COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..864887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..715 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205153.1:IS1182-like element ISBma2 family transposase locus_tag LOCUS_00010 CDS complement(887..1498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1583..3235) product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531883.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(3244..4083) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969503.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(4083..5228) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(5343..6533) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396615.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 6648..7865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(7970..9301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(9423..10409) product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(10529..11575) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090884.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(11572..12372) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971771.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 12668..13375 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531889.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(13463..14761) product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(15307..16323) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene dctP CDS complement(16430..17260) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene thiD CDS complement(17257..18075) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972914.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 18394..18630 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014493934.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(18698..19627) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968996.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 19539..19748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(20038..22122) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972154.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(22414..24720) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532625.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(24923..25513) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529260.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 25796..26713 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(26736..27620) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966578.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(27687..29366) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(29635..31350) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992329.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene ade CDS complement(31813..32010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 32020..32955 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532174.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 33267..34733 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971003.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene zwf CDS 34966..36786 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527052.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene edd CDS 36815..37459 product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243294.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(37544..38077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(38380..38682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 38638..39108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 39337..40965 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968607.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene pgi CDS 41159..41428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 41500..41769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 41843..42130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 42343..43215 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968359.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(43316..43927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(44021..44800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(44979..45278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(45701..46027) product RebB family R body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038031.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(46219..46998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(46931..47545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(47555..47935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(47871..48248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(48371..48568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(48586..48822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(48936..49556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 tRNA complement(49967..50042) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 50749..52524 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 52539..53114 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531048.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene ilvN CDS complement(53207..53797) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764030.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 53696..54046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 54494..55738 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene serA CDS complement(55951..57243) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240324.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 57554..58300 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243095.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 58303..58926 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266180.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(58960..59343) product DUF4087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188671.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(59441..60310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 60815..61396 product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976096.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 61480..62499 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976095.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene ilvC CDS complement(62698..63648) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140099.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 64172..65317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(65367..66329) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528386.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(66341..67102) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089319.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(67102..68082) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089318.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 68291..69466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 69602..70513 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530005.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(70549..71451) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975807.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 71624..72388 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 72487..74346 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670404.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene ggt CDS 74778..76343 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919415.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 76558..76944 product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(77050..77676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(78197..79144) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534915.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene miaA CDS 79143..80033 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089245.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene serB CDS complement(80134..81645) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531033.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(81818..82003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(82000..82941) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089248.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(82941..84128) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene hflK CDS complement(84373..84849) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925817.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(84846..85364) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 85665..86759 product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene dctP CDS complement(86837..88222) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(88222..88791) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808109.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 89184..90557 product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067001.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(90574..91512) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337530.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(91542..92336) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 93136..93702 product SspB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531016.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 93730..93933 product DUF4169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 93978..94196 product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328916.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(94211..98005) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(98140..99555) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531008.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(99790..101604) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227541.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 101880..103556 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389287.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(103572..104606) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182165467.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(104783..106597) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530971.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 106858..107073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(107224..108114) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976184.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(108230..109567) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(109609..110310) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(110664..112955) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972026.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(112952..113110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(113572..114045) product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088962.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(114157..116319) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976200.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene ligA CDS 116469..116651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(116774..118444) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242937.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene recN CDS complement(118473..119336) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089334.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(119595..120536) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972045.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene lpxC CDS complement(120820..122730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(122799..124121) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004442783.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene ftsA CDS complement(124118..125032) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530961.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(125020..125961) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969744.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(125963..126934) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530959.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene murB CDS complement(126939..128348) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene murC CDS complement(128345..129463) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089342.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene murG CDS complement(129490..130647) product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529129.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene ftsW CDS complement(130647..132047) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene murD CDS complement(132051..133136) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530954.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene mraY CDS complement(133146..134576) product UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diaminopimelate--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972056.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(134573..136045) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089347.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(136144..137856) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(137871..138230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(138236..139294) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972059.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene rsmH CDS complement(139291..139761) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310455.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene mraZ CDS complement(140670..142133) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209790.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 142269..142964 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(143105..143794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(144180..144938) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976234.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(144935..145627) product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328962.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 145928..148201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(148276..149007) product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267058.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene arsH CDS complement(149004..149414) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530551.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene arsC CDS complement(149633..150196) product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395860.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(150261..151565) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811093.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(151565..152122) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930615.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(152216..153211) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930616.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(153367..154611) product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926862.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 154745..155452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 155493..157067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 157241..160825 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530942.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 161337..163085 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(163164..163985) product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396073.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 164249..164653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(164733..165509) product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066520.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 165631..166257 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252464.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(166324..167472) product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083306.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 168245..168562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(168628..172377) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970331.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene metH CDS complement(172389..173303) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530934.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene metF CDS complement(173307..174293) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969763.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(174437..175318) product trpBA operon transcriptional activator TrpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114633.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene trpI CDS complement(175769..176866) product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083609.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(177194..179380) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene katG CDS complement(179811..181361) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968798.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene katA CDS 181465..182382 product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083599.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 182493..183113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(183399..184061) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926969.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 184455..184769 product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530931.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(184808..185446) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530927.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 185644..187005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(187063..187620) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(187755..189407) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969764.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene ettA CDS 189873..190214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 190346..191515 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066706.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 191558..192259 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(192268..193587) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064276.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(193592..194914) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 195180..195416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(195438..195932) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387802.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(195985..198291) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 198740..199516 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 200068..201261 product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 201372..202394 product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene orr CDS complement(202567..203601) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532956.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene rsgA CDS complement(204264..204785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 tRNA complement(205243..205319) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 205817..206632 product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530175.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(206715..207302) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338369.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(207444..208541) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532194.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(208655..209065) product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(209236..210126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(210130..211146) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045461484.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(211284..211673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(211846..212235) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 212413..213561 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(213574..214935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(215098..217095) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387243.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene rpoD CDS complement(217657..220035) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969855.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene dnaG CDS complement(220228..220770) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532937.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 221010..222194 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090106.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene carA CDS complement(222423..222866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(223446..224528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 224843..225109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 225337..228699 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090112.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene carB CDS 228812..229285 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530066.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene greA CDS complement(229400..229762) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 230120..231658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(231741..232211) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 232524..233507 product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 233585..234550 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530078.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene trxB CDS 234628..235527 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975409.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(236450..237430) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene msrP CDS 237617..237943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(238098..238598) product DUF992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311346.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(238830..240029) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174694.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(240205..241326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 241710..242033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 242162..242461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(242507..242848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 242990..243412 product DUF3775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530064.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 243792..244808 product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531115.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(244816..245403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 245750..246070 product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268529.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 246196..247713 product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241097.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene betC CDS 248181..250562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 250835..251644 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183806692.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 note possible pseudo, frameshifted CDS 251926..252198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 252288..252626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 252826..255726 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971990.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene uvrB CDS complement(256025..256330) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529964.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene clpS CDS 256765..257370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 257445..258701 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338708.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 259133..260188 product DUF1402 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531977.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(260239..260922) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083722.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 261093..262319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 262540..263394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 263846..264400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 264475..265323 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532491.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 265539..265979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 266018..266665 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010205456.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(266781..269963) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(269974..271488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(271790..272452) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312871.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 272805..273800 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 273943..274707 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532482.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 274819..276783 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969086.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene uvrC CDS 276891..277979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 278114..278695 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969910.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 278997..280685 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532602.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 280801..281088 product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460998.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 281199..281777 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532480.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene pgsA CDS 281835..282086 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974978.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene moaD CDS 282088..282570 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532478.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 282744..284012 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532138.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(284104..285006) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 285340..285834 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000365.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 285839..286528 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708803.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 286549..287937 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090196.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(287959..288465) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972320.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(288466..288807) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537521.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(288915..289655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(289774..290535) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972141.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene proC CDS complement(290592..291092) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311131.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(291450..291734) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530008.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 291973..292797 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene lgt CDS 292825..293907 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396735.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 294001..294768 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969870.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene pgeF CDS 294809..295966 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 296210..296566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 296831..297763 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972147.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(297839..298123) product DUF930 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974429.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 298638..299267 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529995.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 299381..300157 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972157.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene pth CDS 300249..301283 product ribonuclease T(2) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530922.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(301360..301710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(301912..302106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 302059..302460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 302618..303430 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 303579..304679 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529993.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene ychF CDS complement(304745..305497) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(305507..306283) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384629.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(306294..307055) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384630.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(307117..308088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(308184..308879) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384632.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 309052..309732 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336836.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(309812..310300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 310644..312419 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 312526..313440 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037382902.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 313486..314397 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530857.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(314485..314964) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886643.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(315112..315660) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529989.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(315905..316744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 note possible pseudo, internal stop codon CDS complement(316775..318040) product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529985.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(318065..318625) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene petA CDS complement(318832..319035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(318984..320825) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529979.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(320818..321276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(321753..322160) product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640534.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(322270..324141) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969492.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 324306..324767 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254662.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 324908..325834 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene hemF CDS complement(325887..326996) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083664.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(327159..328259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(328384..329598) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085256.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(329598..329858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(329858..330529) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329137.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(330522..331118) product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 331494..332519 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 332541..333500 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976403.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 333497..336361 product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529966.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 336383..338458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018183745.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(338506..339006) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085246.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 339463..340437 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976408.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(340460..340996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 341452..342381 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(342483..343067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(343401..344021) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084228.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 344198..344401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(344431..346602) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966504.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene flhA CDS complement(346631..347986) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089740.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(348004..348342) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene fliN CDS complement(348339..349079) product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089738.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(349079..350128) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089737.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene fliG CDS complement(350132..351748) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089736.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene fliF CDS complement(352144..352419) product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004430042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(352709..353368) product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(353514..355811) product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388306.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 356249..357445 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529903.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene mnmA CDS 357379..357639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 tRNA 357859..357935 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 358026..359972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(360134..360673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963497.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 360875..363622 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090898.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 363908..364147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 note possible pseudo, internal stop codon, frameshifted CDS complement(364106..364321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 364379..364939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 note possible pseudo, frameshifted CDS 365137..365688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 366148..367362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530180.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 367359..367805 product DUF6521 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530179.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 367802..369661 product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(370523..372460) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147182312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(372636..373562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 373727..373894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(374140..374550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(374606..375274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 376599..377300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105153.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 note possible pseudo, internal stop codon CDS 377448..378371 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(379537..379800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(379790..380116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(380023..380298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(380505..381464) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215524.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(381466..382203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(382577..382981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 383321..383761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(383779..384744) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(384781..385833) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705154.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(385830..386861) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705153.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(386858..387703) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705152.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 388076..390271 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240667.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 390470..391351 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614950.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(391571..391792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 392025..392258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 note possible pseudo, internal stop codon, frameshifted CDS 393287..393808 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037975.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 393817..394647 product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(394586..395407) product trans-aconitate methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230076.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(395404..396474) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168117700.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(396471..396869) product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(396882..397874) product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 398136..398930 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031073.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 398927..399679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(399693..400655) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110692878.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 400823..402364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028386.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(402371..404170) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339157.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(404221..405174) product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975888.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(405164..406798) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975889.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(406871..407791) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969591.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(407795..408694) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(408691..409302) product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723885.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(409299..410528) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975893.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(410950..411858) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206875.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(411969..412904) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195013.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(412952..413734) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267485.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(413797..414507) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228129.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(414504..415277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(415274..416572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(416574..417515) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191272.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(417599..418828) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331310.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 419201..419920 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(419952..420551) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384078.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 420849..422285 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965348.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 422394..423113 product nopaline ABC transporter permease NocQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891638.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene nocQ CDS 423113..423850 product nopaline ABC transporter permease NocM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523894.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene nocM CDS 423847..424629 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133012.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 424693..425541 product nopaline ABC transporter substrate-binding protein NocT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene nocT CDS complement(425648..425854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 425787..426428 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037144.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 426497..427405 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 427417..428409 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 428402..429346 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972350.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 429343..430101 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226767.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(430197..432161) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339007.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(432460..433266) product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384111.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(433263..433946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(433949..435718) product SbmA/BacA-like family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384110.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(435723..438041) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537673.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(438275..439672) product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061740.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 440214..440903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 440900..441844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(441858..442130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 442053..443453 product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene pelF CDS 443459..444898 product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene pelG CDS 444895..445827 product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887350.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 445973..448258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 448255..449688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(449860..451380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 451977..456110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 456284..457036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(457054..458127) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086178.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 458315..459640 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528077.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 459722..460669 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 460666..461601 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086350.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 461598..461786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528080.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 461790..462887 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528081.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 462880..463875 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615005.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 463887..465515 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528083.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(465647..467077) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329335.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(467095..468303) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(468333..469958) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 470151..471029 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303519.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(471148..471909) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529934.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(471935..472654) product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018324898.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(472680..473960) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919324.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(473963..474484) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088798.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(474576..475580) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088799.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 475802..476527 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972794.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(476542..477321) product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034857483.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(477351..478145) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene iolB CDS complement(478157..479053) product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397481.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene iolE CDS complement(479079..480920) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329377.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene iolD CDS complement(480920..482848) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329378.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene iolC CDS complement(482838..484031) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168149.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(484054..484872) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(484874..485980) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192697.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(486053..486973) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(487099..488091) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene iolG CDS 488295..489308 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077984631.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(489336..490595) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384388.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 491137..493698 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066653.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(493779..494795) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330392.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(494867..495784) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970198.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(495781..496743) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313732.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(496736..497680) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313733.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(497677..499158) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020479424.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(499172..500188) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967108.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 500415..501683 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970203.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 501680..502399 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967110.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(502415..503215) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389053.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(503265..503924) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389052.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(503928..504581) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389051.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(504664..505482) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470652.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(505543..507225) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973441.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(507218..508054) product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391667.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene hutG CDS complement(508041..509609) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337859.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene hutH CDS complement(509606..510820) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973444.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene hutI CDS 510893..512278 product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140219.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 512275..512976 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337856.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(513003..514202) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092733229.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 514434..515426 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973976.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 515532..516614 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973977.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 516611..518290 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973978.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 518369..519316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973979.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(519398..520072) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(520219..521022) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 521106..522179 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106181.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 522179..523099 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337461.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 523099..523917 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106179.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 523946..524974 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531376.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 524994..525770 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027793.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 525767..527131 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114627.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 527299..528549 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530448.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 528588..529007 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877160.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 529085..529717 product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530450.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 529737..531221 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530451.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 531245..532183 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929941.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(532209..533606) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968718.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(533612..533926) product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529957.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene rhaM CDS complement(533930..534946) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968717.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(534943..535923) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968716.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(535920..537479) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391991.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(537564..538556) product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene rhaS CDS complement(538611..539417) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 539602..541704 product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974433.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 541718..543004 product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327306.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene rhaI CDS complement(543047..543985) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972433.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(543982..545172) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972432.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene nagA CDS complement(545169..546191) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310751.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(546207..546959) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972431.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 547396..548580 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310749.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 548592..549476 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310748.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 549473..550330 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061573.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 550368..551600 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 551701..552825 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972429.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene ugpC CDS complement(552894..554009) product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973437.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(553990..555459) product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(555500..555982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972671.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 556103..556489 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254348.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 556512..557375 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331848.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 557420..558190 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391669.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 558217..560139 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972427.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 560151..561608 product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391662.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 561679..562887 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061585.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 562900..563643 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651233.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(563640..564041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(564038..564196) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310667.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(564283..566022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(566186..566710) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(566914..568203) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309966.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 568600..569655 product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651627.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene cyoA CDS 569731..571764 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970677.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene cyoB CDS 571761..572393 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061308.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene cyoC CDS 572390..572770 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309962.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene cyoD CDS 572795..573535 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392415.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(573569..573805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(573868..574899) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668096.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 575206..576549 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921455.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 576554..577762 product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 577755..578573 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 578573..579226 product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208714.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 579226..579834 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene nqrE CDS 579850..581073 product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225565.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene nqrF CDS complement(581127..581315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(581385..582452) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(582452..583855) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038449.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(583848..584519) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038450.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 584713..585702 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816062.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 585819..586250 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 586265..587803 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114173.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(587900..589300) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530396.