310 109304 110122 gene locus_tag LOCUS_16320 109304 110122 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061685.1 protein_id gnl|my_center|LOCUS_16320 111428 110130 gene locus_tag LOCUS_16330 111428 110130 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625669.1 protein_id gnl|my_center|LOCUS_16330 111588 112583 gene locus_tag LOCUS_16340 111588 112583 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 protein_id gnl|my_center|LOCUS_16340 112883 112698 gene locus_tag LOCUS_16350 112883 112698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 115064 113172 gene locus_tag LOCUS_16360 115064 113172 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170064.1 protein_id gnl|my_center|LOCUS_16360 117662 115212 gene locus_tag LOCUS_16370 117662 115212 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920983.1 protein_id gnl|my_center|LOCUS_16370 119130 117940 gene locus_tag LOCUS_16380 119130 117940 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_16380 119243 119698 gene locus_tag LOCUS_16390 119243 119698 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265920.1 protein_id gnl|my_center|LOCUS_16390 119802 119712 gene locus_tag LOCUS_t00310 119802 119712 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 119899 120765 gene locus_tag LOCUS_16400 119899 120765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 120989 123508 gene locus_tag LOCUS_16410 120989 123508 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037568.1 protein_id gnl|my_center|LOCUS_16410 123697 124638 gene locus_tag LOCUS_16420 123697 124638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 124923 126569 gene locus_tag LOCUS_16430 124923 126569 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038582.1 protein_id gnl|my_center|LOCUS_16430 126573 127751 gene locus_tag LOCUS_16440 126573 127751 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705600.1 protein_id gnl|my_center|LOCUS_16440 127748 129136 gene locus_tag LOCUS_16450 127748 129136 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705601.1 protein_id gnl|my_center|LOCUS_16450 129211 129636 gene locus_tag LOCUS_16460 129211 129636 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083560.1 protein_id gnl|my_center|LOCUS_16460 129720 130229 gene locus_tag LOCUS_16470 gene gloA 129720 130229 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101793.1 protein_id gnl|my_center|LOCUS_16470 130384 131898 gene locus_tag LOCUS_16480 130384 131898 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971110.1 protein_id gnl|my_center|LOCUS_16480 131982 132254 gene locus_tag LOCUS_16490 131982 132254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 132268 134448 gene locus_tag LOCUS_16500 132268 134448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 134445 135302 gene locus_tag LOCUS_16510 134445 135302 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706839.1 protein_id gnl|my_center|LOCUS_16510 135302 136321 gene locus_tag LOCUS_16520 135302 136321 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918324.1 protein_id gnl|my_center|LOCUS_16520 136318 136890 gene locus_tag LOCUS_16530 136318 136890 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918326.1 protein_id gnl|my_center|LOCUS_16530 136968 137300 gene locus_tag LOCUS_16540 136968 137300 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918320.1 protein_id gnl|my_center|LOCUS_16540 137324 137767 gene locus_tag LOCUS_16550 137324 137767 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265620.1 protein_id gnl|my_center|LOCUS_16550 137819 138826 gene locus_tag LOCUS_16560 gene cheB 137819 138826 CDS product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970952.1 protein_id gnl|my_center|LOCUS_16560 138862 139128 gene locus_tag LOCUS_16570 138862 139128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 139831 139328 gene locus_tag LOCUS_16580 139831 139328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 142888 140024 gene locus_tag LOCUS_16590 142888 140024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 143941 143129 gene locus_tag LOCUS_16600 143941 143129 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640699.1 protein_id gnl|my_center|LOCUS_16600 146312 144027 gene locus_tag LOCUS_16610 146312 144027 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813609.1 protein_id gnl|my_center|LOCUS_16610 146368 146739 gene locus_tag LOCUS_16620 146368 146739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 146736 148301 gene locus_tag LOCUS_16630 146736 148301 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928947.1 protein_id gnl|my_center|LOCUS_16630 148294 148668 gene locus_tag LOCUS_16640 148294 148668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 149509 148574 gene locus_tag LOCUS_16650 149509 148574 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531363.1 protein_id gnl|my_center|LOCUS_16650 149625 150941 gene locus_tag LOCUS_16660 149625 150941 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142259.1 protein_id gnl|my_center|LOCUS_16660 151654 150899 gene locus_tag LOCUS_16670 151654 150899 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528029.1 protein_id gnl|my_center|LOCUS_16670 154657 151841 gene locus_tag LOCUS_16680 154657 151841 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918450.1 protein_id gnl|my_center|LOCUS_16680 154856 156076 gene locus_tag LOCUS_16690 154856 156076 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035996.1 protein_id gnl|my_center|LOCUS_16690 156123 157877 gene locus_tag LOCUS_16700 156123 157877 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533172.1 protein_id gnl|my_center|LOCUS_16700 157874 159220 gene locus_tag LOCUS_16710 157874 159220 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387751.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16710 159210 160790 gene locus_tag LOCUS_16720 159210 160790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 162423 160948 gene locus_tag LOCUS_16730 gene pelF 162423 160948 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 protein_id gnl|my_center|LOCUS_16730 163274 162420 gene locus_tag LOCUS_16740 163274 162420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 164257 163271 gene locus_tag LOCUS_16750 164257 163271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 165702 164254 gene locus_tag LOCUS_16760 165702 164254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 167450 165732 gene locus_tag LOCUS_16770 167450 165732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 168307 167447 gene locus_tag LOCUS_16780 168307 167447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 169701 168304 gene locus_tag LOCUS_16790 gene pelG 169701 168304 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 protein_id gnl|my_center|LOCUS_16790 173094 169723 gene locus_tag LOCUS_16800 173094 169723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 173310 173990 gene locus_tag LOCUS_16810 173310 173990 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_16810 173987 175351 gene locus_tag LOCUS_16820 173987 175351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 177463 175352 gene locus_tag LOCUS_16830 177463 175352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 179947 177542 gene locus_tag LOCUS_16840 179947 177542 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_16840 182481 180058 gene locus_tag LOCUS_16850 182481 180058 CDS product DUF3772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040940459.1 protein_id gnl|my_center|LOCUS_16850 182657 184252 gene locus_tag LOCUS_16860 182657 184252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 184249 184632 gene locus_tag LOCUS_16870 184249 184632 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038770.1 protein_id gnl|my_center|LOCUS_16870 184629 185414 gene locus_tag LOCUS_16880 184629 185414 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337109.1 protein_id gnl|my_center|LOCUS_16880 185566 188256 gene locus_tag LOCUS_16890 185566 188256 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265674.1 protein_id gnl|my_center|LOCUS_16890 188256 189356 gene locus_tag LOCUS_16900 188256 189356 CDS product phosphatidylinositol-specific phospholipase C1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920762.1 protein_id gnl|my_center|LOCUS_16900 189903 189427 gene locus_tag LOCUS_16910 189903 189427 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770293.1 protein_id gnl|my_center|LOCUS_16910 190892 190098 gene locus_tag LOCUS_16920 190892 190098 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_16920 191452 190889 gene locus_tag LOCUS_16930 191452 190889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 191593 192528 gene locus_tag LOCUS_16940 gene dapF 191593 192528 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965912.1 protein_id gnl|my_center|LOCUS_16940 193040 193933 gene locus_tag LOCUS_16950 193040 193933 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113910.1 protein_id gnl|my_center|LOCUS_16950 194156 194302 gene locus_tag LOCUS_16960 194156 194302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 195189 194266 gene locus_tag LOCUS_16970 195189 194266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 196870 195335 gene locus_tag LOCUS_16980 196870 195335 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066972.1 protein_id gnl|my_center|LOCUS_16980 197166 196867 gene locus_tag LOCUS_16990 197166 196867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 197623 197168 gene locus_tag LOCUS_17000 197623 197168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 198747 197620 gene locus_tag LOCUS_17010 198747 197620 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923248.1 protein_id gnl|my_center|LOCUS_17010 198881 198747 gene locus_tag LOCUS_17020 198881 198747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 199128 200549 gene locus_tag LOCUS_17030 199128 200549 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089866.1 protein_id gnl|my_center|LOCUS_17030 201570 200686 gene locus_tag LOCUS_17040 201570 200686 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 protein_id gnl|my_center|LOCUS_17040 201854 202681 gene locus_tag LOCUS_17050 gene thiD 201854 202681 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388857.1 protein_id gnl|my_center|LOCUS_17050 202753 203349 gene locus_tag LOCUS_17060 202753 203349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 203687 204826 gene locus_tag LOCUS_17070 203687 204826 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968922.1 protein_id gnl|my_center|LOCUS_17070 204869 205924 gene locus_tag LOCUS_17080 gene folP 204869 205924 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337038.1 protein_id gnl|my_center|LOCUS_17080 205976 206737 gene locus_tag LOCUS_17090 205976 206737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 206792 208291 gene locus_tag LOCUS_17100 206792 208291 CDS product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316406.1 protein_id gnl|my_center|LOCUS_17100 208292 208735 gene locus_tag LOCUS_17110 gene tcrA 208292 208735 CDS product acid-responsive two-component system response regulator TcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970747.1 protein_id gnl|my_center|LOCUS_17110 208813 209784 gene locus_tag LOCUS_17120 208813 209784 CDS product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087060.1 protein_id gnl|my_center|LOCUS_17120 211133 210384 gene locus_tag LOCUS_17130 211133 210384 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640216.1 protein_id gnl|my_center|LOCUS_17130 213801 211309 gene locus_tag LOCUS_17140 gene gyrB 213801 211309 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390482.1 protein_id gnl|my_center|LOCUS_17140 213973 214353 gene locus_tag LOCUS_17150 213973 214353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 215621 214542 gene locus_tag LOCUS_17160 gene recF 215621 214542 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527878.1 protein_id gnl|my_center|LOCUS_17160 216993 215767 gene locus_tag LOCUS_17170 gene dnaN 216993 215767 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387763.1 protein_id gnl|my_center|LOCUS_17170 217647 217033 gene locus_tag LOCUS_17180 217647 217033 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084022.1 protein_id gnl|my_center|LOCUS_17180 217789 218445 gene locus_tag LOCUS_17190 217789 218445 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454893.1 protein_id gnl|my_center|LOCUS_17190 218442 218915 gene locus_tag LOCUS_17200 218442 218915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 219048 220292 gene locus_tag LOCUS_17210 gene rlmN 219048 220292 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083356.1 protein_id gnl|my_center|LOCUS_17210 220492 221253 gene locus_tag LOCUS_17220 220492 221253 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528860.1 protein_id gnl|my_center|LOCUS_17220 221752 221294 gene locus_tag LOCUS_17230 221752 221294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 222057 222425 gene locus_tag LOCUS_17240 222057 222425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 223019 222471 gene locus_tag LOCUS_17250 223019 222471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 223712 223092 gene locus_tag LOCUS_17260 223712 223092 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035721.1 protein_id gnl|my_center|LOCUS_17260 223737 224465 gene locus_tag LOCUS_17270 223737 224465 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126923991.1 protein_id gnl|my_center|LOCUS_17270 224462 225217 gene locus_tag LOCUS_17280 224462 225217 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037113771.1 protein_id gnl|my_center|LOCUS_17280 225236 226480 gene locus_tag LOCUS_17290 gene cfa2 225236 226480 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969028.1 protein_id gnl|my_center|LOCUS_17290 227014 226613 gene locus_tag LOCUS_17300 227014 226613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 227442 227011 gene locus_tag LOCUS_17310 227442 227011 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 protein_id gnl|my_center|LOCUS_17310 227649 228674 gene locus_tag LOCUS_17320 227649 228674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 228725 229897 gene locus_tag LOCUS_17330 228725 229897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 229894 231369 gene locus_tag LOCUS_17340 229894 231369 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106515452.1 protein_id gnl|my_center|LOCUS_17340 231465 232481 gene locus_tag LOCUS_17350 231465 232481 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704140.1 protein_id gnl|my_center|LOCUS_17350 232561 233481 gene locus_tag LOCUS_17360 232561 233481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 235434 233608 gene locus_tag LOCUS_17370 235434 233608 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974923.1 protein_id gnl|my_center|LOCUS_17370 237657 235687 gene locus_tag LOCUS_17380 237657 235687 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_17380 237779 238009 gene locus_tag LOCUS_17390 237779 238009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 239083 238133 gene locus_tag LOCUS_17400 239083 238133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 239652 239080 gene locus_tag LOCUS_17410 239652 239080 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_17410 239999 239739 gene locus_tag LOCUS_17420 239999 239739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 240891 240043 gene locus_tag LOCUS_17430 240891 240043 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_17430 241246 243015 gene locus_tag LOCUS_17440 gene recQ 241246 243015 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_17440 243027 243539 gene locus_tag LOCUS_17450 243027 243539 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529609.1 protein_id gnl|my_center|LOCUS_17450 244056 244871 gene locus_tag LOCUS_17460 244056 244871 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057754.1 protein_id gnl|my_center|LOCUS_17460 244801 245214 gene locus_tag LOCUS_17470 244801 245214 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_17470 245285 246181 gene locus_tag LOCUS_17480 245285 246181 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967744.1 protein_id gnl|my_center|LOCUS_17480 246731 246219 gene locus_tag LOCUS_17490 246731 246219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 246812 247249 gene locus_tag LOCUS_17500 246812 247249 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391820.1 protein_id gnl|my_center|LOCUS_17500 247779 247390 gene locus_tag LOCUS_17510 247779 247390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 247882 248604 gene locus_tag LOCUS_17520 gene ung 247882 248604 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067035.1 protein_id gnl|my_center|LOCUS_17520 248683 248994 gene locus_tag LOCUS_17530 248683 248994 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974886.1 protein_id gnl|my_center|LOCUS_17530 249034 249288 gene locus_tag LOCUS_17540 gene yefM 249034 249288 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259256.1 protein_id gnl|my_center|LOCUS_17540 249285 249551 gene locus_tag LOCUS_17550 249285 249551 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972002.1 protein_id gnl|my_center|LOCUS_17550 249917 250198 gene locus_tag LOCUS_17560 249917 250198 CDS product DUF3892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090958.1 protein_id gnl|my_center|LOCUS_17560 252211 250343 gene locus_tag LOCUS_17570 gene thiC 252211 250343 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919895.1 protein_id gnl|my_center|LOCUS_17570 253578 252538 gene locus_tag LOCUS_17580 253578 252538 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224311.1 protein_id gnl|my_center|LOCUS_17580 254584 253613 gene locus_tag LOCUS_17590 254584 253613 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224311.1 protein_id gnl|my_center|LOCUS_17590 255763 254786 gene locus_tag LOCUS_17600 gene egtD 255763 254786 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967207.1 protein_id gnl|my_center|LOCUS_17600 257037 255766 gene locus_tag LOCUS_17610 gene egtB 257037 255766 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551490.1 protein_id gnl|my_center|LOCUS_17610 257642 257079 gene locus_tag LOCUS_17620 257642 257079 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 protein_id gnl|my_center|LOCUS_17620 257874 257647 gene locus_tag LOCUS_17630 257874 257647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 258738 257884 gene locus_tag LOCUS_17640 gene gluQRS 258738 257884 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_17640 258849 259415 gene locus_tag LOCUS_17650 258849 259415 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920061.1 protein_id gnl|my_center|LOCUS_17650 259434 259883 gene locus_tag LOCUS_17660 259434 259883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 259994 262669 gene locus_tag LOCUS_17670 gene ppc 259994 262669 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191560.1 protein_id gnl|my_center|LOCUS_17670 262671 263072 gene locus_tag LOCUS_17680 262671 263072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 264054 263404 gene locus_tag LOCUS_17690 264054 263404 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532164.1 protein_id gnl|my_center|LOCUS_17690 264548 264051 gene locus_tag LOCUS_17700 264548 264051 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086236.1 protein_id gnl|my_center|LOCUS_17700 264990 264598 gene locus_tag LOCUS_17710 264990 264598 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 protein_id gnl|my_center|LOCUS_17710 265592 264987 gene locus_tag LOCUS_17720 265592 264987 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267085.1 protein_id gnl|my_center|LOCUS_17720 267637 265568 gene locus_tag LOCUS_17730 267637 265568 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083208.1 protein_id gnl|my_center|LOCUS_17730 267900 269690 gene locus_tag LOCUS_17740 267900 269690 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966432.1 protein_id gnl|my_center|LOCUS_17740 274744 270155 gene locus_tag LOCUS_17750 274744 270155 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037450254.1 protein_id gnl|my_center|LOCUS_17750 275664 274849 gene locus_tag LOCUS_17760 275664 274849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 275806 275881 gene locus_tag LOCUS_t00320 275806 275881 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence034 2868 286 gene locus_tag LOCUS_17770 gene lpiA 2868 286 CDS product acid-inducible protein LpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970745.1 protein_id gnl|my_center|LOCUS_17770 3139 3624 gene locus_tag LOCUS_17780 3139 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 3617 4288 gene locus_tag LOCUS_17790 3617 4288 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_17790 4366 5631 gene locus_tag LOCUS_17800 4366 5631 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_17800 6248 5898 gene locus_tag LOCUS_17810 6248 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 7420 6392 gene locus_tag LOCUS_17820 7420 6392 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_17820 7756 10143 gene locus_tag LOCUS_17830 7756 10143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 10064 10858 gene locus_tag LOCUS_17840 10064 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 11979 11038 gene locus_tag LOCUS_17850 11979 11038 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918851.1 protein_id gnl|my_center|LOCUS_17850 12614 11985 gene locus_tag LOCUS_17860 12614 11985 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918669.1 protein_id gnl|my_center|LOCUS_17860 13510 12611 gene locus_tag LOCUS_17870 13510 12611 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968850.1 protein_id gnl|my_center|LOCUS_17870 14056 15696 gene locus_tag LOCUS_17880 gene mqo 14056 15696 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992235.1 protein_id gnl|my_center|LOCUS_17880 16147 15770 gene locus_tag LOCUS_17890 16147 15770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 16273 17235 gene locus_tag LOCUS_17900 16273 17235 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530933.1 protein_id gnl|my_center|LOCUS_17900 17232 18173 gene locus_tag LOCUS_17910 gene metF 17232 18173 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389283.1 protein_id gnl|my_center|LOCUS_17910 18487 19533 gene locus_tag LOCUS_17920 18487 19533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 19677 22274 gene locus_tag LOCUS_17930 gene metH 19677 22274 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160601504.1 protein_id gnl|my_center|LOCUS_17930 22484 23659 gene locus_tag LOCUS_17940 22484 23659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 23703 24470 gene locus_tag LOCUS_17950 gene gntA 23703 24470 CDS product guanitoxin biosynthesis heme-dependent pre-guanitoxin N-hydroxylase GntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390792.1 protein_id gnl|my_center|LOCUS_17950 24467 25066 gene locus_tag LOCUS_17960 24467 25066 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390793.1 protein_id gnl|my_center|LOCUS_17960 26918 25200 gene locus_tag LOCUS_17970 gene phoY 26918 25200 CDS product alkaline phosphatase PhoY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265813.1 protein_id gnl|my_center|LOCUS_17970 26986 29010 gene locus_tag LOCUS_17980 26986 29010 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_17980 29181 30716 gene locus_tag LOCUS_17990 29181 30716 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175426.1 protein_id gnl|my_center|LOCUS_17990 30716 31651 gene locus_tag LOCUS_18000 30716 31651 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088359.1 protein_id gnl|my_center|LOCUS_18000 31651 32412 gene locus_tag LOCUS_18010 31651 32412 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967763.1 protein_id gnl|my_center|LOCUS_18010 33385 32588 gene locus_tag LOCUS_18020 33385 32588 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383980.1 protein_id gnl|my_center|LOCUS_18020 34809 33532 gene locus_tag LOCUS_18030 34809 33532 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921462.1 protein_id gnl|my_center|LOCUS_18030 35197 37119 gene locus_tag LOCUS_18040 35197 37119 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104754.1 protein_id gnl|my_center|LOCUS_18040 37233 37640 gene locus_tag LOCUS_18050 37233 37640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 37697 37773 gene locus_tag LOCUS_t00330 37697 37773 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 38124 39314 gene locus_tag LOCUS_18060 38124 39314 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975626.1 protein_id gnl|my_center|LOCUS_18060 40148 39342 gene locus_tag LOCUS_18070 gene fdhD 40148 39342 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085919.1 protein_id gnl|my_center|LOCUS_18070 40662 40156 gene locus_tag LOCUS_18080 40662 40156 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160352515.1 protein_id gnl|my_center|LOCUS_18080 42947 40659 gene locus_tag LOCUS_18090 42947 40659 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337007.1 protein_id gnl|my_center|LOCUS_18090 43070 44038 gene locus_tag LOCUS_18100 gene trxB 43070 44038 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090115.1 protein_id gnl|my_center|LOCUS_18100 44263 44640 gene locus_tag LOCUS_18110 44263 44640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 45686 44820 gene locus_tag LOCUS_18120 45686 44820 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525132.1 protein_id gnl|my_center|LOCUS_18120 46236 45715 gene locus_tag LOCUS_18130 46236 45715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 47117 46260 gene locus_tag LOCUS_18140 47117 46260 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338591.1 protein_id gnl|my_center|LOCUS_18140 48028 47192 gene locus_tag LOCUS_18150 48028 47192 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_18150 48699 48004 gene locus_tag LOCUS_18160 48699 48004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 48968 48696 gene locus_tag LOCUS_18170 48968 48696 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_18170 49491 50981 gene locus_tag LOCUS_18180 49491 50981 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548106.1 protein_id gnl|my_center|LOCUS_18180 50978 52192 gene locus_tag LOCUS_18190 50978 52192 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_18190 52311 52949 gene locus_tag LOCUS_18200 52311 52949 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_18200 52965 54473 gene locus_tag LOCUS_18210 52965 54473 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_18210 54536 55609 gene locus_tag LOCUS_18220 54536 55609 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390867.1 protein_id gnl|my_center|LOCUS_18220 55612 57312 gene locus_tag LOCUS_18230 55612 57312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 57332 58690 gene locus_tag LOCUS_18240 57332 58690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 58680 59546 gene locus_tag LOCUS_18250 58680 59546 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_18250 59543 60580 gene locus_tag LOCUS_18260 59543 60580 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_18260 60577 61731 gene locus_tag LOCUS_18270 60577 61731 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_18270 61728 63233 gene locus_tag LOCUS_18280 gene xrtA 61728 63233 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_18280 63240 65123 gene locus_tag LOCUS_18290 63240 65123 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_18290 66683 65691 gene locus_tag LOCUS_18300 66683 65691 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053070.1 protein_id gnl|my_center|LOCUS_18300 66945 66799 gene locus_tag LOCUS_18310 66945 66799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 67994 66945 gene locus_tag LOCUS_18320 67994 66945 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639944.1 protein_id gnl|my_center|LOCUS_18320 69416 68181 gene locus_tag LOCUS_18330 69416 68181 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 protein_id gnl|my_center|LOCUS_18330 69558 70520 gene locus_tag LOCUS_18340 69558 70520 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967041.1 protein_id gnl|my_center|LOCUS_18340 70520 70684 gene locus_tag LOCUS_18350 70520 70684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 70852 71526 gene locus_tag LOCUS_18360 gene mtgA 70852 71526 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918214.1 protein_id gnl|my_center|LOCUS_18360 72308 72054 gene locus_tag LOCUS_18370 72308 72054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 72705 72382 gene locus_tag LOCUS_18380 72705 72382 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090837.1 protein_id gnl|my_center|LOCUS_18380 74269 72707 gene locus_tag LOCUS_18390 74269 72707 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338432.1 protein_id gnl|my_center|LOCUS_18390 74222 74422 gene locus_tag LOCUS_18400 74222 74422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 75003 74689 gene locus_tag LOCUS_18410 75003 74689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 75406 75101 gene locus_tag LOCUS_18420 75406 75101 CDS product ferredoxin family 2Fe-2S iron-sulfur cluster binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_18420 76680 75403 gene locus_tag LOCUS_18430 76680 75403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 77684 76677 gene locus_tag LOCUS_18440 77684 76677 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_18440 77834 78490 gene locus_tag LOCUS_18450 77834 78490 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495402.1 protein_id gnl|my_center|LOCUS_18450 78696 79127 gene locus_tag LOCUS_18460 78696 79127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 79216 80412 gene locus_tag LOCUS_18470 79216 80412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 80409 81008 gene locus_tag LOCUS_18480 80409 81008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 82272 81367 gene locus_tag LOCUS_18490 gene rpoH 82272 81367 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920934.1 protein_id gnl|my_center|LOCUS_18490 83287 82340 gene locus_tag LOCUS_18500 83287 82340 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918341.1 protein_id gnl|my_center|LOCUS_18500 83305 83757 gene locus_tag LOCUS_18510 83305 83757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 83754 84398 gene locus_tag LOCUS_18520 83754 84398 CDS product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529909.1 protein_id gnl|my_center|LOCUS_18520 84459 86783 gene locus_tag LOCUS_18530 84459 86783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 86783 87211 gene locus_tag LOCUS_18540 86783 87211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 87294 87659 gene locus_tag LOCUS_18550 87294 87659 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007600538.1 protein_id gnl|my_center|LOCUS_18550 87697 88761 gene locus_tag LOCUS_18560 87697 88761 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918484.1 protein_id gnl|my_center|LOCUS_18560 88761 89648 gene locus_tag LOCUS_18570 88761 89648 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_18570 89719 90408 gene locus_tag LOCUS_18580 89719 90408 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 protein_id gnl|my_center|LOCUS_18580 91241 93235 gene locus_tag LOCUS_18590 91241 93235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 93922 93284 gene locus_tag LOCUS_18600 gene can 93922 93284 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072441.1 protein_id gnl|my_center|LOCUS_18600 95499 93919 gene locus_tag LOCUS_18610 95499 93919 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_18610 95685 96224 gene locus_tag LOCUS_18620 95685 96224 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920846.1 protein_id gnl|my_center|LOCUS_18620 96221 96517 gene locus_tag LOCUS_18630 96221 96517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 97269 96868 gene locus_tag LOCUS_18640 97269 96868 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085853.1 protein_id gnl|my_center|LOCUS_18640 97991 97323 gene locus_tag LOCUS_18650 97991 97323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 98233 97994 gene locus_tag LOCUS_18660 98233 97994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 98524 98267 gene locus_tag LOCUS_18670 98524 98267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 98831 98553 gene locus_tag LOCUS_18680 98831 98553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 99140 98844 gene locus_tag LOCUS_18690 99140 98844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 99566 99183 gene locus_tag LOCUS_18700 gene pspC 99566 99183 CDS product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071930.1 protein_id gnl|my_center|LOCUS_18700 99861 99568 gene locus_tag LOCUS_18710 99861 99568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 100531 99863 gene locus_tag LOCUS_18720 gene pspA 100531 99863 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_18720 100713 100561 gene locus_tag LOCUS_18730 100713 100561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 100889 101935 gene locus_tag LOCUS_18740 gene pspF 100889 101935 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 protein_id gnl|my_center|LOCUS_18740 102002 102613 gene locus_tag LOCUS_18750 gene sodA 102002 102613 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_18750 102869 104596 gene locus_tag LOCUS_18760 102869 104596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 105243 104629 gene locus_tag LOCUS_18770 105243 104629 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067297.1 protein_id gnl|my_center|LOCUS_18770 106175 105240 gene locus_tag LOCUS_18780 106175 105240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 107317 106172 gene locus_tag LOCUS_18790 gene mtaB 107317 106172 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388937.1 protein_id gnl|my_center|LOCUS_18790 107430 108005 gene locus_tag LOCUS_18800 107430 108005 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_18800 109446 107980 gene locus_tag LOCUS_18810 109446 107980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 109772 111292 gene locus_tag LOCUS_18820 gene ffh 109772 111292 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965072.1 protein_id gnl|my_center|LOCUS_18820 111350 111733 gene locus_tag LOCUS_18830 111350 111733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 111843 111983 gene locus_tag LOCUS_18840 111843 111983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 111961 112449 gene locus_tag LOCUS_18850 gene rimM 111961 112449 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083314.1 protein_id gnl|my_center|LOCUS_18850 113347 112439 gene locus_tag LOCUS_18860 113347 112439 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174092.1 protein_id gnl|my_center|LOCUS_18860 113434 113706 gene locus_tag LOCUS_18870 113434 113706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 113699 114082 gene locus_tag LOCUS_18880 113699 114082 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_18880 114079 114798 gene locus_tag LOCUS_18890 gene trmD 114079 114798 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528859.1 protein_id gnl|my_center|LOCUS_18890 114810 115202 gene locus_tag LOCUS_18900 114810 115202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 116068 115427 gene locus_tag LOCUS_18910 116068 115427 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919214.1 protein_id gnl|my_center|LOCUS_18910 116600 116142 gene locus_tag LOCUS_18920 116600 116142 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087264.1 protein_id gnl|my_center|LOCUS_18920 118749 116737 gene locus_tag LOCUS_18930 gene rpoD 118749 116737 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972109.1 protein_id gnl|my_center|LOCUS_18930 120754 118907 gene locus_tag LOCUS_18940 120754 118907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 121253 120873 gene locus_tag LOCUS_18950 121253 120873 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035690.