>Feature sequence001 93 248 gene locus_tag LOCUS_00010 93 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 415 224 gene locus_tag LOCUS_00020 415 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 979 1335 gene locus_tag LOCUS_00030 979 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00030 1713 2474 gene locus_tag LOCUS_00040 1713 2474 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387025.1 protein_id gnl|my_center|LOCUS_00040 2429 3202 gene locus_tag LOCUS_00050 2429 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4160 3246 gene locus_tag LOCUS_00060 4160 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4341 4416 gene locus_tag LOCUS_t00010 4341 4416 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4748 4584 gene locus_tag LOCUS_00070 4748 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4920 5090 gene locus_tag LOCUS_00080 4920 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 5139 5486 gene locus_tag LOCUS_00090 5139 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 5706 5542 gene locus_tag LOCUS_00100 5706 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 5893 6075 gene locus_tag LOCUS_00110 5893 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 6876 6145 gene locus_tag LOCUS_00120 6876 6145 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957681.1 protein_id gnl|my_center|LOCUS_00120 7070 7270 gene locus_tag LOCUS_00130 7070 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 7434 8000 gene locus_tag LOCUS_00140 7434 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 8111 8431 gene locus_tag LOCUS_00150 8111 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 8934 8509 gene locus_tag LOCUS_00160 8934 8509 CDS product DUF1885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163299.1 protein_id gnl|my_center|LOCUS_00160 10663 9194 gene locus_tag LOCUS_00170 gene speA 10663 9194 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244780.1 protein_id gnl|my_center|LOCUS_00170 10855 12039 gene locus_tag LOCUS_00180 10855 12039 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_00180 12915 12226 gene locus_tag LOCUS_00190 12915 12226 CDS product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232300.1 protein_id gnl|my_center|LOCUS_00190 13165 13761 gene locus_tag LOCUS_00200 13165 13761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 13943 15538 gene locus_tag LOCUS_00210 gene gntK 13943 15538 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450003.1 protein_id gnl|my_center|LOCUS_00210 15617 15742 gene locus_tag LOCUS_00220 15617 15742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00220 15739 17028 gene locus_tag LOCUS_00230 gene gndA 15739 17028 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_00230 17350 17051 gene locus_tag LOCUS_00240 17350 17051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 17478 18014 gene locus_tag LOCUS_00250 17478 18014 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 protein_id gnl|my_center|LOCUS_00250 18086 19387 gene locus_tag LOCUS_00260 gene aroA 18086 19387 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479628.1 protein_id gnl|my_center|LOCUS_00260 19408 19842 gene locus_tag LOCUS_00270 19408 19842 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151390.1 protein_id gnl|my_center|LOCUS_00270 19935 20534 gene locus_tag LOCUS_00280 19935 20534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 20680 21003 gene locus_tag LOCUS_00290 20680 21003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 20931 21404 gene locus_tag LOCUS_00300 20931 21404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00300 21801 22562 gene locus_tag LOCUS_00310 21801 22562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00310 22559 24331 gene locus_tag LOCUS_00320 gene ptsP 22559 24331 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_00320 24901 24371 gene locus_tag LOCUS_00330 24901 24371 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723656.1 protein_id gnl|my_center|LOCUS_00330 25027 25461 gene locus_tag LOCUS_00340 25027 25461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 25607 26020 gene locus_tag LOCUS_00350 25607 26020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 26057 26413 gene locus_tag LOCUS_00360 gene ytxJ 26057 26413 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073516751.1 protein_id gnl|my_center|LOCUS_00360 26645 27493 gene locus_tag LOCUS_00370 gene ccpA 26645 27493 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103304.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00370 29670 28495 gene locus_tag LOCUS_00380 29670 28495 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398517.1 protein_id gnl|my_center|LOCUS_00380 30467 29835 gene locus_tag LOCUS_00390 gene acuA 30467 29835 CDS product acetoin utilization protein acetyltransferase AcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229296.1 protein_id gnl|my_center|LOCUS_00390 30700 32424 gene locus_tag LOCUS_00400 gene acsA 30700 32424 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 protein_id gnl|my_center|LOCUS_00400 33091 32513 gene locus_tag LOCUS_00410 33091 32513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 33891 33091 gene locus_tag LOCUS_00420 33891 33091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00420 34316 33792 gene locus_tag LOCUS_00430 34316 33792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00430 35410 34316 gene locus_tag LOCUS_00440 35410 34316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00440 36080 36400 gene locus_tag LOCUS_00450 36080 36400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00450 36550 37332 gene locus_tag LOCUS_00460 