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(589511..590404) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 590745..591203 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368597.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 591205..593400 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538282.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 593562..593957 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070690482.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(594002..595264) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922632.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 595407..596966 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804536.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 597050..597994 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975337.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 597994..599931 product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969281.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 599928..600920 product oligopeptide ABC transporter ATP-binding protein AppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232964.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene appF CDS 600962..601756 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975340.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 601835..602803 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233159.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(602864..603931) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771516.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(603928..604938) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809246.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(604935..605735) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642350.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 605898..607172 product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112996.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(607197..608189) product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401275.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene doeB CDS complement(608194..609396) product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974131.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene doeA CDS 610071..611165 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722797.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 611251..612351 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643541.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 612423..614063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 614076..614930 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722803.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 615114..616343 product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 616516..617316 product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491485.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 617309..618550 product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 618675..619889 product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338098.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene kynU CDS 619893..620531 product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810518.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene kynB CDS 620585..621355 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 621352..622059 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 622071..622943 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532983.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 622960..623916 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 623974..625176 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537683.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(625242..626363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(626336..627151) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972907.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 627217..628371 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 628371..629261 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972906.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 629261..629776 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972905.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 629828..630430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 630430..631719 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 631744..632802 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(632885..634519) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 634792..634941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(635177..636019) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769036.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene yghU CDS complement(636188..637042) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200879.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(637116..638060) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(638157..639161) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(639158..640684) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene gguA CDS complement(640721..641368) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(641528..643054) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311047.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 643219..643899 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244084.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 643958..645001 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532188.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 645001..645432 product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532181.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 645429..646280 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(646661..648655) product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397063.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(648732..650363) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976311.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(650356..651183) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976310.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(651180..652187) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(652283..653854) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 654103..654894 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976312.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 654985..655725 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 655736..656689 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329274.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 657003..658316 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337986.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 658483..659265 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066580.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 659268..660098 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066579.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 660110..661111 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337989.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 661111..661881 product L-iditol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528417.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 661885..663357 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528418.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 663365..664294 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337354.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(664394..665317) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969920.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(665322..666014) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720652.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 666159..667604 product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene uxaC CDS 667611..668612 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566022.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 668687..669211 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566024.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 669213..670493 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720648.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 670505..670822 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338257.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 670849..671673 product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720646.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene kduI CDS 671670..672398 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338256.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene kduD CDS 672388..673830 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139922.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 673827..674993 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438591.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene uxuA CDS complement(674999..675778) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338237.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 676041..677621 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669370.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene glpD CDS 677660..678748 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337645.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 678762..679838 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337644.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 679838..680710 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719816.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 680711..681562 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 681581..681853 product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 681931..683640 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337642.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 683777..684748 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368588.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(684897..685751) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975163.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 685833..686741 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969490.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 686738..688075 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975165.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 688211..689173 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 689351..691984 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067553987.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 692005..692442 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339636.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(692536..694197) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529813.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(694305..695336) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531376.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(695388..696188) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529816.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(696181..697092) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337461.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(697098..698135) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 698676..699122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 699211..700626 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702955.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(700649..701278) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018009470.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 701433..703472 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972390.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(703557..704120) product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992446.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(704137..707127) product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973739.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(707124..707426) product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973738.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(707437..708690) product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973737.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 708806..709816 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399686.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 710153..711391 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395754.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 711421..712467 product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395755.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 712615..713994 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385587.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(714002..714757) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene fabG CDS complement(714844..715851) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385613.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(715848..717326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(717337..718395) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(718395..719222) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015918758.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(719231..720535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(720607..721974) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083271.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(722171..722938) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969383.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(722887..723876) product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397815.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene yjfF CDS complement(723873..724928) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061821.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(724928..726442) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061820.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(726539..727492) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061819.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 728064..728975 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383424.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene purU CDS complement(728979..729317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(729479..730219) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228258.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(730216..731367) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480242.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene menC CDS 731701..735039 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921365.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 735043..737454 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 737464..738339 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529827.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(738368..738946) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338232.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 739199..739600 product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328873.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(739611..740651) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338815.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 740907..742139 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975867.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 742332..743186 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972962.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 743179..744165 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504414.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 744177..745265 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529542.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene ugpC CDS 745303..746049 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 746062..747183 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 747196..748242 product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529545.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene mgrA CDS 748239..749846 product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975849.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 749890..750951 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529509.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 750948..752096 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970271.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 752222..752374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 752567..752908 product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(753053..755878) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene fdhF CDS complement(755875..757554) product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(757649..759352) product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531269.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(759599..761557) product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074303.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(761561..762937) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074304.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(762940..763119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 763718..763867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 763878..764075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(764129..765037) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 765193..765645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 765642..766118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 766130..767353 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 767401..768621 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(768690..770774) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536383.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(770930..771883) product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028521.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(771933..772712) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086229.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(772714..773652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(773652..774827) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086232.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(774834..775616) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930187.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(775622..776827) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(776874..777929) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039704.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(777929..778804) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(778808..779614) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930184.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 779829..780710 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031174.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(780888..782201) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(782201..782701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(782815..783798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 784522..785130 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531972.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 785472..786572 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 786928..787977 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530723.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 788051..788863 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339543.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 788868..790133 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530725.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 790159..790887 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565148.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 790891..792504 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530727.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(792676..793671) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975244.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 793824..794846 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974157.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 794913..797126 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975242.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 797123..798184 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975241.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 798181..798987 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969391.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 799606..800262 product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene parA CDS 800259..800897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 801079..801675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(801783..801992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(801989..803383) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528425.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(803389..804255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(804431..825109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(825106..826440) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530640.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(826437..847328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(847338..849713) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231811.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene fabD CDS complement(849710..851359) product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193739.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(851362..852996) product cyclic peptide syringomycin export ABC transporter SyrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267822.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene syrD CDS 853372..853620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 853643..855640 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268959.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene asnB CDS complement(855604..856374) product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886512.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(856371..857507) product polyketide biosynthesis malonyl-ACP decarboxylase PksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245287.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene pksF CDS complement(857584..857832) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198264.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(857878..859134) product polyketide biosynthesis 3-hydroxy-3-methylglutaryl-ACP synthase PksG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231805.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene pksG CDS complement(859134..860384) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(860606..860836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 860732..861463 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(861529..862332) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187830.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 862406..863308 product acyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231814.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 863498..864541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 tRNA complement(864671..864747) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 sequence02 source 1..78132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(818..1924) product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969557.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene znuA CDS 2223..3842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 4047..4796 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144067654.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(4871..5494) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090297.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene wrbA CDS 5770..6735 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 7094..8179 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969813.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 8253..9242 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528023.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 9239..10195 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210183137.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 10517..11329 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976320.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 11351..12778 product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528020.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(12856..13887) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene galE CDS 13938..14105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 14125..14499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 14634..16262 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400472.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(17461..17682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 17896..18717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 tRNA complement(18910..18985) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 19369..19665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 19910..20647 product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401893.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(20655..21905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 22200..23558 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531912.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene glmU CDS 23691..25517 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531911.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene glmS CDS 25549..25998 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172297.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(26017..26385) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 26531..27274 product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537698.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(27354..28847) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 29104..30243 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 30391..31485 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119359.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 31489..32412 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975171.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 32409..33626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(34358..35551) product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028053720.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(35548..37332) product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969277.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene ngg CDS complement(37340..39115) product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975341.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(39989..41191) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328326.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(41225..41746) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531740.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene moaC CDS complement(41773..42585) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314425.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene trpC CDS complement(42590..43603) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087577.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene trpD CDS complement(43696..45582) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969377.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 45830..46603 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975244.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene tpiA CDS 46825..47208 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087554.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 47368..48420 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975252.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene pdhA CDS 48436..49824 product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531482.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 49840..51222 product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969228.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 51299..52747 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969230.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene lpdA CDS 53013..53249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 53252..53671 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088625.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 53755..54729 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969231.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene lipA CDS 54809..55261 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087250.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(55286..55816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(56020..56538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(56692..58794) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene recG CDS 59061..59384 product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 59463..62948 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene mfd CDS complement(63048..63464) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170906.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(63653..65050) product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965237.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(65047..65232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(65317..66501) product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972933.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(66794..67804) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836238.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 68135..69577 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331335.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 69613..70260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(70262..71134) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706043.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene rfbA CDS complement(71339..72736) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975725.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene fumC CDS complement(72943..73635) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966590.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 73841..75232 product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene tcuA CDS 75225..76370 product tricarballylate utilization 4Fe-4S protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085110.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene tcuB CDS 76367..77182 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086448.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(77207..77935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 sequence03 source 1..62429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 535..945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 942..1418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 1559..1993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 1986..2645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(2867..4288) product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192381.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene otsA CDS 4544..4747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 4833..5348 product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658301.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 5451..5681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(5773..7590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 7803..8015 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528984.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(8125..9192) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084283.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(9303..10106) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394504.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 10299..10550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 10547..11101 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529285.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 11187..12587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(12663..12830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 13045..13233 product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721784.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 13404..14519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(14633..15667) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533631.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 15897..16958 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535531.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene chvE CDS 17139..18713 product sugar ABC transporter ATP-binding protein GguA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311698.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene gguA CDS 18725..19969 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329215.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene gguB CDS 19996..21000 product GguC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533635.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene gguC CDS 21056..22798 product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976013.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene araD CDS 22833..23771 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971402.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 23836..24702 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338915.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 24687..25292 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267366.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 25323..26180 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339073.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(26506..27681) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967956.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene argE CDS 27987..29009 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390594.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 29300..30859 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390595.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 30856..31941 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390596.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 31941..32882 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402896.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 32892..34187 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393085.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 34476..35270 product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969818.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene fhuF CDS complement(35271..36092) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940422.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(36089..36973) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815927.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(37068..38351) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(38429..39508) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929634.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(39505..40290) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(40590..41681) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene ugpC CDS complement(41727..42869) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529834.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(42880..43869) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529835.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(44006..45364) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337812.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 45570..46631 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365311.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(46660..47949) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(47959..48840) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(48809..50740) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(50800..51720) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(51765..52847) product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(52840..53514) product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039101.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(53530..54261) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(54282..55238) product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086600.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(55590..56141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 56779..58203 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(58285..60480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 misc_feature complement(60464..>62429) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263951.1:Ig-like domain-containing protein locus_tag LOCUS_08580 assembly_gap 60513..60612 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence04 source 1..55484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(320..883) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642469.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(909..2240) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(2237..2731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(2832..3914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(3935..4339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(4403..5548) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039923.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(5559..6374) product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244068.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 6635..7462 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 7506..9023 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537730.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 9107..9967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 9964..10335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 10572..11336 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(11363..11851) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243734.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(11866..12633) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973552.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(12806..14629) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene atzF CDS complement(14669..16321) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086124.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(16318..17199) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083858.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(17196..18221) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083857.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(18227..19852) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967343.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 19994..20920 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084073.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(20979..21827) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973992.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(21892..23220) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(23213..23809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(23892..24908) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065227.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene dctP CDS complement(24994..26031) product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 26210..26923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(26948..27829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(27838..29280) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939726.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(29298..30641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(30631..31626) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(31637..32620) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259508.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(32678..33976) product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(34041..34847) product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026965.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(34860..36614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 36931..37893 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528163.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 37964..38761 product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026965.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 38847..39821 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 39833..40834 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612396.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene rbsC CDS 40831..42342 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189455.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene rbsA CDS complement(42350..43150) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(43161..44033) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(44088..44636) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190386.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(44633..45310) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010205456.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(45307..46617) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(46614..47132) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089912.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(47242..48270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(48424..49347) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089979.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(49630..50514) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723694.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 50645..51592 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582705.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 51589..52098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 52100..53614 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 53598..55187 product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368533.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 tRNA complement(55371..55447) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 sequence05 source 1..42481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(340..1542) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(1539..2378) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966629.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(2371..3138) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082944.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(3208..4224) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082945.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(4253..4927) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339095.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 5014..5841 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253115.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(5854..6696) product DUF296 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974193.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(6693..8321) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969395.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(8318..9487) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(9521..10342) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974197.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 10543..11565 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337992.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 11644..12177 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 12181..13548 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 13545..14363 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162688106.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 14388..15140 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089900.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(15247..16152) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527624.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 16315..17118 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972353.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 17176..18366 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 18497..21670 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972354.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(21801..22466) product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976287.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(22459..23466) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970687.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(23463..24572) product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970692.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene mtnA CDS complement(24569..25843) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532923.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene mtnK CDS 25980..27578 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532922.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 27590..28603 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532921.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 28643..29686 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976315.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(29805..31544) product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973469.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene araD CDS complement(31555..33213) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399307.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(33254..34210) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112311.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(34210..35115) product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene kdgD CDS complement(35160..36686) product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972889.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 36956..37669 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083214.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 37748..38644 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929933.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(38641..38967) product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967421.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 39203..40174 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085835.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 40244..40717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 40717..42243 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813871.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 sequence06 source 1..33785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(177..1589) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(1776..2582) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529922.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 2763..3362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(3428..4621) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391461.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(4682..6223) product UDP-phosphomannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957674.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(6397..9138) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066739.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene secA CDS complement(9200..9385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 9405..10307 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973107.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 10504..11745 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene argJ CDS 11855..12259 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533503.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene mutT CDS 12293..12526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(12611..13501) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 13625..14464 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529448.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 14657..14914 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529449.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene grxC CDS 14949..15806 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529450.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 15803..16387 product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626011.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(16499..16996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(17228..17938) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090105.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(17944..18696) product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529456.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene ubiG CDS 18898..20133 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529459.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 20209..22473 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529460.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene ptsP CDS 22540..23613 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329507.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene prfA CDS 23617..24477 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083051.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene prmC CDS 24912..25769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(26066..26620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 26619..26756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(26841..27155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(27423..27752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 note possible pseudo, internal stop codon CDS 27963..30569 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529464.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene clpB CDS complement(30659..32620) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965357.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 sequence07 source 1..5930 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 263..1743 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 2031..2107 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 2122..2197 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 rRNA 2657..5385 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 5749..5858 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence08 source 1..1833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(972..>1833) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086476.1:flagellin locus_tag LOCUS_09780 sequence09 source 1..1463 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 336..1292 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721051.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 sequence10 source 1..811534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(769..1491) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198766.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1524..2981) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813512.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(3005..5539) product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(5539..6414) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170747.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(6560..7822) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086444.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 8008..8985 product tricarballylate utilization LysR family transcriptional regulator TcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423368.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene tcuR CDS complement(9023..9391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(9419..11203) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393370.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(11216..12994) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085507.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(13159..14151) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921423.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 14499..15437 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(15400..17073) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227653.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(17070..18191) product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(18176..20191) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395919.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(20255..21352) product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399877.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(21571..22458) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969452.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 22658..23632 product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035278.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(23648..24736) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538073.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(24919..25725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(25793..26302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 26186..26542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 26539..27531 product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 27528..29735 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163175.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(29872..31083) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265899.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(31251..32285) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 32885..34171 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 34250..34993 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 34993..35721 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064071.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 35733..36611 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 36608..37648 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 37661..38455 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082941.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene maiA CDS 38467..39393 product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877177.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 39396..40136 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 40140..41018 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088206.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 41043..42047 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085682.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 42097..42447 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878703.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 42778..43932 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 44064..44879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 44876..46390 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967730.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 46482..47984 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 47996..48925 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031749.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 48922..49788 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538206.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 49795..50583 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene fabG CDS 50580..51473 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729776.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 51473..53026 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966515.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 53019..54008 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868769.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 54017..54994 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(55017..56948) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(56948..58042) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267680.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene ugpC CDS complement(58035..60149) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546333.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(60146..60997) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524829.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(60997..61905) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524828.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(61993..63243) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 63396..64364 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504770.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(64391..65293) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 65234..65398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 65425..66375 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082966.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene speB CDS 66466..67512 product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 67549..68412 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531382.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 68417..69208 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531381.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 69205..70281 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531380.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 70293..71024 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531379.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(71044..71955) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393019.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 72050..73708 product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393021.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(73800..75695) product sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395800.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(75713..76987) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(76989..77519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(77577..78584) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(78604..79488) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267452.