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence035 3297 307 gene locus_tag LOCUS_18960 3297 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 5792 3540 gene locus_tag LOCUS_18970 5792 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 6849 5905 gene locus_tag LOCUS_18980 6849 5905 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388639.1 protein_id gnl|my_center|LOCUS_18980 7413 6871 gene locus_tag LOCUS_18990 7413 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 8237 7434 gene locus_tag LOCUS_19000 8237 7434 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529675.1 protein_id gnl|my_center|LOCUS_19000 9138 8248 gene locus_tag LOCUS_19010 9138 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 9388 10854 gene locus_tag LOCUS_19020 9388 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 10946 11599 gene locus_tag LOCUS_19030 10946 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 11771 14038 gene locus_tag LOCUS_19040 gene katG 11771 14038 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167181779.1 protein_id gnl|my_center|LOCUS_19040 15764 14100 gene locus_tag LOCUS_19050 15764 14100 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265651.1 protein_id gnl|my_center|LOCUS_19050 17238 15781 gene locus_tag LOCUS_19060 17238 15781 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042595882.1 protein_id gnl|my_center|LOCUS_19060 17416 19341 gene locus_tag LOCUS_19070 gene acs 17416 19341 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921410.1 protein_id gnl|my_center|LOCUS_19070 19428 19973 gene locus_tag LOCUS_19080 19428 19973 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092229.1 protein_id gnl|my_center|LOCUS_19080 23529 20233 gene locus_tag LOCUS_19090 23529 20233 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039145.1 protein_id gnl|my_center|LOCUS_19090 27117 23719 gene locus_tag LOCUS_19100 27117 23719 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265500.1 protein_id gnl|my_center|LOCUS_19100 27240 28115 gene locus_tag LOCUS_19110 27240 28115 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920157.1 protein_id gnl|my_center|LOCUS_19110 28616 28122 gene locus_tag LOCUS_19120 28616 28122 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_19120 29824 28616 gene locus_tag LOCUS_19130 29824 28616 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162234465.1 protein_id gnl|my_center|LOCUS_19130 30786 29884 gene locus_tag LOCUS_19140 30786 29884 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036667.1 protein_id gnl|my_center|LOCUS_19140 30969 32654 gene locus_tag LOCUS_19150 30969 32654 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036666.1 protein_id gnl|my_center|LOCUS_19150 32638 33723 gene locus_tag LOCUS_19160 32638 33723 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036665.1 protein_id gnl|my_center|LOCUS_19160 33720 35174 gene locus_tag LOCUS_19170 33720 35174 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036664.1 protein_id gnl|my_center|LOCUS_19170 37065 35362 gene locus_tag LOCUS_19180 37065 35362 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918680.1 protein_id gnl|my_center|LOCUS_19180 38353 37172 gene locus_tag LOCUS_19190 38353 37172 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920728.1 protein_id gnl|my_center|LOCUS_19190 38624 40453 gene locus_tag LOCUS_19200 38624 40453 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917955.1 protein_id gnl|my_center|LOCUS_19200 41981 40509 gene locus_tag LOCUS_19210 41981 40509 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275526.1 protein_id gnl|my_center|LOCUS_19210 43579 41990 gene locus_tag LOCUS_19220 43579 41990 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037485.1 protein_id gnl|my_center|LOCUS_19220 44772 43576 gene locus_tag LOCUS_19230 44772 43576 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037486.1 protein_id gnl|my_center|LOCUS_19230 44869 45330 gene locus_tag LOCUS_19240 44869 45330 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975070.1 protein_id gnl|my_center|LOCUS_19240 45856 45392 gene locus_tag LOCUS_19250 45856 45392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 46988 45819 gene locus_tag LOCUS_19260 46988 45819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 49142 47175 gene locus_tag LOCUS_19270 49142 47175 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_19270 49357 50064 gene locus_tag LOCUS_19280 49357 50064 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919296.1 protein_id gnl|my_center|LOCUS_19280 51528 50278 gene locus_tag LOCUS_19290 51528 50278 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456650.1 protein_id gnl|my_center|LOCUS_19290 51655 51870 gene locus_tag LOCUS_19300 51655 51870 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313175.1 protein_id gnl|my_center|LOCUS_19300 52869 52231 gene locus_tag LOCUS_19310 52869 52231 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_19310 53350 52874 gene locus_tag LOCUS_19320 gene greA 53350 52874 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920688.1 protein_id gnl|my_center|LOCUS_19320 56777 53445 gene locus_tag LOCUS_19330 gene carB 56777 53445 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390636.1 protein_id gnl|my_center|LOCUS_19330 57109 56780 gene locus_tag LOCUS_19340 57109 56780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 58326 57145 gene locus_tag LOCUS_19350 gene carA 58326 57145 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390635.1 protein_id gnl|my_center|LOCUS_19350 58467 58919 gene locus_tag LOCUS_19360 58467 58919 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090104.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence036 422 21 gene locus_tag LOCUS_19370 422 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 841 755 gene locus_tag LOCUS_t00340 841 755 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 947 1879 gene locus_tag LOCUS_19380 947 1879 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_19380 1951 2772 gene locus_tag LOCUS_19390 1951 2772 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721584.1 protein_id gnl|my_center|LOCUS_19390 2926 4377 gene locus_tag LOCUS_19400 2926 4377 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 protein_id gnl|my_center|LOCUS_19400 4374 4964 gene locus_tag LOCUS_19410 4374 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 4964 9478 gene locus_tag LOCUS_19420 gene gltB 4964 9478 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387780.1 protein_id gnl|my_center|LOCUS_19420 9825 10904 gene locus_tag LOCUS_19430 9825 10904 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113380.1 protein_id gnl|my_center|LOCUS_19430 11028 11549 gene locus_tag LOCUS_19440 11028 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 12170 11898 gene locus_tag LOCUS_19450 12170 11898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 13309 12254 gene locus_tag LOCUS_19460 13309 12254 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105702.1 protein_id gnl|my_center|LOCUS_19460 13581 14648 gene locus_tag LOCUS_19470 13581 14648 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920901.1 protein_id gnl|my_center|LOCUS_19470 14990 16414 gene locus_tag LOCUS_19480 14990 16414 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265632.1 protein_id gnl|my_center|LOCUS_19480 17861 16620 gene locus_tag LOCUS_19490 17861 16620 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919660.1 protein_id gnl|my_center|LOCUS_19490 19159 17966 gene locus_tag LOCUS_19500 19159 17966 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038894.1 protein_id gnl|my_center|LOCUS_19500 19358 19936 gene locus_tag LOCUS_19510 gene rimP 19358 19936 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639861.1 protein_id gnl|my_center|LOCUS_19510 19936 21552 gene locus_tag LOCUS_19520 gene nusA 19936 21552 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527896.1 protein_id gnl|my_center|LOCUS_19520 21552 21788 gene locus_tag LOCUS_19530 21552 21788 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209548.1 protein_id gnl|my_center|LOCUS_19530 21736 22572 gene locus_tag LOCUS_19540 21736 22572 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626660.1 protein_id gnl|my_center|LOCUS_19540 22569 25412 gene locus_tag LOCUS_19550 gene infB 22569 25412 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097063504.1 protein_id gnl|my_center|LOCUS_19550 25514 25921 gene locus_tag LOCUS_19560 gene rbfA 25514 25921 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083604.1 protein_id gnl|my_center|LOCUS_19560 26170 26493 gene locus_tag LOCUS_19570 26170 26493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 27080 26490 gene locus_tag LOCUS_19580 27080 26490 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228210.1 protein_id gnl|my_center|LOCUS_19580 27134 27745 gene locus_tag LOCUS_19590 27134 27745 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314642.1 protein_id gnl|my_center|LOCUS_19590 27756 28778 gene locus_tag LOCUS_19600 gene truB 27756 28778 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172518.1 protein_id gnl|my_center|LOCUS_19600 28791 29060 gene locus_tag LOCUS_19610 gene rpsO 28791 29060 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 protein_id gnl|my_center|LOCUS_19610 29307 31655 gene locus_tag LOCUS_19620 gene pnp 29307 31655 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917924.1 protein_id gnl|my_center|LOCUS_19620 31885 33276 gene locus_tag LOCUS_19630 31885 33276 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919528.1 protein_id gnl|my_center|LOCUS_19630 34297 33302 gene locus_tag LOCUS_19640 34297 33302 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533625.1 protein_id gnl|my_center|LOCUS_19640 36017 34602 gene locus_tag LOCUS_19650 36017 34602 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330170.1 protein_id gnl|my_center|LOCUS_19650 38579 36480 gene locus_tag LOCUS_19660 38579 36480 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385014.1 protein_id gnl|my_center|LOCUS_19660 41262 38851 gene locus_tag LOCUS_19670 41262 38851 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650294.1 protein_id gnl|my_center|LOCUS_19670 41282 42280 gene locus_tag LOCUS_19680 41282 42280 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014745580.1 protein_id gnl|my_center|LOCUS_19680 44179 42380 gene locus_tag LOCUS_19690 gene mdoH 44179 42380 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919884.1 protein_id gnl|my_center|LOCUS_19690 45690 44176 gene locus_tag LOCUS_19700 45690 44176 CDS product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339113.1 protein_id gnl|my_center|LOCUS_19700 45901 48846 gene locus_tag LOCUS_19710 45901 48846 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_19710 49729 49121 gene locus_tag LOCUS_19720 49729 49121 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388157.1 protein_id gnl|my_center|LOCUS_19720 49728 51113 gene locus_tag LOCUS_19730 gene argH 49728 51113 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388156.1 protein_id gnl|my_center|LOCUS_19730 51110 51346 gene locus_tag LOCUS_19740 51110 51346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 51346 52608 gene locus_tag LOCUS_19750 gene lysA 51346 52608 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383406.1 protein_id gnl|my_center|LOCUS_19750 52758 53531 gene locus_tag LOCUS_19760 52758 53531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 53528 54481 gene locus_tag LOCUS_19770 gene zntB 53528 54481 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169583.1 protein_id gnl|my_center|LOCUS_19770 55311 54892 gene locus_tag LOCUS_19780 gene fliS 55311 54892 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080180.1 protein_id gnl|my_center|LOCUS_19780 56797 55313 gene locus_tag LOCUS_19790 gene fliD 56797 55313 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096008.1 protein_id gnl|my_center|LOCUS_19790 58001 56874 gene locus_tag LOCUS_19800 gene flhB 58001 56874 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420337.1 protein_id gnl|my_center|LOCUS_19800 58774 58001 gene locus_tag LOCUS_19810 gene fliR 58774 58001 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268436.1 protein_id gnl|my_center|LOCUS_19810 59063 58794 gene locus_tag LOCUS_19820 gene fliQ 59063 58794 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187051.1 protein_id gnl|my_center|LOCUS_19820 60261 59380 gene locus_tag LOCUS_19830 60261 59380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 60614 60258 gene locus_tag LOCUS_19840 60614 60258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 60912 60622 gene locus_tag LOCUS_19850 gene fliN 60912 60622 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720209.1 protein_id gnl|my_center|LOCUS_19850 61895 60909 gene locus_tag LOCUS_19860 gene fliM 61895 60909 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130773.1 protein_id gnl|my_center|LOCUS_19860 62573 61899 gene locus_tag LOCUS_19870 62573 61899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 64449 62584 gene locus_tag LOCUS_19880 64449 62584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19880 64894 64460 gene locus_tag LOCUS_19890 64894 64460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 66253 64916 gene locus_tag LOCUS_19900 66253 64916 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337959.1 protein_id gnl|my_center|LOCUS_19900 67041 66247 gene locus_tag LOCUS_19910 67041 66247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 68053 67034 gene locus_tag LOCUS_19920 gene fliG 68053 67034 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720202.1 protein_id gnl|my_center|LOCUS_19920 69780 68050 gene locus_tag LOCUS_19930 gene fliF 69780 68050 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337957.1 protein_id gnl|my_center|LOCUS_19930 70156 69782 gene locus_tag LOCUS_19940 70156 69782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 71436 70153 gene locus_tag LOCUS_19950 71436 70153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 71721 72575 gene locus_tag LOCUS_19960 71721 72575 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_19960 72789 73634 gene locus_tag LOCUS_19970 72789 73634 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_19970 74620 73775 gene locus_tag LOCUS_19980 74620 73775 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071369.1 protein_id gnl|my_center|LOCUS_19980 75354 74617 gene locus_tag LOCUS_19990 75354 74617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705899.1 protein_id gnl|my_center|LOCUS_19990 76033 75431 gene locus_tag LOCUS_20000 76033 75431 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457739.1 protein_id gnl|my_center|LOCUS_20000 78306 76240 gene locus_tag LOCUS_20010 gene flhA 78306 76240 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337939.1 protein_id gnl|my_center|LOCUS_20010 79188 78310 gene locus_tag LOCUS_20020 79188 78310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 79724 79410 gene locus_tag LOCUS_20030 79724 79410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 80014 79721 gene locus_tag LOCUS_20040 80014 79721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 80606 80109 gene locus_tag LOCUS_20050 80606 80109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 81157 80606 gene locus_tag LOCUS_20060 81157 80606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 81852 81154 gene locus_tag LOCUS_20070 81852 81154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 82259 82606 gene locus_tag LOCUS_20080 gene flgB 82259 82606 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946948.1 protein_id gnl|my_center|LOCUS_20080 82610 83020 gene locus_tag LOCUS_20090 gene flgC 82610 83020 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337978.1 protein_id gnl|my_center|LOCUS_20090 83023 83721 gene locus_tag LOCUS_20100 gene flgD 83023 83721 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244383.1 protein_id gnl|my_center|LOCUS_20100 83751 85040 gene locus_tag LOCUS_20110 gene flgE 83751 85040 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037113.1 protein_id gnl|my_center|LOCUS_20110 85070 85825 gene locus_tag LOCUS_20120 gene flgF 85070 85825 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037112.1 protein_id gnl|my_center|LOCUS_20120 85839 86627 gene locus_tag LOCUS_20130 gene flgG 85839 86627 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005994332.1 protein_id gnl|my_center|LOCUS_20130 86636 87331 gene locus_tag LOCUS_20140 gene flgH 86636 87331 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082166.1 protein_id gnl|my_center|LOCUS_20140 87343 88440 gene locus_tag LOCUS_20150 87343 88440 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082169.1 protein_id gnl|my_center|LOCUS_20150 88437 88766 gene locus_tag LOCUS_20160 88437 88766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 88781 90124 gene locus_tag LOCUS_20170 88781 90124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 90130 91023 gene locus_tag LOCUS_20180 gene flgL 90130 91023 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463980.1 protein_id gnl|my_center|LOCUS_20180 91116 91979 gene locus_tag LOCUS_20190 gene motA 91116 91979 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918636.1 protein_id gnl|my_center|LOCUS_20190 91983 92873 gene locus_tag LOCUS_20200 91983 92873 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389596.1 protein_id gnl|my_center|LOCUS_20200 93121 92915 gene locus_tag LOCUS_20210 93121 92915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 93396 93184 gene locus_tag LOCUS_20220 93396 93184 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003508146.1 protein_id gnl|my_center|LOCUS_20220 94274 93786 gene locus_tag LOCUS_20230 94274 93786 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533377.1 protein_id gnl|my_center|LOCUS_20230 95266 94862 gene locus_tag LOCUS_20240 95266 94862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 96823 95339 gene locus_tag LOCUS_20250 gene rpoN 96823 95339 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083548.1 protein_id gnl|my_center|LOCUS_20250 97834 97034 gene locus_tag LOCUS_20260 gene lptB 97834 97034 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385411.1 protein_id gnl|my_center|LOCUS_20260 98468 97926 gene locus_tag LOCUS_20270 98468 97926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 99113 98487 gene locus_tag LOCUS_20280 99113 98487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 99775 99155 gene locus_tag LOCUS_20290 99775 99155 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338751.1 protein_id gnl|my_center|LOCUS_20290 100111 100959 gene locus_tag LOCUS_20300 100111 100959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 101139 101483 gene locus_tag LOCUS_20310 101139 101483 CDS product low molecular weight protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_20310 102347 101562 gene locus_tag LOCUS_20320 102347 101562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 102576 103028 gene locus_tag LOCUS_20330 102576 103028 CDS product DUF3429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267848.1 protein_id gnl|my_center|LOCUS_20330 103098 103562 gene locus_tag LOCUS_20340 103098 103562 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203374.1 protein_id gnl|my_center|LOCUS_20340 103567 104142 gene locus_tag LOCUS_20350 103567 104142 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974638.1 protein_id gnl|my_center|LOCUS_20350 105515 104172 gene locus_tag LOCUS_20360 105515 104172 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534205.1 protein_id gnl|my_center|LOCUS_20360 106491 105724 gene locus_tag LOCUS_20370 gene pgeF 106491 105724 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976381.1 protein_id gnl|my_center|LOCUS_20370 106997 106488 gene locus_tag LOCUS_20380 106997 106488 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038144.1 protein_id gnl|my_center|LOCUS_20380 108076 106994 gene locus_tag LOCUS_20390 108076 106994 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069708318.1 protein_id gnl|my_center|LOCUS_20390 109108 108227 gene locus_tag LOCUS_20400 gene lgt 109108 108227 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388399.1 protein_id gnl|my_center|LOCUS_20400 109575 111788 gene locus_tag LOCUS_20410 109575 111788 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_20410 111788 112801 gene locus_tag LOCUS_20420 gene hemH 111788 112801 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531079.1 protein_id gnl|my_center|LOCUS_20420 112886 113608 gene locus_tag LOCUS_20430 gene phbB 112886 113608 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_20430 114170 113832 gene locus_tag LOCUS_20440 114170 113832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 114352 115362 gene locus_tag LOCUS_20450 114352 115362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 115911 115603 gene locus_tag LOCUS_20460 gene rpmB 115911 115603 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527451.1 protein_id gnl|my_center|LOCUS_20460 116075 116287 gene locus_tag LOCUS_20470 116075 116287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 116343 116792 gene locus_tag LOCUS_20480 116343 116792 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090228.1 protein_id gnl|my_center|LOCUS_20480 117317 117111 gene locus_tag LOCUS_20490 117317 117111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 118140 117463 gene locus_tag LOCUS_20500 118140 117463 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330705.1 protein_id gnl|my_center|LOCUS_20500 118240 119583 gene locus_tag LOCUS_20510 118240 119583 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530058.1 protein_id gnl|my_center|LOCUS_20510 119938 119570 gene locus_tag LOCUS_20520 119938 119570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 120172 121002 gene locus_tag LOCUS_20530 120172 121002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 121092 121562 gene locus_tag LOCUS_20540 121092 121562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 122119 121559 gene locus_tag LOCUS_20550 122119 121559 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169172.1 protein_id gnl|my_center|LOCUS_20550 122906 122157 gene locus_tag LOCUS_20560 122906 122157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 124256 122970 gene locus_tag LOCUS_20570 gene purD 124256 122970 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532813.1 protein_id gnl|my_center|LOCUS_20570 124255 125676 gene locus_tag LOCUS_20580 124255 125676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 125691 125891 gene locus_tag LOCUS_20590 125691 125891 CDS product DUF2093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090242.1 protein_id gnl|my_center|LOCUS_20590 125888 126733 gene locus_tag LOCUS_20600 125888 126733 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925869.1 protein_id gnl|my_center|LOCUS_20600 127268 126744 gene locus_tag LOCUS_20610 127268 126744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 127498 130425 gene locus_tag LOCUS_20620 127498 130425 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_20620 130502 130723 gene locus_tag LOCUS_20630 130502 130723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 130832 132118 gene locus_tag LOCUS_20640 130832 132118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 132571 135648 gene locus_tag LOCUS_20650 132571 135648 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114864.1 protein_id gnl|my_center|LOCUS_20650 136008 139274 gene locus_tag LOCUS_20660 136008 139274 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918809.1 protein_id gnl|my_center|LOCUS_20660 141923 139344 gene locus_tag LOCUS_20670 gene clpB 141923 139344 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084221.1 protein_id gnl|my_center|LOCUS_20670 142137 144992 gene locus_tag LOCUS_20680 142137 144992 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038616.1 protein_id gnl|my_center|LOCUS_20680 145035 145334 gene locus_tag LOCUS_20690 145035 145334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 145577 147382 gene locus_tag LOCUS_20700 145577 147382 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920889.1 protein_id gnl|my_center|LOCUS_20700 147428 148237 gene locus_tag LOCUS_20710 147428 148237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 149296 148241 gene locus_tag LOCUS_20720 149296 148241 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336844.1 protein_id gnl|my_center|LOCUS_20720 149781 149302 gene locus_tag LOCUS_20730 gene purE 149781 149302 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536030.1 protein_id gnl|my_center|LOCUS_20730 150438 149884 gene locus_tag LOCUS_20740 150438 149884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 151255 150569 gene locus_tag LOCUS_20750 gene gpmA 151255 150569 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920122.1 protein_id gnl|my_center|LOCUS_20750 151537 151313 gene locus_tag LOCUS_20760 151537 151313 CDS product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969964.1 protein_id gnl|my_center|LOCUS_20760 152877 151537 gene locus_tag LOCUS_20770 gene glmM 152877 151537 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174702.1 protein_id gnl|my_center|LOCUS_20770 153016 154260 gene locus_tag LOCUS_20780 gene gltP 153016 154260 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821134.1 protein_id gnl|my_center|LOCUS_20780 154257 155249 gene locus_tag LOCUS_20790 154257 155249 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_20790 157258 155672 gene locus_tag LOCUS_20800 157258 155672 CDS product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 protein_id gnl|my_center|LOCUS_20800 157388 157987 gene locus_tag LOCUS_20810 157388 157987 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157335780.1 protein_id gnl|my_center|LOCUS_20810 158061 158417 gene locus_tag LOCUS_20820 158061 158417 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_20820 159417 158365 gene locus_tag LOCUS_20830 159417 158365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 160332 160087 gene locus_tag LOCUS_20840 160332 160087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 162161 160329 gene locus_tag LOCUS_20850 gene cobT 162161 160329 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918558.1 protein_id gnl|my_center|LOCUS_20850 163162 162158 gene locus_tag LOCUS_20860 gene cobS 163162 162158 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_20860 163365 164129 gene locus_tag LOCUS_20870 163365 164129 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394225.1 protein_id gnl|my_center|LOCUS_20870 164867 164253 gene locus_tag LOCUS_20880 164867 164253 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920846.1 protein_id gnl|my_center|LOCUS_20880 164908 165192 gene locus_tag LOCUS_20890 164908 165192 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_20890 165197 165889 gene locus_tag LOCUS_20900 165197 165889 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929854.1 protein_id gnl|my_center|LOCUS_20900 165886 166332 gene locus_tag LOCUS_20910 165886 166332 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_20910 166325 167224 gene locus_tag LOCUS_20920 166325 167224 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532790.1 protein_id gnl|my_center|LOCUS_20920 169767 167890 gene locus_tag LOCUS_20930 169767 167890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 170717 169761 gene locus_tag LOCUS_20940 170717 169761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 172870 170714 gene locus_tag LOCUS_20950 172870 170714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 173821 172994 gene locus_tag LOCUS_20960 173821 172994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 174234 173851 gene locus_tag LOCUS_20970 174234 173851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 174731 174351 gene locus_tag LOCUS_20980 174731 174351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 174932 176128 gene locus_tag LOCUS_20990 174932 176128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 176821 176123 gene locus_tag LOCUS_21000 176821 176123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 177439 176948 gene locus_tag LOCUS_21010 177439 176948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 179406 177436 gene locus_tag LOCUS_21020 179406 177436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 179995 180089 gene locus_tag LOCUS_t00350 179995 180089 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 180927 180250 gene locus_tag LOCUS_21030 180927 180250 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003198.1 protein_id gnl|my_center|LOCUS_21030 181600 182781 gene locus_tag LOCUS_21040 181600 182781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 182875 183147 gene locus_tag LOCUS_21050 182875 183147 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537152.1 protein_id gnl|my_center|LOCUS_21050 183195 184019 gene locus_tag LOCUS_21060 183195 184019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21060 185191 184196 gene locus_tag LOCUS_21070 185191 184196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 185972 185205 gene locus_tag LOCUS_21080 185972 185205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642350.1 protein_id gnl|my_center|LOCUS_21080 186952 185969 gene locus_tag LOCUS_21090 186952 185969 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_21090 187842 186949 gene locus_tag LOCUS_21100 187842 186949 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337465.1 protein_id gnl|my_center|LOCUS_21100 189791 187842 gene locus_tag LOCUS_21110 189791 187842 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_21110 191048 190275 gene locus_tag LOCUS_21120 191048 190275 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389409.1 protein_id gnl|my_center|LOCUS_21120 191401 191057 gene locus_tag LOCUS_21130 191401 191057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 191848 192831 gene locus_tag LOCUS_21140 191848 192831 CDS product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973350.1 protein_id gnl|my_center|LOCUS_21140 192861 193889 gene locus_tag LOCUS_21150 192861 193889 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973349.1 protein_id gnl|my_center|LOCUS_21150 195733 193952 gene locus_tag LOCUS_21160 195733 193952 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919029.1 protein_id gnl|my_center|LOCUS_21160 195662 195877 gene locus_tag LOCUS_21170 195662 195877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 196854 196558 gene locus_tag LOCUS_21180 196854 196558 