36550 37332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00460 37571 38098 gene locus_tag LOCUS_00470 37571 38098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460096.1 protein_id gnl|my_center|LOCUS_00470 38648 39646 gene locus_tag LOCUS_00480 38648 39646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00480 40295 39696 gene locus_tag LOCUS_00490 gene rpsD 40295 39696 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229304.1 protein_id gnl|my_center|LOCUS_00490 40672 42597 gene locus_tag LOCUS_00500 40672 42597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 42662 43444 gene locus_tag LOCUS_00510 42662 43444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 43518 44243 gene locus_tag LOCUS_00520 43518 44243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00520 44195 44632 gene locus_tag LOCUS_00530 44195 44632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00530 44717 44959 gene locus_tag LOCUS_00540 44717 44959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 45097 45387 gene locus_tag LOCUS_00550 45097 45387 CDS product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135695.1 protein_id gnl|my_center|LOCUS_00550 45507 45890 gene locus_tag LOCUS_00560 45507 45890 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015712.1 protein_id gnl|my_center|LOCUS_00560 46566 45940 gene locus_tag LOCUS_00570 46566 45940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00570 >Feature sequence002 229 1377 gene locus_tag LOCUS_00580 229 1377 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_00580 2392 1457 gene locus_tag LOCUS_00590 2392 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00590 4177 3164 gene locus_tag LOCUS_00600 4177 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00600 4539 4922 gene locus_tag LOCUS_00610 4539 4922 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687512.1 protein_id gnl|my_center|LOCUS_00610 4924 5625 gene locus_tag LOCUS_00620 4924 5625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403437.1 protein_id gnl|my_center|LOCUS_00620 5622 6392 gene locus_tag LOCUS_00630 5622 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 7630 6686 gene locus_tag LOCUS_00640 7630 6686 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287753.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00640 7775 8059 gene locus_tag LOCUS_00650 7775 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 7993 8664 gene locus_tag LOCUS_00660 7993 8664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00660 9485 8709 gene locus_tag LOCUS_00670 9485 8709 CDS product DUF3891 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577271.1 protein_id gnl|my_center|LOCUS_00670 10483 9482 gene locus_tag LOCUS_00680 10483 9482 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973947.1 protein_id gnl|my_center|LOCUS_00680 10668 13577 gene locus_tag LOCUS_00690 10668 13577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 13710 14690 gene locus_tag LOCUS_00700 13710 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00700 15055 15534 gene locus_tag LOCUS_00710 15055 15534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00710 16696 15710 gene locus_tag LOCUS_00720 gene cytR 16696 15710 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644897.1 protein_id gnl|my_center|LOCUS_00720 16923 19382 gene locus_tag LOCUS_00730 16923 19382 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_00730 20506 19595 gene locus_tag LOCUS_00740 20506 19595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 20661 21812 gene locus_tag LOCUS_00750 20661 21812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 >Feature sequence003 308 12 gene locus_tag LOCUS_00760 308 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 748 305 gene locus_tag LOCUS_00770 748 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 974 741 gene locus_tag LOCUS_00780 974 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 1569 967 gene locus_tag LOCUS_00790 1569 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 1741 1559 gene locus_tag LOCUS_00800 1741 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 2034 1783 gene locus_tag LOCUS_00810 2034 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 2397 2161 gene locus_tag LOCUS_00820 2397 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 2782 2417 gene locus_tag LOCUS_00830 2782 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 3082 2825 gene locus_tag LOCUS_00840 3082 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 4204 3095 gene locus_tag LOCUS_00850 4204 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 4599 4243 gene locus_tag LOCUS_00860 4599 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 5299 4610 gene locus_tag LOCUS_00870 5299 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 5830 5339 gene locus_tag LOCUS_00880 5830 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 6045 5836 gene locus_tag LOCUS_00890 6045 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 6477 6292 gene locus_tag LOCUS_00900 6477 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 6948 6610 gene locus_tag LOCUS_00910 6948 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 7784 6948 gene locus_tag LOCUS_00920 7784 6948 CDS product phage antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286575.1 protein_id gnl|my_center|LOCUS_00920 8075 7878 gene locus_tag LOCUS_00930 8075 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 8348 8587 gene locus_tag LOCUS_00940 8348 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 9160 10602 gene locus_tag LOCUS_00950 9160 10602 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_00950 >Feature sequence004 950 1417 gene locus_tag LOCUS_00960 950 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00960 1363 1908 gene locus_tag LOCUS_00970 1363 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00970 1933 2598 gene locus_tag LOCUS_00980 1933 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00980 2502 2816 gene locus_tag LOCUS_00990 2502 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00990 2946 4376 gene locus_tag LOCUS_01000 2946 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01000 4483 4671 gene locus_tag LOCUS_01010 4483 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 4989 4741 gene locus_tag LOCUS_01020 4989 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 5583 6623 gene locus_tag LOCUS_01030 5583 6623 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258545.1 protein_id gnl|my_center|LOCUS_01030 6620 7771 gene locus_tag LOCUS_01040 6620 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01040 7755 8831 gene locus_tag LOCUS_01050 7755 8831 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583801.1 protein_id gnl|my_center|LOCUS_01050 8812 9513 gene locus_tag LOCUS_01060 8812 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01060 9510 10232 gene locus_tag LOCUS_01070 9510 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01070 10479 11546 gene locus_tag LOCUS_01080 gene ssuD 10479 11546 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268305.1 protein_id gnl|my_center|LOCUS_01080 11585 13090 gene locus_tag LOCUS_01090 gene hpaB 11585 13090 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228328.1 protein_id gnl|my_center|LOCUS_01090 13044 14348 gene locus_tag LOCUS_01100 gene hpaB 13044 14348 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228328.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01100 14333 14521 gene locus_tag LOCUS_01110 14333 14521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 14546 15631 gene locus_tag LOCUS_01120 gene sfnG 14546 15631 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267559.1 protein_id gnl|my_center|LOCUS_01120 15653 16420 gene locus_tag LOCUS_01130 15653 16420 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225835.1 protein_id gnl|my_center|LOCUS_01130 16413 17075 gene locus_tag LOCUS_01140 16413 17075 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342247.1 protein_id gnl|my_center|LOCUS_01140 17084 17917 gene locus_tag LOCUS_01150 17084 17917 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225833.1 protein_id gnl|my_center|LOCUS_01150 18328 18936 gene locus_tag LOCUS_01160 18328 18936 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948716.1 protein_id gnl|my_center|LOCUS_01160 19086 20210 gene locus_tag LOCUS_01170 gene zinU 19086 20210 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_01170 20099 20302 gene locus_tag LOCUS_01180 20099 20302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01180 20444 20890 gene locus_tag LOCUS_01190 20444 20890 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831164.1 protein_id gnl|my_center|LOCUS_01190 21080 21289 gene locus_tag LOCUS_01200 21080 21289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01200 21487 22467 gene locus_tag LOCUS_01210 21487 22467 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195683.1 protein_id gnl|my_center|LOCUS_01210 22534 23172 gene locus_tag LOCUS_01220 22534 23172 CDS product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190362.1 protein_id gnl|my_center|LOCUS_01220 23178 24026 gene locus_tag LOCUS_01230 23178 24026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 24251 25756 gene locus_tag LOCUS_01240 24251 25756 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876423.1 protein_id gnl|my_center|LOCUS_01240 25828 26709 gene locus_tag LOCUS_01250 25828 26709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01250 26797 26970 gene locus_tag LOCUS_01260 26797 26970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 26967 27443 gene locus_tag LOCUS_01270 26967 27443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01270 27632 28324 gene locus_tag LOCUS_01280 27632 28324 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021173.1 protein_id gnl|my_center|LOCUS_01280 28321 28848 gene locus_tag LOCUS_01290 28321 28848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 28869 29582 gene locus_tag LOCUS_01300 28869 29582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 29594 30805 gene locus_tag LOCUS_01310 29594 30805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 30798 31604 gene locus_tag LOCUS_01320 30798 31604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142031.1 protein_id gnl|my_center|LOCUS_01320 31729 33834 gene locus_tag LOCUS_01330 31729 33834 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_01330 33831 34703 gene locus_tag LOCUS_01340 33831 34703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142031.1 protein_id gnl|my_center|LOCUS_01340 35264 35806 gene locus_tag LOCUS_01350 35264 35806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 35785 36783 gene locus_tag LOCUS_01360 35785 36783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01360 37054 38109 gene locus_tag LOCUS_01370 37054 38109 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742142.1 protein_id gnl|my_center|LOCUS_01370 38093 39886 gene locus_tag LOCUS_01380 gene yesM 38093 39886 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_01380 39883 41424 gene locus_tag LOCUS_01390 39883 41424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 >Feature sequence005 560 51 gene locus_tag LOCUS_01400 gene mscL 560 51 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_01400 