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 79618..80286 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973934.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(80355..81506) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(81593..82963) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975296.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(82972..84444) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530323.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(84549..85034) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401300.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(85253..85732) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705485.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(85740..86171) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096712.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(86168..86371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 86468..87196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 87418..88614 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 89161..89706 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 90186..91253 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924841.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 91246..92316 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392937.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 92309..93076 product molybdate ABC transporter ATP-binding protein MolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693486.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene molC CDS 93060..94358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(94558..95934) product adenylosuccinate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034850905.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(95952..97559) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528531.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(97556..98470) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762883.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(98467..99384) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383488.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(99439..100968) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738493.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(101049..102581) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738493.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 102711..103640 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083069.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(103772..106591) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105372141.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(106879..108228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(108225..109298) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106663661.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(109295..111355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 111753..113330 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 113327..114586 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103419.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 114779..115915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 115915..119007 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 tRNA complement(119599..119672) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 121368..122390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 122387..123118 product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532288.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 123433..124935 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974584.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene guaB CDS 124996..126288 product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(126361..127587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 127801..129360 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565333.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene guaA CDS 129605..131152 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970144.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(131203..132162) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 132321..132719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 132865..133530 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083414.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(133617..134249) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328424.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 134501..137377 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975403.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene gyrA CDS complement(137517..137927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 138111..138611 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531827.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene coaD CDS 138656..139195 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919458.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 139213..139725 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087459.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 139893..141017 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531823.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene queA CDS 141022..142218 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975429.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene tgt CDS complement(142281..142712) product DUF4864 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531820.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(142839..144143) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(144277..145170) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970204.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene galU CDS 145515..146351 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092769113.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene kdsA CDS 146487..147761 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969226.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene eno CDS complement(147839..149212) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958071.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(149380..150051) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969365.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(150175..151380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(151446..153140) product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228720.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(153142..154944) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577290.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 155310..155933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(156041..156364) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027161605.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene hspQ CDS complement(156471..157514) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265893.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(157652..158473) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086588.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 158739..159704 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531656.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(159743..161047) product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328317.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 161261..162151 product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532424.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 162335..163054 product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971870.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene pcs CDS 163122..163844 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087355.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 163883..164860 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401901.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 164877..165863 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084073.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 165935..166297 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850504.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene uraH CDS 166304..167797 product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255385.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene xdhA CDS 167794..170205 product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975970.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene xdhB CDS 170205..171239 product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189595.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene xdhC CDS 171268..172908 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172149.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 172908..173990 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 173994..174908 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328322.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 175019..176086 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531647.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 176263..177444 product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391571.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 177459..177968 product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene uraD tRNA complement(178063..178152) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(178213..178470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 179104..180045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 note possible pseudo, frameshifted CDS 180196..181548 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173681.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 181617..182303 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene tmk CDS 182293..183375 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087288.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 183483..185039 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971668.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene metG CDS 185167..185970 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528321.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 185980..186798 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531573.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(186802..187434) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067011.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 187661..188791 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067010.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 188846..190417 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 190453..191028 product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388397.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(191025..192020) product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971111.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 192150..192602 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971112.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 192827..193207 product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398477.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(193232..193414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 193355..193759 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(193784..194824) product PLP-dependent lyase/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065102.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(194958..195440) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene arfB CDS complement(195437..196120) product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720331.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(196216..196893) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 197235..198563 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153438978.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 198637..198924 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447274.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 198937..200193 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 200365..200553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 200641..202098 product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969947.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene hydA CDS 202279..203124 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972284.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 203767..204657 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066594.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 204654..205796 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530915.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(205933..206112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 206229..207050 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087265.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene mazG CDS complement(207254..208267) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971319.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 208364..208783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(208857..210089) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531499.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene hflX CDS complement(210240..210497) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007591126.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene hfq CDS complement(211151..212527) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975268.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene trkA CDS complement(212582..213949) product two-component system response regulator NtrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535439.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene ntrX CDS complement(213956..216247) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971628.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(216670..218109) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene ntrC CDS complement(218116..219255) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969237.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(219252..220193) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971627.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene dusB CDS 220453..221721 product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 221770..222306 product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531490.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 222377..222886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(222979..224301) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920685.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 224483..225235 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973571.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(225530..225883) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527133.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 226179..227063 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082684.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(227134..228561) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113731.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(228912..230042) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088343.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(230137..231297) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388739.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(231395..233068) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927038.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(233072..233959) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814451.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(233959..234900) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814453.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(235063..236694) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376440.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(236807..238339) product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389097.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 238552..239364 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814457.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(239383..240804) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(240929..241846) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973849.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(241895..242590) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 242946..243719 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 243810..245363 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084030.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 245458..246426 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084029.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 246426..247265 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173684.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 247267..248916 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965309.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 248913..250235 product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 250235..251200 product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 251220..252257 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(252409..253632) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086628.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(253629..256145) product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086442.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(256155..257030) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(257121..258305) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152802079.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 258545..258952 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170906.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(259005..259697) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 259996..260718 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975511.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene lexA CDS complement(261585..264527) product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 264725..266149 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087606.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene gltX CDS 266438..267727 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328205.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene gltA CDS 267976..268098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 268500..268799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(268743..269930) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087615.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene lpxB CDS complement(269927..270826) product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(270839..271636) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389472.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene lpxA CDS complement(271644..272138) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312533.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene fabZ CDS complement(272172..273209) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087620.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene lpxD CDS complement(273303..275684) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531755.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene bamA CDS complement(275855..276991) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087622.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene rseP CDS complement(277142..278371) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(278396..279271) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969257.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(279271..280038) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087625.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(280075..280638) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244675.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene frr CDS complement(280752..281471) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531760.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene pyrH CDS complement(281553..282470) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975302.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene tsf CDS complement(282618..283433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(283805..287350) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969158.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene dnaE CDS complement(287867..288592) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(288589..289875) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087643.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(290026..291357) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087644.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(292180..292467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(292550..292954) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene mce CDS complement(293020..294687) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975097.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(294738..295397) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975096.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(295523..296965) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969150.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene nuoN CDS complement(296991..298511) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531857.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(298511..300508) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531100.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene nuoL CDS complement(300515..300823) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003502389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene nuoK CDS complement(300939..301553) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531099.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(301657..302145) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707628.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene nuoI CDS complement(302172..302408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(302431..303489) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975090.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene nuoH CDS complement(303505..305601) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969148.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene nuoG CDS complement(305598..305948) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(305954..307255) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531094.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene nuoF CDS complement(307265..308593) product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531093.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(308675..309859) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(309852..310286) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971509.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(310298..310897) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327986.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(311020..311598) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531090.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(311589..311954) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312714.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 312266..312514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 312451..312606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 tRNA complement(312753..312829) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(312903..312979) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 313459..314100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 314234..314527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 tRNA complement(314643..314718) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(315072..315347) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(315535..317967) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975068.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene lon CDS complement(318325..319590) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532190.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene clpX CDS complement(319933..320568) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087708.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(320790..322142) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene tig tRNA complement(322464..322548) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(322705..324297) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966309.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 324984..325322 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603495.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 325466..326875 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene glnA CDS complement(326954..329407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(329574..330641) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970056.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 330823..332076 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532167.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene tyrS CDS complement(332335..335793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 335997..336464 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969433.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 336772..338148 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532170.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(338223..339194) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113519808.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene prfB CDS complement(339496..341949) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531366.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(341946..342161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(342282..343571) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 344425..347079 product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919743.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(347151..348350) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577799.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 348466..349956 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087068.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 350028..350795 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 350899..351090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 351121..351582 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087064.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene accB CDS 351596..352945 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975142.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene accC CDS 352976..353662 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919751.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene aat CDS complement(353751..354425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(354537..357392) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975321.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(357564..358343) product DUF2497 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967575.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(358611..359969) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087245.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(360148..360807) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971822.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 tRNA 361128..361201 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(361312..361962) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390319.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(361959..362168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 362300..363316 product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531122.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene cobD CDS 363354..364331 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972582.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene cbiB CDS complement(364358..365848) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142494290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(365845..366156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(366203..366835) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254597.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene cobO CDS complement(366832..370662) product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066873425.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene cobN CDS complement(370777..371889) product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975898.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene cobW CDS complement(371886..372422) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530724.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene cobU tRNA 373095..373170 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 373244..373319 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(374066..374818) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394513.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(374898..375989) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(375986..376912) product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066562.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 377243..377725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066559.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(377924..380854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 381296..382003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 382247..383545 product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 383564..384406 product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 384491..385720 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531472.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(385717..386529) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975520.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(386632..387303) product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338712.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene chrR CDS 387555..388589 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087225.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 388618..390117 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340260.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene cls CDS 390167..390814 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528810.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 390913..391626 product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 391669..392151 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532155.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 392161..393024 product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338566.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene sseA CDS complement(393227..393571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(393847..394170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 394120..394941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(395013..395744) product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972295.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(395758..396552) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(396625..397776) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532421.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(397786..399003) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969246.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(399259..400275) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532423.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 400561..401760 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393472.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(401844..402158) product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087215.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(402209..402964) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174100.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(402961..403908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(403924..405747) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087212.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 406004..406831 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531095.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 406857..407456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 408327..408647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 408854..409105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 tRNA complement(409172..409248) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(409313..409675) product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532440.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 410063..410296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 410427..410921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(410896..411597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 tRNA complement(412026..412102) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(412213..412734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(413076..413654) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530922.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(413808..414581) product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 414734..415174 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971878.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 tRNA 415386..415461 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 415677..416525 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391143.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(416568..417512) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(417686..418465) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(418462..419223) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(419235..420368) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(420373..421401) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812854.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(421576..422922) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723944.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 423498..424112 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920433.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(424131..424667) product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921635.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 424824..426866 product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970561.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 427032..427436 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532266.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 427544..428950 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 428955..430103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 430322..432607 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316667.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 432799..433515 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338250.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 433682..434398 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304053.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(434421..434702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 434631..435167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 435252..436103 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(436192..437685) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337282.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(437783..438289) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256275.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(438383..439276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(439420..439626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(439744..441564) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992394.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene recJ CDS complement(441670..442665) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531987.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene glpX CDS complement(442712..444016) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531990.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(444045..445262) product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969423.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(445438..445890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 446239..448047 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531993.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene phaC CDS 448402..448866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875932.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(448879..449856) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532211.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene speB CDS 450049..450996 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337926.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(451035..451784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(452068..452541) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975055.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene rpsI CDS complement(452541..453008) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532205.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene rplM CDS complement(453219..453644) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878205.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 453860..454678 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391002.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(454707..455582) product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172389.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 455723..456277 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 456401..457684 product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969134.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(457832..459307) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017264205.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 459393..459872 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969411.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(459900..462452) product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972107.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(462801..463433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(463518..464003) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384952.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 464097..467573 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643744.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene putA CDS 467908..468675 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976269.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 468840..471008 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170156.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 471038..471853 product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386588.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene fhuC CDS 471898..472752 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 472745..474775 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533592.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene fhuB CDS 474844..476580 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528963.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 476812..477366 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195598.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 477433..478410 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383116.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 478617..479747 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972998.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 479737..480807 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976079.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 480801..481550 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 tRNA 481697..481786 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 482134..482367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061391.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(482447..483952) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925786.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(483955..484437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 484586..485353 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384736.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 485595..486563 product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085864.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 486656..487222 product class I chromate reductase YieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291253.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene yieF CDS 487219..487884 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966152.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 488094..488360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 488784..491075 product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808393.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 491329..492678 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066639.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 492678..493988 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969983.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(494690..494959) product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532614.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 495418..495903 product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090502.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 496006..496506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(496529..496948) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312626.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 497281..499164 product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100176370.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(499159..500661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(501256..502740) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene gatB CDS 503009..503392 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(503405..503692) product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919773.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(503689..504408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(504405..504575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(505449..505937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 506210..506476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 506629..506880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(506892..507191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 507395..507628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(507709..509517) product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720276.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene mdoH CDS complement(509580..509816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(509798..511405) product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563902.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(511848..512954) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(513112..514596) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240741.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene gatA CDS complement(514683..514970) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531787.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene gatC CDS complement(515302..515571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 515464..515769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 515876..516379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(516620..517324) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531789.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 517471..518259 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084097.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(518363..519688) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(519701..520228) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(520236..521318) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene dctP CDS 521643..522155 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384481.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene ruvX CDS 522375..523304 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087855.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 523451..524359 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087859.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 524371..525672 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971533.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 525760..526425 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526685.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene plsY CDS 526428..527564 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969165.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene dprA CDS 527733..530567 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531916.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene topA CDS 530564..533005 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969163.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene rnr CDS 533005..533487 product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503574.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 533484..534242 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531919.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 534430..534597 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537640.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene rpmG CDS complement(534688..536403) product Cache 3/Cache 2 fusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088065.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 536734..536913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(537118..537489) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537642.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 537631..537930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 537923..538609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531934.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 538736..540037 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252179.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(540073..540882) product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 541243..541725 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561623.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 541759..542649 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087891.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 542733..544007 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087892.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 544269..545468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 545606..546034 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535003.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(546055..546396) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312555.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(546417..547175) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393451.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(547428..549899) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531774.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene clpA CDS complement(549912..550244) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312564.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene clpS CDS complement(550716..551048) product phasin PhaP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969250.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene phaP2 CDS 551716..553254 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969214.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(553296..553997) product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087915.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(554044..554820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(554936..555370) product DUF1489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531780.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(555591..555797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 556066..556821 product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531782.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(556707..557951) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921422.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(558082..558885) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535747.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 558952..559542 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252920.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 559661..560083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(560188..560949) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066512.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(561019..562245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(562361..562765) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969811.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(562901..563530) product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532593.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(563651..564076) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269427.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(564260..564688) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 564865..565689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(565727..567142) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531112.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene mgtE CDS complement(567364..567681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(567695..568039) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311727.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(568746..569927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 tRNA complement(570942..571028) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(571201..571467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 571610..572311 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258843.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene lipB CDS complement(572348..573538) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967685.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(573662..574273) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097992.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(574380..574676) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390404.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(574720..575631) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419994.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(575949..577241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(577362..578021) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958039.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(578099..580111) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531942.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 580406..580777 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene folB CDS 580881..581243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(581281..582813) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531455.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 583066..584490 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503502.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 584494..585444 product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061414.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 585526..586341 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972242.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 586560..587291 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 587349..588818 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404919.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene mgtE CDS complement(588823..589584) product ATP12 family chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975194.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(589584..590273) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385291.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 590461..590625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529243.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(590722..591747) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088122.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(591941..592303) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531444.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene crcB CDS complement(592390..593190) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655294.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(593223..594017) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655294.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(594310..596715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(596867..598174) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969201.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(598192..599661) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967063.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(599852..602035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(602341..602766) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707774.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene rplQ CDS complement(602853..603875) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088132.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(603964..604353) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603045.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene rpsK CDS complement(604420..604788) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531437.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene rpsM CDS complement(605056..605652) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531436.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(605649..606983) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531435.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene secY CDS complement(607031..607501) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene rplO CDS complement(607519..607713) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205449.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene rpmD CDS complement(607755..608321) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136332.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene rpsE CDS complement(608360..608722) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531433.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene rplR CDS complement(608735..609268) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531432.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene rplF CDS complement(609316..609714) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088139.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene rpsH CDS complement(609727..610032) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919140.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene rpsN CDS complement(610065..610622) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018239492.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene rplE CDS complement(610615..610932) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975178.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene rplX CDS complement(610932..611300) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495199.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene rplN CDS complement(611374..611604) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240643.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene rpsQ CDS complement(611615..611812) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205459.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene rpmC CDS complement(611833..612246) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390431.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene rplP CDS complement(612292..613020) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531426.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene rpsC CDS complement(613020..613400) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088147.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene rplV CDS complement(613403..613681) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507772.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene rpsS CDS complement(613694..614527) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531425.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene rplB CDS complement(614545..614838) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531424.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(614835..615455) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536623.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene rplD CDS complement(615455..616168) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969195.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene rplC CDS complement(616192..616500) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002712302.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene rpsJ CDS complement(616567..617757) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971964.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene tuf CDS complement(617805..619880) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975170.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene fusA CDS complement(619905..620375) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507761.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene rpsG CDS complement(620388..620759) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390503.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene rpsL CDS complement(621519..621812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(621919..626118) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316440.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene rpoC CDS complement(626208..630347) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531414.