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969946.1 protein_id gnl|my_center|LOCUS_21180 197032 197757 gene locus_tag LOCUS_21190 197032 197757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 198281 198652 gene locus_tag LOCUS_21200 198281 198652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21200 199569 199216 gene locus_tag LOCUS_21210 199569 199216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 202870 199637 gene locus_tag LOCUS_21220 202870 199637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 204618 202852 gene locus_tag LOCUS_21230 204618 202852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 205322 204606 gene locus_tag LOCUS_21240 205322 204606 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036640.1 protein_id gnl|my_center|LOCUS_21240 207277 205328 gene locus_tag LOCUS_21250 gene zorA 207277 205328 CDS product anti-phage ZorAB system protein ZorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036639.1 protein_id gnl|my_center|LOCUS_21250 207505 210081 gene locus_tag LOCUS_21260 207505 210081 CDS product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003681.1 protein_id gnl|my_center|LOCUS_21260 210078 211361 gene locus_tag LOCUS_21270 210078 211361 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003683.1 protein_id gnl|my_center|LOCUS_21270 211438 213546 gene locus_tag LOCUS_21280 211438 213546 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338082.1 protein_id gnl|my_center|LOCUS_21280 214761 213754 gene locus_tag LOCUS_21290 214761 213754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 215177 216598 gene locus_tag LOCUS_21300 215177 216598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 216719 217117 gene locus_tag LOCUS_21310 216719 217117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 218371 217322 gene locus_tag LOCUS_21320 218371 217322 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002890.1 protein_id gnl|my_center|LOCUS_21320 219057 221132 gene locus_tag LOCUS_21330 219057 221132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 221164 221811 gene locus_tag LOCUS_21340 221164 221811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 221874 222584 gene locus_tag LOCUS_21350 221874 222584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 222584 223021 gene locus_tag LOCUS_21360 222584 223021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 223264 224388 gene locus_tag LOCUS_21370 223264 224388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204895.1 protein_id gnl|my_center|LOCUS_21370 224388 224906 gene locus_tag LOCUS_21380 224388 224906 CDS product DUF6521 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204896.1 protein_id gnl|my_center|LOCUS_21380 224903 226843 gene locus_tag LOCUS_21390 224903 226843 CDS product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204897.1 protein_id gnl|my_center|LOCUS_21390 228123 227086 gene locus_tag LOCUS_21400 228123 227086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 228637 228170 gene locus_tag LOCUS_21410 228637 228170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 230531 228807 gene locus_tag LOCUS_21420 230531 228807 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116957511.1 protein_id gnl|my_center|LOCUS_21420 231799 230528 gene locus_tag LOCUS_21430 231799 230528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 232315 232240 gene locus_tag LOCUS_t00360 232315 232240 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 232514 232347 gene locus_tag LOCUS_21440 gene yacG 232514 232347 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720789.1 protein_id gnl|my_center|LOCUS_21440 233461 232511 gene locus_tag LOCUS_21450 233461 232511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 234023 233454 gene locus_tag LOCUS_21460 234023 233454 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640472.1 protein_id gnl|my_center|LOCUS_21460 234256 234038 gene locus_tag LOCUS_21470 gene infA 234256 234038 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004617696.1 protein_id gnl|my_center|LOCUS_21470 236523 234544 gene locus_tag LOCUS_21480 236523 234544 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918932.1 protein_id gnl|my_center|LOCUS_21480 237511 236606 gene locus_tag LOCUS_21490 gene thiL 237511 236606 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087788.1 protein_id gnl|my_center|LOCUS_21490 237977 237522 gene locus_tag LOCUS_21500 gene nusB 237977 237522 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919237.1 protein_id gnl|my_center|LOCUS_21500 238574 238158 gene locus_tag LOCUS_21510 238574 238158 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921390.1 protein_id gnl|my_center|LOCUS_21510 239866 238571 gene locus_tag LOCUS_21520 gene hisD 239866 238571 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390581.1 protein_id gnl|my_center|LOCUS_21520 240525 239863 gene locus_tag LOCUS_21530 gene hisG 240525 239863 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390582.1 protein_id gnl|my_center|LOCUS_21530 241428 240703 gene locus_tag LOCUS_21540 241428 240703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 241627 242232 gene locus_tag LOCUS_21550 241627 242232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 242969 242340 gene locus_tag LOCUS_21560 242969 242340 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_21560 243134 243009 gene locus_tag LOCUS_21570 gene ykgO 243134 243009 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709334.1 protein_id gnl|my_center|LOCUS_21570 243323 243940 gene locus_tag LOCUS_21580 243323 243940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 243942 245051 gene locus_tag LOCUS_21590 243942 245051 CDS product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481455.1 protein_id gnl|my_center|LOCUS_21590 246751 245378 gene locus_tag LOCUS_21600 246751 245378 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_21600 247013 246744 gene locus_tag LOCUS_21610 247013 246744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 247751 247026 gene locus_tag LOCUS_21620 247751 247026 CDS product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389967.1 protein_id gnl|my_center|LOCUS_21620 247938 248753 gene locus_tag LOCUS_21630 gene panC 247938 248753 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246105.1 protein_id gnl|my_center|LOCUS_21630 248831 249139 gene locus_tag LOCUS_21640 248831 249139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 251780 249183 gene locus_tag LOCUS_21650 gene topA 251780 249183 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920309.1 protein_id gnl|my_center|LOCUS_21650 252497 251991 gene locus_tag LOCUS_21660 252497 251991 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528088.1 protein_id gnl|my_center|LOCUS_21660 253573 252494 gene locus_tag LOCUS_21670 gene dprA 253573 252494 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_21670 254171 253566 gene locus_tag LOCUS_21680 gene plsY 254171 253566 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531796.1 protein_id gnl|my_center|LOCUS_21680 254276 255073 gene locus_tag LOCUS_21690 gene murI 254276 255073 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201819.1 protein_id gnl|my_center|LOCUS_21690 255325 256566 gene locus_tag LOCUS_21700 gene hemA 255325 256566 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084018.1 protein_id gnl|my_center|LOCUS_21700 257373 256825 gene locus_tag LOCUS_21710 257373 256825 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037712.1 protein_id gnl|my_center|LOCUS_21710 257894 257418 gene locus_tag LOCUS_21720 257894 257418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 257981 258424 gene locus_tag LOCUS_21730 gene rpiB 257981 258424 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389581.1 protein_id gnl|my_center|LOCUS_21730 258445 259740 gene locus_tag LOCUS_21740 258445 259740 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478453.1 protein_id gnl|my_center|LOCUS_21740 259752 259943 gene locus_tag LOCUS_21750 259752 259943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 259944 260411 gene locus_tag LOCUS_21760 gene nrdR 259944 260411 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919235.1 protein_id gnl|my_center|LOCUS_21760 260598 260921 gene locus_tag LOCUS_21770 260598 260921 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_21770 260969 261700 gene locus_tag LOCUS_21780 260969 261700 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384471.1 protein_id gnl|my_center|LOCUS_21780 262154 261846 gene locus_tag LOCUS_21790 262154 261846 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265672.1 protein_id gnl|my_center|LOCUS_21790 262259 262483 gene locus_tag LOCUS_21800 262259 262483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 262644 263258 gene locus_tag LOCUS_21810 gene rpsD 262644 263258 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533017.1 protein_id gnl|my_center|LOCUS_21810 263383 263754 gene locus_tag LOCUS_21820 263383 263754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 264155 263778 gene locus_tag LOCUS_21830 264155 263778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 264695 264237 gene locus_tag LOCUS_21840 264695 264237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 265290 264688 gene locus_tag LOCUS_21850 265290 264688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 265757 267400 gene locus_tag LOCUS_21860 265757 267400 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_21860 267397 268392 gene locus_tag LOCUS_21870 267397 268392 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639908.1 protein_id gnl|my_center|LOCUS_21870 268672 269106 gene locus_tag LOCUS_21880 268672 269106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 269140 269988 gene locus_tag LOCUS_21890 gene aguB 269140 269988 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141681.1 protein_id gnl|my_center|LOCUS_21890 270693 270022 gene locus_tag LOCUS_21900 270693 270022 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_21900 270716 271192 gene locus_tag LOCUS_21910 gene folK 270716 271192 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886816.1 protein_id gnl|my_center|LOCUS_21910 271213 271288 gene locus_tag LOCUS_t00370 271213 271288 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 271785 272483 gene locus_tag LOCUS_21920 271785 272483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 273302 272460 gene locus_tag LOCUS_21930 273302 272460 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_21930 274313 273306 gene locus_tag LOCUS_21940 gene galE 274313 273306 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533607.1 protein_id gnl|my_center|LOCUS_21940 274391 274930 gene locus_tag LOCUS_21950 gene msrA 274391 274930 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870242.1 protein_id gnl|my_center|LOCUS_21950 275982 275047 gene locus_tag LOCUS_21960 275982 275047 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383387.1 protein_id gnl|my_center|LOCUS_21960 276070 276888 gene locus_tag LOCUS_21970 276070 276888 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482900.1 protein_id gnl|my_center|LOCUS_21970 277357 277671 gene locus_tag LOCUS_21980 277357 277671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 277713 278036 gene locus_tag LOCUS_21990 277713 278036 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626162.1 protein_id gnl|my_center|LOCUS_21990 278033 279985 gene locus_tag LOCUS_22000 278033 279985 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170118044.1 protein_id gnl|my_center|LOCUS_22000 279972 280499 gene locus_tag LOCUS_22010 279972 280499 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389154.1 protein_id gnl|my_center|LOCUS_22010 280526 282325 gene locus_tag LOCUS_22020 280526 282325 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389158.1 protein_id gnl|my_center|LOCUS_22020 282564 284216 gene locus_tag LOCUS_22030 282564 284216 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389155.1 protein_id gnl|my_center|LOCUS_22030 284213 284710 gene locus_tag LOCUS_22040 284213 284710 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389156.1 protein_id gnl|my_center|LOCUS_22040 284787 285638 gene locus_tag LOCUS_22050 284787 285638 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389159.1 protein_id gnl|my_center|LOCUS_22050 285643 286716 gene locus_tag LOCUS_22060 285643 286716 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389160.1 protein_id gnl|my_center|LOCUS_22060 286736 288445 gene locus_tag LOCUS_22070 286736 288445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 288579 290303 gene locus_tag LOCUS_22080 gene poxB 288579 290303 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994147.1 protein_id gnl|my_center|LOCUS_22080 290300 290851 gene locus_tag LOCUS_22090 290300 290851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 293411 290829 gene locus_tag LOCUS_22100 293411 290829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 294823 293435 gene locus_tag LOCUS_22110 294823 293435 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204819.1 protein_id gnl|my_center|LOCUS_22110 296893 294842 gene locus_tag LOCUS_22120 296893 294842 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_22120 297017 298078 gene locus_tag LOCUS_22130 297017 298078 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975880.1 protein_id gnl|my_center|LOCUS_22130 298379 300232 gene locus_tag LOCUS_22140 298379 300232 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_22140 300743 300668 gene locus_tag LOCUS_t00380 300743 300668 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 301343 301642 gene locus_tag LOCUS_22150 301343 301642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 302194 301910 gene locus_tag LOCUS_22160 302194 301910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 302421 302194 gene locus_tag LOCUS_22170 302421 302194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 302598 303008 gene locus_tag LOCUS_22180 302598 303008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 304224 303187 gene locus_tag LOCUS_22190 304224 303187 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204766.1 protein_id gnl|my_center|LOCUS_22190 306029 304224 gene locus_tag LOCUS_22200 306029 304224 CDS product terminase ATPase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015602129.1 protein_id gnl|my_center|LOCUS_22200 306198 307019 gene locus_tag LOCUS_22210 306198 307019 CDS product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205526.1 protein_id gnl|my_center|LOCUS_22210 307066 308142 gene locus_tag LOCUS_22220 307066 308142 CDS product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098795.1 protein_id gnl|my_center|LOCUS_22220 308193 309017 gene locus_tag LOCUS_22230 308193 309017 CDS product terminase endonuclease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531049.1 protein_id gnl|my_center|LOCUS_22230 309260 309048 gene locus_tag LOCUS_22240 309260 309048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 309145 309390 gene locus_tag LOCUS_22250 309145 309390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 309387 309869 gene locus_tag LOCUS_22260 309387 309869 CDS product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816106.1 protein_id gnl|my_center|LOCUS_22260 309869 310081 gene locus_tag LOCUS_22270 309869 310081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 310081 310425 gene locus_tag LOCUS_22280 310081 310425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 310422 310940 gene locus_tag LOCUS_22290 310422 310940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 310937 311407 gene locus_tag LOCUS_22300 310937 311407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 311322 311645 gene locus_tag LOCUS_22310 311322 311645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 311648 311983 gene locus_tag LOCUS_22320 311648 311983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 311976 313370 gene locus_tag LOCUS_22330 311976 313370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 313367 313864 gene locus_tag LOCUS_22340 313367 313864 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816101.1 protein_id gnl|my_center|LOCUS_22340 313864 314340 gene locus_tag LOCUS_22350 313864 314340 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038100.1 protein_id gnl|my_center|LOCUS_22350 314399 315292 gene locus_tag LOCUS_22360 314399 315292 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038101.1 protein_id gnl|my_center|LOCUS_22360 315289 315933 gene locus_tag LOCUS_22370 315289 315933 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038102.1 protein_id gnl|my_center|LOCUS_22370 315930 316982 gene locus_tag LOCUS_22380 315930 316982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 316986 318971 gene locus_tag LOCUS_22390 316986 318971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 318971 319105 gene locus_tag LOCUS_22400 318971 319105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 319168 319731 gene locus_tag LOCUS_22410 319168 319731 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038105.1 protein_id gnl|my_center|LOCUS_22410 319728 320105 gene locus_tag LOCUS_22420 319728 320105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 320102 321277 gene locus_tag LOCUS_22430 320102 321277 CDS product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038107.1 protein_id gnl|my_center|LOCUS_22430 321310 321822 gene locus_tag LOCUS_22440 321310 321822 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038108.1 protein_id gnl|my_center|LOCUS_22440 321894 322238 gene locus_tag LOCUS_22450 321894 322238 CDS product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038109.1 protein_id gnl|my_center|LOCUS_22450 322247 322375 gene locus_tag LOCUS_22460 322247 322375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 322379 324838 gene locus_tag LOCUS_22470 322379 324838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 324838 325227 gene locus_tag LOCUS_22480 324838 325227 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038111.1 protein_id gnl|my_center|LOCUS_22480 325224 326261 gene locus_tag LOCUS_22490 325224 326261 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038112.1 protein_id gnl|my_center|LOCUS_22490 326647 326294 gene locus_tag LOCUS_22500 326647 326294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 328500 327844 gene locus_tag LOCUS_22510 328500 327844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 329629 328817 gene locus_tag LOCUS_22520 329629 328817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 329628 330020 gene locus_tag LOCUS_22530 329628 330020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 330017 330181 gene locus_tag LOCUS_22540 330017 330181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 330178 330435 gene locus_tag LOCUS_22550 330178 330435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 330432 330662 gene locus_tag LOCUS_22560 330432 330662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 330659 331261 gene locus_tag LOCUS_22570 330659 331261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 331258 331752 gene locus_tag LOCUS_22580 331258 331752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 331749 332066 gene locus_tag LOCUS_22590 331749 332066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 332173 334899 gene locus_tag LOCUS_22600 332173 334899 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074056806.1 protein_id gnl|my_center|LOCUS_22600 334913 335275 gene locus_tag LOCUS_22610 334913 335275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 335275 335760 gene locus_tag LOCUS_22620 335275 335760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 335757 335879 gene locus_tag LOCUS_22630 335757 335879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 335876 336562 gene locus_tag LOCUS_22640 335876 336562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976047.1 protein_id gnl|my_center|LOCUS_22640 336738 337823 gene locus_tag LOCUS_22650 336738 337823 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087764.1 protein_id gnl|my_center|LOCUS_22650 338277 337816 gene locus_tag LOCUS_22660 338277 337816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 338671 339144 gene locus_tag LOCUS_22670 338671 339144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 339144 340454 gene locus_tag LOCUS_22680 339144 340454 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235776816.1 protein_id gnl|my_center|LOCUS_22680 340612 341709 gene locus_tag LOCUS_22690 340612 341709 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971283.1 protein_id gnl|my_center|LOCUS_22690 341706 342026 gene locus_tag LOCUS_22700 341706 342026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 342023 342403 gene locus_tag LOCUS_22710 342023 342403 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383947.1 protein_id gnl|my_center|LOCUS_22710 342405 343403 gene locus_tag LOCUS_22720 342405 343403 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971286.1 protein_id gnl|my_center|LOCUS_22720 343599 344096 gene locus_tag LOCUS_22730 343599 344096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 344093 344482 gene locus_tag LOCUS_22740 344093 344482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 344495 344902 gene locus_tag LOCUS_22750 344495 344902 CDS product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920622.1 protein_id gnl|my_center|LOCUS_22750 344899 345207 gene locus_tag LOCUS_22760 344899 345207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 345204 345401 gene locus_tag LOCUS_22770 345204 345401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 345394 345933 gene locus_tag LOCUS_22780 345394 345933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920620.1 protein_id gnl|my_center|LOCUS_22780 346104 348377 gene locus_tag LOCUS_22790 346104 348377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 348374 349180 gene locus_tag LOCUS_22800 348374 349180 CDS product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383958.1 protein_id gnl|my_center|LOCUS_22800 349177 349545 gene locus_tag LOCUS_22810 349177 349545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 349545 351677 gene locus_tag LOCUS_22820 349545 351677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 351674 352177 gene locus_tag LOCUS_22830 351674 352177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 352291 353421 gene locus_tag LOCUS_22840 352291 353421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 353734 354312 gene locus_tag LOCUS_22850 353734 354312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 355135 354356 gene locus_tag LOCUS_22860 355135 354356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 355183 356502 gene locus_tag LOCUS_22870 355183 356502 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145923747.1 protein_id gnl|my_center|LOCUS_22870 356499 356900 gene locus_tag LOCUS_22880 356499 356900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 357782 357021 gene locus_tag LOCUS_22890 357782 357021 CDS product DUF1134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084979.1 protein_id gnl|my_center|LOCUS_22890 357948 358037 gene locus_tag LOCUS_t00390 357948 358037 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 358332 359270 gene locus_tag LOCUS_22900 358332 359270 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969472.1 protein_id gnl|my_center|LOCUS_22900 359617 366783 gene locus_tag LOCUS_22910 359617 366783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 366799 367248 gene locus_tag LOCUS_22920 366799 367248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 367751 367389 gene locus_tag LOCUS_22930 367751 367389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 367633 369039 gene locus_tag LOCUS_22940 367633 369039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 369036 370769 gene locus_tag LOCUS_22950 369036 370769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 370769 372085 gene locus_tag LOCUS_22960 370769 372085 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040402.1 protein_id gnl|my_center|LOCUS_22960 372447 372815 gene locus_tag LOCUS_22970 372447 372815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976140.1 protein_id gnl|my_center|LOCUS_22970 374186 372912 gene locus_tag LOCUS_22980 374186 372912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 375663 374254 gene locus_tag LOCUS_22990 375663 374254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 376016 376972 gene locus_tag LOCUS_23000 376016 376972 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107136145.1 protein_id gnl|my_center|LOCUS_23000 377005 378048 gene locus_tag LOCUS_23010 377005 378048 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224311.1 protein_id gnl|my_center|LOCUS_23010 378250 378035 gene locus_tag LOCUS_23020 378250 378035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 378286 378780 gene locus_tag LOCUS_23030 378286 378780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 378976 381483 gene locus_tag LOCUS_23040 378976 381483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 382769 381498 gene locus_tag LOCUS_23050 382769 381498 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920212.1 protein_id gnl|my_center|LOCUS_23050 382933 385431 gene locus_tag LOCUS_23060 382933 385431 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037568.1 protein_id gnl|my_center|LOCUS_23060 385455 385805 gene locus_tag LOCUS_23070 385455 385805 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086771.1 protein_id gnl|my_center|LOCUS_23070 386183 385968 gene locus_tag LOCUS_23080 386183 385968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 386304 388439 gene locus_tag LOCUS_23090 386304 388439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 388742 389932 gene locus_tag LOCUS_23100 388742 389932 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096774.1 protein_id gnl|my_center|LOCUS_23100 389929 391035 gene locus_tag LOCUS_23110 389929 391035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 391029 392282 gene locus_tag LOCUS_23120 391029 392282 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315676.1 protein_id gnl|my_center|LOCUS_23120 393666 392443 gene locus_tag LOCUS_23130 393666 392443 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967232.1 protein_id gnl|my_center|LOCUS_23130 394355 393726 gene locus_tag LOCUS_23140 394355 393726 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707003.1 protein_id gnl|my_center|LOCUS_23140 394455 395198 gene locus_tag LOCUS_23150 394455 395198 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922137.1 protein_id gnl|my_center|LOCUS_23150 395295 395876 gene locus_tag LOCUS_23160 395295 395876 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086719.1 protein_id gnl|my_center|LOCUS_23160 395876 396436 gene locus_tag LOCUS_23170 395876 396436 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533689.1 protein_id gnl|my_center|LOCUS_23170 396499 397758 gene locus_tag LOCUS_23180 396499 397758 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170976.1 protein_id gnl|my_center|LOCUS_23180 399568 397784 gene locus_tag LOCUS_23190 399568 397784 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388768.1 protein_id gnl|my_center|LOCUS_23190 399682 399999 gene locus_tag LOCUS_23200 399682 399999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 400046 400735 gene locus_tag LOCUS_23210 gene feuP 400046 400735 CDS product two-component system response regulator FeuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527364.1 protein_id gnl|my_center|LOCUS_23210 400749 402113 gene locus_tag LOCUS_23220 400749 402113 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_23220 403505 402504 gene locus_tag LOCUS_23230 403505 402504 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528459.1 protein_id gnl|my_center|LOCUS_23230 405801 403555 gene locus_tag LOCUS_23240 405801 403555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 405913 406578 gene locus_tag LOCUS_23250 405913 406578 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391090.1 protein_id gnl|my_center|LOCUS_23250 406581 407408 gene locus_tag LOCUS_23260 gene dapD 406581 407408 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639928.1 protein_id gnl|my_center|LOCUS_23260 409338 407797 gene locus_tag LOCUS_23270 409338 407797 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089230.1 protein_id gnl|my_center|LOCUS_23270 410078 409335 gene locus_tag LOCUS_23280 410078 409335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966485.1 protein_id gnl|my_center|LOCUS_23280 410230 411192 gene locus_tag LOCUS_23290 gene glpX 410230 411192 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919260.1 protein_id gnl|my_center|LOCUS_23290 411335 412060 gene locus_tag LOCUS_23300 411335 412060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 412946 412185 gene locus_tag LOCUS_23310 412946 412185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528680.1 protein_id gnl|my_center|LOCUS_23310 413875 412943 gene locus_tag LOCUS_23320 413875 412943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 protein_id gnl|my_center|LOCUS_23320 414616 413909 gene locus_tag LOCUS_23330 414616 413909 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390181.1 protein_id gnl|my_center|LOCUS_23330 415962 414613 gene locus_tag LOCUS_23340 415962 414613 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087068.1 protein_id gnl|my_center|LOCUS_23340 416078 416467 gene locus_tag LOCUS_23350 416078 416467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 419544 416869 gene locus_tag LOCUS_23360 419544 416869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 420037 421284 gene locus_tag LOCUS_23370 420037 421284 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 protein_id gnl|my_center|LOCUS_23370 421577 421365 gene locus_tag LOCUS_23380 421577 421365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 421814 422767 gene locus_tag LOCUS_23390 421814 422767 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918944.1 protein_id gnl|my_center|LOCUS_23390 422834 425332 gene locus_tag LOCUS_23400 422834 425332 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531366.1 protein_id gnl|my_center|LOCUS_23400 425397 426524 gene locus_tag LOCUS_23410 gene prfB 425397 426524 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100209475.1 protein_id gnl|my_center|LOCUS_23410 426526 427278 gene locus_tag LOCUS_23420 426526 427278 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494111.1 protein_id gnl|my_center|LOCUS_23420 427405 427851 gene locus_tag LOCUS_23430 427405 427851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 427860 428603 gene locus_tag LOCUS_23440 427860 428603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 429211 428819 gene locus_tag LOCUS_23450 429211 428819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 429297 430091 gene locus_tag LOCUS_23460 gene thyA 429297 430091 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948554.1 protein_id gnl|my_center|LOCUS_23460 430088 430558 gene locus_tag LOCUS_23470 gene folA 430088 430558 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_23470 430684 431709 gene locus_tag LOCUS_23480 430684 431709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 431743 432693 gene locus_tag LOCUS_23490 431743 432693 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_23490 432729 435560 gene locus_tag LOCUS_23500 gene ileS 432729 435560 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918587.1 protein_id gnl|my_center|LOCUS_23500 435553 436059 gene locus_tag LOCUS_23510 gene lspA 435553 436059 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_23510 436052 436471 gene locus_tag LOCUS_23520 436052 436471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 437836 436667 gene locus_tag LOCUS_23530 437836 436667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 438833 437997 gene locus_tag LOCUS_23540 438833 437997 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036158.1 protein_id gnl|my_center|LOCUS_23540 440334 439024 gene locus_tag LOCUS_23550 440334 439024 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_23550 441527 440331 gene locus_tag LOCUS_23560 441527 440331 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072223.1 protein_id gnl|my_center|LOCUS_23560 442378 441533 gene locus_tag LOCUS_23570 gene sseA 442378 441533 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389305.1 protein_id gnl|my_center|LOCUS_23570 444275 442728 gene locus_tag LOCUS_23580 444275 442728 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974139.1 protein_id gnl|my_center|LOCUS_23580 444297 444737 gene locus_tag LOCUS_23590 gene queF 444297 444737 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122403094.1 protein_id gnl|my_center|LOCUS_23590 445376 444813 gene locus_tag LOCUS_23600 445376 444813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 445715 447985 gene locus_tag LOCUS_23610 445715 447985 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388680.1 protein_id gnl|my_center|LOCUS_23610 448051 449334 gene locus_tag LOCUS_23620 448051 449334 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087901.1 protein_id gnl|my_center|LOCUS_23620 451580 449607 gene locus_tag LOCUS_23630 451580 449607 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727591.1 protein_id gnl|my_center|LOCUS_23630 453515 451905 gene locus_tag LOCUS_23640 453515 451905 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537591.1 protein_id gnl|my_center|LOCUS_23640 455192 453663 gene locus_tag LOCUS_23650 455192 453663 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528279.1 protein_id gnl|my_center|LOCUS_23650 456165 455299 gene locus_tag LOCUS_23660 456165 455299 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089248.1 protein_id gnl|my_center|LOCUS_23660 457181 456162 gene locus_tag LOCUS_23670 gene hflK 457181 456162 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338174.1 protein_id gnl|my_center|LOCUS_23670 457371 458333 gene locus_tag LOCUS_23680 457371 458333 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383214.1 protein_id gnl|my_center|LOCUS_23680 458424 458858 gene locus_tag LOCUS_23690 458424 458858 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097249.1 protein_id gnl|my_center|LOCUS_23690 458889 459155 gene locus_tag LOCUS_23700 458889 459155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 459236 459616 gene locus_tag LOCUS_23710 459236 459616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 459633 460061 gene locus_tag LOCUS_23720 459633 460061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 460768 460193 gene locus_tag LOCUS_23730 460768 460193 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384535.1 protein_id gnl|my_center|LOCUS_23730 460893 462182 gene locus_tag LOCUS_23740 460893 462182 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390163.1 protein_id gnl|my_center|LOCUS_23740 463314 462358 gene locus_tag LOCUS_23750 463314 462358 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918089.1 protein_id gnl|my_center|LOCUS_23750 463880 463383 gene locus_tag LOCUS_23760 463880 463383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 464091 464624 gene locus_tag LOCUS_23770 464091 464624 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091907.1 protein_id gnl|my_center|LOCUS_23770 464648 465976 gene locus_tag LOCUS_23780 464648 465976 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971915.1 protein_id gnl|my_center|LOCUS_23780 466048 466389 gene locus_tag LOCUS_23790 466048 466389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 466386 466706 gene locus_tag LOCUS_23800 466386 466706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 466939 467571 gene locus_tag LOCUS_23810 466939 467571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 467666 467998 gene locus_tag LOCUS_23820 467666 467998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 469764 468709 gene locus_tag LOCUS_23830 469764 468709 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918149.1 protein_id gnl|my_center|LOCUS_23830 470069 469770 gene locus_tag LOCUS_23840 470069 469770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 470263 470066 gene locus_tag LOCUS_23850 470263 470066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 470320 470571 gene locus_tag LOCUS_23860 470320 470571 CDS product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532118.1 protein_id gnl|my_center|LOCUS_23860 471074 470646 gene locus_tag LOCUS_23870 471074 470646 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_23870 473145 471229 gene locus_tag LOCUS_23880 473145 471229 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923295.1 protein_id gnl|my_center|LOCUS_23880 473984 473514 gene locus_tag LOCUS_23890 473984 473514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 476942 474288 gene locus_tag LOCUS_23900 476942 474288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 477089 478612 gene locus_tag LOCUS_23910 477089 478612 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185225179.1 protein_id gnl|my_center|LOCUS_23910 480647 478860 gene locus_tag LOCUS_23920 480647 478860 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 protein_id gnl|my_center|LOCUS_23920 482469 480712 gene locus_tag LOCUS_23930 gene ggt 482469 480712 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065022.1 protein_id gnl|my_center|LOCUS_23930 483544 482516 gene locus_tag LOCUS_23940 483544 482516 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388272.1 protein_id gnl|my_center|LOCUS_23940 483739 484827 gene locus_tag LOCUS_23950 483739 484827 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338580.1 protein_id gnl|my_center|LOCUS_23950 484856 485629 gene locus_tag LOCUS_23960 484856 485629 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921385.1 protein_id gnl|my_center|LOCUS_23960 486131 485634 gene locus_tag LOCUS_23970 486131 485634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 487033 486146 gene locus_tag LOCUS_23980 487033 486146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 488451 487207 gene locus_tag LOCUS_23990 488451 487207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 488806 492984 gene locus_tag LOCUS_24000 gene rpoB 488806 492984 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088159.1 protein_id gnl|my_center|LOCUS_24000 493071 497357 gene locus_tag LOCUS_24010 gene rpoC 493071 497357 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385330.1 protein_id gnl|my_center|LOCUS_24010 497627 497806 gene locus_tag LOCUS_24020 497627 497806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 499446 499012 gene locus_tag LOCUS_24030 499446 499012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 500013 499639 gene locus_tag LOCUS_24040 gene rplL 500013 499639 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390506.1 protein_id gnl|my_center|LOCUS_24040 500604 500083 gene locus_tag LOCUS_24050 gene rplJ 500604 500083 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_249163115.1 protein_id gnl|my_center|LOCUS_24050 501045 503525 gene locus_tag LOCUS_24060 501045 503525 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208315.1 protein_id gnl|my_center|LOCUS_24060 503618 504709 gene locus_tag LOCUS_24070 503618 504709 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668699.1 protein_id gnl|my_center|LOCUS_24070 504897 505601 gene locus_tag LOCUS_24080 504897 505601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 508405 506081 gene locus_tag LOCUS_24090 508405 506081 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036376.1 protein_id gnl|my_center|LOCUS_24090 508639 510087 gene locus_tag LOCUS_24100 508639 510087 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407630.1 protein_id gnl|my_center|LOCUS_24100 510266 510910 gene locus_tag LOCUS_24110 510266 510910 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528009.1 protein_id gnl|my_center|LOCUS_24110 510921 511934 gene locus_tag LOCUS_24120 510921 511934 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528008.1 protein_id gnl|my_center|LOCUS_24120 513637 512216 gene locus_tag LOCUS_24130 513637 512216 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_24130 516813 513634 gene locus_tag LOCUS_24140 516813 513634 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085816.1 protein_id gnl|my_center|LOCUS_24140 518075 516813 gene locus_tag LOCUS_24150 518075 516813 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085815.1 protein_id gnl|my_center|LOCUS_24150 518316 518471 gene locus_tag LOCUS_24160 518316 518471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 518836 519468 gene locus_tag LOCUS_24170 518836 519468 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081233.1 protein_id gnl|my_center|LOCUS_24170 519582 521099 gene locus_tag LOCUS_24180 519582 521099 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640198.1 protein_id gnl|my_center|LOCUS_24180 521229 522371 gene locus_tag LOCUS_24190 521229 522371 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389588.1 protein_id gnl|my_center|LOCUS_24190 522486 523535 gene locus_tag LOCUS_24200 522486 523535 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919229.1 protein_id gnl|my_center|LOCUS_24200 523562 524338 gene locus_tag LOCUS_24210 523562 524338 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 protein_id gnl|my_center|LOCUS_24210 524487 525362 gene locus_tag LOCUS_24220 gene mmsB 524487 525362 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919231.1 protein_id gnl|my_center|LOCUS_24220 525552 526583 gene locus_tag LOCUS_24230 gene alr 525552 526583 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972917.1 protein_id gnl|my_center|LOCUS_24230 527349 526594 gene locus_tag LOCUS_24240 527349 526594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 530744 527655 gene locus_tag LOCUS_24250 530744 527655 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 protein_id gnl|my_center|LOCUS_24250 532156 530984 gene locus_tag LOCUS_24260 532156 530984 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175239.1 protein_id gnl|my_center|LOCUS_24260 533231 532179 gene locus_tag LOCUS_24270 533231 532179 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388028.1 protein_id gnl|my_center|LOCUS_24270 533271 533834 gene locus_tag LOCUS_24280 gene phaR 533271 533834 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_24280 534284 534745 gene locus_tag LOCUS_24290 gene hslV 534284 534745 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083476.1 protein_id gnl|my_center|LOCUS_24290 534759 536057 gene locus_tag LOCUS_24300 gene hslU 534759 536057 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528355.1 protein_id gnl|my_center|LOCUS_24300 536626 536279 gene locus_tag LOCUS_24310 536626 536279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 537072 536644 gene locus_tag LOCUS_24320 537072 536644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918737.1 protein_id gnl|my_center|LOCUS_24320 537829 537113 gene locus_tag LOCUS_24330 gene gloB 537829 537113 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337385.1 protein_id gnl|my_center|LOCUS_24330 538255 537839 gene locus_tag LOCUS_24340 538255 537839 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265697.1 protein_id gnl|my_center|LOCUS_24340 539111 538332 gene locus_tag LOCUS_24350 539111 538332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 539896 539108 gene locus_tag LOCUS_24360 539896 539108 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_24360 540554 540300 gene locus_tag LOCUS_24370 540554 540300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 542020 540626 gene locus_tag LOCUS_24380 gene murC 542020 540626 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030625.1 protein_id gnl|my_center|LOCUS_24380 542095 542910 gene locus_tag LOCUS_24390 542095 542910 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_24390 542934 543686 gene locus_tag LOCUS_24400 542934 543686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 543863 545866 gene locus_tag LOCUS_24410 gene thrS 543863 545866 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391234.1 protein_id gnl|my_center|LOCUS_24410 545996 546514 gene locus_tag LOCUS_24420 gene infC 545996 546514 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_24420 550011 547237 gene locus_tag LOCUS_24430 550011 547237 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391286.1 protein_id gnl|my_center|LOCUS_24430 550245 551507 gene locus_tag LOCUS_24440 550245 551507 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258038.1 protein_id gnl|my_center|LOCUS_24440 551504 552103 gene locus_tag LOCUS_24450 551504 552103 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965055.1 protein_id gnl|my_center|LOCUS_24450 552116 552520 gene locus_tag LOCUS_24460 gene rsfS 552116 552520 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365321.1 protein_id gnl|my_center|LOCUS_24460 552538 552960 gene locus_tag LOCUS_24470 gene rlmH 552538 552960 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083264.1 protein_id gnl|my_center|LOCUS_24470 552965 554122 gene locus_tag LOCUS_24480 552965 554122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 554276 554776 gene locus_tag LOCUS_24490 554276 554776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 554773 555621 gene locus_tag LOCUS_24500 554773 555621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 555651 556043 gene locus_tag LOCUS_24510 555651 556043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 556198 557547 gene locus_tag LOCUS_24520 556198 557547 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531244.1 protein_id gnl|my_center|LOCUS_24520 557550 558044 gene locus_tag LOCUS_24530 557550 558044 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337855.1 protein_id gnl|my_center|LOCUS_24530 558041 558583 gene locus_tag LOCUS_24540 558041 558583 CDS product demethoxyubiquinone hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391245.1 protein_id gnl|my_center|LOCUS_24540 558607 559071 gene locus_tag LOCUS_24550 558607 559071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 560458 559394 gene locus_tag LOCUS_24560 560458 559394 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388795.1 protein_id gnl|my_center|LOCUS_24560 560585 561055 gene locus_tag LOCUS_24570 560585 561055 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103096.1 protein_id gnl|my_center|LOCUS_24570 561252 562667 gene locus_tag LOCUS_24580 561252 562667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259614.1 protein_id gnl|my_center|LOCUS_24580 563257 562622 gene locus_tag LOCUS_24590 563257 562622 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812028.1 protein_id gnl|my_center|LOCUS_24590 563333 564136 gene locus_tag LOCUS_24600 563333 564136 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930068.1 protein_id gnl|my_center|LOCUS_24600 565242 564154 gene locus_tag LOCUS_24610 565242 564154 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061853.1 protein_id gnl|my_center|LOCUS_24610 566896 565490 gene locus_tag LOCUS_24620 566896 565490 CDS product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528231.1 protein_id gnl|my_center|LOCUS_24620 567545 567060 gene locus_tag LOCUS_24630 567545 567060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 568870 567626 gene locus_tag LOCUS_24640 568870 567626 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972122.1 protein_id gnl|my_center|LOCUS_24640 568974 570743 gene locus_tag LOCUS_24650 568974 570743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 571054 570782 gene locus_tag LOCUS_24660 571054 570782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 572188 571070 gene locus_tag LOCUS_24670 gene mnmA 572188 571070 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337613.1 protein_id gnl|my_center|LOCUS_24670 572344 572574 gene locus_tag LOCUS_24680 572344 572574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 572667 572969 gene locus_tag LOCUS_24690 gene sciP 572667 572969 CDS product CtrA inhibitor SciP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918787.1 protein_id gnl|my_center|LOCUS_24690 573074 573331 gene locus_tag LOCUS_24700 573074 573331 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039113.1 protein_id gnl|my_center|LOCUS_24700 574252 573512 gene locus_tag LOCUS_24710 574252 573512 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037741.1 protein_id gnl|my_center|LOCUS_24710 574448 575638 gene locus_tag LOCUS_24720 574448 575638 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921032.1 protein_id gnl|my_center|LOCUS_24720 575640 578843 gene locus_tag LOCUS_24730 575640 578843 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083188.1 protein_id gnl|my_center|LOCUS_24730 578827 579048 gene locus_tag LOCUS_24740 578827 579048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 579064 580314 gene locus_tag LOCUS_24750 579064 580314 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855471.1 protein_id gnl|my_center|LOCUS_24750 580412 581518 gene locus_tag LOCUS_24760 580412 581518 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921501.1 protein_id gnl|my_center|LOCUS_24760 581518 582432 gene locus_tag LOCUS_24770 581518 582432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_24770 582432 583394 gene locus_tag LOCUS_24780 582432 583394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 583415 583999 gene locus_tag LOCUS_24790 583415 583999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 585466 584624 gene locus_tag LOCUS_24800 585466 584624 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921486.1 protein_id gnl|my_center|LOCUS_24800 585586 586011 gene locus_tag LOCUS_24810 585586 586011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 586152 586949 gene locus_tag LOCUS_24820 gene cyoA 586152 586949 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525255.1 protein_id gnl|my_center|LOCUS_24820 586946 588958 gene locus_tag LOCUS_24830 gene cyoB 586946 588958 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085500.1 protein_id gnl|my_center|LOCUS_24830 588955 589590 gene locus_tag LOCUS_24840 588955 589590 CDS product cytochrome (ubi)quinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525253.1 protein_id gnl|my_center|LOCUS_24840 589587 589970 gene locus_tag LOCUS_24850 gene cyoD 589587 589970 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525252.1 protein_id gnl|my_center|LOCUS_24850 591855 590092 gene locus_tag LOCUS_24860 gene glgX 591855 590092 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394194.1 protein_id gnl|my_center|LOCUS_24860 593681 592056 gene locus_tag LOCUS_24870 593681 592056 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970236.1 protein_id gnl|my_center|LOCUS_24870 595132 593678 gene locus_tag LOCUS_24880 gene glgA 595132 593678 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973546.1 protein_id gnl|my_center|LOCUS_24880 596403 595141 gene locus_tag LOCUS_24890 gene glgC 596403 595141 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532699.1 protein_id gnl|my_center|LOCUS_24890 598635 596482 gene locus_tag LOCUS_24900 gene glgB 598635 596482 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532700.1 protein_id gnl|my_center|LOCUS_24900 601064 598632 gene locus_tag LOCUS_24910 601064 598632 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973547.1 protein_id gnl|my_center|LOCUS_24910 602467 601157 gene locus_tag LOCUS_24920 602467 601157 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037317.1 protein_id gnl|my_center|LOCUS_24920 603576 602668 gene locus_tag LOCUS_24930 gene ubiA 603576 602668 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923273.1 protein_id gnl|my_center|LOCUS_24930 603746 604798 gene locus_tag LOCUS_24940 603746 604798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 604866 605012 gene locus_tag LOCUS_24950 604866 605012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 606016 605009 gene locus_tag LOCUS_24960 606016 605009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 607128 606118 gene locus_tag LOCUS_24970 607128 606118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 607964 607209 gene locus_tag LOCUS_24980 gene ppk2 607964 607209 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921245.1 protein_id gnl|my_center|LOCUS_24980 608042 608785 gene locus_tag LOCUS_24990 608042 608785 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383391.1 protein_id gnl|my_center|LOCUS_24990 608831 610204 gene locus_tag LOCUS_25000 608831 610204 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_25000 611566 610298 gene locus_tag LOCUS_25010 611566 610298 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137931707.1 protein_id gnl|my_center|LOCUS_25010 612689 612381 gene locus_tag LOCUS_25020 612689 612381 CDS product polyhydroxyalkanoic acid system family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640665.1 protein_id gnl|my_center|LOCUS_25020 612886 612813 gene locus_tag LOCUS_t00400 612886 612813 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 613014 612929 gene locus_tag LOCUS_t00410 613014 612929 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 613182 614792 gene locus_tag LOCUS_25030 613182 614792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 614861 615535 gene locus_tag LOCUS_25040 614861 615535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25040 616314 615997 gene locus_tag LOCUS_25050 616314 615997 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456649.1 protein_id gnl|my_center|LOCUS_25050 616372 617001 gene locus_tag LOCUS_25060 616372 617001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 617202 617005 gene locus_tag LOCUS_25070 617202 617005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 618378 617242 gene locus_tag LOCUS_25080 618378 617242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 618498 619844 gene locus_tag LOCUS_25090 618498 619844 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_25090 619837 620640 gene locus_tag LOCUS_25100 619837 620640 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174622.1 protein_id gnl|my_center|LOCUS_25100 621334 620630 gene locus_tag LOCUS_25110 gene cobB 621334 620630 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391392.1 protein_id gnl|my_center|LOCUS_25110 621719 621546 gene locus_tag LOCUS_25120 621719 621546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 622010 622738 gene locus_tag LOCUS_25130 gene dapB 622010 622738 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921379.1 protein_id gnl|my_center|LOCUS_25130 622744 623406 gene locus_tag LOCUS_25140 gene nth 622744 623406 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625878.1 protein_id gnl|my_center|LOCUS_25140 623462 623538 gene locus_tag LOCUS_t00420 623462 623538 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 623743 624873 gene locus_tag LOCUS_25150 623743 624873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 625113 624952 gene locus_tag LOCUS_25160 625113 624952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 625647 625132 gene locus_tag LOCUS_25170 625647 625132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 625834 628107 gene locus_tag LOCUS_25180 gene ptsP 625834 628107 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083049.1 protein_id gnl|my_center|LOCUS_25180 628199 629125 gene locus_tag LOCUS_25190 628199 629125 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812890.1 protein_id gnl|my_center|LOCUS_25190 629213 630151 gene locus_tag LOCUS_25200 629213 630151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 630300 631292 gene locus_tag LOCUS_25210 gene tilS 630300 631292 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089882.1 protein_id gnl|my_center|LOCUS_25210 631405 633372 gene locus_tag LOCUS_25220 gene ftsH 631405 633372 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388853.1 protein_id gnl|my_center|LOCUS_25220 634443 633580 gene locus_tag LOCUS_25230 634443 633580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 634564 635472 gene locus_tag LOCUS_25240 634564 635472 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971021.1 protein_id gnl|my_center|LOCUS_25240 635481 636140 gene locus_tag LOCUS_25250 635481 636140 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003717.1 protein_id gnl|my_center|LOCUS_25250 636344 636177 gene locus_tag LOCUS_25260 636344 636177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 637861 636512 gene locus_tag LOCUS_25270 gene gorA 637861 636512 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268131.1 protein_id gnl|my_center|LOCUS_25270 639595 638102 gene locus_tag LOCUS_25280 gene pgi 639595 638102 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527211.1 protein_id gnl|my_center|LOCUS_25280 640513 639749 gene locus_tag LOCUS_25290 640513 639749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 641243 640653 gene locus_tag LOCUS_25300 641243 640653 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 protein_id gnl|my_center|LOCUS_25300 643397 641433 gene locus_tag LOCUS_25310 gene sppA 643397 641433 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259810.1 protein_id gnl|my_center|LOCUS_25310 643623 643910 gene locus_tag LOCUS_25320 gene groES 643623 643910 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706990.1 protein_id gnl|my_center|LOCUS_25320 643965 645608 gene locus_tag LOCUS_25330 gene groL 643965 645608 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388345.1 protein_id gnl|my_center|LOCUS_25330 646976 647064 gene locus_tag LOCUS_t00430 646976 647064 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 647907 647209 gene locus_tag LOCUS_25340 647907 647209 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385520.1 protein_id gnl|my_center|LOCUS_25340 648470 647907 gene locus_tag LOCUS_25350 648470 647907 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085285.1 protein_id gnl|my_center|LOCUS_25350 648482 649510 gene locus_tag LOCUS_25360 gene mutY 648482 649510 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336762.1 protein_id gnl|my_center|LOCUS_25360 649514 650839 gene locus_tag LOCUS_25370 649514 650839 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_25370 650836 651690 gene locus_tag LOCUS_25380 gene nudC 650836 651690 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338430.1 protein_id gnl|my_center|LOCUS_25380 652718 651828 gene locus_tag LOCUS_25390 652718 651828 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_25390 652825 653556 gene locus_tag LOCUS_25400 652825 653556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 653724 654782 gene locus_tag LOCUS_25410 653724 654782 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064355.1 protein_id gnl|my_center|LOCUS_25410 655841 654954 gene locus_tag LOCUS_25420 655841 654954 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378215.1 protein_id gnl|my_center|LOCUS_25420 656537 655875 gene locus_tag LOCUS_25430 656537 655875 CDS product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765937.1 protein_id gnl|my_center|LOCUS_25430 656801 656580 gene locus_tag LOCUS_25440 656801 656580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 657307 656801 gene locus_tag LOCUS_25450 657307 656801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 658079 657408 gene locus_tag LOCUS_25460 658079 657408 CDS product DUF4328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066963.1 protein_id gnl|my_center|LOCUS_25460 658225 659382 gene locus_tag LOCUS_25470 658225 659382 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382854.1 protein_id gnl|my_center|LOCUS_25470 659464 661041 gene locus_tag LOCUS_25480 gene serA 659464 661041 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921048.1 protein_id gnl|my_center|LOCUS_25480 661483 661094 gene locus_tag LOCUS_25490 661483 661094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 662154 661558 gene locus_tag LOCUS_25500 662154 661558 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061814.1 protein_id gnl|my_center|LOCUS_25500 662295 663401 gene locus_tag LOCUS_25510 662295 663401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 663514 664803 gene locus_tag LOCUS_25520 663514 664803 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537502.1 protein_id gnl|my_center|LOCUS_25520 665049 665291 gene locus_tag LOCUS_25530 665049 665291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 665295 665465 gene locus_tag LOCUS_25540 665295 665465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 666600 665533 gene locus_tag LOCUS_25550 gene aroC 666600 665533 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920990.1 protein_id gnl|my_center|LOCUS_25550 667124 666597 gene locus_tag LOCUS_25560 667124 666597 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528472.1 protein_id gnl|my_center|LOCUS_25560 667372 667121 gene locus_tag LOCUS_25570 667372 667121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 668168 667365 gene locus_tag LOCUS_25580 gene fabI 668168 667365 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719509.1 protein_id gnl|my_center|LOCUS_25580 669136 668165 gene locus_tag LOCUS_25590 669136 668165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 670085 669144 gene locus_tag LOCUS_25600 670085 669144 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920613.1 protein_id gnl|my_center|LOCUS_25600 670187 670417 gene locus_tag LOCUS_25610 670187 670417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 671430 670537 gene locus_tag LOCUS_25620 671430 670537 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085763.1 protein_id gnl|my_center|LOCUS_25620 673880 671427 gene locus_tag LOCUS_25630 673880 671427 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085762.1 protein_id gnl|my_center|LOCUS_25630 674111 674692 gene locus_tag LOCUS_25640 gene pdxH 674111 674692 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918802.1 protein_id gnl|my_center|LOCUS_25640 674689 675639 gene locus_tag LOCUS_25650 gene fieF 674689 675639 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093118.1 protein_id gnl|my_center|LOCUS_25650 675639 676442 gene locus_tag LOCUS_25660 675639 676442 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388858.1 protein_id gnl|my_center|LOCUS_25660 679966 676580 gene locus_tag LOCUS_25670 gene smc 679966 676580 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918261.1 protein_id gnl|my_center|LOCUS_25670 680481 680074 gene locus_tag LOCUS_25680 680481 680074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 680575 680913 gene locus_tag LOCUS_25690 680575 680913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 682369 681134 gene locus_tag LOCUS_25700 682369 681134 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480719.1 protein_id gnl|my_center|LOCUS_25700 682445 683458 gene locus_tag LOCUS_25710 682445 683458 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389818.1 protein_id gnl|my_center|LOCUS_25710 684747 683545 gene locus_tag LOCUS_25720 684747 683545 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037551.1 protein_id gnl|my_center|LOCUS_25720 688143 684799 gene locus_tag LOCUS_25730 688143 684799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 689886 688381 gene locus_tag LOCUS_25740 689886 688381 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921247.1 protein_id gnl|my_center|LOCUS_25740 690036 692936 gene locus_tag LOCUS_25750 gene uvrA 690036 692936 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389505.1 protein_id gnl|my_center|LOCUS_25750 693316 693723 gene locus_tag LOCUS_25760 693316 693723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 694019 694333 gene locus_tag LOCUS_25770 694019 694333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 695333 694338 gene locus_tag LOCUS_25780 695333 694338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 698336 695493 gene locus_tag LOCUS_25790 698336 695493 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921413.1 protein_id gnl|my_center|LOCUS_25790 698574 698362 gene locus_tag LOCUS_25800 698574 698362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 699728 698598 gene locus_tag LOCUS_25810 gene tgt 699728 698598 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337793.1 protein_id gnl|my_center|LOCUS_25810 700180 699725 gene locus_tag LOCUS_25820 700180 699725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 701268 700231 gene locus_tag LOCUS_25830 gene queA 701268 700231 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971794.1 protein_id gnl|my_center|LOCUS_25830 702017 701265 gene locus_tag LOCUS_25840 702017 701265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 702747 702244 gene locus_tag LOCUS_25850 gene coaD 702747 702244 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919455.1 protein_id gnl|my_center|LOCUS_25850 703646 702744 gene locus_tag LOCUS_25860 703646 702744 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_25860 703888 703649 gene locus_tag LOCUS_25870 703888 703649 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532792.1 protein_id gnl|my_center|LOCUS_25870 704156 703959 gene locus_tag LOCUS_25880 704156 703959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 705914 704181 gene locus_tag LOCUS_25890 705914 704181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 708462 706147 gene locus_tag LOCUS_25900 gene clpA 708462 706147 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531774.1 protein_id gnl|my_center|LOCUS_25900 708860 708666 gene locus_tag LOCUS_25910 708860 708666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 708960 709979 gene locus_tag LOCUS_25920 708960 709979 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_25920 710086 710790 gene locus_tag LOCUS_25930 710086 710790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 710959 711636 gene locus_tag LOCUS_25940 710959 711636 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388810.1 protein_id gnl|my_center|LOCUS_25940 711761 712081 gene locus_tag LOCUS_25950 711761 712081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 712345 712270 gene locus_tag LOCUS_t00440 712345 712270 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 712651 713022 gene locus_tag LOCUS_25960 gene rpsL 712651 713022 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603006.1 protein_id gnl|my_center|LOCUS_25960 713089 713559 gene locus_tag LOCUS_25970 gene rpsG 713089 713559 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707751.1 protein_id gnl|my_center|LOCUS_25970 713707 715782 gene locus_tag LOCUS_25980 gene fusA 