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene rpoB CDS complement(630627..631001) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390506.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene rplL CDS complement(631063..631581) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531412.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene rplJ CDS complement(631931..632629) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975163.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene rplA CDS complement(632634..633062) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088164.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene rplK CDS complement(633259..633789) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088165.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene nusG CDS complement(633848..634045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 tRNA complement(634149..634224) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(634347..635537) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971964.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene tuf tRNA complement(635707..635780) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(635802..635886) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 636507..637184 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921492.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene rlmB CDS complement(637195..637548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(637619..637927) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(638084..638269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 tRNA 638305..638380 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(638857..640428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(640776..641606) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538025.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(641606..642490) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398044.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(642487..643416) product manganese/iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385381.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(643502..644437) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242572.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 644734..645795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 645929..646729 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401481.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 646890..647417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(647505..648671) product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(648819..649874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(650103..650705) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328128.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(650715..651308) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975233.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 651602..652663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534713.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(652730..653557) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(654380..654835) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534698.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene hisI CDS complement(654892..655518) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495569.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene folE CDS 655897..656355 product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 656400..656747 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088273.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene yidD CDS 656934..658904 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975231.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene thrS CDS complement(660056..660490) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(660593..661381) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921493.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 662007..662666 product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531342.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 662915..663403 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176079.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(663470..664477) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200388.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 665053..665571 product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967896.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(665789..666325) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240524.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(666378..666704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 666941..667648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(667741..667956) product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535016.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(668043..668909) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175407.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene cysE CDS 669123..669884 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(670085..670840) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 671058..671315 product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602543.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 671376..672563 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088337.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 672699..673448 product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532015.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 673495..674004 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614148.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene gpt CDS 674278..674967 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379663.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(675459..676163) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188483638.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene sfsA CDS complement(676244..677689) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388889.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 tRNA complement(678091..678176) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 678431..679261 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174009106.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene map CDS 679317..680063 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969427.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene radC CDS 680213..682504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(682501..683484) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390694.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(683532..686195) product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532744.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene ppdK CDS 686602..688410 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085312.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 688437..689381 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336977.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 689869..690060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(690459..691475) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327536.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 691649..691888 product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327537.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 691882..692724 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085320.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(692763..693035) product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708254.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(693149..694057) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205484.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 694189..694668 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970751.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(694679..695104) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265948.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 695195..696187 product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265949.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene ftrA CDS complement(696151..696594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(696649..696918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 696808..697761 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532114.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 697765..698982 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532113.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(698979..699698) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(699701..700057) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258957.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(700147..700650) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083403.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(701071..702174) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(702348..702716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329310.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(702728..703459) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066617.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(703456..704301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(704298..705632) product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088418.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene livM CDS complement(705636..706565) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389504.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 707002..707538 product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816246.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene rutF CDS 707625..708635 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526837.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(708678..709427) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537999.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene map CDS complement(709627..713178) product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640689.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 713443..713820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(713893..715137) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523157.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 715262..716254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 716262..717068 product DUF2259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532119.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 717220..717891 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975644.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene rpe CDS complement(718316..718666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 718883..720211 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383544.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene purB CDS 720344..721084 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530111.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 721150..721647 product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968882.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 721785..722354 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240413.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(722389..723165) product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532125.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(723325..723648) product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(724008..725960) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463733.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 726644..727414 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532127.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 727562..727801 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314096.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene purS CDS 727921..728589 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650918.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene purQ CDS 728917..729171 product DUF2164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489304.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(729201..730109) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974404.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 730212..730748 product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(730896..731147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 731241..732755 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 732956..735196 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251802.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene purL CDS 735252..735485 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 735609..735941 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532137.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene grxD CDS 736233..736502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(736549..737568) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene ttcA CDS complement(737733..738350) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532142.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene rpsD CDS 738861..740618 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391353.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(740619..741422) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314071.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene murI CDS complement(741419..742261) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971925.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 742509..743738 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975672.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(743850..745091) product cyclic nucleotide-gated ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967190.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(745230..746600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 746579..746779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(746768..749425) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975673.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene alaS CDS complement(749791..750864) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532151.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene recA CDS 751271..752221 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140203.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 752310..753221 product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337748.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 753688..754167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(754297..756849) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531860.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(756934..758013) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088553.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene flhB CDS complement(758023..758796) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088554.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene fliR CDS complement(758816..759085) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088555.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene fliQ CDS complement(759149..759469) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390451.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(759614..760024) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602149.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene flgC CDS complement(760108..760524) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088557.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene flgB CDS complement(761763..762038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(762228..762506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 762466..762942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 762939..763712 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088559.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene fliP CDS complement(763829..767986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(768056..768748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(768745..769476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(769473..770705) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088568.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene fliM CDS complement(770751..771251) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088569.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene fliL CDS 771536..772279 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390469.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene flgF CDS 772301..773083 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919925.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene flgG CDS 773096..774073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 774070..774864 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088573.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene flgH CDS complement(775112..775528) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531862.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene dksA CDS complement(775694..776122) product flagellar assembly protein FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088579.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 776414..777529 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173283.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 777526..777855 product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390477.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 777852..778340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 778855..779241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 779999..781147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 781340..782503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 782695..783843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 784101..785585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 786102..787604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 787695..788183 product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088588.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene flbT CDS 788071..788445 product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008554779.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene flaF CDS complement(788627..790168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(790176..792026) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088594.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene flgK CDS complement(792105..793481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 793893..794735 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028152332.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 794750..795322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 795398..795925 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 795973..797478 product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531864.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 797475..798557 product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975680.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 798634..799809 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(799822..800610) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082522.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 800734..801963 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(802138..803568) product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038716188.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 803678..804235 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112313490.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(804313..804633) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532979.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(804775..805101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(805110..805331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 806001..811367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 sequence11 source 1..581045 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 239..658 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087349.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 609..1034 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070496.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 1078..1878 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529139.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene recO CDS complement(1891..3912) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104266.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 4355..6604 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532278.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene parC CDS complement(7191..7670) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971340.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene smpB CDS complement(7754..8632) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974875.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene dapA CDS 8885..9892 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532597.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(9990..11096) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532599.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(11623..12708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(13527..14648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(15516..16154) product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene parA CDS complement(16344..17546) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082409.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(17891..19222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(19234..20082) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene phnE CDS complement(20165..21079) product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061597.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene phnD CDS complement(21132..21974) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391686.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene phnC CDS 22554..23156 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172955.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 23290..23736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(23746..24114) product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(24244..25668) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971478.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 25795..26994 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531699.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene moaA CDS 26997..27329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(27383..28150) product DUF3306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970356.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(28147..28710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 28881..30995 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088232.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(31037..32137) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971806.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(32253..33176) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975732.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 33066..33383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(33420..34433) product DUF6352 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088230.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(34433..34927) product DUF6505 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970359.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(34932..35702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(35751..35942) product DUF6494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526979.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(36067..36240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(36237..37667) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967505.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(37681..38838) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970351.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(38877..39083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(39095..39280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(39299..39898) product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970352.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene fdh3B CDS complement(39914..42877) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706856.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(43081..43287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(43330..43938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(44436..45650) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392735.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 45998..47977 product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969356.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 48122..48799 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 48843..49436 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967669.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 49550..50725 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329124.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 50770..51666 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970347.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 51663..52346 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531703.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene mobA CDS 52343..52861 product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328558.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene mobB CDS 52858..54141 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389877.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 54416..55192 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328560.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 55311..56024 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971933.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 56021..56851 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969531.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 56974..58140 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390124.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(58146..59048) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109209.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 59149..59310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 59414..60295 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000663.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(60359..60850) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507846.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(61004..61423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 61787..63349 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966223.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(63421..64446) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328572.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene cobT CDS 64610..65455 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992315.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 65539..66720 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531323.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 66941..67648 product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531717.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(67668..68516) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971950.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(68565..69701) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172127.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene dusA CDS 69770..70651 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811290.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(70658..71167) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974554.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(71227..71667) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529131.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 71794..72702 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067746.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(72792..73646) product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974702.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(73663..74694) product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722599.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(74654..75655) product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336970.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 75829..76731 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(76855..77535) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252482.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(77538..78377) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339220.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(78379..79254) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561538.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(79395..80687) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339221.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(80771..81781) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339222.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 82025..82765 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339223.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(82884..84893) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384209.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(84971..85141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(85278..85397) product cytochrome bd-I oxidase subunit CydX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313811.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene cydX CDS complement(85410..86567) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973557.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene cydB CDS complement(86572..88167) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973556.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(88405..89910) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383174.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(90126..91958) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651734.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene cydD CDS complement(92666..94162) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968775.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 94328..95227 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327401.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(95220..96017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 96479..97450 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene mak CDS 97545..97931 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 98061..99143 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639973.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene gmd CDS 99145..100083 product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639972.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(100198..101598) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971781.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene sthA CDS 102020..102535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 102529..104493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(104580..105515) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088246.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 105450..105623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(105732..106973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(107062..107979) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459241.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 108095..108595 product lactoylglutathione lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109225.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 108940..111117 product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529939.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 111535..112113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 112341..112829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(112836..113909) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931011.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(113982..114491) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231010.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 114627..116168 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992239.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(116250..117314) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398980.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 117425..118450 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815710.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(118481..119113) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397352.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(119454..121298) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene ilvD CDS 121643..122881 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390317.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 123087..124277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 124387..125055 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090698.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(125195..126295) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337792.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(126433..127083) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043127834.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 127186..128196 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140036.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(128261..129541) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(129547..130119) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392310.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(130237..131238) product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525901.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(131370..131774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(131977..132456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 132605..133783 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966696.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 133874..134797 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 134794..135765 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 135762..136514 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040563.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 136511..137218 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 137299..138543 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976243.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(138560..139909) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946411.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(139973..140200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(140197..141021) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972415.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(141033..141488) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331941.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(141609..144197) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027997802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 144583..145749 product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310733.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 145875..147095 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083269077.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 147116..148261 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061518.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 148258..149412 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037469338.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 149409..150185 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310727.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 150274..151104 product bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086786.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 151158..152159 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113326.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(152236..153096) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172659.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 153196..154104 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530571.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(154351..156582) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 157112..157534 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530300.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 157629..158891 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973649.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene fabF CDS 158959..159516 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972196.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 159513..160061 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970759.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 160151..160336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 160344..160514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 160762..163095 product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973588.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 163268..163621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(163891..164340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(164625..165218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(165317..166477) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061528.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(166492..167517) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241956.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(167714..169615) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975625.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(169633..171516) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975624.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(171685..173565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(173760..174938) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061602.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 174937..175134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(175203..175694) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310724.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 175950..176801 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870818.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 176862..179507 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532626.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene pepN CDS 179678..182164 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532627.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(182262..185261) product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968993.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(185258..186670) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974841.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(186675..187361) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965709.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(187589..189127) product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327729.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(189335..190042) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 190302..191396 product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085824.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(191470..191694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 192087..192281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(192189..192719) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085912.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(192730..194724) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(194824..195261) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532635.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene ccmE CDS complement(195373..196458) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532636.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene ccmI CDS 196433..196564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(196689..198182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(198527..198976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532637.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(199099..200562) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(200552..201220) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(201257..201481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 201871..202617 product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015930683.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(202565..203263) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529238.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(203272..203643) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095835.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(203739..204137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975471.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(204134..204370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(204448..205305) product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975472.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(205332..206057) product DUF2793 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920229.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(206050..209919) product glycoside hydrolase TIM-barrel-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971295.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(209919..210380) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149776562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(210373..211272) product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(211286..211921) product DUF2460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337517.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 212017..212271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(212295..212885) product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972646.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(213071..213475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(213520..213933) product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719628.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(213967..214377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(214374..214712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(214709..215278) product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(215472..216821) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971286.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(216818..217321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(217318..217473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(217514..217753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(217764..218879) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971283.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 219149..219748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(219870..221198) product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235776816.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(221104..222057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(222590..223171) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108781965.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 223353..224039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 224118..225803 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 226054..227535 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463733.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(227559..228008) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327718.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 228175..230511 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085886.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 230508..231275 product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085885.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 231272..231838 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327715.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(231863..233032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(233029..234024) product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883998.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(234021..234440) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224916.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(234433..234786) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(234788..235663) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618919.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 236014..236973 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337355.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 237182..238696 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435814.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(238710..239627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(239692..239901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 240087..241322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(241344..241757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(241856..242659) product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974820.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(242753..244570) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085855.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 244683..244880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 245128..245745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 246008..246439 product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532659.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(246474..247382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(247396..247893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(248227..248646) product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085852.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(249070..249432) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971249.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene mnhG CDS complement(249429..249785) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974814.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(249782..250258) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971247.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(250260..251849) product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241048.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(251855..252232) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316622.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(252232..252651) product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316621.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(252651..255029) product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971245.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 255492..256433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 256592..256999 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971244.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene msrB CDS complement(257005..257487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 257663..258514 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170580.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(258511..258690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 258806..260776 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170147.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(260889..262508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 262870..263262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(263308..264258) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532665.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(264319..264774) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974792.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(265264..265860) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974789.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(266114..266986) product pyridoxine 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097798.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene pdxI CDS 267083..268006 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532207.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(268021..268893) product DUF6159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 269134..269886 product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037197.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 270012..270191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 270462..271163 product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971224.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 271234..271767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(271769..272059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 272303..273529 product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(273589..274446) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241072.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 274581..275855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 275922..276350 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893670.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 276499..277161 product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(277729..279888) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085838.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene scpA CDS complement(279885..281765) product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 282803..283504 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083882.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(283764..284156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 284404..285972 product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974780.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 286146..287582 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968407.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 287713..288294 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929870.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 288502..289107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(289150..290199) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182165467.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 290329..291363 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene meaB CDS 291407..292003 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085831.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 292049..293464 product TIGR03808 family TAT-translocated repetitive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532675.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(293473..294273) product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975664.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(294309..295340) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391327.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(295563..296756) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389837.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 296779..296964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(296974..298521) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(298539..298973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(299117..299359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 299383..299682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 299967..301535 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 301663..303468 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444553.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(303605..304153) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090485.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(304183..305253) product ornithine/lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529754.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene odc2 CDS 305137..305427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(306136..307275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 307541..308266 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970997.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 308267..309742 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(309879..310727) product TolB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396629.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(311331..313496) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528604.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 313893..314810 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066836.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 315059..317788 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720592.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(317901..318152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(318227..318787) product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175650.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(318824..319717) product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(319734..320945) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(320947..321828) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(321980..324400) product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(324397..324906) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(324918..325784) product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(326606..327958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(328325..329065) product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976004.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene mnmD CDS 329221..330363 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976003.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 330448..330921 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086914.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(331016..332326) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(332328..332951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(333026..334045) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065227.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene dctP tRNA complement(334448..334522) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 334947..335023 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 335167..336009 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(336025..336837) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187830.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(336895..338349) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256894.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene cysG CDS complement(338405..341101) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982243.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(341204..341647) product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088475.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene cynS CDS complement(341691..343454) product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(343535..344377) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(344506..344832) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530461.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene nirD CDS complement(344829..347282) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973414.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene nirB CDS complement(347306..349066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(349077..350159) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(350260..351669) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(352083..353252) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160926.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(353255..353842) product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 354210..355157 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533048.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 355284..355544 product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 355683..357149 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030046.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(357231..357791) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313905.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 357980..359101 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061685.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 359126..359452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(359510..361975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(362156..364621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 365003..365371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(365430..366905) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992401.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 367298..367966 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(368031..368648) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067426.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(368823..370211) product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939668.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(370329..370739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(370744..370866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(371062..372573) product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528581.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(372601..373959) product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845126.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(373956..375272) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970023.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(375269..375757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(375928..376947) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967084.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene dctP CDS 377096..377815 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970020.