713707 715782 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390501.1 protein_id gnl|my_center|LOCUS_25980 715918 717111 gene locus_tag LOCUS_25990 gene tuf 715918 717111 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390500.1 protein_id gnl|my_center|LOCUS_25990 717629 717372 gene locus_tag LOCUS_26000 717629 717372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 717725 718033 gene locus_tag LOCUS_26010 gene rpsJ 717725 718033 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_26010 718318 719052 gene locus_tag LOCUS_26020 gene rplC 718318 719052 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563652.1 protein_id gnl|my_center|LOCUS_26020 719056 719682 gene locus_tag LOCUS_26030 gene rplD 719056 719682 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531423.1 protein_id gnl|my_center|LOCUS_26030 719675 719986 gene locus_tag LOCUS_26040 719675 719986 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536621.1 protein_id gnl|my_center|LOCUS_26040 719991 720842 gene locus_tag LOCUS_26050 gene rplB 719991 720842 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536619.1 protein_id gnl|my_center|LOCUS_26050 720849 721127 gene locus_tag LOCUS_26060 gene rpsS 720849 721127 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919131.1 protein_id gnl|my_center|LOCUS_26060 721127 721504 gene locus_tag LOCUS_26070 gene rplV 721127 721504 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205462.1 protein_id gnl|my_center|LOCUS_26070 721504 722214 gene locus_tag LOCUS_26080 gene rpsC 721504 722214 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495188.1 protein_id gnl|my_center|LOCUS_26080 722227 722661 gene locus_tag LOCUS_26090 gene rplP 722227 722661 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390431.1 protein_id gnl|my_center|LOCUS_26090 722661 722861 gene locus_tag LOCUS_26100 gene rpmC 722661 722861 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495193.1 protein_id gnl|my_center|LOCUS_26100 722874 723146 gene locus_tag LOCUS_26110 gene rpsQ 722874 723146 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919136.1 protein_id gnl|my_center|LOCUS_26110 723379 723747 gene locus_tag LOCUS_26120 gene rplN 723379 723747 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495199.1 protein_id gnl|my_center|LOCUS_26120 723747 724064 gene locus_tag LOCUS_26130 gene rplX 723747 724064 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919138.1 protein_id gnl|my_center|LOCUS_26130 724057 724638 gene locus_tag LOCUS_26140 gene rplE 724057 724638 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531429.1 protein_id gnl|my_center|LOCUS_26140 724696 725001 gene locus_tag LOCUS_26150 gene rpsN 724696 725001 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536519.1 protein_id gnl|my_center|LOCUS_26150 725014 725409 gene locus_tag LOCUS_26160 gene rpsH 725014 725409 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975181.1 protein_id gnl|my_center|LOCUS_26160 725409 725942 gene locus_tag LOCUS_26170 gene rplF 725409 725942 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538008.1 protein_id gnl|my_center|LOCUS_26170 725942 726298 gene locus_tag LOCUS_26180 725942 726298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 726300 727016 gene locus_tag LOCUS_26190 726300 727016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 727023 727199 gene locus_tag LOCUS_26200 gene rpmD 727023 727199 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205449.1 protein_id gnl|my_center|LOCUS_26200 727355 727969 gene locus_tag LOCUS_26210 gene rplO 727355 727969 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390419.1 protein_id gnl|my_center|LOCUS_26210 728127 729491 gene locus_tag LOCUS_26220 gene secY 728127 729491 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390418.1 protein_id gnl|my_center|LOCUS_26220 729529 730182 gene locus_tag LOCUS_26230 729529 730182 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336954.1 protein_id gnl|my_center|LOCUS_26230 730426 731304 gene locus_tag LOCUS_26240 730426 731304 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338319.1 protein_id gnl|my_center|LOCUS_26240 731916 731311 gene locus_tag LOCUS_26250 731916 731311 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_26250 732028 732825 gene locus_tag LOCUS_26260 gene lepB 732028 732825 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087823.1 protein_id gnl|my_center|LOCUS_26260 732822 733487 gene locus_tag LOCUS_26270 gene rnc 732822 733487 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532584.1 protein_id gnl|my_center|LOCUS_26270 733836 733615 gene locus_tag LOCUS_26280 733836 733615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 733975 734871 gene locus_tag LOCUS_26290 gene era 733975 734871 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087821.1 protein_id gnl|my_center|LOCUS_26290 736102 735053 gene locus_tag LOCUS_26300 gene queG 736102 735053 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528621.1 protein_id gnl|my_center|LOCUS_26300 736142 737059 gene locus_tag LOCUS_26310 736142 737059 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 protein_id gnl|my_center|LOCUS_26310 737056 738279 gene locus_tag LOCUS_26320 737056 738279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 738336 738830 gene locus_tag LOCUS_26330 gene msrB 738336 738830 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528493.1 protein_id gnl|my_center|LOCUS_26330 739530 738982 gene locus_tag LOCUS_26340 739530 738982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 741563 739701 gene locus_tag LOCUS_26350 741563 739701 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994158.1 protein_id gnl|my_center|LOCUS_26350 741670 742077 gene locus_tag LOCUS_26360 741670 742077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 742405 742169 gene locus_tag LOCUS_26370 742405 742169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 742966 742583 gene locus_tag LOCUS_26380 742966 742583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 743640 742963 gene locus_tag LOCUS_26390 743640 742963 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338508.1 protein_id gnl|my_center|LOCUS_26390 743795 744787 gene locus_tag LOCUS_26400 743795 744787 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126540609.1 protein_id gnl|my_center|LOCUS_26400 746509 744971 gene locus_tag LOCUS_26410 746509 744971 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036992.1 protein_id gnl|my_center|LOCUS_26410 747218 746841 gene locus_tag LOCUS_26420 747218 746841 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_26420 747586 747236 gene locus_tag LOCUS_26430 747586 747236 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815805.1 protein_id gnl|my_center|LOCUS_26430 747738 747583 gene locus_tag LOCUS_26440 747738 747583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 748917 748156 gene locus_tag LOCUS_26450 gene hisF 748917 748156 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970619.1 protein_id gnl|my_center|LOCUS_26450 749648 748914 gene locus_tag LOCUS_26460 gene hisA 749648 748914 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965127.1 protein_id gnl|my_center|LOCUS_26460 750250 749645 gene locus_tag LOCUS_26470 gene hisH 750250 749645 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337344.1 protein_id gnl|my_center|LOCUS_26470 750834 750247 gene locus_tag LOCUS_26480 gene hisB 750834 750247 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537957.1 protein_id gnl|my_center|LOCUS_26480 750906 751391 gene locus_tag LOCUS_26490 750906 751391 CDS product SspB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969716.1 protein_id gnl|my_center|LOCUS_26490 752105 753496 gene locus_tag LOCUS_26500 gene fumC 752105 753496 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535082.1 protein_id gnl|my_center|LOCUS_26500 754234 753593 gene locus_tag LOCUS_26510 754234 753593 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265992.1 protein_id gnl|my_center|LOCUS_26510 754382 754690 gene locus_tag LOCUS_26520 754382 754690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 754869 755432 gene locus_tag LOCUS_26530 754869 755432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 755750 755493 gene locus_tag LOCUS_26540 755750 755493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 755848 756582 gene locus_tag LOCUS_26550 755848 756582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 756647 757021 gene locus_tag LOCUS_26560 gene crcB 756647 757021 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919847.1 protein_id gnl|my_center|LOCUS_26560 757018 758115 gene locus_tag LOCUS_26570 757018 758115 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390409.1 protein_id gnl|my_center|LOCUS_26570 758054 758386 gene locus_tag LOCUS_26580 758054 758386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 758748 758374 gene locus_tag LOCUS_26590 758748 758374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 759036 759218 gene locus_tag LOCUS_26600 759036 759218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 759274 759939 gene locus_tag LOCUS_26610 759274 759939 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_26610 759936 760151 gene locus_tag LOCUS_26620 759936 760151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 760148 760831 gene locus_tag LOCUS_26630 760148 760831 CDS product ATP12 family chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975194.1 protein_id gnl|my_center|LOCUS_26630 762046 761387 gene locus_tag LOCUS_26640 gene gmk 762046 761387 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086862.1 protein_id gnl|my_center|LOCUS_26640 762333 762127 gene locus_tag LOCUS_26650 762333 762127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 762548 762330 gene locus_tag LOCUS_26660 762548 762330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 763571 762609 gene locus_tag LOCUS_26670 gene gshB 763571 762609 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391437.1 protein_id gnl|my_center|LOCUS_26670 764004 763633 gene locus_tag LOCUS_26680 764004 763633 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391439.1 protein_id gnl|my_center|LOCUS_26680 764427 764017 gene locus_tag LOCUS_26690 764427 764017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 764868 764500 gene locus_tag LOCUS_26700 764868 764500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 765853 764930 gene locus_tag LOCUS_26710 gene rsmI 765853 764930 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918033.1 protein_id gnl|my_center|LOCUS_26710 765798 767030 gene locus_tag LOCUS_26720 765798 767030 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626639.1 protein_id gnl|my_center|LOCUS_26720 767027 767356 gene locus_tag LOCUS_26730 767027 767356 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920728.1 protein_id gnl|my_center|LOCUS_26730 768668 767505 gene locus_tag LOCUS_26740 gene hemW 768668 767505 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399647.1 protein_id gnl|my_center|LOCUS_26740 768598 769287 gene locus_tag LOCUS_26750 768598 769287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 769317 769703 gene locus_tag LOCUS_26760 769317 769703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 770469 769843 gene locus_tag LOCUS_26770 gene rdgB 770469 769843 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391387.1 protein_id gnl|my_center|LOCUS_26770 771182 770466 gene locus_tag LOCUS_26780 gene rph 771182 770466 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918041.1 protein_id gnl|my_center|LOCUS_26780 771469 772509 gene locus_tag LOCUS_26790 gene hrcA 771469 772509 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639892.1 protein_id gnl|my_center|LOCUS_26790 772519 773067 gene locus_tag LOCUS_26800 gene grpE 772519 773067 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970822.1 protein_id gnl|my_center|LOCUS_26800 774351 773233 gene locus_tag LOCUS_26810 774351 773233 CDS product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211152.1 protein_id gnl|my_center|LOCUS_26810 776591 774510 gene locus_tag LOCUS_26820 776591 774510 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031789.1 protein_id gnl|my_center|LOCUS_26820 777185 776751 gene locus_tag LOCUS_26830 777185 776751 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384123.1 protein_id gnl|my_center|LOCUS_26830 777365 779263 gene locus_tag LOCUS_26840 gene dnaK 777365 779263 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502156.1 protein_id gnl|my_center|LOCUS_26840 779439 780569 gene locus_tag LOCUS_26850 gene dnaJ 779439 780569 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309945.1 protein_id gnl|my_center|LOCUS_26850 781382 780600 gene locus_tag LOCUS_26860 781382 780600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 781611 782120 gene locus_tag LOCUS_26870 781611 782120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 783684 782368 gene locus_tag LOCUS_26880 gene purB 783684 782368 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975647.1 protein_id gnl|my_center|LOCUS_26880 783904 784362 gene locus_tag LOCUS_26890 783904 784362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 785330 784716 gene locus_tag LOCUS_26900 785330 784716 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329125.1 protein_id gnl|my_center|LOCUS_26900 786336 785512 gene locus_tag LOCUS_26910 786336 785512 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265978.1 protein_id gnl|my_center|LOCUS_26910 787351 786452 gene locus_tag LOCUS_26920 787351 786452 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_26920 787841 787404 gene locus_tag LOCUS_26930 787841 787404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 788029 787838 gene locus_tag LOCUS_26940 788029 787838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 788472 788026 gene locus_tag LOCUS_26950 788472 788026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 788653 788450 gene locus_tag LOCUS_26960 788653 788450 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_26960 788934 789821 gene locus_tag LOCUS_26970 788934 789821 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390704.1 protein_id gnl|my_center|LOCUS_26970 789821 792004 gene locus_tag LOCUS_26980 gene glyS 789821 792004 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384808.1 protein_id gnl|my_center|LOCUS_26980 792129 794789 gene locus_tag LOCUS_26990 gene ppdK 792129 794789 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640245.1 protein_id gnl|my_center|LOCUS_26990 795370 795008 gene locus_tag LOCUS_27000 795370 795008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 796456 795458 gene locus_tag LOCUS_27010 796456 795458 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310061.1 protein_id gnl|my_center|LOCUS_27010 797440 796457 gene locus_tag LOCUS_27020 797440 796457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 798707 797445 gene locus_tag LOCUS_27030 798707 797445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 799381 798707 gene locus_tag LOCUS_27040 799381 798707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 800925 799408 gene locus_tag LOCUS_27050 800925 799408 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647881.1 protein_id gnl|my_center|LOCUS_27050 801944 800931 gene locus_tag LOCUS_27060 801944 800931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 802482 801997 gene locus_tag LOCUS_27070 802482 801997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 802535 803473 gene locus_tag LOCUS_27080 802535 803473 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531142.1 protein_id gnl|my_center|LOCUS_27080 803470 804549 gene locus_tag LOCUS_27090 803470 804549 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339415.1 protein_id gnl|my_center|LOCUS_27090 804811 805344 gene locus_tag LOCUS_27100 804811 805344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 805926 805489 gene locus_tag LOCUS_27110 gene rnhA 805926 805489 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974731.1 protein_id gnl|my_center|LOCUS_27110 806876 805923 gene locus_tag LOCUS_27120 806876 805923 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084133.1 protein_id gnl|my_center|LOCUS_27120 807836 806880 gene locus_tag LOCUS_27130 gene ispH 807836 806880 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722409.1 protein_id gnl|my_center|LOCUS_27130 807939 808577 gene locus_tag LOCUS_27140 807939 808577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 809103 810278 gene locus_tag LOCUS_27150 gene gcvT 809103 810278 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337302.1 protein_id gnl|my_center|LOCUS_27150 810281 810652 gene locus_tag LOCUS_27160 gene gcvH 810281 810652 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390798.1 protein_id gnl|my_center|LOCUS_27160 810833 812212 gene locus_tag LOCUS_27170 gene gcvPA 810833 812212 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921182.1 protein_id gnl|my_center|LOCUS_27170 812209 813765 gene locus_tag LOCUS_27180 gene gcvPB 812209 813765 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923258.1 protein_id gnl|my_center|LOCUS_27180 814120 813881 gene locus_tag LOCUS_27190 814120 813881 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680497.1 protein_id gnl|my_center|LOCUS_27190 814205 814855 gene locus_tag LOCUS_27200 gene bluB 814205 814855 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391283.1 protein_id gnl|my_center|LOCUS_27200 815878 814982 gene locus_tag LOCUS_27210 815878 814982 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_27210 815970 817502 gene locus_tag LOCUS_27220 gene proS 815970 817502 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_27220 818597 817629 gene locus_tag LOCUS_27230 818597 817629 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329145.1 protein_id gnl|my_center|LOCUS_27230 820973 818775 gene locus_tag LOCUS_27240 gene rnr 820973 818775 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338736.1 protein_id gnl|my_center|LOCUS_27240 821214 823715 gene locus_tag LOCUS_27250 821214 823715 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073347.1 protein_id gnl|my_center|LOCUS_27250 825805 823862 gene locus_tag LOCUS_27260 825805 823862 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037191.1 protein_id gnl|my_center|LOCUS_27260 827830 826046 gene locus_tag LOCUS_27270 827830 826046 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923241.1 protein_id gnl|my_center|LOCUS_27270 828040 829257 gene locus_tag LOCUS_27280 gene phaZ 828040 829257 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390504.1 protein_id gnl|my_center|LOCUS_27280 829928 829449 gene locus_tag LOCUS_27290 829928 829449 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719538.1 protein_id gnl|my_center|LOCUS_27290 830434 833400 gene locus_tag LOCUS_27300 gene putA 830434 833400 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089996.1 protein_id gnl|my_center|LOCUS_27300 834689 833523 gene locus_tag LOCUS_27310 834689 833523 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143858.1 protein_id gnl|my_center|LOCUS_27310 835734 834733 gene locus_tag LOCUS_27320 835734 834733 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267946.1 protein_id gnl|my_center|LOCUS_27320 835858 836430 gene locus_tag LOCUS_27330 835858 836430 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727021.1 protein_id gnl|my_center|LOCUS_27330 836515 837444 gene locus_tag LOCUS_27340 836515 837444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 838950 837583 gene locus_tag LOCUS_27350 838950 837583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 839080 838943 gene locus_tag LOCUS_27360 839080 838943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 839172 840383 gene locus_tag LOCUS_27370 839172 840383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 840380 841036 gene locus_tag LOCUS_27380 840380 841036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 842050 841040 gene locus_tag LOCUS_27390 842050 841040 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331258.1 protein_id gnl|my_center|LOCUS_27390 845044 842357 gene locus_tag LOCUS_27400 gene acnA 845044 842357 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391258.1 protein_id gnl|my_center|LOCUS_27400 845413 845610 gene locus_tag LOCUS_27410 845413 845610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 845753 846301 gene locus_tag LOCUS_27420 845753 846301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 846291 846536 gene locus_tag LOCUS_27430 846291 846536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 846549 846716 gene locus_tag LOCUS_27440 846549 846716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 846767 847234 gene locus_tag LOCUS_27450 846767 847234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 847224 847679 gene locus_tag LOCUS_27460 847224 847679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 847759 848121 gene locus_tag LOCUS_27470 847759 848121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 849753 848170 gene locus_tag LOCUS_27480 849753 848170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 852980 849753 gene locus_tag LOCUS_27490 852980 849753 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209267.1 protein_id gnl|my_center|LOCUS_27490 854190 852988 gene locus_tag LOCUS_27500 854190 852988 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_27500 854440 855111 gene locus_tag LOCUS_27510 gene rpiA 854440 855111 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258577.1 protein_id gnl|my_center|LOCUS_27510 855184 857271 gene locus_tag LOCUS_27520 gene tkt 855184 857271 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_27520 857271 858392 gene locus_tag LOCUS_27530 857271 858392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 858467 859450 gene locus_tag LOCUS_27540 gene gnd 858467 859450 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766216.1 protein_id gnl|my_center|LOCUS_27540 859447 860268 gene locus_tag LOCUS_27550 859447 860268 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766212.1 protein_id gnl|my_center|LOCUS_27550 860265 861014 gene locus_tag LOCUS_27560 860265 861014 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051905.1 protein_id gnl|my_center|LOCUS_27560 861068 861520 gene locus_tag LOCUS_27570 861068 861520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 863920 861764 gene locus_tag LOCUS_27580 863920 861764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 864103 865284 gene locus_tag LOCUS_27590 864103 865284 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640425.1 protein_id gnl|my_center|LOCUS_27590 865686 867284 gene locus_tag LOCUS_27600 865686 867284 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920031.1 protein_id gnl|my_center|LOCUS_27600 867284 867862 gene locus_tag LOCUS_27610 867284 867862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 867855 869708 gene locus_tag LOCUS_27620 867855 869708 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920029.1 protein_id gnl|my_center|LOCUS_27620 869705 870154 gene locus_tag LOCUS_27630 869705 870154 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089535.1 protein_id gnl|my_center|LOCUS_27630 872336 870264 gene locus_tag LOCUS_27640 872336 870264 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_27640 872783 873508 gene locus_tag LOCUS_27650 872783 873508 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_27650 873606 874040 gene locus_tag LOCUS_27660 gene ccmE 873606 874040 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387797.1 protein_id gnl|my_center|LOCUS_27660 874037 875971 gene locus_tag LOCUS_27670 874037 875971 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532634.1 protein_id gnl|my_center|LOCUS_27670 875968 876495 gene locus_tag LOCUS_27680 875968 876495 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029940705.1 protein_id gnl|my_center|LOCUS_27680 876492 876869 gene locus_tag LOCUS_27690 876492 876869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 876869 877495 gene locus_tag LOCUS_27700 876869 877495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 877712 877500 gene locus_tag LOCUS_27710 877712 877500 CDS product DUF3072 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227672.1 protein_id gnl|my_center|LOCUS_27710 879267 878161 gene locus_tag LOCUS_27720 gene ald 879267 878161 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072305.1 protein_id gnl|my_center|LOCUS_27720 879394 879837 gene locus_tag LOCUS_27730 879394 879837 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338436.1 protein_id gnl|my_center|LOCUS_27730 880024 881700 gene locus_tag LOCUS_27740 880024 881700 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_27740 881761 882816 gene locus_tag LOCUS_27750 881761 882816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 883987 883280 gene locus_tag LOCUS_27760 gene ctrA 883987 883280 CDS product cell cycle two-component system response regulator CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203583.1 protein_id gnl|my_center|LOCUS_27760 885185 884091 gene locus_tag LOCUS_27770 885185 884091 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035337.1 protein_id gnl|my_center|LOCUS_27770 886102 885182 gene locus_tag LOCUS_27780 886102 885182 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919349.1 protein_id gnl|my_center|LOCUS_27780 886155 886964 gene locus_tag LOCUS_27790 886155 886964 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919348.1 protein_id gnl|my_center|LOCUS_27790 886996 887598 gene locus_tag LOCUS_27800 gene wrbA 886996 887598 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918676.1 protein_id gnl|my_center|LOCUS_27800 888737 887964 gene locus_tag LOCUS_27810 888737 887964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 888787 889431 gene locus_tag LOCUS_27820 888787 889431 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174878.1 protein_id gnl|my_center|LOCUS_27820 889442 889867 gene locus_tag LOCUS_27830 gene arfB 889442 889867 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_27830 890065 891843 gene locus_tag LOCUS_27840 890065 891843 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921187.1 protein_id gnl|my_center|LOCUS_27840 891901 892395 gene locus_tag LOCUS_27850 891901 892395 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945126.1 protein_id gnl|my_center|LOCUS_27850 892526 893518 gene locus_tag LOCUS_27860 892526 893518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 894887 893625 gene locus_tag LOCUS_27870 894887 893625 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_27870 895589 895134 gene locus_tag LOCUS_27880 895589 895134 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310195.1 protein_id gnl|my_center|LOCUS_27880 895720 897066 gene locus_tag LOCUS_27890 895720 897066 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_27890 897086 897298 gene locus_tag LOCUS_27900 897086 897298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 897295 897681 gene locus_tag LOCUS_27910 897295 897681 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265510.1 protein_id gnl|my_center|LOCUS_27910 897687 898118 gene locus_tag LOCUS_27920 897687 898118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 898111 899535 gene locus_tag LOCUS_27930 gene lpdA 898111 899535 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670037.1 protein_id gnl|my_center|LOCUS_27930 899879 901228 gene locus_tag LOCUS_27940 899879 901228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 901273 901614 gene locus_tag LOCUS_27950 901273 901614 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339310.1 protein_id gnl|my_center|LOCUS_27950 903664 901910 gene locus_tag LOCUS_27960 903664 901910 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640164.1 protein_id gnl|my_center|LOCUS_27960 903839 904324 gene locus_tag LOCUS_27970 903839 904324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 904439 905008 gene locus_tag LOCUS_27980 904439 905008 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530922.1 protein_id gnl|my_center|LOCUS_27980 905005 905508 gene locus_tag LOCUS_27990 905005 905508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 905541 905933 gene locus_tag LOCUS_28000 905541 905933 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328036.1 protein_id gnl|my_center|LOCUS_28000 906403 905906 gene locus_tag LOCUS_28010 906403 905906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 907155 906409 gene locus_tag LOCUS_28020 907155 906409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 907865 907152 gene locus_tag LOCUS_28030 907865 907152 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_28030 908372 907986 gene locus_tag LOCUS_28040 908372 907986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 908542 909507 gene locus_tag LOCUS_28050 908542 909507 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 protein_id gnl|my_center|LOCUS_28050 909601 909852 gene locus_tag LOCUS_28060 909601 909852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 910410 910925 gene locus_tag LOCUS_28070 910410 910925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 910922 911902 gene locus_tag LOCUS_28080 gene rsmH 910922 911902 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920418.1 protein_id gnl|my_center|LOCUS_28080 911899 912552 gene locus_tag LOCUS_28090 911899 912552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 912549 914267 gene locus_tag LOCUS_28100 912549 914267 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_28100 914278 915708 gene locus_tag LOCUS_28110 914278 915708 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089347.1 protein_id gnl|my_center|LOCUS_28110 915696 915875 gene locus_tag LOCUS_28120 915696 915875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 915872 917251 gene locus_tag LOCUS_28130 915872 917251 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920414.1 protein_id gnl|my_center|LOCUS_28130 917254 918321 gene locus_tag LOCUS_28140 gene mraY 917254 918321 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530954.1 protein_id gnl|my_center|LOCUS_28140 918318 919631 gene locus_tag LOCUS_28150 gene murD 918318 919631 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920413.1 protein_id gnl|my_center|LOCUS_28150 919628 920857 gene locus_tag LOCUS_28160 gene ftsW 919628 920857 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972054.1 protein_id gnl|my_center|LOCUS_28160 920854 922005 gene locus_tag LOCUS_28170 gene murG 920854 922005 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388705.1 protein_id gnl|my_center|LOCUS_28170 922002 923417 gene locus_tag LOCUS_28180 gene murC 922002 923417 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388704.1 protein_id gnl|my_center|LOCUS_28180 923414 924301 gene locus_tag LOCUS_28190 gene murB 923414 924301 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089340.1 protein_id gnl|my_center|LOCUS_28190 924381 925313 gene locus_tag LOCUS_28200 924381 925313 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242931.1 protein_id gnl|my_center|LOCUS_28200 925310 926263 gene locus_tag LOCUS_28210 925310 926263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 926271 927530 gene locus_tag LOCUS_28220 gene ftsA 926271 927530 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004442783.1 protein_id gnl|my_center|LOCUS_28220 927650 929191 gene locus_tag LOCUS_28230 927650 929191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 929995 932067 gene locus_tag LOCUS_28240 929995 932067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 932072 933238 gene locus_tag LOCUS_28250 932072 933238 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383040.1 protein_id gnl|my_center|LOCUS_28250 934274 933348 gene locus_tag LOCUS_28260 934274 933348 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971314.1 protein_id gnl|my_center|LOCUS_28260 934736 934437 gene locus_tag LOCUS_28270 934736 934437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 934982 936706 gene locus_tag LOCUS_28280 gene argS 934982 936706 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140224.1 protein_id gnl|my_center|LOCUS_28280 936706 937449 gene locus_tag LOCUS_28290 936706 937449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 937465 938499 gene locus_tag LOCUS_28300 gene nagZ 937465 938499 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 protein_id gnl|my_center|LOCUS_28300 939252 938641 gene locus_tag LOCUS_28310 939252 938641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 939366 940088 gene locus_tag LOCUS_28320 939366 940088 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389528.1 protein_id gnl|my_center|LOCUS_28320 940085 940687 gene locus_tag LOCUS_28330 940085 940687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 940827 941063 gene locus_tag LOCUS_28340 940827 941063 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314389.1 protein_id gnl|my_center|LOCUS_28340 941093 941542 gene locus_tag LOCUS_28350 gene tatB 941093 941542 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166940007.1 protein_id gnl|my_center|LOCUS_28350 941539 942327 gene locus_tag LOCUS_28360 gene tatC 941539 942327 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389524.1 protein_id gnl|my_center|LOCUS_28360 942702 942568 gene locus_tag