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 377921..378571 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388419.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(378605..379366) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013635657.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 379649..380728 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529297.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 381624..382412 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974395.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(382440..384080) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336772.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(384092..385252) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532690.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(385268..386191) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336773.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(386357..387943) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336774.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(388185..388637) product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976367.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 388860..390770 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529166.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 391523..392185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(392274..392972) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038721.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(392977..394056) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038722.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(394249..395442) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403189.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(395568..396476) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532109.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 396876..397580 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397009.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(397903..399990) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970510.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(400336..400992) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528866.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(401240..403285) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970510.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(403538..405133) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390250.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 405467..406021 product DUF2585 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972622.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(406135..406392) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314830.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene minE CDS complement(406389..407210) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976171.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene minD CDS complement(407262..408011) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene minC CDS 408266..409090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(409136..409450) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729016.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 409580..410740 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729017.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(410754..411506) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099978.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 411700..412911 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384689.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 413123..413986 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384688.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 413983..414912 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384687.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 414909..415640 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384686.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 415640..416368 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384685.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 416489..417949 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384684.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 418290..418640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 418866..419492 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090855.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 tRNA complement(419648..419723) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(420093..423200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(423227..424438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390100.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(424787..426385) product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384909.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(426991..427617) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530196.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(427669..427887) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435948.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene infA CDS complement(428053..428475) product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974421.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(428527..429021) product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974420.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(429100..430395) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084074.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene hisD CDS complement(430503..431015) product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530200.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(431173..432462) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530201.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene murA CDS complement(432691..433017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 tRNA 433471..433545 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(433754..434488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 434375..434770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 434867..435901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 435861..437066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 437189..437395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(437331..437558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 437662..438969 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920237.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(439079..439519) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339256.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene aroQ CDS complement(439693..440220) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 440617..441903 product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533608.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene hemA CDS 442101..442304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(442307..442456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(442456..444681) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085554.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(444684..445211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(445208..446677) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088522.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene ccoG CDS complement(446875..447753) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085551.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene ccoP CDS complement(447757..447912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(447917..448651) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085549.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene ccoO CDS complement(448666..450324) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085548.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene ccoN CDS complement(450626..451786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 451913..453295 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390257.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene hemN CDS complement(453328..454044) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967398.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(454353..454949) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083218.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(455615..456817) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970959.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 457170..460700 product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173555.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(460819..461454) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084012.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(462318..462785) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173696.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(463119..463352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 463353..463976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(464033..464881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(465098..465718) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(465805..467472) product cisplatin damage response ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921437.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 467875..469920 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313934.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(470001..470396) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972338.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(470446..470874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(470944..471981) product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083964.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 472202..474649 product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391937.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 474646..475377 product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000237.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene pdeM CDS complement(475442..476242) product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083972.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(476239..477168) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974359.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(477340..481515) product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241884.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 481979..482479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 482807..484603 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083977.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 484720..485355 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 485384..486592 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533658.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 486619..488847 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533657.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 489034..490083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 490351..491391 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918523.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 492006..492278 product DUF6460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172810.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(492282..493295) product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533619.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 493357..494706 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026613309.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(494720..495820) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241446.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(495817..496161) product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173552.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 496368..497012 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083957.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 497035..497970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(498009..498584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(498593..499693) product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530160.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 499946..501145 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310686.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(501241..501846) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391904.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 501994..502395 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706741.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene apaG CDS complement(502406..502819) product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530154.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 503042..504700 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099307999.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(504753..505550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 tRNA 505781..505854 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(505820..507751) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228162.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 507853..508722 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083951.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 508864..509517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105994.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(509600..510580) product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083919.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(510623..511552) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083918.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene argF CDS complement(511549..512751) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533643.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 513187..513753 product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530176.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(513931..514626) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493692.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene phoB CDS complement(514664..515374) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083915.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene phoU CDS complement(515459..516283) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467712.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene pstB CDS complement(516298..517638) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382999.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene pstA CDS complement(517638..519005) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337600.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene pstC CDS complement(519178..520215) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337601.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 520376..520534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(520613..521989) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992210.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene phoR CDS 522284..523183 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532737.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(523223..524188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 524449..525423 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085408.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(525444..526079) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532806.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene pdxH CDS 526154..526654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 526825..527832 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085412.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(527891..528757) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(528791..529528) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532807.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(529560..531341) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392664.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 531574..532569 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085356.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 533218..534012 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085438.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 534148..534417 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532792.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 534623..535780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(536236..536430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 536353..538161 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532789.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene dxs CDS 538323..539714 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314722.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(540018..540173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 540301..540852 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529534.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 540907..541530 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976183.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 541570..541704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 541754..542497 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971109.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 542595..543833 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971108.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 543915..544907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 544904..545665 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965071.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 545721..547040 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532799.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene ribB CDS 547241..548446 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531018.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 548517..549068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 549262..550221 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 550294..552114 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530644.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(552238..553143) product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267754.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene yghX CDS complement(553380..554468) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968904.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene aroC CDS 554755..557049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(557099..558271) product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391459.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(558369..558992) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707099.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 559223..559645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(559730..560548) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532347.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene fabI CDS 560721..562133 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971098.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 562336..562812 product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389404.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(562864..563694) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400622.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(563844..564611) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085350.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 564694..565206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085349.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 565279..565719 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921211.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 565846..566220 product TIGR02301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532565.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 566412..566684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008135624.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(566791..567423) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388953.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(567527..567748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 567816..568355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(568334..569032) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(569048..570319) product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530941.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(570467..571777) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969159.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(571981..572826) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531192.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 572960..573163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(573203..573625) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338894.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 573617..573772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(573874..575208) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145923747.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 575381..576265 product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085341.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 576318..576968 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265716.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 577051..577587 product tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531123.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 577587..578570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240927.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 578848..580020 product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968853.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 580244..580840 product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396117.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 sequence12 source 1..495498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(703..1395) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086475.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 2154..3368 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086489.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 3379..5406 product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086488.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(5485..6840) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(6844..8166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(8267..9373) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065227.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene dctP CDS complement(9721..11130) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029723090.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(11127..11846) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970997.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 12276..12737 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523768.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 12739..14913 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339094.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 14910..15578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(15647..16477) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972757.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(16474..17358) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311911.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(17442..18713) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972759.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(18788..19852) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311909.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(19863..21374) product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972760.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(21520..22449) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311907.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(22573..23619) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869311.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(23662..24468) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226900.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(24458..25237) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086102.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(25308..26021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(26025..27014) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965807.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 27241..28011 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972727.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 28028..28900 product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894369.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 28900..30063 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339538.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 30887..31153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 note possible pseudo, internal stop codon, frameshifted CDS 31665..32027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(32503..33084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 33262..33447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 33444..36800 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537424.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 tRNA complement(37065..37154) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 37183..37386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 37738..38346 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529062.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 38394..38663 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083253.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene rpmA CDS 38789..39397 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310979.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 39394..39987 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531224.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 40382..41428 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529067.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene obgE CDS 41428..42567 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972562.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene proB CDS 42623..43903 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258038.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 43900..44535 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393806.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 44700..45110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 45221..45673 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083264.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene rlmH CDS 45917..47407 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083265.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 47404..48744 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083266.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 48837..49976 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083267.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 49988..50518 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330099.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 50578..51345 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(51355..52479) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528621.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene queG CDS complement(52488..53180) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067730.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 53375..54181 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310140.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(54195..55202) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090584.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(55401..55610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(55693..56673) product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241620.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 tRNA 56858..56944 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 57128..57214 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 57459..59150 product CHASE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529277.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 59325..59945 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 60014..60658 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083545.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene lptC CDS 60655..61188 product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965157.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 61330..62142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 62214..63791 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083548.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene rpoN CDS 64070..64657 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327046.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene raiA CDS 64756..65226 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene ptsN CDS complement(65301..66065) product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086052.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(66055..67149) product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390744.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 67272..68132 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975884.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene cobA CDS 68132..69463 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969584.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 69599..70003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(70066..70833) product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391131.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene cobM CDS complement(70830..72686) product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526968.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene cobJ CDS complement(72656..73381) product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390738.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(73378..74595) product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390740.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(74592..74783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(74876..75121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(75118..75780) product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(75786..76907) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124958.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(76907..77191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 77672..78877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880001.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 78982..80271 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974850.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 80398..80916 product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(80992..81876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 82079..84235 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068954085.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 84538..86670 product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704432.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene fhuA CDS 86707..88356 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146602274.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 88404..88715 product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339024.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 88754..89878 product iron-siderophore ABC transporter substrate-binding protein YiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene yiuA CDS 89875..90957 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972996.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 90948..91739 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161751.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 91953..92690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 92680..93060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 93125..93523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 93553..94662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(94743..95345) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723970.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 95569..96813 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530682.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 96813..99953 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530683.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 100067..101494 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(102023..103753) product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(103854..104738) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(104759..104968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(105145..105825) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 tRNA complement(106001..106090) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 106407..106733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 106977..107636 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309948.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene msrA CDS 107966..108283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 108280..109761 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389995.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 109933..111729 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404430.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene pabB CDS complement(111726..112331) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528306.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(112488..114908) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970769.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene pheT CDS complement(114990..116072) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528309.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene pheS CDS complement(116419..117321) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968949.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 117462..117602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 117739..118098 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966773.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 118095..118697 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946004.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(118718..119296) product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(119406..121211) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067667.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene lepA CDS 121322..121840 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383066.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(121879..122664) product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967706.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene mepA CDS complement(122970..124022) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 124347..125393 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229495.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(125409..126005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(126159..126854) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390534.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(126939..128546) product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085524.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(128741..128941) product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene cspC CDS complement(129284..130969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(130993..131634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390583.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(131779..132639) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970799.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(132652..133491) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529576.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(133488..134444) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650244.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 134793..135665 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165113428.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 135938..136651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 136797..137285 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531265.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 137349..139709 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083168.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 139722..140522 product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083169.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(140621..143050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(143200..143802) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529556.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 144002..144331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 144493..144987 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531268.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene bfr CDS complement(145030..145731) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968331.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(145742..147454) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338059.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(147488..148771) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531965.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(148927..149796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(149877..152384) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640169.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene hrpB CDS complement(152424..153482) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528618.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(153479..153910) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310016.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(154073..154921) product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085427.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 155559..156542 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067250.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 156623..157621 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309949.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 157699..158706 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944638.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 158765..160297 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970667.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 160294..161400 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970668.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 161410..162387 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529631.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 162384..162782 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970669.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 162787..163599 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970670.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 163592..164371 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309955.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene deoC CDS 164373..165689 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529628.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene deoA CDS 165763..166986 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398358.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 167070..168056 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241800.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(168088..169446) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536011.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 169721..170980 product URC4/urg3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089973.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 171037..171666 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173511417.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene upp CDS 171677..172588 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970844.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 172639..173157 product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494178.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 173225..174724 product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090848.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 174925..175923 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310896.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(175966..176139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 176254..177003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(177034..177666) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532757.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 177753..178661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(178686..179276) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086720.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(179270..179731) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242000.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(179877..180359) product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084261.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 180884..181060 product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310069.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 181213..181728 product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084258.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 182029..182802 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083494.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene cpaB CDS 182799..184247 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173504.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 184256..184975 product CpaD family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651427.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 184984..186288 product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533681.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 186320..187786 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084253.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 187783..188808 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967818.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 188821..189807 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310061.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(189963..190742) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330514.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 191026..192414 product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 192490..192840 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533675.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 192994..193752 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173545.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(193749..194318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(194366..195568) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528468.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene rmuC CDS 195870..196388 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974268.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene def CDS 196432..197382 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968562.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene fmt CDS 197428..197967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 197976..198782 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918167.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene truA CDS 198956..199384 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109667275.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 199455..200636 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970848.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene dapE CDS 200642..201235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(201317..202165) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528480.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene dapD CDS 202386..203303 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968573.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(203308..204180) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878751.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene gcvA CDS 204336..204995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(204966..205709) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528482.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(205706..206593) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528489.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene argB CDS complement(206685..207329) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970858.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene yihA CDS complement(207388..208035) product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391018.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(208242..210053) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528504.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene yidC CDS complement(210059..210496) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090819.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene rnpA CDS 211039..211809 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968582.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 211844..213259 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327117.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 213358..214896 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175987.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 tRNA 215221..215297 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(215903..216109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 216276..217622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(217641..218120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(218123..219829) product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039194.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 219942..220709 product myo-inositol degradation transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030772.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 220750..221688 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929877.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 221685..222308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 222318..223913 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 224707..224928 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930015.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene nrdH CDS 224933..225337 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370076.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene nrdI CDS 225319..227466 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651373.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene nrdE CDS 227475..228452 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970636.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene nrdF CDS 228748..230100 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972924.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 230102..231172 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389784.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 231276..231893 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537566.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(231913..232320) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706317.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(232339..233733) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328106.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(233941..234141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(234586..235053) product iron-responsive transcriptional regulator RirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531245.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene rirA CDS complement(235222..236259) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255246.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(236387..237574) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 237683..238825 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970697.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(238852..240321) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532682.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene betB CDS complement(240361..242019) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532681.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene betA CDS complement(242044..242676) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532678.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene betI CDS 242950..243897 product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066528.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 244036..244884 product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396090.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene choW CDS 244881..245918 product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969913.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene choV CDS 246044..246895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 247001..247744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(247821..248984) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529684.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(249071..250459) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529683.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(250553..251920) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972090.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(252011..253093) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(253194..254534) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(254534..255130) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(255123..255923) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529680.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 256113..256979 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529679.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(257065..257277) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530020.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 257691..258023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(258082..258552) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086743.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(258549..259682) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918524.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 260033..261232 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388450.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(261285..262064) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598575.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 262548..263627 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968755.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 263665..265014 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031698.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 265143..266468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 266470..267696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 267757..269043 product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 269070..270131 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086008.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(270174..271841) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037608.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 272349..273515 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086701.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 273728..275173 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529561.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene cysG CDS 275185..275484 product DUF2849 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315350.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 275583..277241 product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975275.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 277228..277989 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563863.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 278110..278643 product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244790.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(278719..280110) product putrescine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084297.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene spuC CDS complement(280146..281561) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920966.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(281823..282536) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640678.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 282812..284272 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147522.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 284424..285515 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530248.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 285942..287099 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971011.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 287121..288044 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968767.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 288041..288862 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974521.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(288937..289215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 289426..290121 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889327.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 290132..290761 product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(290854..292572) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968770.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(292648..293694) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974534.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(293998..298920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 299521..299904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 300209..300727 product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327400.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 tRNA 301062..301138 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(301207..301749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 301943..302770 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529874.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(302827..303057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 302987..303691 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480275.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 303684..304004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(304015..305622) product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088812.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 305900..307567 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992325.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 307664..308110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(308491..311217) product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039059.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(311399..312229) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(312375..312902) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382932.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS complement(312933..314087) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 314410..315435 product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930618.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene dctP CDS 315523..316161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 316158..317528 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(317613..318143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(318238..319851) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037436470.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene xseA CDS 320011..320772 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968803.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 320947..322320 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968802.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 322403..323224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(323358..323723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 324030..324914 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530338.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(324927..325373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 325567..325845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 325848..326408 product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310073.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(326472..327608) product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040791.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(327642..328451) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530348.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 328664..329977 product DUF3422 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968806.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(330054..330431) product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973792.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(330584..331531) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974598.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 331718..333214 product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530350.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 333232..334425 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530351.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 334449..335774 product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530352.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene glcF CDS 335842..336525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(336541..337239) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971054.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 337124..337411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(337431..338141) product DUF2927 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172954.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 338403..339158 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174613.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 339316..339990 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974604.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(339998..340240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(340185..341165) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090257.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene hisG CDS complement(341162..342313) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090256.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(342313..343932) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399583.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene hisS CDS 344356..345543 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 345635..347143 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 347233..348030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 348404..349000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 349036..349476 product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530049.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(349466..349786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(350049..350258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(350430..352076) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968823.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene groL CDS complement(352135..352422) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706990.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene groES CDS complement(352794..353321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(353495..354997) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(355216..355953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(356230..356409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 356384..357763 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090210.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(357895..359229) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967298.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(359296..360750) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463825.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(360961..361716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532359.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(361812..362351) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174654.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene lspA CDS complement(362389..365352) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974616.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene ileS CDS complement(365653..366639) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401773.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 366845..368098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(368041..369048) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532363.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(369290..369739) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 369977..370360 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 370537..371220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(371293..372168) product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170199.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 372286..374241 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532334.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene mutL CDS complement(374272..377496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(377778..378209) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971070.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 378487..380145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 380145..380702 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241227.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene rsmD CDS complement(380767..381561) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970172.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 381962..382243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(382440..383306) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532353.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(383533..386784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(387355..388632) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532813.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene purD CDS 388864..389808 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173619.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene ubiA CDS complement(389931..390527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 390829..392172 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974625.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 392159..392974 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174622.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 393021..393248 product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533684.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 393284..393982 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532344.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 393933..395309 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532343.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene waaA CDS 395306..396358 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090246.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene lpxK CDS complement(396885..397109) product DUF2093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532341.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 397178..397387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 397505..398929 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968899.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene tldD CDS complement(399533..400048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 400238..400855 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108953.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 401004..402848 product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312313.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(402929..403471) product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185888.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 403976..404899 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974720.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene coxB CDS 404981..406576 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532779.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene ctaD CDS 406755..407690 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971137.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 407690..407875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 407894..408517 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309822.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 408568..409437 product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974725.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 409561..409944 product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503617.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 409990..410796 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082985.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(411143..411622) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241131.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(411797..412678) product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327605.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 413009..413590 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084308.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 413743..415149 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153458433.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene thrC CDS 415152..416441 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327609.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 416457..417095 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974736.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 417126..420032 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173457.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 420203..420385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 420494..420760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(420777..421691) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(421688..422158) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003511799.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene rnhA CDS complement(422155..423120) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084133.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(423126..424112) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971140.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene ispH CDS 424324..424968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 425394..426545 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390799.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene gcvT CDS 426574..426945 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088496.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene gcvH CDS 426950..427444 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707488.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 427920..429269 product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921182.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene gcvPA CDS 429266..430852 product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923258.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene gcvPB CDS 431021..431224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 432088..433368 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389785.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene tyrS CDS complement(433479..434375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 434569..435483 product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261730.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene bla CDS complement(435505..436680) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701054.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(436900..437646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(437883..439028) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311935.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 439483..440889 product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969100.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 441012..442523 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811138.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(442530..443129) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261712.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 443298..443861 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(443965..444450) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310955.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene bfr CDS complement(444620..445168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 445055..445321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(445372..446436) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486227.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene mutY CDS 446650..447273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 447548..448186 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309853.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 448337..451795 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532753.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene smc CDS 451890..452399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 452470..453219 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532843.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 453295..453519 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006206606.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 453621..454181 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392730.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 454195..454680 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974653.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(454824..455477) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971095.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(455523..456698) product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023808673.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 456812..457504 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085300.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 457661..458968 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 459085..460257 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(460341..461270) product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385747.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(461521..462078) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532836.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene moaB CDS 462341..463555 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969673.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 463658..464392 product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140133.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 464432..466732 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534110.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(466839..468419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 468945..470300 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061417.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(471138..472817) product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968999.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(473050..473352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 473560..474141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 474317..474961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 475111..476001 product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533284.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 476077..476310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(476329..477237) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200344113.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene gcvA CDS 477308..478312 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173806.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(478386..479549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(479957..481153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 481586..482542 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392709.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 482723..483277 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 483298..485265 product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392706.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(485280..486836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 487248..489341 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085323.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene glyS CDS complement(489529..489918) product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530539.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(489924..491156) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974900.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 491581..492663 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391193.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene nadA CDS 492802..494421 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391192.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 494418..495290 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969041.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene nadC sequence13 source 1..376916 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(270..1274) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974885.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene era CDS complement(1278..1985) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087822.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene rnc CDS complement(2033..3001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(3040..3624) product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532587.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(3713..4294) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532589.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene pyrE CDS complement(4327..6573) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532590.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(6779..7180) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527295.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene rpoZ CDS 7677..8258 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010915096.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 8270..8947 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(8996..9751) product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532274.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(9792..11615) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(11780..12181) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971440.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(12374..13705) product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921462.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(13783..14817) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966342.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene hemB CDS 15050..16111 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 16127..16537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 16674..17564 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene mmsB CDS 17728..18240 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087797.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 18742..20085 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529314.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 20284..20526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 20831..22144 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532252.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 22169..22678 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532250.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene nrdR CDS 22769..23902 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087792.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene ribD CDS 23841..24575 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532248.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 24757..25206 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312824.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 25212..25781 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532244.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene nusB CDS 25784..26815 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389573.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene thiL CDS 26956..28209 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532243.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 28470..30608 product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252216.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(30701..31138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 31251..31835 product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532235.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 31825..32397 product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971447.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 32582..33646 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975024.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene plsX CDS 33643..34620 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971448.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 34765..35073 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171641.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 35225..35866 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532230.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(35894..37243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(37359..38573) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222093.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 38965..39537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 39534..40172 product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390793.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(40769..41257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(41487..42980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(43073..43294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(43394..43684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 44029..44340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 44426..45265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 45258..45716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 45713..47878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 47950..48720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 48720..49367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 49364..49744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 49737..49991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 49988..50371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 50375..51016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 51050..51262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 51264..51521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 51525..52145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 52145..52495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 52603..53259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 53284..53511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 53518..53748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 53723..53932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 53929..54276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 54273..54569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 54571..55167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 55164..56837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169542415.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 56837..58426 product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072627.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 58429..59214 product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072628.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 repeat_region 59417..61170 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcggttggcctgacttttccagagtgctacaac CDS complement(61244..61588) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene cas2 CDS complement(61588..62520) product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene cas1 CDS complement(62578..65829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(66047..66235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 66320..67486 product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232421.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 67483..67866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 67920..68783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 68905..69285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 69293..69724 product DUF1320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071001.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 69733..70341 product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693592.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 70338..70766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 70763..71113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 71126..72052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 72239..72709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 72709..73080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 73077..75302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 75302..75928 product DUF2460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337517.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 75925..76809 product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 76806..77273 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971294.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 77273..81235 product glycoside hydrolase TIM-barrel-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971295.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 81232..81957 product DUF2793 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920229.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(82300..82818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 82970..83197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 tRNA complement(83377..83453) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(83500..84807) product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975044.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(84804..86450) product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304066.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(86447..87679) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532221.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(87788..88348) product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532220.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 88625..91117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(91215..92414) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966320.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 92724..93737 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083903.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(93697..93912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 94089..95174 product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532214.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 95210..96064 product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971568.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(96079..96513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 96788..97882 product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973611.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene nspC CDS 98068..99312 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976328.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 99644..99853 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003508146.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(100062..101054) product acrylyl-CoA reductase AcuI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336735.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene acuI CDS complement(101069..101716) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336736.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(101857..102795) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313850.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(103094..104731) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088540.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(104926..105474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(105501..106085) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947373.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(106187..106774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 107182..107904 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973645.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 108172..109278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 109403..112135 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966708.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(112210..113667) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531228.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 114054..115076 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 115079..116119 product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207160.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(116164..120546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(120609..122624) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530880.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(122838..123749) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530231.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene folD CDS 124075..125205 product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194378.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 125534..126649 product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974404.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 126633..127976 product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974404.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 128026..128832 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194054.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(128914..130299) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391972.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(130321..137949) product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563188.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(138367..139593) product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338923.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 139982..140794 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971635.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 141051..141917 product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926938.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(141968..142912) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002082140.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 143175..143906 product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 143903..145036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(145067..146935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 147271..147960 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086535.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 tRNA 148081..148155 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(148241..150019) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965394.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 150400..151101 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086536.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene rpiA CDS 151145..151660 product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531665.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 151901..153277 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971739.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene gor CDS complement(153416..154969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 155278..155871 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275214.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(155887..156612) product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 156822..158201 product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975719.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 158436..158999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 159257..160099 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400999.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 160214..161905 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531895.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 162080..163441 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531892.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene gltX CDS complement(163404..164798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 165397..166554 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083176.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 166723..167247 product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086924.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(167262..167447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 167824..169254 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971378.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene cysS CDS 169396..169743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 169749..170708 product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532557.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene pip CDS 170766..172373 product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564965.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene cimA CDS 172396..173325 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535550.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene rarD CDS complement(173412..174017) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170865.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 174372..176012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 176303..176674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 176781..178748 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969054.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 178933..179637 product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969055.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 179652..180542 product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086578.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(180564..181538) product bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049034212.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(181660..185226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(185223..186326) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529194.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(186356..186967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(187611..187778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 187981..188892 product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061422.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene puuE CDS complement(188970..190661) product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090030.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 191088..191981 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061538724.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 192147..192422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(192574..193746) product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973946.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene pobA CDS complement(193948..195288) product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765672.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 195358..195627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(195678..196883) product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528954.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene pcaF CDS complement(196895..197665) product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528953.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(197676..198533) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528952.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(198651..199277) product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366377.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene pcaG CDS complement(199281..200039) product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085121.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene pcaH CDS complement(200145..200537) product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392057.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene pcaC CDS complement(200530..201324) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969833.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 gene pcaD CDS 201458..202384 product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037467939.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene pcaQ CDS 202590..203618 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 203695..204192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 204185..205573 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 205826..206689 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene cysQ CDS 206756..207685 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532711.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene cysD CDS 207685..209625 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503688.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene cysN CDS 209821..210696 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971687.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene znuC CDS 210689..211489 product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975837.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene znuB CDS 211519..211929 product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971685.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene zur CDS 212119..213240 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972959.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(213343..213624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 214359..215051 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532849.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 215051..216415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 216473..217909 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972209.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene der CDS 218078..218860 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969391.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(218955..219689) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532529.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(219698..221170) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086836.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene purF CDS complement(221293..221904) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379721.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(222002..223402) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532526.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene radA CDS complement(223403..224563) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327819.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene alr CDS complement(224801..226285) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531702.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(226647..227234) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314572.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene rplI CDS complement(227398..227646) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203718.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene rpsR CDS complement(227653..228105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 228804..229748 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969068.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene fabD CDS 229827..230564 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086858.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene fabG CDS 230854..231090 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130699.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 231210..232445 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969069.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene fabF CDS 232649..233773 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086860.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene mltG CDS 233817..234710 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086861.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 234716..235414 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532512.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene gmk CDS complement(235467..236315) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314585.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene rsmA CDS complement(236318..237340) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532510.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene pdxA CDS complement(237357..238292) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504313.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(238621..241065) product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921454.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(241073..242167) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966780.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 gene lptG CDS complement(242171..243364) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532506.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene lptF CDS 243586..245088 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971399.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 245833..246285 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532504.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(246372..247394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 247517..248224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(248236..248937) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(248949..250841) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971407.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(250920..251963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 252246..252668 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531616.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene ndk CDS 252945..254966 product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532465.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 255266..255430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(255442..256098) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532446.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene purN CDS complement(256095..257177) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312859.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene purM CDS 257428..258522 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974991.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 258526..259224 product DnaA regulatory inactivator HdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532442.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene hdaA CDS 259364..261598 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171108.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 261600..263126 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532415.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene ppx CDS complement(263225..264397) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391103.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene rnd CDS 264571..265218 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804567.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 265485..267266 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338512.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene aspS CDS complement(267225..267434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 267433..269250 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973999.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(269288..271252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(271400..272605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS 272968..274596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 274804..275496 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529308.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 275501..276604 product multidrug efflux RND transporter periplasmic adaptor subunit VexC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069849.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene vexC CDS 276634..279717 product efflux RND transporter permease subunit VmeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene vmeI CDS 279905..280324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461511.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(280376..280870) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336828.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(280876..281694) product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392210.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 281915..282232 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719241.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(282254..283207) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215599.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(283566..284126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(284529..284816) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390987.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(284820..285083) product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390988.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(285247..286080) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088209.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(286233..287537) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 287954..288277 product sulfite-sensing transcriptional repressor BigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389407.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene bigR CDS 288279..288710 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 288713..289135 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(289162..289587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 290159..291154 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243046.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(291177..291953) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392253.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(291950..292936) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244131.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(293145..294443) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973446.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(294458..296080) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(296088..296948) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(296960..297829) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(297829..298950) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(299134..300210) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666442.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(300432..301949) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226022.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 302113..303219 product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene dgoD CDS 303226..304719 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193515.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 304846..305208 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530464.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(305292..306044) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035567.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(306149..306700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 306581..307105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(307117..308352) product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268636.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(308593..309741) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975371.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene dgoD CDS complement(309816..312497) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063890.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(312494..313609) product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931043.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 313816..314274 product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254297.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(314237..315157) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(315274..318963) product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087047.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 319760..320455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 320630..321016 product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975139.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(321072..321554) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972158.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(321667..322335) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143006.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 322620..323789 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 323962..325434 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507956.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene sufB CDS 325519..326271 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240388.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 gene sufC CDS 326291..327610 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087113.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene sufD CDS 327830..329077 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393009.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 329140..329538 product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971890.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 329652..330035 product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971889.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 gene sufA CDS 330041..330709 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090123.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene tenA CDS complement(330803..331861) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(332254..333846) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314108.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(334292..336436) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534725.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene parE CDS 337439..338305 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967247.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(338373..339155) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531286.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene xth CDS complement(339371..339712) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531288.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene erpA CDS 339986..341206 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534550.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 341299..343074 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971816.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene argS CDS 343145..345646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(346187..347194) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 347286..348353 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene nagZ CDS 348429..349226 product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531293.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 349223..349993 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171841.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene scpB CDS 349990..351123 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020487294.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 351263..351493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 351721..352206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 352203..352997 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328227.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene tatC CDS 353076..354350 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971811.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene serS CDS 354353..355114 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969283.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene surE CDS 355135..355887 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087512.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 356243..357835 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393411.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(358813..359685) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531304.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 359980..360315 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244709.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene yajC CDS 360399..362009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 note possible pseudo, frameshifted CDS 362027..362989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 note possible pseudo, frameshifted CDS 363134..363523 product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531307.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 363557..364408 product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172317.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(364505..364681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 364622..364900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 364897..365049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(365381..366808) product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531313.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene trmFO CDS 367061..367777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(368019..368168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(369494..369643) product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970249.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(369876..372842) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531840.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene uvrA CDS complement(372955..373119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 373554..374096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 374663..376708 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969521.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 sequence14 source 1..310394 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 1..77 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(225..1730) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973394.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(1723..2565) product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973395.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(2556..4298) product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973396.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(4358..5386) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969244.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(5343..6323) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312892.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(6339..7337) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973399.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(7350..8870) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973400.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(8953..9972) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312895.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(10217..11251) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252986.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 11453..12976 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252985.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 12973..14001 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721763.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 14101..15057 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563288.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS 15135..16190 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509042.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 16200..17357 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243283.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(17431..18186) product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105295.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(18177..18824) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244129.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(18821..20062) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266421.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(20059..20979) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124066.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(20976..21920) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970198.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(21917..22876) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066869295.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(22873..23838) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037436677.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(23831..25384) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530864.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(25522..26604) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398874.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 26773..27780 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538059.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(27873..28991) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140377.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 29328..29792 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339286.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 29822..30778 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339285.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 30869..32362 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 32366..33250 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339284.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 33247..34221 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339283.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 34271..35251 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339282.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene pdxA CDS complement(35302..36045) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562709.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(36056..37117) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174893321.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(37234..38658) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040324.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(38660..39274) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085510.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(39279..41330) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528563.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(41327..43063) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(43063..43929) product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064986.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(43920..44432) product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876462.