LOCUS_28370 942702 942568 CDS product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640119.1 protein_id gnl|my_center|LOCUS_28370 944749 943157 gene locus_tag LOCUS_28380 944749 943157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 944931 944761 gene locus_tag LOCUS_28390 944931 944761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 945179 945979 gene locus_tag LOCUS_28400 gene phyR 945179 945979 CDS product anti-anti sigma factor/receiver protein PhyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921306.1 protein_id gnl|my_center|LOCUS_28400 946038 946175 gene locus_tag LOCUS_28410 946038 946175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 946282 946920 gene locus_tag LOCUS_28420 946282 946920 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921304.1 protein_id gnl|my_center|LOCUS_28420 947015 947299 gene locus_tag LOCUS_28430 947015 947299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 947296 947832 gene locus_tag LOCUS_28440 947296 947832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28440 947825 948043 gene locus_tag LOCUS_28450 947825 948043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 948324 950984 gene locus_tag LOCUS_28460 948324 950984 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391265.1 protein_id gnl|my_center|LOCUS_28460 950988 951443 gene locus_tag LOCUS_28470 950988 951443 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720132.1 protein_id gnl|my_center|LOCUS_28470 951440 952264 gene locus_tag LOCUS_28480 951440 952264 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392992.1 protein_id gnl|my_center|LOCUS_28480 952352 953098 gene locus_tag LOCUS_28490 952352 953098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 953350 953688 gene locus_tag LOCUS_28500 gene erpA 953350 953688 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919875.1 protein_id gnl|my_center|LOCUS_28500 953690 954466 gene locus_tag LOCUS_28510 gene xth 953690 954466 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101332.1 protein_id gnl|my_center|LOCUS_28510 954831 955094 gene locus_tag LOCUS_28520 954831 955094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 955117 955365 gene locus_tag LOCUS_28530 955117 955365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 956567 955416 gene locus_tag LOCUS_28540 956567 955416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919038.1 protein_id gnl|my_center|LOCUS_28540 956702 957796 gene locus_tag LOCUS_28550 956702 957796 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639906.1 protein_id gnl|my_center|LOCUS_28550 959243 958143 gene locus_tag LOCUS_28560 gene lptG 959243 958143 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919560.1 protein_id gnl|my_center|LOCUS_28560 960439 959240 gene locus_tag LOCUS_28570 960439 959240 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919040.1 protein_id gnl|my_center|LOCUS_28570 962544 960625 gene locus_tag LOCUS_28580 962544 960625 CDS product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529458.1 protein_id gnl|my_center|LOCUS_28580 963858 962596 gene locus_tag LOCUS_28590 963858 962596 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 protein_id gnl|my_center|LOCUS_28590 964132 963887 gene locus_tag LOCUS_28600 964132 963887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 965099 964203 gene locus_tag LOCUS_28610 965099 964203 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077137.1 protein_id gnl|my_center|LOCUS_28610 966196 965096 gene locus_tag LOCUS_28620 gene proB 966196 965096 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972562.1 protein_id gnl|my_center|LOCUS_28620 967406 966357 gene locus_tag LOCUS_28630 gene obgE 967406 966357 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185662252.1 protein_id gnl|my_center|LOCUS_28630 968479 967931 gene locus_tag LOCUS_28640 968479 967931 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972563.1 protein_id gnl|my_center|LOCUS_28640 968933 968667 gene locus_tag LOCUS_28650 gene rpmA 968933 968667 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383240.1 protein_id gnl|my_center|LOCUS_28650 969276 968977 gene locus_tag LOCUS_28660 969276 968977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 969596 972199 gene locus_tag LOCUS_28670 969596 972199 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_28670 972620 972240 gene locus_tag LOCUS_28680 gene hspQ 972620 972240 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919487.1 protein_id gnl|my_center|LOCUS_28680 972749 972838 gene locus_tag LOCUS_t00450 972749 972838 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 973712 972867 gene locus_tag LOCUS_28690 973712 972867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 973916 974926 gene locus_tag LOCUS_28700 gene splB 973916 974926 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245173.1 protein_id gnl|my_center|LOCUS_28700 974923 975423 gene locus_tag LOCUS_28710 974923 975423 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975272.1 protein_id gnl|my_center|LOCUS_28710 975431 975628 gene locus_tag LOCUS_28720 975431 975628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 975665 975913 gene locus_tag LOCUS_28730 975665 975913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 975967 976848 gene locus_tag LOCUS_28740 975967 976848 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_28740 977326 976856 gene locus_tag LOCUS_28750 977326 976856 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081117.1 protein_id gnl|my_center|LOCUS_28750 978873 977323 gene locus_tag LOCUS_28760 978873 977323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28760 980225 978870 gene locus_tag LOCUS_28770 980225 978870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 980366 980989 gene locus_tag LOCUS_28780 980366 980989 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977779.1 protein_id gnl|my_center|LOCUS_28780 981002 982567 gene locus_tag LOCUS_28790 981002 982567 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965761.1 protein_id gnl|my_center|LOCUS_28790 982792 984750 gene locus_tag LOCUS_28800 982792 984750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 985680 984751 gene locus_tag LOCUS_28810 985680 984751 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037027.1 protein_id gnl|my_center|LOCUS_28810 988302 985819 gene locus_tag LOCUS_28820 988302 985819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 989907 988477 gene locus_tag LOCUS_28830 989907 988477 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038271.1 protein_id gnl|my_center|LOCUS_28830 991830 990028 gene locus_tag LOCUS_28840 991830 990028 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265756.1 protein_id gnl|my_center|LOCUS_28840 991951 995526 gene locus_tag LOCUS_28850 991951 995526 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265799.1 protein_id gnl|my_center|LOCUS_28850 995526 996206 gene locus_tag LOCUS_28860 995526 996206 CDS product DUF969 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919083.1 protein_id gnl|my_center|LOCUS_28860 996203 997108 gene locus_tag LOCUS_28870 996203 997108 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919082.1 protein_id gnl|my_center|LOCUS_28870 997105 998097 gene locus_tag LOCUS_28880 997105 998097 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919081.1 protein_id gnl|my_center|LOCUS_28880 998718 998257 gene locus_tag LOCUS_28890 998718 998257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 999990 998803 gene locus_tag LOCUS_28900 999990 998803 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989217.1 protein_id gnl|my_center|LOCUS_28900 1002137 999987 gene locus_tag LOCUS_28910 1002137 999987 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208470.1 protein_id gnl|my_center|LOCUS_28910 1003327 1002134 gene locus_tag LOCUS_28920 1003327 1002134 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367420.1 protein_id gnl|my_center|LOCUS_28920 1017082 1003592 gene locus_tag LOCUS_28930 1017082 1003592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 1017437 1018984 gene locus_tag LOCUS_28940 1017437 1018984 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919385.1 protein_id gnl|my_center|LOCUS_28940 1019005 1019367 gene locus_tag LOCUS_28950 1019005 1019367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 1019693 1021492 gene locus_tag LOCUS_28960 1019693 1021492 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038020.1 protein_id gnl|my_center|LOCUS_28960 1022077 1022244 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1024293 1022497 gene locus_tag LOCUS_28970 1024293 1022497 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275308.1 protein_id gnl|my_center|LOCUS_28970 1024477 1024788 gene locus_tag LOCUS_28980 1024477 1024788 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310858.1 protein_id gnl|my_center|LOCUS_28980 1024836 1025090 gene locus_tag LOCUS_28990 1024836 1025090 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921449.1 protein_id gnl|my_center|LOCUS_28990 1025105 1025983 gene locus_tag LOCUS_29000 gene folD 1025105 1025983 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 protein_id gnl|my_center|LOCUS_29000 1025988 1026611 gene locus_tag LOCUS_29010 1025988 1026611 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337827.1 protein_id gnl|my_center|LOCUS_29010 1028495 1026741 gene locus_tag LOCUS_29020 1028495 1026741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 1028641 1029024 gene locus_tag LOCUS_29030 1028641 1029024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 1029029 1029757 gene locus_tag LOCUS_29040 1029029 1029757 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_29040 1029921 1031030 gene locus_tag LOCUS_29050 1029921 1031030 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533325.1 protein_id gnl|my_center|LOCUS_29050 1031027 1031647 gene locus_tag LOCUS_29060 gene bioD 1031027 1031647 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533326.1 protein_id gnl|my_center|LOCUS_29060 1031644 1032891 gene locus_tag LOCUS_29070 1031644 1032891 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084894.1 protein_id gnl|my_center|LOCUS_29070 1033093 1036530 gene locus_tag LOCUS_29080 1033093 1036530 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054074.1 protein_id gnl|my_center|LOCUS_29080 1036728 1037321 gene locus_tag LOCUS_29090 1036728 1037321 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_29090 1037847 1037431 gene locus_tag LOCUS_29100 1037847 1037431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 1038236 1037844 gene locus_tag LOCUS_29110 1038236 1037844 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106488.1 protein_id gnl|my_center|LOCUS_29110 1038313 1039098 gene locus_tag LOCUS_29120 1038313 1039098 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_29120 1039769 1039314 gene locus_tag LOCUS_29130 1039769 1039314 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919458.1 protein_id gnl|my_center|LOCUS_29130 1039863 1041314 gene locus_tag LOCUS_29140 gene mgtE 1039863 1041314 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389748.1 protein_id gnl|my_center|LOCUS_29140 1041612 1042871 gene locus_tag LOCUS_29150 1041612 1042871 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456066.1 protein_id gnl|my_center|LOCUS_29150 1043140 1042877 gene locus_tag LOCUS_29160 1043140 1042877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 1043253 1043399 gene locus_tag LOCUS_29170 1043253 1043399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 1044309 1043440 gene locus_tag LOCUS_29180 1044309 1043440 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970098.1 protein_id gnl|my_center|LOCUS_29180 1044389 1045414 gene locus_tag LOCUS_29190 1044389 1045414 CDS product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037017.1 protein_id gnl|my_center|LOCUS_29190 1045438 1046052 gene locus_tag LOCUS_29200 1045438 1046052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 1047451 1046426 gene locus_tag LOCUS_29210 1047451 1046426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 1048095 1047562 gene locus_tag LOCUS_29220 1048095 1047562 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919545.1 protein_id gnl|my_center|LOCUS_29220 1048190 1049011 gene locus_tag LOCUS_29230 gene hisN 1048190 1049011 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_29230 1049071 1049535 gene locus_tag LOCUS_29240 1049071 1049535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 1051610 1049565 gene locus_tag LOCUS_29250 1051610 1049565 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105228.1 protein_id gnl|my_center|LOCUS_29250 1051850 1052053 gene locus_tag LOCUS_29260 gene rpmI 1051850 1052053 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918930.1 protein_id gnl|my_center|LOCUS_29260 1052075 1052440 gene locus_tag LOCUS_29270 gene rplT 1052075 1052440 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918929.1 protein_id gnl|my_center|LOCUS_29270 1053200 1052535 gene locus_tag LOCUS_29280 1053200 1052535 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339467.1 protein_id gnl|my_center|LOCUS_29280 1053471 1053884 gene locus_tag LOCUS_29290 1053471 1053884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1053939 1054343 gene locus_tag LOCUS_29300 1053939 1054343 CDS product DUF1489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328107.1 protein_id gnl|my_center|LOCUS_29300 1055263 1054652 gene locus_tag LOCUS_29310 1055263 1054652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 1055294 1055932 gene locus_tag LOCUS_29320 1055294 1055932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 1055932 1056360 gene locus_tag LOCUS_29330 1055932 1056360 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337389.1 protein_id gnl|my_center|LOCUS_29330 1056357 1057025 gene locus_tag LOCUS_29340 1056357 1057025 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_29340 1059106 1057001 gene locus_tag LOCUS_29350 1059106 1057001 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241759.1 protein_id gnl|my_center|LOCUS_29350 1059422 1060012 gene locus_tag LOCUS_29360 1059422 1060012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 1060409 1060323 gene locus_tag LOCUS_t00460 1060409 1060323 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1060544 1061938 gene locus_tag LOCUS_29370 1060544 1061938 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919886.1 protein_id gnl|my_center|LOCUS_29370 1062846 1062094 gene locus_tag LOCUS_29380 1062846 1062094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 1062977 1063702 gene locus_tag LOCUS_29390 gene ftsE 1062977 1063702 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626546.1 protein_id gnl|my_center|LOCUS_29390 1063699 1064598 gene locus_tag LOCUS_29400 1063699 1064598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 1064598 1065131 gene locus_tag LOCUS_29410 1064598 1065131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 1065110 1065823 gene locus_tag LOCUS_29420 1065110 1065823 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626547.1 protein_id gnl|my_center|LOCUS_29420 1066839 1065928 gene locus_tag LOCUS_29430 1066839 1065928 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084213.1 protein_id gnl|my_center|LOCUS_29430 1068023 1066839 gene locus_tag LOCUS_29440 gene hisC 1068023 1066839 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973186.1 protein_id gnl|my_center|LOCUS_29440 1068022 1069182 gene locus_tag LOCUS_29450 1068022 1069182 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918413.1 protein_id gnl|my_center|LOCUS_29450 1069179 1069772 gene locus_tag LOCUS_29460 gene metW 1069179 1069772 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391015.1 protein_id gnl|my_center|LOCUS_29460 1069840 1070232 gene locus_tag LOCUS_29470 1069840 1070232 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974063.1 protein_id gnl|my_center|LOCUS_29470 1071866 1070268 gene locus_tag LOCUS_29480 1071866 1070268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 1072496 1071897 gene locus_tag LOCUS_29490 1072496 1071897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 1074375 1072516 gene locus_tag LOCUS_29500 gene feoB 1074375 1072516 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640041.1 protein_id gnl|my_center|LOCUS_29500 1074643 1074392 gene locus_tag LOCUS_29510 1074643 1074392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 1075515 1074841 gene locus_tag LOCUS_29520 1075515 1074841 CDS product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720899.1 protein_id gnl|my_center|LOCUS_29520 1076444 1075512 gene locus_tag LOCUS_29530 1076444 1075512 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 protein_id gnl|my_center|LOCUS_29530 1076585 1077679 gene locus_tag LOCUS_29540 1076585 1077679 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175517123.1 protein_id gnl|my_center|LOCUS_29540 1077815 1078125 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1079761 1078742 gene locus_tag LOCUS_29550 1079761 1078742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 1080302 1079775 gene locus_tag LOCUS_29560 gene lptE 1080302 1079775 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338532.1 protein_id gnl|my_center|LOCUS_29560 1082800 1080299 gene locus_tag LOCUS_29570 gene leuS 1082800 1080299 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921576.1 protein_id gnl|my_center|LOCUS_29570 1083247 1082813 gene locus_tag LOCUS_29580 1083247 1082813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 1083471 1084178 gene locus_tag LOCUS_29590 1083471 1084178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 1085354 1084818 gene locus_tag LOCUS_29600 1085354 1084818 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266003.1 protein_id gnl|my_center|LOCUS_29600 1085353 1086012 gene locus_tag LOCUS_29610 1085353 1086012 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083450.1 protein_id gnl|my_center|LOCUS_29610 1086009 1086677 gene locus_tag LOCUS_29620 1086009 1086677 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083618.1 protein_id gnl|my_center|LOCUS_29620 1088041 1086977 gene locus_tag LOCUS_29630 gene ribA 1088041 1086977 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391384.1 protein_id gnl|my_center|LOCUS_29630 1088868 1088038 gene locus_tag LOCUS_29640 1088868 1088038 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310943.1 protein_id gnl|my_center|LOCUS_29640 1089831 1089199 gene locus_tag LOCUS_29650 1089831 1089199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 1091373 1089982 gene locus_tag LOCUS_29660 1091373 1089982 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266835.1 protein_id gnl|my_center|LOCUS_29660 1091315 1091503 gene locus_tag LOCUS_29670 1091315 1091503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 1092068 1091607 gene locus_tag LOCUS_29680 gene msrB 1092068 1091607 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970231.1 protein_id gnl|my_center|LOCUS_29680 1092747 1092091 gene locus_tag LOCUS_29690 1092747 1092091 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 protein_id gnl|my_center|LOCUS_29690 1093080 1092844 gene locus_tag LOCUS_29700 1093080 1092844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 1093195 1093944 gene locus_tag LOCUS_29710 1093195 1093944 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038939.1 protein_id gnl|my_center|LOCUS_29710 1094430 1093948 gene locus_tag LOCUS_29720 1094430 1093948 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241839.1 protein_id gnl|my_center|LOCUS_29720 1094630 1095142 gene locus_tag LOCUS_29730 1094630 1095142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 1095196 1095558 gene locus_tag LOCUS_29740 1095196 1095558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 1095765 1095574 gene locus_tag LOCUS_29750 1095765 1095574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 1096620 1096078 gene locus_tag LOCUS_29760 1096620 1096078 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968689.1 protein_id gnl|my_center|LOCUS_29760 1097267 1096770 gene locus_tag LOCUS_29770 1097267 1096770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 1097958 1097491 gene locus_tag LOCUS_29780 1097958 1097491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 1098051 1098770 gene locus_tag LOCUS_29790 1098051 1098770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence037 2978 30 gene locus_tag LOCUS_29800 2978 30 CDS product Tn3-like element ISPa38 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100881.1 protein_id gnl|my_center|LOCUS_29800 3108 3701 gene locus_tag LOCUS_29810 3108 3701 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113775.1 protein_id gnl|my_center|LOCUS_29810 3698 5071 gene locus_tag LOCUS_29820 3698 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 5968 5075 gene locus_tag LOCUS_29830 5968 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 6958 6311 gene locus_tag LOCUS_29840 gene parA 6958 6311 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_29840 7131 7343 gene locus_tag LOCUS_29850 7131 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 7758 7498 gene locus_tag LOCUS_29860 7758 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 8475 9077 gene locus_tag LOCUS_29870 8475 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 9395 12088 gene locus_tag LOCUS_29880 9395 12088 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918977.1 protein_id gnl|my_center|LOCUS_29880 12142 12681 gene locus_tag LOCUS_29890 12142 12681 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640141.1 protein_id gnl|my_center|LOCUS_29890 13268 12885 gene locus_tag LOCUS_29900 13268 12885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 14652 13294 gene locus_tag LOCUS_29910 14652 13294 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267047.1 protein_id gnl|my_center|LOCUS_29910 14916 15281 gene locus_tag LOCUS_29920 14916 15281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 15283 16722 gene locus_tag LOCUS_29930 15283 16722 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089225.1 protein_id gnl|my_center|LOCUS_29930 16724 17233 gene locus_tag LOCUS_29940 16724 17233 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089224.1 protein_id gnl|my_center|LOCUS_29940 17230 18000 gene locus_tag LOCUS_29950 17230 18000 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089223.1 protein_id gnl|my_center|LOCUS_29950 18564 18052 gene locus_tag LOCUS_29960 18564 18052 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086597.1 protein_id gnl|my_center|LOCUS_29960 19628 18561 gene locus_tag LOCUS_29970 19628 18561 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911638.1 protein_id gnl|my_center|LOCUS_29970 19775 20647 gene locus_tag LOCUS_29980 19775 20647 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971057.1 protein_id gnl|my_center|LOCUS_29980 20644 21795 gene locus_tag LOCUS_29990 20644 21795 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428856.1 protein_id gnl|my_center|LOCUS_29990 21885 23120 gene locus_tag LOCUS_30000 21885 23120 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965461.1 protein_id gnl|my_center|LOCUS_30000 23133 23615 gene locus_tag LOCUS_30010 23133 23615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 23750 24226 gene locus_tag LOCUS_30020 23750 24226 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918825.1 protein_id gnl|my_center|LOCUS_30020 24821 24276 gene locus_tag LOCUS_30030 24821 24276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 25260 24850 gene locus_tag LOCUS_30040 25260 24850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 25880 25257 gene locus_tag LOCUS_30050 25880 25257 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_30050 25965 26882 gene locus_tag LOCUS_30060 25965 26882 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_30060 26882 27319 gene locus_tag LOCUS_30070 26882 27319 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_30070 27319 27744 gene locus_tag LOCUS_30080 27319 27744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807254.1 protein_id gnl|my_center|LOCUS_30080 27764 28198 gene locus_tag LOCUS_30090 27764 28198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30090 28195 29427 gene locus_tag LOCUS_30100 28195 29427 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266171.1 protein_id gnl|my_center|LOCUS_30100 29424 30206 gene locus_tag LOCUS_30110 29424 30206 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920702.1 protein_id gnl|my_center|LOCUS_30110 30206 31015 gene locus_tag LOCUS_30120 30206 31015 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172934.1 protein_id gnl|my_center|LOCUS_30120 31012 31638 gene locus_tag LOCUS_30130 31012 31638 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965344.1 protein_id gnl|my_center|LOCUS_30130 31641 32282 gene locus_tag LOCUS_30140 31641 32282 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965344.1 protein_id gnl|my_center|LOCUS_30140 32304 33191 gene locus_tag LOCUS_30150 32304 33191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 33380 33961 gene locus_tag LOCUS_30160 33380 33961 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100847.1 protein_id gnl|my_center|LOCUS_30160 34027 34188 gene locus_tag LOCUS_30170 34027 34188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 34254 34904 gene locus_tag LOCUS_30180 34254 34904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 35775 34885 gene locus_tag LOCUS_30190 35775 34885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30190 36107 35826 gene locus_tag LOCUS_30200 36107 35826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30200 36171 37721 gene locus_tag LOCUS_30210 36171 37721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 38518 37766 gene locus_tag LOCUS_30220 38518 37766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 38625 38861 gene locus_tag LOCUS_30230 38625 38861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 38854 39999 gene locus_tag LOCUS_30240 38854 39999 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_30240 39996 40733 gene locus_tag LOCUS_30250 39996 40733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 40745 43654 gene locus_tag LOCUS_30260 40745 43654 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480405.1 protein_id gnl|my_center|LOCUS_30260 43797 44663 gene locus_tag LOCUS_30270 43797 44663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 45998 44730 gene locus_tag LOCUS_30280 45998 44730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 46274 47524 gene locus_tag LOCUS_30290 46274 47524 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074255371.1 protein_id gnl|my_center|LOCUS_30290 47599 48000 gene locus_tag LOCUS_30300 47599 48000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 48014 48490 gene locus_tag LOCUS_30310 48014 48490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 48487 48693 gene locus_tag LOCUS_30320 48487 48693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 48774 49196 gene locus_tag LOCUS_30330 48774 49196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30330 49243 49716 gene locus_tag LOCUS_30340 49243 49716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30340 49716 49973 gene locus_tag LOCUS_30350 49716 49973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 51170 49998 gene locus_tag LOCUS_30360 51170 49998 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_30360 51353 52900 gene locus_tag LOCUS_30370 51353 52900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 53035 54051 gene locus_tag LOCUS_30380 53035 54051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 54048 54686 gene locus_tag LOCUS_30390 54048 54686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 54849 56339 gene locus_tag LOCUS_30400 54849 56339 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104617363.1 protein_id gnl|my_center|LOCUS_30400 56771 56445 gene locus_tag LOCUS_30410 56771 56445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 56917 58188 gene locus_tag LOCUS_30420 56917 58188 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014066.1 protein_id gnl|my_center|LOCUS_30420 58875 58348 gene locus_tag LOCUS_30430 58875 58348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30430 59240 58974 gene locus_tag LOCUS_30440 59240 58974 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073326483.1 protein_id gnl|my_center|LOCUS_30440 61186 60011 gene locus_tag LOCUS_30450 61186 60011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 63444 61243 gene locus_tag LOCUS_30460 63444 61243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 64168 63458 gene locus_tag LOCUS_30470 64168 63458 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216900.1 protein_id gnl|my_center|LOCUS_30470 65130 65327 gene locus_tag LOCUS_30480 65130 65327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 66379 65633 gene locus_tag LOCUS_30490 66379 65633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 67553 66501 gene locus_tag LOCUS_30500 67553 66501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 68475 67546 gene locus_tag LOCUS_30510 68475 67546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 68998 69171 gene locus_tag LOCUS_30520 68998 69171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 70659 71942 gene locus_tag LOCUS_30530 70659 71942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 73343 74491 gene locus_tag LOCUS_30540 73343 74491 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_30540 75551 74541 gene locus_tag LOCUS_30550 75551 74541 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942886.1 protein_id gnl|my_center|LOCUS_30550 76718 75606 gene locus_tag LOCUS_30560 76718 75606 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388688.1 protein_id gnl|my_center|LOCUS_30560 77763 76723 gene locus_tag LOCUS_30570 gene arnB 77763 76723 CDS product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112882.1 protein_id gnl|my_center|LOCUS_30570 79934 78663 gene locus_tag LOCUS_30580 79934 78663 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289498.1 protein_id gnl|my_center|LOCUS_30580 80221 81042 gene locus_tag LOCUS_30590 80221 81042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 81154 81720 gene locus_tag LOCUS_30600 gene rfbC 81154 81720 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385393.1 protein_id gnl|my_center|LOCUS_30600 81735 82787 gene locus_tag LOCUS_30610 gene rfbB 81735 82787 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921456.1 protein_id gnl|my_center|LOCUS_30610 82787 83689 gene locus_tag LOCUS_30620 gene rfbD 82787 83689 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919024.1 protein_id gnl|my_center|LOCUS_30620 83686 84552 gene locus_tag LOCUS_30630 gene rfbA 83686 84552 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904719.1 protein_id gnl|my_center|LOCUS_30630 84847 84584 gene locus_tag LOCUS_30640 84847 84584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 85497 84844 gene locus_tag LOCUS_30650 85497 84844 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919411.1 protein_id gnl|my_center|LOCUS_30650 86563 85679 gene locus_tag LOCUS_30660 86563 85679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 87975 87016 gene locus_tag LOCUS_30670 87975 87016 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148265485.1 protein_id gnl|my_center|LOCUS_30670 88463 88170 gene locus_tag LOCUS_30680 88463 88170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 89466 88504 gene locus_tag LOCUS_30690 89466 88504 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_30690 90281 89532 gene locus_tag LOCUS_30700 90281 89532 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 protein_id gnl|my_center|LOCUS_30700 90577 91620 gene locus_tag LOCUS_30710 90577 91620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 91738 92142 gene locus_tag LOCUS_30720 91738 92142 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176526623.1 protein_id gnl|my_center|LOCUS_30720 92494 92246 gene locus_tag LOCUS_30730 92494 92246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 92956 92525 gene locus_tag LOCUS_30740 92956 92525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 93154 94506 gene locus_tag LOCUS_30750 93154 94506 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339198.1 protein_id gnl|my_center|LOCUS_30750 94667 94855 gene locus_tag LOCUS_30760 94667 94855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 94831 95547 gene locus_tag LOCUS_30770 94831 95547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 95567 96802 gene locus_tag LOCUS_30780 95567 96802 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_30780 97785 96799 gene locus_tag LOCUS_30790 97785 96799 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313891.1 protein_id gnl|my_center|LOCUS_30790 97913 98263 gene locus_tag LOCUS_30800 97913 98263 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530007.1 protein_id gnl|my_center|LOCUS_30800 98425 98703 gene locus_tag LOCUS_30810 98425 98703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30810 98754 98948 gene locus_tag LOCUS_30820 98754 98948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 >Feature sequence038 797 336 gene locus_tag LOCUS_30830 gene greA 797 336 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920063.1 protein_id gnl|my_center|LOCUS_30830 1011 2750 gene locus_tag LOCUS_30840 1011 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 4162 2945 gene locus_tag LOCUS_30850 gene pyrC 4162 2945 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338650.1 protein_id gnl|my_center|LOCUS_30850 5142 4159 gene locus_tag LOCUS_30860 5142 4159 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971534.1 protein_id gnl|my_center|LOCUS_30860 6635 5187 gene locus_tag LOCUS_30870 6635 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 9342 6841 gene locus_tag LOCUS_30880 9342 6841 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918608.1 protein_id gnl|my_center|LOCUS_30880 10081 9617 gene locus_tag LOCUS_30890 gene ruvX 10081 9617 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719835.1 protein_id gnl|my_center|LOCUS_30890 11229 10081 gene locus_tag LOCUS_30900 11229 10081 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_30900 11323 11610 gene locus_tag LOCUS_30910 gene gatC 11323 11610 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533050.1 protein_id gnl|my_center|LOCUS_30910 11610 13091 gene locus_tag LOCUS_30920 gene gatA 11610 13091 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920295.1 protein_id gnl|my_center|LOCUS_30920 13085 13501 gene locus_tag LOCUS_30930 13085 13501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 13498 14979 gene locus_tag LOCUS_30940 gene gatB 13498 14979 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533056.1 protein_id gnl|my_center|LOCUS_30940 15489 15247 gene locus_tag LOCUS_30950 15489 15247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 15659 15501 gene locus_tag LOCUS_30960 15659 15501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 15782 15866 gene locus_tag LOCUS_t00470 15782 15866 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15927 17579 gene locus_tag LOCUS_30970 gene tig 15927 17579 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971784.1 protein_id gnl|my_center|LOCUS_30970 17884 18816 gene locus_tag LOCUS_30980 17884 18816 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_30980 20192 18780 gene locus_tag LOCUS_30990 20192 18780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 20364 21053 gene locus_tag LOCUS_31000 gene clpP 20364 21053 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389425.1 protein_id gnl|my_center|LOCUS_31000 21166 22437 gene locus_tag LOCUS_31010 gene clpX 21166 22437 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919827.1 protein_id gnl|my_center|LOCUS_31010 22527 23117 gene locus_tag LOCUS_31020 22527 23117 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729926.1 protein_id gnl|my_center|LOCUS_31020 23294 24013 gene locus_tag LOCUS_31030 23294 24013 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084101.1 protein_id gnl|my_center|LOCUS_31030 >Feature sequence039 >Feature sequence040 >Feature sequence041 >Feature sequence042 52 261 gene locus_tag LOCUS_31040 52 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 >Feature sequence043 >Feature sequence044 >Feature sequence045 >Feature sequence046 1712 300 gene locus_tag LOCUS_31050 gene tagH 1712 300 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147054.1 protein_id gnl|my_center|LOCUS_31050 3782 1749 gene locus_tag LOCUS_31060 gene vgrG1a 3782 1749 CDS product type VI secretion system spike protein VgrG1a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895494.1 protein_id gnl|my_center|LOCUS_31060 4013 4744 gene locus_tag LOCUS_31070 4013 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 4759 5757 gene locus_tag LOCUS_31080 gene tssA 4759 5757 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115054.1 protein_id gnl|my_center|LOCUS_31080 5825 6373 gene locus_tag LOCUS_31090 gene tssB 5825 6373 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366559.1 protein_id gnl|my_center|LOCUS_31090 6401 7897 gene locus_tag LOCUS_31100 gene tssC 6401 7897 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096181.1 protein_id gnl|my_center|LOCUS_31100 7942 8436 gene locus_tag LOCUS_31110 gene hcp 7942 8436 CDS product type VI secretion system receptor/chaperone Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083670.1 protein_id gnl|my_center|LOCUS_31110 8496 9293 gene locus_tag LOCUS_31120 gene tagJ 8496 9293 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119488.1 protein_id gnl|my_center|LOCUS_31120 9302 9835 gene locus_tag LOCUS_31130 9302 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 9828 11708 gene locus_tag LOCUS_31140 gene tssF 9828 11708 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115055.1 protein_id gnl|my_center|LOCUS_31140 11672 12679 gene locus_tag LOCUS_31150 gene tssG 11672 12679 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086369.1 protein_id gnl|my_center|LOCUS_31150 12705 13622 gene locus_tag LOCUS_31160 12705 13622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 13619 14137 gene locus_tag LOCUS_31170 13619 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 14175 15092 gene locus_tag LOCUS_31180 14175 15092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 15180 17828 gene locus_tag LOCUS_31190 gene tssH 15180 17828 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096191.1 protein_id gnl|my_center|LOCUS_31190 18096 18581 gene locus_tag LOCUS_31200 18096 18581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 18677 20413 gene locus_tag LOCUS_31210 18677 20413 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640015.1 protein_id gnl|my_center|LOCUS_31210 20423 29791 gene locus_tag LOCUS_31220 20423 29791 CDS product autotransporter-associated beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104543246.1 protein_id gnl|my_center|LOCUS_31220 29788 32910 gene locus_tag LOCUS_31230 29788 32910 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918488.1 protein_id gnl|my_center|LOCUS_31230 32907 33776 gene locus_tag LOCUS_31240 32907 33776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 34572 33700 gene locus_tag LOCUS_31250 34572 33700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 34994 34587 gene locus_tag LOCUS_31260 34994 34587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 36403 35063 gene locus_tag LOCUS_31270 36403 35063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 36582 37886 gene locus_tag LOCUS_31280 gene tssK 36582 37886 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548748.1 protein_id gnl|my_center|LOCUS_31280 37883 39250 gene locus_tag LOCUS_31290 37883 39250 CDS product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808318.1 protein_id gnl|my_center|LOCUS_31290 39250 42753 gene locus_tag LOCUS_31300 gene tssM 39250 42753 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 protein_id gnl|my_center|LOCUS_31300 42750 43196 gene locus_tag LOCUS_31310 42750 43196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 43193 43948 gene locus_tag LOCUS_31320 gene pppA 43193 43948 CDS product serine/threonine phosphatase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 protein_id gnl|my_center|LOCUS_31320 43945 45753 gene locus_tag LOCUS_31330 43945 45753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 45839 45763 gene locus_tag LOCUS_t00480 45839 45763 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45921 46655 gene locus_tag LOCUS_31340 45921 46655 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_31340 47873 47205 gene locus_tag LOCUS_31350 gene purQ 47873 47205 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532129.1 protein_id gnl|my_center|LOCUS_31350 48103 47873 gene locus_tag LOCUS_31360 gene purS 48103 47873 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383889.1 protein_id gnl|my_center|LOCUS_31360 48882 48103 gene locus_tag LOCUS_31370 48882 48103 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975652.1 protein_id gnl|my_center|LOCUS_31370 49048 49230 gene locus_tag LOCUS_31380 49048 49230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 49250 49978 gene locus_tag LOCUS_31390 49250 49978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 50041 52293 gene locus_tag LOCUS_31400 gene parC 50041 52293 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389601.1 protein_id gnl|my_center|LOCUS_31400 52417 54087 gene locus_tag LOCUS_31410 52417 54087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 55235 54078 gene locus_tag LOCUS_31420 55235 54078 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265544.1 protein_id gnl|my_center|LOCUS_31420 55816 55226 gene locus_tag LOCUS_31430 55816 55226 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969880.1 protein_id gnl|my_center|LOCUS_31430 56379 55813 gene locus_tag LOCUS_31440 56379 55813 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918294.1 protein_id gnl|my_center|LOCUS_31440 56939 56388 gene locus_tag LOCUS_31450 56939 56388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 57050 57418 gene locus_tag LOCUS_31460 57050 57418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 57424 57711 gene locus_tag LOCUS_31470 57424 57711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 58592 57687 gene locus_tag LOCUS_31480 58592 57687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 58808 59488 gene locus_tag LOCUS_31490 58808 59488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 59542 60342 gene locus_tag LOCUS_31500 59542 60342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 60443 60916 gene locus_tag LOCUS_31510 60443 60916 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_31510 60952 61377 gene locus_tag LOCUS_31520 60952 61377 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 protein_id gnl|my_center|LOCUS_31520 61956 62315 gene locus_tag LOCUS_31530 61956 62315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 63286 62732 gene locus_tag LOCUS_31540 gene dcd 63286 62732 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554836.1 protein_id gnl|my_center|LOCUS_31540 63409 64179 gene locus_tag LOCUS_31550 63409 64179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 64833 64375 gene locus_tag LOCUS_31560 64833 64375 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_31560 65504 64830 gene locus_tag LOCUS_31570 65504 64830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 65986 65504 gene locus_tag LOCUS_31580 65986 65504 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530198.1 protein_id gnl|my_center|LOCUS_31580 66084 67577 gene locus_tag LOCUS_31590 66084 67577 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337085.1 protein_id gnl|my_center|LOCUS_31590 67676 68341 gene locus_tag LOCUS_31600 67676 68341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 68368 69087 gene locus_tag LOCUS_31610 68368 69087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 68972 69385 gene locus_tag LOCUS_31620 68972 69385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 70213 69467 gene locus_tag LOCUS_31630 70213 69467 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529564.1 protein_id gnl|my_center|LOCUS_31630 70664 70206 gene locus_tag LOCUS_31640 70664 70206 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244790.1 protein_id gnl|my_center|LOCUS_31640 72282 70657 gene locus_tag LOCUS_31650 72282 70657 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975275.1 protein_id gnl|my_center|LOCUS_31650 72589 72293 gene locus_tag LOCUS_31660 72589 72293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 73413 72586 gene locus_tag LOCUS_31670 73413 72586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 73555 76584 gene locus_tag LOCUS_31680 73555 76584 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_31680 78062 76629 gene locus_tag LOCUS_31690 gene astD 78062 76629 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918469.1 protein_id gnl|my_center|LOCUS_31690 79581 78205 gene locus_tag LOCUS_31700 79581 78205 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345479.1 protein_id gnl|my_center|LOCUS_31700 79661 80479 gene locus_tag LOCUS_31710 79661 80479 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 protein_id gnl|my_center|LOCUS_31710 80690 81826 gene locus_tag LOCUS_31720 80690 81826 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626518.1 protein_id gnl|my_center|LOCUS_31720 81919 83322 gene locus_tag LOCUS_31730 81919 83322 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_31730 83575 83384 gene locus_tag LOCUS_31740 83575 83384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 85078 84080 gene locus_tag LOCUS_31750 85078 84080 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 protein_id gnl|my_center|LOCUS_31750 85229 85717 gene locus_tag LOCUS_31760 85229 85717 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214555.1 protein_id gnl|my_center|LOCUS_31760 87116 85935 gene locus_tag LOCUS_31770 87116 85935 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918779.1 protein_id gnl|my_center|LOCUS_31770 87210 87986 gene locus_tag LOCUS_31780 87210 87986 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639900.1 protein_id gnl|my_center|LOCUS_31780 87983 88414 gene locus_tag LOCUS_31790 87983 88414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 88505 90736 gene locus_tag LOCUS_31800 88505 90736 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626303.1 protein_id gnl|my_center|LOCUS_31800 90736 94971 gene locus_tag LOCUS_31810 90736 94971 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640286.1 protein_id gnl|my_center|LOCUS_31810 95178 96347 gene locus_tag LOCUS_31820 gene argE 95178 96347 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921458.1 protein_id gnl|my_center|LOCUS_31820 96652 97968 gene locus_tag LOCUS_31830 96652 97968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 97955 100366 gene locus_tag LOCUS_31840 97955 100366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 100430 100819 gene locus_tag LOCUS_31850 100430 100819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 101710 100820 gene locus_tag LOCUS_31860 101710 100820 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388494.1 protein_id gnl|my_center|LOCUS_31860 101723 102472 gene locus_tag LOCUS_31870 101723 102472 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_31870 102453 102761 gene locus_tag LOCUS_31880 gene grxC 102453 102761 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024389.1 protein_id gnl|my_center|LOCUS_31880 102758 103582 gene locus_tag LOCUS_31890 102758 103582 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388497.1 protein_id gnl|my_center|LOCUS_31890 103579 104010 gene locus_tag LOCUS_31900 103579 104010 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918712.1 protein_id gnl|my_center|LOCUS_31900 104068 104144 gene locus_tag LOCUS_t00490 104068 104144 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 104373 106244 gene locus_tag LOCUS_31910 104373 106244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 106927 106475 gene locus_tag LOCUS_31920 106927 106475 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920913.1 protein_id gnl|my_center|LOCUS_31920 107852 106992 gene locus_tag LOCUS_31930 gene asd 107852 106992 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089371.1 protein_id gnl|my_center|LOCUS_31930 107891 109567 gene locus_tag LOCUS_31940 107891 109567 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089372.1 protein_id gnl|my_center|LOCUS_31940 110394 109771 gene locus_tag LOCUS_31950 110394 109771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089373.1 protein_id gnl|my_center|LOCUS_31950 111056 110391 gene locus_tag LOCUS_31960 111056 110391 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089374.1 protein_id gnl|my_center|LOCUS_31960 112676 111327 gene locus_tag LOCUS_31970 112676 111327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 112851 113276 gene locus_tag LOCUS_31980 112851 113276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 113593 113333 gene locus_tag LOCUS_31990 113593 113333 CDS product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 protein_id gnl|my_center|LOCUS_31990 113853 113650 gene locus_tag LOCUS_32000 113853 113650 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339146.1 protein_id gnl|my_center|LOCUS_32000 113961 115073 gene locus_tag LOCUS_32010 113961 115073 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088955.1 protein_id gnl|my_center|LOCUS_32010 115073 115459 gene locus_tag LOCUS_32020 115073 115459 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491259.1 protein_id gnl|my_center|LOCUS_32020 115459 115842 gene locus_tag LOCUS_32030 115459 115842 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974762.1 protein_id gnl|my_center|LOCUS_32030 115839 116699 gene locus_tag LOCUS_32040 gene purU 115839 116699 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388314.1 protein_id gnl|my_center|LOCUS_32040 116696 117538 gene locus_tag LOCUS_32050 gene fghA 116696 117538 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088926.1 protein_id gnl|my_center|LOCUS_32050 117799 118425 gene locus_tag LOCUS_32060 gene folE 117799 118425 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945065.1 protein_id gnl|my_center|LOCUS_32060 118422 119168 gene locus_tag LOCUS_32070 118422 119168 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194458.1 protein_id gnl|my_center|LOCUS_32070 119165 119518 gene locus_tag LOCUS_32080 119165 119518 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 protein_id gnl|my_center|LOCUS_32080 119778 121232 gene locus_tag LOCUS_32090 119778 121232 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035575.1 protein_id gnl|my_center|LOCUS_32090 122045 121236 gene locus_tag LOCUS_32100 122045 121236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 123842 122184 gene locus_tag LOCUS_32110 gene leuA 123842 122184 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389215.1 protein_id gnl|my_center|LOCUS_32110 124136 124537 gene locus_tag LOCUS_32120 124136 124537 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 protein_id gnl|my_center|LOCUS_32120 125188 124583 gene locus_tag LOCUS_32130 125188 124583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 126521 125502 gene locus_tag LOCUS_32140 gene ilvC 126521 125502 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919981.1 protein_id gnl|my_center|LOCUS_32140 127104 126589 gene locus_tag LOCUS_32150 gene ilvN 127104 126589 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_32150 128988 127243 gene locus_tag LOCUS_32160 128988 127243 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640408.1 protein_id gnl|my_center|LOCUS_32160 130007 129075 gene locus_tag LOCUS_32170 gene miaA 130007 129075 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089244.1 protein_id gnl|my_center|LOCUS_32170 130006 130890 gene locus_tag LOCUS_32180 gene serB 130006 130890 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089245.1 protein_id gnl|my_center|LOCUS_32180 131962 130925 gene locus_tag LOCUS_32190 131962 130925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 132151 133458 gene locus_tag LOCUS_32200 132151 133458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 134689 133502 gene locus_tag LOCUS_32210 134689 133502 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 protein_id gnl|my_center|LOCUS_32210 >Feature sequence047 >Feature sequence048 >Feature sequence049 >Feature sequence050 >Feature sequence051 >Feature sequence052 >Feature sequence053 >Feature sequence054 >Feature sequence055 >Feature sequence056 >Feature sequence057 1375 245 gene locus_tag LOCUS_32220 1375 245 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969253.1 protein_id gnl|my_center|LOCUS_32220 2072 1596 gene locus_tag LOCUS_32230 2072 1596 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467599.1 protein_id gnl|my_center|LOCUS_32230 2720 2094 gene locus_tag LOCUS_32240 2720 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 2959 2717 gene locus_tag LOCUS_32250 2959 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 3038 3388 gene locus_tag LOCUS_32260 gene divK 3038 3388 CDS product cell-cycle response regulator DivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640499.1 protein_id gnl|my_center|LOCUS_32260 4854 3634 gene locus_tag LOCUS_32270 4854 3634 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721701.1 protein_id gnl|my_center|LOCUS_32270 5015 5389 gene locus_tag LOCUS_32280 5015 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 7518 6151 gene locus_tag LOCUS_32290 7518 6151 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919215.1 protein_id gnl|my_center|LOCUS_32290 7871 7533 gene locus_tag LOCUS_32300 7871 7533 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529649.1 protein_id gnl|my_center|LOCUS_32300 8097 8873 gene locus_tag LOCUS_32310 gene focA 8097 8873 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705812.1 protein_id gnl|my_center|LOCUS_32310 10438 9005 gene locus_tag LOCUS_32320 gene tldD 10438 9005 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_32320 11121 10888 gene locus_tag LOCUS_32330 11121 10888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 11211 12143 gene locus_tag LOCUS_32340 11211 12143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387830.1 protein_id gnl|my_center|LOCUS_32340 13130 12444 gene locus_tag LOCUS_32350 13130 12444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 13314 14891 gene locus_tag LOCUS_32360 gene nadB 13314 14891 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764756.1 protein_id gnl|my_center|LOCUS_32360 15154 16269 gene locus_tag LOCUS_32370 gene bla 15154 16269 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975615.1 protein_id gnl|my_center|LOCUS_32370 16752 19526 gene locus_tag LOCUS_32380 gene polA 16752 19526 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338672.1 protein_id gnl|my_center|LOCUS_32380 19717 21231 gene locus_tag LOCUS_32390 19717 21231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 22979 21360 gene locus_tag LOCUS_32400 gene purH 22979 21360 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721490.1 protein_id gnl|my_center|LOCUS_32400 24903 23161 gene locus_tag LOCUS_32410 24903 23161 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529012.1 protein_id gnl|my_center|LOCUS_32410 25565 24909 gene locus_tag LOCUS_32420 gene rpe 25565 24909 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639879.1 protein_id gnl|my_center|LOCUS_32420 26942 25599 gene locus_tag LOCUS_32430 26942 25599 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_32430 27011 27172 gene locus_tag LOCUS_32440 27011 27172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 28292 27393 gene locus_tag LOCUS_32450 gene argB 28292 27393 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391088.1 protein_id gnl|my_center|LOCUS_32450 29005 28352 gene locus_tag LOCUS_32460 29005 28352 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015968.1 protein_id gnl|my_center|LOCUS_32460 29289 30698 gene locus_tag LOCUS_32470 29289 30698 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921072.1 protein_id gnl|my_center|LOCUS_32470 31079 30720 gene locus_tag LOCUS_32480 31079 30720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 31996 31232 gene locus_tag LOCUS_32490 31996 31232 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265913.1 protein_id gnl|my_center|LOCUS_32490 32211 32534 gene locus_tag LOCUS_32500 32211 32534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 32947 32603 gene locus_tag LOCUS_32510 32947 32603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 33200 34291 gene locus_tag LOCUS_32520 33200 34291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 35033 34419 gene locus_tag LOCUS_32530 35033 34419 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123659.1 protein_id gnl|my_center|LOCUS_32530 34987 35232 gene locus_tag LOCUS_32540 34987 35232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 35180 35500 gene locus_tag LOCUS_32550 35180 35500 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104566.1 protein_id gnl|my_center|LOCUS_32550 37942 35651 gene locus_tag LOCUS_32560 37942 35651 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021816.1 protein_id gnl|my_center|LOCUS_32560 38206 39096 gene locus_tag LOCUS_32570 38206 39096 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071711.1 protein_id gnl|my_center|LOCUS_32570 39500 39333 gene locus_tag LOCUS_32580 gene rpmG 39500 39333 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006201775.1 protein_id gnl|my_center|LOCUS_32580 39708 40046 gene locus_tag LOCUS_32590 39708 40046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 40047 40616 gene locus_tag LOCUS_32600 40047 40616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 40730 41227 gene locus_tag LOCUS_32610 40730 41227 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966677.1 protein_id gnl|my_center|LOCUS_32610 41328 41660 gene locus_tag LOCUS_32620 41328 41660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 42002 42469 gene locus_tag LOCUS_32630 42002 42469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_32630 42537 42722 gene locus_tag LOCUS_32640 42537 42722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 42730 44322 gene locus_tag LOCUS_32650 42730 44322 CDS product cisplatin damage response ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527948.1 protein_id gnl|my_center|LOCUS_32650 45741 44461 gene locus_tag LOCUS_32660 gene murA 45741 44461 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720800.1 protein_id gnl|my_center|LOCUS_32660 45945 46679 gene locus_tag LOCUS_32670 45945 46679 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339467.1 protein_id gnl|my_center|LOCUS_32670 47149 46808 gene locus_tag LOCUS_32680 47149 46808 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640610.1 protein_id gnl|my_center|LOCUS_32680 49472 47211 gene locus_tag LOCUS_32690 gene katG 49472 47211 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268890.1 protein_id gnl|my_center|LOCUS_32690 49804 50736 gene locus_tag LOCUS_32700 49804 50736 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768828.1 protein_id gnl|my_center|LOCUS_32700 51325 50870 gene locus_tag LOCUS_32710 51325 50870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 54862 51569 gene locus_tag LOCUS_32720 54862 51569 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921044.1 protein_id gnl|my_center|LOCUS_32720 56563 55010 gene locus_tag LOCUS_32730 56563 55010 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921433.1 protein_id gnl|my_center|LOCUS_32730 57215 56454 gene locus_tag LOCUS_32740 57215 56454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 57347 57421 gene locus_tag LOCUS_t00500 57347 57421 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 57874 58824 gene locus_tag LOCUS_32750 57874 58824 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498063.1 protein_id gnl|my_center|LOCUS_32750 58996 61134 gene locus_tag LOCUS_32760 58996 61134 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368623.1 protein_id gnl|my_center|LOCUS_32760 61263 61679 gene locus_tag LOCUS_32770 61263 61679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368627.1 protein_id gnl|my_center|LOCUS_32770 61676 61939 gene locus_tag LOCUS_32780 61676 61939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 61936 62232 gene locus_tag LOCUS_32790 61936 62232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368624.1 protein_id gnl|my_center|LOCUS_32790 62395 66702 gene locus_tag LOCUS_32800 62395 66702 CDS product strawberry notch family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368629.1 protein_id gnl|my_center|LOCUS_32800 66702 67739 gene locus_tag LOCUS_32810 66702 67739 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368630.1 protein_id gnl|my_center|LOCUS_32810 68087 69013 gene locus_tag LOCUS_32820 68087 69013 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538225.1 protein_id gnl|my_center|LOCUS_32820 69376 69023 gene locus_tag LOCUS_32830 69376 69023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 69707 69874 gene locus_tag LOCUS_32840 69707 69874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368625.1 protein_id gnl|my_center|LOCUS_32840 69959 70447 gene locus_tag LOCUS_32850 69959 70447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368632.1 protein_id gnl|my_center|LOCUS_32850 71113 70874 gene locus_tag LOCUS_32860 71113 70874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 71022 71348 gene locus_tag LOCUS_32870 71022 71348 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368635.1 protein_id gnl|my_center|LOCUS_32870 71669 71935 gene locus_tag LOCUS_32880 71669 71935 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107649648.1 protein_id gnl|my_center|LOCUS_32880 72028 72288 gene locus_tag LOCUS_32890 72028 72288 CDS product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084140443.1 protein_id gnl|my_center|LOCUS_32890 72415 72726 gene locus_tag LOCUS_32900 72415 72726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 72635 73177 gene locus_tag LOCUS_32910 72635 73177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 73312 73593 gene locus_tag LOCUS_32920 73312 73593 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 protein_id gnl|my_center|LOCUS_32920 73611 74768 gene locus_tag LOCUS_32930 73611 74768 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490269.1 protein_id gnl|my_center|LOCUS_32930 74765 75418 gene locus_tag LOCUS_32940 gene parA 74765 75418 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 protein_id gnl|my_center|LOCUS_32940 75415 75666 gene locus_tag LOCUS_32950 75415 75666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082881.1 protein_id gnl|my_center|LOCUS_32950 75663 76184 gene locus_tag LOCUS_32960 75663 76184 CDS product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 protein_id gnl|my_center|LOCUS_32960 76181 76726 gene locus_tag LOCUS_32970 76181 76726 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368397.1 protein_id gnl|my_center|LOCUS_32970 76795 77130 gene locus_tag LOCUS_32980 76795 77130 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082878.1 protein_id gnl|my_center|LOCUS_32980 77200 77910 gene locus_tag LOCUS_32990 77200 77910 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368399.1 protein_id gnl|my_center|LOCUS_32990 78157 79896 gene locus_tag LOCUS_33000 78157 79896 CDS product VirD2 family relaxase/mobilization nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018269524.1 protein_id gnl|my_center|LOCUS_33000 79923 81908 gene locus_tag LOCUS_33010 79923 81908 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018269525.1 protein_id gnl|my_center|LOCUS_33010 81913 82362 gene locus_tag LOCUS_33020 81913 82362 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082874.1 protein_id gnl|my_center|LOCUS_33020 82530 83513 gene locus_tag LOCUS_33030 gene trbB 82530 83513 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 protein_id gnl|my_center|LOCUS_33030 83510 83842 gene locus_tag LOCUS_33040 83510 83842 CDS product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388565.1 protein_id gnl|my_center|LOCUS_33040 83842 84123 gene locus_tag LOCUS_33050 83842 84123 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368410.1 protein_id gnl|my_center|LOCUS_33050 84138 86588 gene locus_tag LOCUS_33060 gene trbE 84138 86588 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 protein_id gnl|my_center|LOCUS_33060 86593 87390 gene locus_tag LOCUS_33070 gene trbJ 86593 87390 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 protein_id gnl|my_center|LOCUS_33070 87401 87685 gene locus_tag LOCUS_33080 gene trbK-alt 87401 87685 CDS product putative entry exclusion protein TrbK-alt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368413.1 protein_id gnl|my_center|LOCUS_33080 87689 89047 gene locus_tag LOCUS_33090 gene trbL 87689 89047 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368414.1 protein_id gnl|my_center|LOCUS_33090 89044 89733 gene locus_tag LOCUS_33100 gene trbF 89044 89733 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 protein_id gnl|my_center|LOCUS_33100 89730 90710 gene locus_tag LOCUS_33110 gene trbG 89730 90710 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368416.1 protein_id gnl|my_center|LOCUS_33110 90707 91894 gene locus_tag LOCUS_33120 90707 91894 CDS product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 protein_id gnl|my_center|LOCUS_33120 91896 92135 gene locus_tag LOCUS_33130 91896 92135 CDS product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 protein_id gnl|my_center|LOCUS_33130 93023 92130 gene locus_tag LOCUS_33140 93023 92130 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368405.1 protein_id gnl|my_center|LOCUS_33140 96208 93167 gene locus_tag LOCUS_33150 96208 93167 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_33150 99275 96477 gene locus_tag LOCUS_33160 99275 96477 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_33160 100543 99272 gene locus_tag LOCUS_33170 100543 99272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 103806 100543 gene locus_tag LOCUS_33180 103806 100543 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_33180 104953 104069 gene locus_tag LOCUS_33190 104953 104069 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008000.1 protein_id gnl|my_center|LOCUS_33190 105177 107831 gene