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene hacB CDS complement(44429..45715) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064988.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(45712..46416) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(46409..47215) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(47208..48185) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(48189..49061) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(49132..50367) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807943.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(50434..51279) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 51367..51927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 52056..52775 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538160.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 53036..54097 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 54120..54635 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243030.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 54640..55953 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 56056..57015 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969507.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 57437..58444 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339540.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 58456..59400 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073418.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene cysT CDS 59402..60265 product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208510.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene cysW CDS 60262..61047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 61330..62439 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088955.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 62439..63278 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088926.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene fghA CDS 63468..66122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(66135..66512) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082826795.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(66513..66731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 66923..67915 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066596.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 68231..70387 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967073.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(70454..71767) product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530894.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene preA CDS complement(71792..73150) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530893.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(73581..75263) product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090058733.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(75260..76690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(76690..77874) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529273.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 78214..79245 product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563217.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene xylF CDS 79389..80714 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338770.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 80719..81504 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338769.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 81625..83076 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984027.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene xylB CDS 83089..84402 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067004.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene xylA CDS 84558..85292 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038195.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene otsB CDS 85313..87121 product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 87220..88596 product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390238.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(88622..89056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(89259..90305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(90336..90749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(90866..92893) product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS 93230..94696 product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene pap CDS complement(94735..95922) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083205.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 96419..97441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(97472..98662) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193319.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(98740..99951) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975703.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 100120..101043 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535214.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 101073..101993 product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091230.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene yegS CDS 102137..103885 product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703274.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 103940..105025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 105027..105929 product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(105946..106839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(106942..108027) product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027473.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene glgA CDS complement(108126..108326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31270 tRNA complement(108491..108567) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 109562..111571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(111657..114110) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390482.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene gyrB CDS complement(114266..115384) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527878.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 gene recF CDS complement(115461..116585) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970806.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene dnaN CDS complement(116742..118226) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083652.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene dnaA CDS complement(119488..119754) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241581.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene rpsT CDS complement(119937..120710) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(120806..121702) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968531.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene mutM CDS 121919..122722 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310167.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 gene ubiE CDS 122726..124309 product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397492.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene ubiB CDS complement(124333..124956) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 125201..127126 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309946.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene dnaK CDS 127358..128497 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067592.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene dnaJ CDS 128599..129237 product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598495.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 129321..129908 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 130022..130582 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083476.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene hslV CDS 130579..131685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304037.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 131727..133031 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083473.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene hslU CDS 133095..133589 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310195.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 133793..134350 product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310196.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 134502..135179 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968552.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene tsaB CDS 135176..135664 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310198.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 135725..136219 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310199.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 136206..137081 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527908.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 137249..138715 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327072.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene miaB CDS 138741..139820 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974256.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 139825..140361 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968555.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene ybeY CDS complement(140358..140537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 140536..141561 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399659.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 141694..143307 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083613.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene lnt CDS 143392..143562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 143493..143897 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327078.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 144018..145190 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383554.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene metK CDS 145263..145958 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310208.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene trmB CDS 146236..146823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 146895..148559 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968444.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene nusA CDS 148619..149272 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083606.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 149280..151937 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067639.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene infB CDS 152061..152480 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083604.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene rbfA CDS 152538..153482 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172518.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene truB CDS 153707..153976 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 gene rpsO CDS 154228..156351 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527890.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene pnp CDS 156308..156496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 156498..157310 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398299.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 gene dapB CDS 157335..157955 product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083512.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(158022..159023) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126540609.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(159052..159942) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(159997..160731) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527937.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 160920..161621 product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241721.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 161767..163206 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524734.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 163618..165078 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479983.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 165206..167131 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084241.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 167128..169029 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173514.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 169061..170176 product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527941.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 170179..171333 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527942.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 171343..172986 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(173036..174193) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527927.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(174321..174899) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970805.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(174896..175840) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527934.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 gene nudC CDS complement(175931..176344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(176462..177337) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183603351.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 177739..179667 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527932.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 179786..180106 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309920.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 180131..180739 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527928.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene recR CDS 180928..181596 product sulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528050.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(181621..181983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 182314..183219 product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531363.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 183522..183920 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330061.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene sdhC CDS 183932..184315 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene sdhD CDS 184321..186147 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970386.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene sdhA CDS 186163..187020 product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965090.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 187081..187863 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709621.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(188133..188963) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 189259..189903 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970385.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene msrA CDS complement(189914..190624) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004430439.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 190825..191346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(191357..193219) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324107.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene recQ CDS complement(193333..194226) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067143.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(194375..194782) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928900.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 195047..195499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(195545..196183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 196428..196949 product protease inhibitor Inh/omp19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037456298.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 197023..197790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 198053..199252 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393729.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene zapE CDS 199426..200388 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393726.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene mdh CDS 200468..201667 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530260.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene sucC CDS 201667..202575 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067153.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene sucD CDS 202782..205769 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970380.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 205840..207354 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003725.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene odhB CDS 207502..208905 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528854.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene lpdA CDS 209187..209675 product twin-arginine translocation pathway signal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965303.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 209681..210313 product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084064.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(210325..210744) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241064.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 210824..211525 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966301.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(211532..211963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(212325..212549) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014762084.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene rpsU CDS complement(212736..213704) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310850.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(213756..215060) product DUF1835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480179.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(215378..216031) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067139.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene fsa CDS 216277..218484 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970369.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 218813..219415 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067136.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 219415..220944 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389785.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene atpA CDS 220975..221862 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529037.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 221891..223315 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072597055.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene atpD CDS 223415..223825 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529039.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 224014..226008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(226104..228713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(229005..229214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(229517..231136) product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969439.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(231133..231831) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532111.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(231834..232466) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530072.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(232466..232828) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975638.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(232975..234585) product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968314.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 235199..235897 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008542552.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 235909..237726 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528336.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 237727..238233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 238339..238743 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532013.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 238789..239073 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311103.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 239519..239704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 239905..241293 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532016.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 gene ahcY CDS 241643..244051 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528331.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 244069..245598 product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528330.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 245630..246364 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083577.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 246368..249517 product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528328.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene addB CDS 249514..253023 product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968308.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene addA CDS 253108..253428 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968307.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene trxA CDS 253568..254221 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026613481.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene grpE CDS 254306..254944 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529571.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(255198..255554) product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974237.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(255643..255942) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974236.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(255953..256954) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327051.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene sppA CDS complement(257236..257667) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(257865..259565) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534399.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene rpsA CDS complement(259939..260565) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968453.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene cmk CDS complement(260562..261917) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968452.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene aroA CDS 262119..262565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32630 tRNA 262715..262790 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 262938..263013 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 263130..263561 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972826.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 263865..265172 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397418.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 265327..266163 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047141.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 266174..267016 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397422.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene ugpE CDS 267026..268108 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975293.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(268178..269374) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258908.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(269371..269742) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 269978..270406 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083554.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 270444..270731 product DUF1150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083553.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(270857..272080) product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268737.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(272140..273522) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 273881..274081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(274694..275455) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338588.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 275648..276433 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531940.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 276555..277553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS 277771..278997 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS 278994..280634 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086799.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 281184..281480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 281488..281853 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 281976..284117 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918321.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 284138..284641 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529946.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 284751..287447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 287525..288373 product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918323.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 288370..288987 product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918326.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 288998..290062 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811913.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 290097..291356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS 291366..291686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 291691..292938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS 292925..293518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(293533..295032) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(295029..295811) product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064130.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene phnX CDS complement(295823..296950) product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813122.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 297230..298078 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707282.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene panC CDS 298194..299012 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086824.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene panB CDS 299157..300638 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389402.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(300661..301557) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086485.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(301574..302965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(302997..303458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(303489..303749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(303755..305377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(305390..305953) product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089735.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 306526..306831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(306828..307118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(307143..307586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(307590..309299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 misc_feature complement(309367..>310394) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086476.1:flagellin locus_tag LOCUS_33090 sequence15 source 1..307148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 286..1260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(1257..2471) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086617.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(2595..4619) product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965916.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS 4767..5642 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098734.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS complement(5639..6562) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529430.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS 6689..8377 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140055.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 8441..8914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(8947..9408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 9854..10261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(10368..11378) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(11540..12454) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532260.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene ppk2 CDS complement(12628..13464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS 13534..13686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS 13883..14386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33230 tRNA complement(14410..14485) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(14617..16560) product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528911.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(16663..17913) product COG4223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972468.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 18059..18478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(18602..19309) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083395.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(19332..20177) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970392.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene hemC CDS 20339..21466 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393860.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene tsaD CDS 21564..22046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS 22058..23080 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083397.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 23122..23412 product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528905.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 23413..23838 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972462.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 23852..24529 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508815.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 24653..25825 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529349.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 26055..27848 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968945.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS 27918..28688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 28864..29976 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535893.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene leuB CDS 30077..30493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 30674..30850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS 30840..31214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 31376..32494 product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(32589..34796) product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390989.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 35394..36428 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003514078.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 36504..37211 product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993682.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(37246..37920) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819076.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(38031..38426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(38662..40485) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330113.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene typA CDS 40720..41172 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876608.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 41169..42395 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393947.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 42488..43306 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172291.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 gene folP CDS 43303..43797 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992279.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene folK CDS 44033..45283 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170122069.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(45280..45732) product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085262.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(45933..47168) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330161.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(47372..48022) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765127.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(48339..48827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS 48802..49035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(49032..50267) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310888.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene rlmN CDS 50455..50658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(50595..51104) product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529690.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 51375..51935 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(51958..52512) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 52709..53683 product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083359.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(54023..54832) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393770.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS 55153..55857 product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992323.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(55914..56420) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968485.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 56494..57399 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058717.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(57305..57925) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965381.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(58128..59438) product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721248.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene ccrA CDS 59710..61686 product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(61993..62268) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 62648..63700 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111198133.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(63707..64627) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529355.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(64664..64807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS 64997..65668 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175815.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS 65698..66864 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970120.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene aroB CDS 66861..68207 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066784.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(68255..68596) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066783.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS 68732..69322 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973195.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 69392..70378 product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529367.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene cobS CDS 70585..72495 product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527455.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene cobT CDS 72502..73554 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973193.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 73596..74222 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395790.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(74297..74950) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973191.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(74979..75272) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509888.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene rpmB CDS 75677..76531 product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966645.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS 76728..77684 product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310357.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS 78080..79330 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494184.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(79344..80111) product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528989.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(80104..81003) product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067391.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 gene pdxY CDS complement(81046..82323) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615358.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene ispG CDS 82548..83318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS 83528..84310 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529312.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS 84350..85381 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529189.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS 85908..86741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(86832..87650) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967744.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 87904..88194 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598721.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(88272..88490) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917997.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(88499..89179) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528774.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(89258..90223) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310301.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene trxA CDS complement(90307..90828) product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528772.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 tRNA 91089..91163 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 91309..91383 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 91650..91994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 note possible pseudo, internal stop codon CDS 92610..94040 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529438.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS 94040..95182 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529437.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(95191..96828) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329527.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 97133..97822 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242065.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene queC CDS 97815..98198 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533306.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene queD CDS 98195..98959 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975899.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene queE CDS 99016..99483 product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122403094.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene queF CDS complement(99493..100149) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968046.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS 100473..101594 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921599.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS 101591..104401 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970484.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS 104479..105165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS 105193..106206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 106320..106703 product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014535.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(106811..106954) product DUF3563 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527290.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(107318..108787) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086088023.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(108784..110334) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(110351..110821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(110860..111819) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930003.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(111907..113661) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399880.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS 113984..115237 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208960.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(115249..115953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 116052..117035 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038796.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 117507..117713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS 118362..118535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 repeat_region 118872..120144 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcgatccacgcccccgtgagggggcgac CDS complement(120339..120629) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384683.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene cas2 CDS complement(120641..121675) product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388588.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene cas1c CDS complement(121672..122343) product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388587.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene cas4 CDS complement(122347..123300) product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384680.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene cas7c CDS complement(123297..125051) product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384679.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene cas8c CDS complement(125048..125716) product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene cas5c CDS complement(125750..127741) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 127703..127936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS 128739..130217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(130223..131467) product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602456.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 131466..131780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS complement(131917..133029) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223883297.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(133148..134143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(134673..137645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34410 note possible pseudo, frameshifted CDS complement(137645..139567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS 140210..140398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS complement(140729..141070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 140954..143119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 143149..146307 product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083688.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene drmA CDS 146304..148124 product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 148127..149803 product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727568.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 150226..150372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 150473..150628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 150942..151400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 151611..151928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS 152613..152855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 note possible pseudo, frameshifted CDS 152855..153250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS complement(153592..154104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(154134..154472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(154947..155336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS 155610..156296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(156368..156550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS complement(156543..156851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34600 tRNA complement(157099..157175) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 157695..158438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS 158435..159970 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330170.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(160050..160934) product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529172.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(161177..161767) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535785.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS complement(162171..162362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(162398..162736) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972540.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(162920..163282) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529181.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(163339..166389) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563365.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 167187..170627 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102045028.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 gene pyc CDS complement(170796..171071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 171219..172172 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531758.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 gene htpX CDS 172405..173736 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 173870..175708 product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965110.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS 175880..177496 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529011.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene purH CDS complement(177548..178921) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083411.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS complement(179004..183809) product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090718.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 184234..185184 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532212.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene argC CDS 185237..185842 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531292.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene leuD CDS 185975..186847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(186865..187350) product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972548.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(187456..188139) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528898.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS 188516..188875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS 188988..189821 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972116.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 190022..190936 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083308.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene dapF CDS 190933..192201 product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528840.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene mtaB CDS 192251..193579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS 193759..194400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(194492..197185) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393923.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene acnA CDS 197794..200586 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS 200840..201433 product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972489.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene ccmA CDS 201430..202113 product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067292.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 gene ccmB CDS 202245..203012 product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083300.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS 203018..203209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 203206..203814 product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528832.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 203924..204742 product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083296.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 204904..205791 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338243.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 205951..206769 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397422.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 gene ugpE CDS 206786..207472 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086002.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS complement(207527..208747) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207506.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(209073..210386) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383316.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene amt CDS complement(210407..210745) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004444057.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(211282..211833) product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919983.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS 211950..212183 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388629.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(212198..212488) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528817.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS 212680..212925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35050 note possible pseudo, frameshifted CDS 212939..213145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 213198..213497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS 213592..214044 product host attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090683.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(214069..214929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(214998..216176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS 216367..217329 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533430.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(217321..219387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(219665..220522) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970092.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene gluQRS CDS 220504..220692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 220702..221355 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529433.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS complement(221362..222150) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083536.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS 222226..223425 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640128.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(223443..223979) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972484.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 gene thpR CDS complement(224196..225248) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532104.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(225302..225940) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067280.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS 226070..226774 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083291.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS 226771..229341 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528822.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 229528..230307 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310857.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(230455..230847) product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083295.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS 231386..231907 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136728.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(231953..232537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 232694..233224 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531185.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 gene ppa CDS complement(233283..233717) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389938.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(233809..234087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(234084..234608) product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529434.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(234605..235183) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 tRNA 235390..235474 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS 235719..237269 product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925999.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(237290..238030) product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203732.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene phnF CDS 238145..238648 product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529524.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 gene phnG CDS 238648..239283 product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529523.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene phnH CDS 239289..240425 product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440333.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 240422..241354 product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530631.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS 241356..242180 product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003524419.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 gene phnK CDS 242192..242893 product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529517.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 gene phnL CDS 242906..243580 product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971427.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS 243590..244345 product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061594.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 244353..245495 product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528377.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS 245506..246117 product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256056.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 gene phnN CDS complement(246133..249039) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061918.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS complement(249116..249811) product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244010.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene urtE CDS complement(249858..250604) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531846.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 gene urtD CDS complement(250608..251807) product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976303.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 gene urtC CDS complement(251804..253432) product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398880.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene urtB CDS complement(253622..254920) product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529436.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene urtA CDS 255311..258787 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972310.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS 258780..259700 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972311.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS 259842..261047 product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242132.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 261286..261480 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383043.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 gene rpmI CDS 261513..261872 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131615061.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 gene rplT CDS 262039..262284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(262310..262903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 263162..263497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 263788..264123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 264333..265205 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532727.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 gene rfbA CDS 265202..265774 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061738.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene rfbC CDS 265778..266851 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532725.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene rfbB CDS 266848..267666 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532724.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene rfbD CDS 267770..268981 product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811220.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS 268985..269638 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975455.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS 269671..270939 product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811220.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS 271005..271835 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930466.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS 272152..273789 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387750.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS 273871..275316 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387751.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 275449..275757 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387752.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 275822..277576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 277937..280741 product hemolysin-type calcium-binding region inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387748.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 280997..282547 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265659.