locus_tag LOCUS_33200 105177 107831 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494176.1 protein_id gnl|my_center|LOCUS_33200 107828 111217 gene locus_tag LOCUS_33210 107828 111217 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090811.1 protein_id gnl|my_center|LOCUS_33210 111337 114018 gene locus_tag LOCUS_33220 111337 114018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 114112 115296 gene locus_tag LOCUS_33230 114112 115296 CDS product DUF6361 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804170.1 protein_id gnl|my_center|LOCUS_33230 115286 117142 gene locus_tag LOCUS_33240 115286 117142 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804171.1 protein_id gnl|my_center|LOCUS_33240 117132 120260 gene locus_tag LOCUS_33250 117132 120260 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804172.1 protein_id gnl|my_center|LOCUS_33250 122115 120262 gene locus_tag LOCUS_33260 122115 120262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 123319 122426 gene locus_tag LOCUS_33270 123319 122426 CDS product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974303.1 protein_id gnl|my_center|LOCUS_33270 124205 123327 gene locus_tag LOCUS_33280 124205 123327 CDS product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974304.1 protein_id gnl|my_center|LOCUS_33280 125698 124202 gene locus_tag LOCUS_33290 125698 124202 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338946.1 protein_id gnl|my_center|LOCUS_33290 125844 126260 gene locus_tag LOCUS_33300 125844 126260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974306.1 protein_id gnl|my_center|LOCUS_33300 126411 129068 gene locus_tag LOCUS_33310 126411 129068 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108570.1 protein_id gnl|my_center|LOCUS_33310 >Feature sequence058 >Feature sequence059 >Feature sequence060 >Feature sequence061 >Feature sequence062 417 58 gene locus_tag LOCUS_33320 417 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 >Feature sequence063 >Feature sequence064 >Feature sequence065 >Feature sequence066 >Feature sequence067 >Feature sequence068 312 109 gene locus_tag LOCUS_33330 312 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 632 354 gene locus_tag LOCUS_33340 632 354 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189132.1 protein_id gnl|my_center|LOCUS_33340 631 1749 gene locus_tag LOCUS_33350 631 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 5266 2057 gene locus_tag LOCUS_33360 5266 2057 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525251.1 protein_id gnl|my_center|LOCUS_33360 5902 7587 gene locus_tag LOCUS_33370 5902 7587 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100342827.1 protein_id gnl|my_center|LOCUS_33370 7722 8900 gene locus_tag LOCUS_33380 7722 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 9905 8940 gene locus_tag LOCUS_33390 9905 8940 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970198.1 protein_id gnl|my_center|LOCUS_33390 10095 11369 gene locus_tag LOCUS_33400 10095 11369 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_33400 11366 12253 gene locus_tag LOCUS_33410 11366 12253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 13847 12267 gene locus_tag LOCUS_33420 13847 12267 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920443.1 protein_id gnl|my_center|LOCUS_33420 14060 15490 gene locus_tag LOCUS_33430 14060 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 15583 16521 gene locus_tag LOCUS_33440 15583 16521 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_33440 17125 16592 gene locus_tag LOCUS_33450 17125 16592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 17377 19824 gene locus_tag LOCUS_33460 17377 19824 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_33460 20530 19913 gene locus_tag LOCUS_33470 20530 19913 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_33470 20605 21333 gene locus_tag LOCUS_33480 20605 21333 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_33480 21412 22716 gene locus_tag LOCUS_33490 gene pncB 21412 22716 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085115.1 protein_id gnl|my_center|LOCUS_33490 22977 25946 gene locus_tag LOCUS_33500 22977 25946 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919497.1 protein_id gnl|my_center|LOCUS_33500 25958 26959 gene locus_tag LOCUS_33510 25958 26959 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107223.1 protein_id gnl|my_center|LOCUS_33510 28114 27083 gene locus_tag LOCUS_33520 28114 27083 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640475.1 protein_id gnl|my_center|LOCUS_33520 28222 29496 gene locus_tag LOCUS_33530 28222 29496 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918872.1 protein_id gnl|my_center|LOCUS_33530 29493 31103 gene locus_tag LOCUS_33540 29493 31103 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918873.1 protein_id gnl|my_center|LOCUS_33540 33020 31143 gene locus_tag LOCUS_33550 33020 31143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 36498 33337 gene locus_tag LOCUS_33560 36498 33337 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920672.1 protein_id gnl|my_center|LOCUS_33560 38930 36888 gene locus_tag LOCUS_33570 38930 36888 CDS product alpha-glucuronidase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275545.1 protein_id gnl|my_center|LOCUS_33570 39261 40472 gene locus_tag LOCUS_33580 39261 40472 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920653.1 protein_id gnl|my_center|LOCUS_33580 40474 41793 gene locus_tag LOCUS_33590 40474 41793 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_33590 42444 45821 gene locus_tag LOCUS_33600 gene hsdR 42444 45821 CDS product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147180764.1 protein_id gnl|my_center|LOCUS_33600 45822 47288 gene locus_tag LOCUS_33610 45822 47288 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_33610 47285 48553 gene locus_tag LOCUS_33620 47285 48553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 48558 49484 gene locus_tag LOCUS_33630 48558 49484 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_33630 51827 49899 gene locus_tag LOCUS_33640 51827 49899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 52771 52211 gene locus_tag LOCUS_33650 52771 52211 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969358.1 protein_id gnl|my_center|LOCUS_33650 53853 52771 gene locus_tag LOCUS_33660 gene dinB 53853 52771 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970234.1 protein_id gnl|my_center|LOCUS_33660 54357 54010 gene locus_tag LOCUS_33670 54357 54010 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969002.1 protein_id gnl|my_center|LOCUS_33670 54458 55489 gene locus_tag LOCUS_33680 54458 55489 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969001.1 protein_id gnl|my_center|LOCUS_33680 56134 55529 gene locus_tag LOCUS_33690 56134 55529 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556052.1 protein_id gnl|my_center|LOCUS_33690 56976 56134 gene locus_tag LOCUS_33700 56976 56134 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973698.1 protein_id gnl|my_center|LOCUS_33700 57083 58468 gene locus_tag LOCUS_33710 57083 58468 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531252.1 protein_id gnl|my_center|LOCUS_33710 58955 58740 gene locus_tag LOCUS_33720 58955 58740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 58878 61280 gene locus_tag LOCUS_33730 58878 61280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 61365 62051 gene locus_tag LOCUS_33740 61365 62051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 62756 62091 gene locus_tag LOCUS_33750 62756 62091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 64804 62783 gene locus_tag LOCUS_33760 64804 62783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33760 65441 65749 gene locus_tag LOCUS_33770 65441 65749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 65813 66331 gene locus_tag LOCUS_33780 65813 66331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 66391 66879 gene locus_tag LOCUS_33790 66391 66879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 68981 66993 gene locus_tag LOCUS_33800 68981 66993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 69156 69080 gene locus_tag LOCUS_t00510 69156 69080 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 69411 69241 gene locus_tag LOCUS_33810 69411 69241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 70732 69488 gene locus_tag LOCUS_33820 70732 69488 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_33820 70815 72221 gene locus_tag LOCUS_33830 gene nhaA 70815 72221 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_33830 74443 72218 gene locus_tag LOCUS_33840 gene purL 74443 72218 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388466.1 protein_id gnl|my_center|LOCUS_33840 76012 74501 gene locus_tag LOCUS_33850 gene ubiB 76012 74501 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_33850 76847 76020 gene locus_tag LOCUS_33860 gene map 76847 76020 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920527.1 protein_id gnl|my_center|LOCUS_33860 76862 77668 gene locus_tag LOCUS_33870 76862 77668 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969361.1 protein_id gnl|my_center|LOCUS_33870 77766 78743 gene locus_tag LOCUS_33880 77766 78743 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920236.1 protein_id gnl|my_center|LOCUS_33880 78913 78986 gene locus_tag LOCUS_t00520 78913 78986 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 80024 79020 gene locus_tag LOCUS_33890 80024 79020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 80425 80114 gene locus_tag LOCUS_33900 80425 80114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 81519 80425 gene locus_tag LOCUS_33910 81519 80425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 82339 83499 gene locus_tag LOCUS_33920 82339 83499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 83854 83525 gene locus_tag LOCUS_33930 83854 83525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 >Feature sequence069 >Feature sequence070 >Feature sequence071 >Feature sequence072 >Feature sequence073 >Feature sequence074 >Feature sequence075 >Feature sequence076 >Feature sequence077 88 291 gene locus_tag LOCUS_33940 88 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 >Feature sequence078 >Feature sequence079 1926 373 gene locus_tag LOCUS_33950 gene guaA 1926 373 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397349.1 protein_id gnl|my_center|LOCUS_33950 3849 2059 gene locus_tag LOCUS_33960 3849 2059 CDS product DUF6055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275338.1 protein_id gnl|my_center|LOCUS_33960 4469 4047 gene locus_tag LOCUS_33970 gene rplQ 4469 4047 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088131.1 protein_id gnl|my_center|LOCUS_33970 5780 4716 gene locus_tag LOCUS_33980 5780 4716 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722536.1 protein_id gnl|my_center|LOCUS_33980 6258 5869 gene locus_tag LOCUS_33990 gene rpsK 6258 5869 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919150.1 protein_id gnl|my_center|LOCUS_33990 6720 6352 gene locus_tag LOCUS_34000 gene rpsM 6720 6352 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919149.1 protein_id gnl|my_center|LOCUS_34000 7127 6879 gene locus_tag LOCUS_34010 7127 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 8644 7295 gene locus_tag LOCUS_34020 8644 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 9333 8641 gene locus_tag LOCUS_34030 9333 8641 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_34030 9731 11194 gene locus_tag LOCUS_34040 9731 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 11315 13414 gene locus_tag LOCUS_34050 11315 13414 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972445.1 protein_id gnl|my_center|LOCUS_34050 13994 13743 gene locus_tag LOCUS_34060 13994 13743 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921274.1 protein_id gnl|my_center|LOCUS_34060 14178 13996 gene locus_tag LOCUS_34070 14178 13996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 15653 14178 gene locus_tag LOCUS_34080 gene atpD 15653 14178 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388981.1 protein_id gnl|my_center|LOCUS_34080 16243 15650 gene locus_tag LOCUS_34090 16243 15650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 17118 16243 gene locus_tag LOCUS_34100 17118 16243 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083273.1 protein_id gnl|my_center|LOCUS_34100 17413 17120 gene locus_tag LOCUS_34110 17413 17120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 18946 17417 gene locus_tag LOCUS_34120 gene atpA 18946 17417 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310773.1 protein_id gnl|my_center|LOCUS_34120 19529 18954 gene locus_tag LOCUS_34130 19529 18954 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529035.1 protein_id gnl|my_center|LOCUS_34130 19748 20599 gene locus_tag LOCUS_34140 gene ada 19748 20599 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706139.1 protein_id gnl|my_center|LOCUS_34140 22460 20901 gene locus_tag LOCUS_34150 22460 20901 CDS product DUF1570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918952.1 protein_id gnl|my_center|LOCUS_34150 24068 22554 gene locus_tag LOCUS_34160 24068 22554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 24177 25712 gene locus_tag LOCUS_34170 24177 25712 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011854072.1 protein_id gnl|my_center|LOCUS_34170 26062 25832 gene locus_tag LOCUS_34180 26062 25832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 26535 26059 gene locus_tag LOCUS_34190 26535 26059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 26807 28057 gene locus_tag LOCUS_34200 26807 28057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 28449 28189 gene locus_tag LOCUS_34210 28449 28189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 29021 28464 gene locus_tag LOCUS_34220 29021 28464 CDS product putative peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166765.1 protein_id gnl|my_center|LOCUS_34220 29990 29091 gene locus_tag LOCUS_34230 29990 29091 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640156.1 protein_id gnl|my_center|LOCUS_34230 30537 30124 gene locus_tag LOCUS_34240 30537 30124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 30660 33779 gene locus_tag LOCUS_34250 gene lacZ 30660 33779 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_34250 33776 36043 gene locus_tag LOCUS_34260 33776 36043 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054847.1 protein_id gnl|my_center|LOCUS_34260 36479 36886 gene locus_tag LOCUS_34270 36479 36886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 36883 37893 gene locus_tag LOCUS_34280 gene cobT 36883 37893 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531074.1 protein_id gnl|my_center|LOCUS_34280 37890 38447 gene locus_tag LOCUS_34290 37890 38447 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_34290 38444 39160 gene locus_tag LOCUS_34300 gene cobS 38444 39160 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943638.1 protein_id gnl|my_center|LOCUS_34300 40587 39145 gene locus_tag LOCUS_34310 40587 39145 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919619.1 protein_id gnl|my_center|LOCUS_34310 41525 40587 gene locus_tag LOCUS_34320 gene cbiB 41525 40587 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966031.1 protein_id gnl|my_center|LOCUS_34320 42492 41518 gene locus_tag LOCUS_34330 gene cobD 42492 41518 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972583.1 protein_id gnl|my_center|LOCUS_34330 42535 43059 gene locus_tag LOCUS_34340 gene cobU 42535 43059 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531119.1 protein_id gnl|my_center|LOCUS_34340 43059 43658 gene locus_tag LOCUS_34350 gene cobO 43059 43658 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192682.1 protein_id gnl|my_center|LOCUS_34350 44788 44024 gene locus_tag LOCUS_34360 gene cobF 44788 44024 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086059.1 protein_id gnl|my_center|LOCUS_34360 45510 44785 gene locus_tag LOCUS_34370 gene cobA 45510 44785 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337778.1 protein_id gnl|my_center|LOCUS_34370 46811 45504 gene locus_tag LOCUS_34380 46811 45504 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339112.1 protein_id gnl|my_center|LOCUS_34380 47572 46808 gene locus_tag LOCUS_34390 gene cobM 47572 46808 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086055.1 protein_id gnl|my_center|LOCUS_34390 47919 47569 gene locus_tag LOCUS_34400 47919 47569 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172124.1 protein_id gnl|my_center|LOCUS_34400 49112 47913 gene locus_tag LOCUS_34410 49112 47913 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337775.1 protein_id gnl|my_center|LOCUS_34410 49111 49857 gene locus_tag LOCUS_34420 49111 49857 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337774.1 protein_id gnl|my_center|LOCUS_34420 50582 49833 gene locus_tag LOCUS_34430 gene cobJ 50582 49833 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337773.1 protein_id gnl|my_center|LOCUS_34430 51304 50579 gene locus_tag LOCUS_34440 51304 50579 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174893316.1 protein_id gnl|my_center|LOCUS_34440 51819 51301 gene locus_tag LOCUS_34450 51819 51301 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337771.1 protein_id gnl|my_center|LOCUS_34450 53051 51930 gene locus_tag LOCUS_34460 gene cobG 53051 51930 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086048.1 protein_id gnl|my_center|LOCUS_34460 56368 53048 gene locus_tag LOCUS_34470 gene cobN 56368 53048 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337770.1 protein_id gnl|my_center|LOCUS_34470 57412 56375 gene locus_tag LOCUS_34480 gene cobW 57412 56375 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086046.1 protein_id gnl|my_center|LOCUS_34480 58960 57947 gene locus_tag LOCUS_34490 58960 57947 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266608.1 protein_id gnl|my_center|LOCUS_34490 59575 60051 gene locus_tag LOCUS_34500 59575 60051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 60596 60087 gene locus_tag LOCUS_34510 60596 60087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 60874 60798 gene locus_tag LOCUS_t00530 60874 60798 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 61068 61418 gene locus_tag LOCUS_34520 61068 61418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 61426 63030 gene locus_tag LOCUS_34530 gene secD 61426 63030 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087503.1 protein_id gnl|my_center|LOCUS_34530 63047 64027 gene locus_tag LOCUS_34540 gene secF 63047 64027 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087502.1 protein_id gnl|my_center|LOCUS_34540 64037 64423 gene locus_tag LOCUS_34550 64037 64423 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722651.1 protein_id gnl|my_center|LOCUS_34550 65615 64428 gene locus_tag LOCUS_34560 65615 64428 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_34560 >Feature sequence080 >Feature sequence081 >Feature sequence082 >Feature sequence083 >Feature sequence084 >Feature sequence085 >Feature sequence086 >Feature sequence087 309 121 gene locus_tag LOCUS_34570 309 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 >Feature sequence088 >Feature sequence089 >Feature sequence090 277 1716 gene locus_tag LOCUS_34580 277 1716 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_34580 2683 1859 gene locus_tag LOCUS_34590 2683 1859 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388679.1 protein_id gnl|my_center|LOCUS_34590 2876 3811 gene locus_tag LOCUS_34600 2876 3811 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640381.1 protein_id gnl|my_center|LOCUS_34600 4043 5707 gene locus_tag LOCUS_34610 gene recN 4043 5707 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530966.1 protein_id gnl|my_center|LOCUS_34610 5798 6019 gene locus_tag LOCUS_34620 5798 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 6084 8216 gene locus_tag LOCUS_34630 gene ligA 6084 8216 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242938.1 protein_id gnl|my_center|LOCUS_34630 8478 11000 gene locus_tag LOCUS_34640 8478 11000 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265514.1 protein_id gnl|my_center|LOCUS_34640 11203 10946 gene locus_tag LOCUS_34650 11203 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 11118 12257 gene locus_tag LOCUS_34660 11118 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 12254 13051 gene locus_tag LOCUS_34670 12254 13051 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34670 13911 13279 gene locus_tag LOCUS_34680 gene queE 13911 13279 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920995.1 protein_id gnl|my_center|LOCUS_34680 14593 13916 gene locus_tag LOCUS_34690 gene queC 14593 13916 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038130.1 protein_id gnl|my_center|LOCUS_34690 15692 14841 gene locus_tag LOCUS_34700 15692 14841 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388398.1 protein_id gnl|my_center|LOCUS_34700 15764 16408 gene locus_tag LOCUS_34710 15764 16408 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337151.1 protein_id gnl|my_center|LOCUS_34710 17484 16624 gene locus_tag LOCUS_34720 17484 16624 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035708.1 protein_id gnl|my_center|LOCUS_34720 17635 19614 gene locus_tag LOCUS_34730 gene parE 17635 19614 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390520.1 protein_id gnl|my_center|LOCUS_34730 19731 20891 gene locus_tag LOCUS_34740 19731 20891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 21032 22222 gene locus_tag LOCUS_34750 21032 22222 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918471.1 protein_id gnl|my_center|LOCUS_34750 22277 23200 gene locus_tag LOCUS_34760 gene argF 22277 23200 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920103.1 protein_id gnl|my_center|LOCUS_34760 23318 24232 gene locus_tag LOCUS_34770 23318 24232 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920102.1 protein_id gnl|my_center|LOCUS_34770 25177 24398 gene locus_tag LOCUS_34780 gene gcvA 25177 24398 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640150.1 protein_id gnl|my_center|LOCUS_34780 25572 25174 gene locus_tag LOCUS_34790 gene apaG 25572 25174 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085085.1 protein_id gnl|my_center|LOCUS_34790 26777 25569 gene locus_tag LOCUS_34800 26777 25569 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974345.1 protein_id gnl|my_center|LOCUS_34800 26929 27234 gene locus_tag LOCUS_34810 26929 27234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 27355 28599 gene locus_tag LOCUS_34820 27355 28599 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085199.1 protein_id gnl|my_center|LOCUS_34820 29709 28609 gene locus_tag LOCUS_34830 29709 28609 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 protein_id gnl|my_center|LOCUS_34830 30758 29715 gene locus_tag LOCUS_34840 gene leuB 30758 29715 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812648.1 protein_id gnl|my_center|LOCUS_34840 31544 30813 gene locus_tag LOCUS_34850 gene recO 31544 30813 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722424.1 protein_id gnl|my_center|LOCUS_34850 31679 32686 gene locus_tag LOCUS_34860 31679 32686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 34638 32719 gene locus_tag LOCUS_34870 gene uvrC 34638 32719 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389875.1 protein_id gnl|my_center|LOCUS_34870 35189 34869 gene locus_tag LOCUS_34880 gene sugE 35189 34869 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118482.1 protein_id gnl|my_center|LOCUS_34880 36275 35613 gene locus_tag LOCUS_34890 36275 35613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 36762 36268 gene locus_tag LOCUS_34900 36762 36268 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563084.1 protein_id gnl|my_center|LOCUS_34900 37053 36826 gene locus_tag LOCUS_34910 37053 36826 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006206606.1 protein_id gnl|my_center|LOCUS_34910 37943 37134 gene locus_tag LOCUS_34920 37943 37134 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390994.1 protein_id gnl|my_center|LOCUS_34920 38276 37959 gene locus_tag LOCUS_34930 38276 37959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 39651 39968 gene locus_tag LOCUS_34940 39651 39968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 39982 40500 gene locus_tag LOCUS_34950 39982 40500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 40948 40580 gene locus_tag LOCUS_34960 40948 40580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 41139 40960 gene locus_tag LOCUS_34970 41139 40960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 44348 41178 gene locus_tag LOCUS_34980 44348 41178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 44473 45162 gene locus_tag LOCUS_34990 44473 45162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 45413 45988 gene locus_tag LOCUS_35000 gene pth 45413 45988 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338521.1 protein_id gnl|my_center|LOCUS_35000 45985 46587 gene locus_tag LOCUS_35010 45985 46587 CDS product TIGR02466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_35010 46751 46945 gene locus_tag LOCUS_35020 46751 46945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 47168 48268 gene locus_tag LOCUS_35030 gene ychF 47168 48268 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391495.1 protein_id gnl|my_center|LOCUS_35030 48421 48200 gene locus_tag LOCUS_35040 48421 48200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 48395 48739 gene locus_tag LOCUS_35050 48395 48739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 48845 50158 gene locus_tag LOCUS_35060 48845 50158 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640195.1 protein_id gnl|my_center|LOCUS_35060 50169 50618 gene locus_tag LOCUS_35070 50169 50618 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967283.1 protein_id gnl|my_center|LOCUS_35070 51414 50911 gene locus_tag LOCUS_35080 51414 50911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 51725 52318 gene locus_tag LOCUS_35090 gene petA 51725 52318 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639988.1 protein_id gnl|my_center|LOCUS_35090 52333 53631 gene locus_tag LOCUS_35100 52333 53631 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534151.1 protein_id gnl|my_center|LOCUS_35100 53658 54506 gene locus_tag LOCUS_35110 53658 54506 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599373.1 protein_id gnl|my_center|LOCUS_35110 >Feature sequence091 <1 289 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgcaatctctgagcggctatgctc >Feature sequence092 >Feature sequence093 >Feature sequence094 >Feature sequence095 >Feature sequence096 >Feature sequence097 >Feature sequence098 >Feature sequence099 280 59 gene locus_tag LOCUS_35120 280 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 >Feature sequence100 >Feature sequence101 312 512 gene locus_tag LOCUS_35130 312 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 539 703 gene locus_tag LOCUS_35140 539 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 969 634 gene locus_tag LOCUS_35150 969 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35150 1385 969 gene locus_tag LOCUS_35160 1385 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35160 2532 1726 gene locus_tag LOCUS_35170 2532 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 5099 2529 gene locus_tag LOCUS_35180 5099 2529 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146536093.1 protein_id gnl|my_center|LOCUS_35180 6157 5165 gene locus_tag LOCUS_35190 6157 5165 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 protein_id gnl|my_center|LOCUS_35190 7873 7466 gene locus_tag LOCUS_35200 gene cadR 7873 7466 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405262.1 protein_id gnl|my_center|LOCUS_35200 8054 8383 gene locus_tag LOCUS_35210 8054 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 8437 9714 gene locus_tag LOCUS_35220 8437 9714 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 protein_id gnl|my_center|LOCUS_35220 9714 10880 gene locus_tag LOCUS_35230 9714 10880 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920568.1 protein_id gnl|my_center|LOCUS_35230 10884 14129 gene locus_tag LOCUS_35240 10884 14129 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007003880.1 protein_id gnl|my_center|LOCUS_35240 14184 14672 gene locus_tag LOCUS_35250 14184 14672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 14669 15043 gene locus_tag LOCUS_35260 14669 15043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 15089 15430 gene locus_tag LOCUS_35270 15089 15430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 15462 16346 gene locus_tag LOCUS_35280 15462 16346 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 protein_id gnl|my_center|LOCUS_35280 16400 16738 gene locus_tag LOCUS_35290 16400 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 16742 17428 gene locus_tag LOCUS_35300 16742 17428 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948152.1 protein_id gnl|my_center|LOCUS_35300 17425 18033 gene locus_tag LOCUS_35310 17425 18033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 18030 20531 gene locus_tag LOCUS_35320 18030 20531 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 protein_id gnl|my_center|LOCUS_35320 20528 21448 gene locus_tag LOCUS_35330 20528 21448 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174092.1 protein_id gnl|my_center|LOCUS_35330 21445 22197 gene locus_tag LOCUS_35340 21445 22197 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051905.1 protein_id gnl|my_center|LOCUS_35340 22213 22809 gene locus_tag LOCUS_35350 22213 22809 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_35350 23140 23520 gene locus_tag LOCUS_35360 23140 23520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 23520 23789 gene locus_tag LOCUS_35370 23520 23789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 24352 23885 gene locus_tag LOCUS_35380 24352 23885 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640420.1 protein_id gnl|my_center|LOCUS_35380 25095 24364 gene locus_tag LOCUS_35390 25095 24364 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067061.1 protein_id gnl|my_center|LOCUS_35390 26174 25092 gene locus_tag LOCUS_35400 26174 25092 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085697.1 protein_id gnl|my_center|LOCUS_35400 27283 26171 gene locus_tag LOCUS_35410 27283 26171 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 protein_id gnl|my_center|LOCUS_35410 28326 27283 gene locus_tag LOCUS_35420 28326 27283 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284567.1 protein_id gnl|my_center|LOCUS_35420 29509 28331 gene locus_tag LOCUS_35430 29509 28331 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191808.1 protein_id gnl|my_center|LOCUS_35430 30483 29590 gene locus_tag LOCUS_35440 gene lysR 30483 29590 CDS product DNA-binding transcriptional regulator LysR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741836.1 protein_id gnl|my_center|LOCUS_35440 30662 31459 gene locus_tag LOCUS_35450 30662 31459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35450 31456 33291 gene locus_tag LOCUS_35460 31456 33291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35460 33343 33717 gene locus_tag LOCUS_35470 33343 33717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 34641 33979 gene locus_tag LOCUS_35480 34641 33979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 34841 35167 gene locus_tag LOCUS_35490 34841 35167 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_35490 35278 36069 gene locus_tag LOCUS_35500 35278 36069 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349104.1 protein_id gnl|my_center|LOCUS_35500 36517 36131 gene locus_tag LOCUS_35510 36517 36131 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_35510 36732 36517 gene locus_tag LOCUS_35520 36732 36517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 37041 37658 gene locus_tag LOCUS_35530 37041 37658 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028006006.1 protein_id gnl|my_center|LOCUS_35530 38333 38953 gene locus_tag LOCUS_35540 38333 38953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 38950 39576 gene locus_tag LOCUS_35550 38950 39576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 39595 39921 gene locus_tag LOCUS_35560 39595 39921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 40056 40673 gene locus_tag LOCUS_35570 40056 40673 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552315.1 protein_id gnl|my_center|LOCUS_35570 40840 41013 gene locus_tag LOCUS_35580 40840 41013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 41019 41792 gene locus_tag LOCUS_35590 41019 41792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 42468 41926 gene locus_tag LOCUS_35600 42468 41926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 >Feature sequence102 >Feature sequence103 >Feature sequence104 >Feature sequence105 >Feature sequence106 226 11 gene locus_tag LOCUS_35610 226 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 >Feature sequence107 >Feature sequence108 >Feature sequence109 >Feature sequence110 >Feature sequence111