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS complement(282554..284635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS 284864..285403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920888.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS 285536..286036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(286016..290296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS 290625..290924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS complement(291021..292730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS complement(292857..295328) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387755.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS 295558..296112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS complement(296117..297160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 297653..299740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS complement(299775..300752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(300736..301728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS 301699..301890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS 302104..303618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(303633..304664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(304812..306407) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528519.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene ggt CDS 306533..306964 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529227.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 sequence16 source 1..266740 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2433..4220 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073843.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS 4243..6420 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706513.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS 6488..7822 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958618.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS complement(7927..8958) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975906.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS complement(8951..9835) product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384671.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS complement(9932..10927) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339009.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 11433..11846 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313628.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS 11843..12805 product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339315.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS 12920..13738 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087316.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS complement(13796..14191) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705171.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS 14331..14936 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402250.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS 15000..16175 product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403601.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS complement(16195..17232) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327675.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS 17513..20434 product hemolysin-type calcium-binding region inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387748.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(20527..21960) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969572.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 gene gndA CDS 22192..23166 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976081.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS 23448..25163 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969669.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(25186..26232) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529321.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(26281..27198) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531163.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS 27394..27519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS 27752..28474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(28482..29315) product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298711.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(29333..30334) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160493.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(30647..33106) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529820.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS complement(33271..35355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 35677..36249 product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391811.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(36473..37255) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528491.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS complement(37252..37806) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327107.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(37913..39037) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311823.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(39169..39927) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384112.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS complement(40158..40913) product N-acyl-homoserine lactone dependent regulator BpsR3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188690.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene bpsR3 CDS complement(41147..42121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS complement(42252..43283) product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS complement(43301..44542) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975157.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 44785..45441 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173266.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS complement(45514..46554) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 gene arsB CDS complement(46625..47113) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS complement(47148..47507) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530549.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS complement(47596..48093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS complement(48258..49094) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527989.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(49094..49930) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527990.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(49935..50864) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378916.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(50882..51889) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723839.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(52007..53611) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723837.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS complement(53929..55422) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396049.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene glpK CDS complement(55739..58141) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337057.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(58317..59876) product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975153.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 60106..61221 product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089235.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS complement(61236..61667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS complement(61956..62366) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084990.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 gene fliJ CDS complement(62395..63720) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084989.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 gene fliI CDS 64096..64788 product cell cycle two-component system response regulator CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203583.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 gene ctrA CDS 64870..65295 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528627.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS complement(65361..66338) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669722.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS complement(66662..67537) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS complement(67534..68745) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197948963.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(68786..69157) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007600538.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS complement(69190..69672) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084983.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(69669..72392) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084982.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS complement(72527..73171) product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967810.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS complement(73277..73612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS 74019..74606 product EipA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329648.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 74732..76195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS 76259..77050 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531814.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(77102..78478) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115242.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 78506..78643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36550 tRNA complement(78723..78798) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 79116..79433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(79423..79779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS 79778..80803 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972327.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 80989..81879 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527567.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 gene rpoH CDS 82069..84288 product adenylate cyclase CyaD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969598.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 gene cyaD2 CDS complement(84358..85296) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257402.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(85320..86075) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972912.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS complement(86452..88275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529163.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(88578..89867) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529162.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS 90203..91102 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529170.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(91162..92325) product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(92481..93284) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973269.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(93513..94856) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529155.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 gene glmM CDS complement(95026..96945) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529152.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene ftsH CDS complement(97194..98585) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338400.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 gene tilS CDS complement(98557..99528) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene ybgF CDS complement(99757..100254) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529149.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 gene pal CDS complement(100386..101729) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970163.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 gene tolB CDS complement(101764..102729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(102736..103116) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529146.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 gene tolR CDS complement(103196..103903) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089890.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 gene tolQ CDS complement(104201..104662) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529144.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene ybgC CDS complement(104718..105758) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535962.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 gene ruvB CDS complement(105751..105993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(105990..106607) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084352.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene ruvA CDS complement(106621..107136) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535966.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 gene ruvC CDS 107237..107998 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992233.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS complement(108008..108310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS complement(108390..109136) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529113.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS complement(109249..110070) product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844839.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS complement(110077..110652) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066865.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS complement(111303..111674) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529252.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS complement(111682..111978) product DUF4164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529251.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 112456..114450 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535989.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene tkt CDS 114591..115601 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314726.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene gap CDS 115770..116963 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393616.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS 117216..118283 product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084337.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 gene fba CDS 118489..119130 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243372.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS 119134..120306 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084334.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 120453..121016 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529127.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 gene efp CDS 121097..121891 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529126.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS 122067..123062 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529124.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS 123069..124100 product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258142.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS complement(124183..124962) product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991851.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS complement(125138..126160) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084319.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 126271..126474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS 126997..127530 product DUF1465 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973290.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(127668..128279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(128413..128637) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084323.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 gene rpmE CDS 128857..130692 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970184.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(130709..132286) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529737.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(132431..133216) product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771267.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS complement(133263..133967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 134142..136016 product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173037.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS complement(136037..136186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 136137..137078 product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173040.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 137206..138579 product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS 138700..138981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 139067..140257 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965507.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 140254..140718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 140731..142125 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209603470.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 142212..142892 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002888348.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 gene rluA CDS complement(142906..143808) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529652.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS complement(143980..144207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS 144539..145927 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975424.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS complement(145970..147061) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089852.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS complement(147114..147602) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529209.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 gene purE CDS complement(147712..147918) product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536028.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 148196..148375 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529217.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(148526..150184) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532916.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS complement(150300..151049) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529133.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS 151305..153218 product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084127.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 153324..154115 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS 154458..156374 product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529738.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(156505..157764) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314675.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 gene pyk CDS complement(157938..158372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 159273..159569 product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314681.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 159677..159940 product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066896.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS complement(160040..161017) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529205.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS complement(161108..161848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS complement(161932..162120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37360 tRNA complement(162227..162301) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(162440..162799) product response regulator CpdR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709376.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 gene cpdR1 CDS 163020..163940 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210328225.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 164297..165088 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393508.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 gene hisN CDS complement(165105..166079) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090464.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(166243..166695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS 166983..167429 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066931.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS complement(167586..168629) product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313436.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS complement(168732..169316) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921090.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(169378..170184) product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975387.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(170174..171139) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534478.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS complement(171148..171447) product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845873.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 172196..176938 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970207.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene gltB CDS 177039..178481 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066926.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS complement(178564..179769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(179810..181075) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763248.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(181163..182788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS 182946..183956 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529724.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS 184087..184854 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086581.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS 184870..185724 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086582.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS complement(186201..186680) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090474.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(186680..187675) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531115.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS complement(187978..189045) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973308.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 gene hemH CDS complement(189335..192001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS complement(192028..193065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS complement(193148..194248) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS 194756..195514 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528216.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS complement(196012..197193) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529745.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS complement(197299..198012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 198238..199227 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970046.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS 199394..200500 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528225.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 200511..201485 product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329833.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS 201512..202018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 202036..203631 product oxamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705415.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene hpxW CDS 203697..204611 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529752.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(204874..205938) product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162675.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS complement(206187..206351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS 206316..208112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS complement(208513..209436) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066978.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS 209685..211823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS complement(211842..212999) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004433466.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS complement(213081..213584) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163013.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS complement(213720..214379) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180938030.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS complement(214559..215509) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081296127.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 215709..216197 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391368.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS complement(216225..216449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS complement(216852..217085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS 217306..218652 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379044.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene chrA CDS complement(218683..219273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(219381..219968) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531132.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(219968..220549) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173711.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS complement(220660..222066) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(222063..223400) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(223404..224285) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384595.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS complement(224282..225112) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS complement(225257..226258) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS complement(226281..226499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 226651..227040 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531125.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS 227260..228603 product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966720.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 228803..229675 product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368513.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 229771..230952 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129710.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS complement(230976..232127) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857629.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS complement(232236..232430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS complement(232327..232941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS 233545..234354 product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS complement(234445..235200) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529175.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(235197..235877) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535752.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS complement(235978..236751) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330185.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(237101..237484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(237757..238941) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811192.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS complement(238952..239776) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974782.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS 239964..240878 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089701.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS complement(240893..241669) product fumarylacetoacetate (FAA) hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532642.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(241696..242799) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525264.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS complement(242847..243773) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113699.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS complement(243789..245291) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085833.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(245311..245766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS complement(245879..246847) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085835.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS complement(246904..247341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS 247764..248912 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192588.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(248890..249819) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973719.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS 249987..250649 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428771.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(250723..251502) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186027.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(251527..253020) product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972889.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS complement(253031..254158) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192588.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(254279..254458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS 254594..255190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(255488..256306) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531522.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(256358..257242) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310642.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(257239..258138) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970865.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS complement(258135..259310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS complement(259386..260660) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310644.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS complement(260854..261453) product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173106.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 gene phnF CDS complement(261672..263375) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385517.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(263375..264307) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385516.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS complement(264319..265410) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385515.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS 265634..266437 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315679.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 sequence17 source 1..214836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(197..790) product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197432674.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 gene phaR CDS complement(1040..1240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS 1131..2312 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841641.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS 2468..3196 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709750.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 3374..4015 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067297.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(4062..4481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(4683..4835) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535764.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 gene rpmF CDS complement(5036..5677) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035262189.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 gene mtgA CDS 6072..6977 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529224.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS complement(6995..7921) product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(7940..9067) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529387.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 gene hisC CDS 9411..10607 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 10609..11241 product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 gene metW CDS complement(11245..12009) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973187.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 12141..12923 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529378.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 gene gloB CDS 12928..13383 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083055.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(13424..14158) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083382.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS complement(14262..14753) product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083384.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 15179..16441 product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926278.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS 16682..18184 product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527913.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS 18181..19269 product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064172.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 19271..20425 product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527911.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS complement(20503..20709) product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003505258.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS complement(20725..21612) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083330.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS complement(21718..22623) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394653.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS 22805..23254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS complement(23293..24327) product DUF2125 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973184.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS 24455..24991 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529391.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS complement(24988..25743) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973182.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS complement(25844..26587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS complement(26679..27749) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529399.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS complement(27762..28421) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010911739.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 gene ftsE CDS 28617..29507 product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965355.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS 29510..30070 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529401.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 gene hpt CDS 30074..30472 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084205.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 30663..32228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS complement(32262..34811) product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529406.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS complement(34972..36243) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529408.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene lysA CDS complement(36297..36566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS complement(36679..38064) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965353.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 gene argH CDS 38106..38774 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084198.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS complement(38846..39052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS complement(39089..39355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS complement(39537..39746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS complement(39935..40816) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084197.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS complement(40959..41891) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967734.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(41919..42668) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084195.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(42999..43574) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529427.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS complement(43611..43805) product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027544319.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS complement(44076..44564) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337983.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS complement(44649..45521) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336944.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS complement(45541..46791) product ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972543.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS 46926..47819 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970482.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 gene tesB CDS complement(47828..49060) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066792.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS complement(49200..49439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS complement(49585..50907) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529350.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(51239..51412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 51424..52278 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969965.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS 52352..52654 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525618.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS 52682..52879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS 52894..53181 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968460.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 53314..53619 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720474.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS 53645..54088 product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255339.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS 54153..55898 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066606.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 gene ureC CDS 55991..56596 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969342.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS 56593..57102 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035255861.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 gene ureE CDS 57186..57905 product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084275.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS 57902..58513 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066600.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 gene ureG CDS 58589..58987 product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553178.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS 59065..59433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 59557..61497 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174953.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 gene acs CDS complement(61570..62943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS complement(63099..63656) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329530.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS complement(64016..65434) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529677.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 gene leuC CDS complement(65751..66224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS complement(66471..67166) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528859.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 gene trmD CDS 67317..67823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS complement(67766..68332) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083314.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 gene rimM CDS complement(68389..68787) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529742.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 gene rpsP CDS complement(68809..69138) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330135.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS complement(69135..70703) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242460.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 gene ffh CDS 71153..72595 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969358.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS complement(73639..74316) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529027.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 74536..77145 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970579.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene leuS CDS 77132..77734 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398682.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 gene lptE CDS 77792..78835 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528740.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 gene holA CDS complement(79044..79943) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528737.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS complement(80054..80878) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083458.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS complement(80895..81551) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970584.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 gene rsmG CDS complement(81551..83431) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398688.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 gene mnmG CDS complement(83779..85128) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398690.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 gene mnmE CDS 85260..87269 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS complement(87305..87871) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105108.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS complement(88004..89269) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709824.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 gene rho CDS complement(89558..89986) product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528731.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 gene hemJ CDS complement(89990..91018) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972601.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 gene hemE CDS 91448..92320 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083464.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 92337..92930 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528728.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 92927..93772 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968287.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS 93769..94356 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528726.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 gene coaE CDS 94483..95199 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538049.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 gene dnaQ CDS complement(95196..96068) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867073.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS complement(96065..97051) product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS 97289..97837 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083590.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS complement(97934..98749) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527887.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 gene fabI CDS complement(98765..99988) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339105.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 gene fabB CDS complement(100149..100655) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527885.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 gene fabA CDS 101062..101544 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037377824.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS complement(101772..102644) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968399.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 gene nth CDS 102667..103209 product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS complement(103206..104390) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651802.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS complement(104557..107274) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968548.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 gene mutS CDS 107404..109686 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528054.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS 110085..110699 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536445.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS 110705..111919 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067442.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 gene trpB CDS 112298..112522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS 112682..113515 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083570.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 gene trpA CDS 113664..114590 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390512.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 gene accD CDS 114746..116080 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330401.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS 116139..117461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS complement(117451..118368) product bifunctional helix-turn-helix domain-containing protein/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531939.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS complement(118453..118905) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313709.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 119046..119981 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313710.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 gene rocF CDS 119985..121079 product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533363.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS 121590..122921 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408510.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 123066..123590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(123621..124358) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241618.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 gene pyrF CDS 124619..125212 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390535.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 gene hisB CDS 125224..125730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS 125727..126380 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067466.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 gene hisH CDS 126403..127143 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970620.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 gene hisA CDS 127268..128050 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330419.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 gene hisF CDS 128107..128430 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311110.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS 128501..129466 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027543772.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 gene coaA CDS complement(129639..130730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS complement(130741..131307) product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082901.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(131311..131754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS complement(131950..133929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS complement(134047..134604) product ActR/PrrA/RegA family redox response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528072.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS complement(134686..136026) product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS 136227..136715 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330375.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 gene secB CDS complement(136819..137628) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083588.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 gene moeB CDS complement(137659..137940) product CPCC family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877836.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS complement(137947..138996) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083502.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 gene hrcA CDS 139261..139974 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083501.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 gene rph CDS 140019..140657 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970821.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 gene rdgB CDS 140657..141832 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310172.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 gene hemW CDS 142153..143814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 143934..144347 product DUF2852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968303.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS 144468..145283 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970604.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS complement(145320..147500) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970655.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS 147663..147971 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083510.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS complement(148070..149002) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310189.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(149341..151956) product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529573.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(152191..153717) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528602.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS 153919..154158 product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315820.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS 154292..154774 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS complement(154864..157863) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970660.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 gene polA CDS complement(157944..158258) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970345.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS complement(158277..158558) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085796.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS complement(158623..159702) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967713.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS complement(159840..160385) product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968289.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS 160621..161367 product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528722.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS 161364..162608 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528721.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 162605..163228 product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083471.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS 163237..163608 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528719.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS 163738..166563 product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528060.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS 166611..168173 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327063.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 gene murJ CDS 168290..169369 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528062.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 gene trpS CDS 169513..170466 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055970141.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 gene speB CDS complement(170600..171346) product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529742.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS complement(171562..172506) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083495.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 gene gshB CDS complement(172634..173044) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210328395.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS complement(173049..173996) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310149.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 gene rsmI CDS 174234..175454 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000235.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS 175516..176739 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067760.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 gene coaBC CDS complement(176748..177563) product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075524.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS 177799..178248 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880090.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 gene dut CDS 178367..179326 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310159.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 gene cysK CDS complement(179612..180781) product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531151.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS 180972..181784 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113014.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 gene modA CDS 181810..182517 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090882.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 gene modB CDS 182510..183637 product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531025.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 gene modC CDS 183650..185365 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061620.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS 185383..186738 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061619.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS 187025..188032 product TRAP transporter solute-binding subunit DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476112.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 gene dctP CDS 188219..188839 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438261.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS 188851..190254 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479029.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS complement(190332..191426) product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921469.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS 191463..192752 product citrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083014.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS complement(192788..193252) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977093.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS complement(193249..194082) product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395810.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS complement(194293..194574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS complement(194723..196522) product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528004.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS complement(196567..198294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS complement(198783..200492) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064774.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS complement(200502..201449) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040761.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS complement(201463..202434) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965796.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS complement(202528..204114) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085661.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS complement(204315..206003) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972416.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS 206202..207548 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS 207664..208023 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172345.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS complement(208043..208459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS complement(208640..209542) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026161017.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS 209652..209948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS complement(209955..210551) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114018.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS 210631..212037 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401297.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS 212179..212973 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337285.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS 212970..213614 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337284.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS 213677..214231 product BioY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391133.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS complement(214412..214720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40430