749 1918 gene locus_tag LOCUS_01410 749 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01410 2214 2543 gene locus_tag LOCUS_01420 2214 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01420 2727 3245 gene locus_tag LOCUS_01430 2727 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01430 3176 3772 gene locus_tag LOCUS_01440 3176 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 4150 3863 gene locus_tag LOCUS_01450 4150 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 4357 4214 gene locus_tag LOCUS_01460 4357 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 5156 4449 gene locus_tag LOCUS_01470 5156 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 6055 5183 gene locus_tag LOCUS_01480 6055 5183 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949071.1 protein_id gnl|my_center|LOCUS_01480 6954 6052 gene locus_tag LOCUS_01490 6954 6052 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066537.1 protein_id gnl|my_center|LOCUS_01490 8301 6967 gene locus_tag LOCUS_01500 8301 6967 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_01500 9288 8332 gene locus_tag LOCUS_01510 9288 8332 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776036.1 protein_id gnl|my_center|LOCUS_01510 10085 9390 gene locus_tag LOCUS_01520 10085 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01520 10495 9968 gene locus_tag LOCUS_01530 10495 9968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01530 11351 11028 gene locus_tag LOCUS_01540 11351 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 11974 11372 gene locus_tag LOCUS_01550 11974 11372 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886465.1 protein_id gnl|my_center|LOCUS_01550 13179 11995 gene locus_tag LOCUS_01560 13179 11995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 14399 13242 gene locus_tag LOCUS_01570 14399 13242 CDS product diglucosyl diacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594708.1 protein_id gnl|my_center|LOCUS_01570 16611 15388 gene locus_tag LOCUS_01580 16611 15388 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402273.1 protein_id gnl|my_center|LOCUS_01580 16848 17615 gene locus_tag LOCUS_01590 16848 17615 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447231.1 protein_id gnl|my_center|LOCUS_01590 >Feature sequence006 265 20 gene locus_tag LOCUS_01600 265 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 381 548 gene locus_tag LOCUS_01610 381 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 700 500 gene locus_tag LOCUS_01620 700 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 1100 873 gene locus_tag LOCUS_01630 1100 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 1265 1801 gene locus_tag LOCUS_01640 1265 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 2017 2742 gene locus_tag LOCUS_01650 2017 2742 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964695.1 protein_id gnl|my_center|LOCUS_01650 3282 2752 gene locus_tag LOCUS_01660 gene bstA 3282 2752 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999070.1 protein_id gnl|my_center|LOCUS_01660 3418 4404 gene locus_tag LOCUS_01670 3418 4404 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066950.1 protein_id gnl|my_center|LOCUS_01670 4701 4411 gene locus_tag LOCUS_01680 4701 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01680 4889 4626 gene locus_tag LOCUS_01690 4889 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 5431 5733 gene locus_tag LOCUS_01700 5431 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 5836 6348 gene locus_tag LOCUS_01710 5836 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01710 6312 7043 gene locus_tag LOCUS_01720 6312 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01720 6959 7177 gene locus_tag LOCUS_01730 6959 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 7269 8303 gene locus_tag LOCUS_01740 gene rbsR 7269 8303 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099392.1 protein_id gnl|my_center|LOCUS_01740 8436 9806 gene locus_tag LOCUS_01750 8436 9806 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_01750 9817 10755 gene locus_tag LOCUS_01760 9817 10755 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_01760 10765 11589 gene locus_tag LOCUS_01770 10765 11589 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009880516.1 protein_id gnl|my_center|LOCUS_01770 11618 13153 gene locus_tag LOCUS_01780 11618 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01780 13102 13401 gene locus_tag LOCUS_01790 13102 13401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 13546 14316 gene locus_tag LOCUS_01800 13546 14316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 14366 15019 gene locus_tag LOCUS_01810 14366 15019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 15132 16688 gene locus_tag LOCUS_01820 15132 16688 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202555.1 protein_id gnl|my_center|LOCUS_01820 16728 18299 gene locus_tag LOCUS_01830 16728 18299 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288137.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01830 18224 18460 gene locus_tag LOCUS_01840 18224 18460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 18497 19291 gene locus_tag LOCUS_01850 18497 19291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01850 19288 19638 gene locus_tag LOCUS_01860 19288 19638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01860 19879 20088 gene locus_tag LOCUS_01870 19879 20088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 20358 20633 gene locus_tag LOCUS_01880 20358 20633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 20691 21077 gene locus_tag LOCUS_01890 20691 21077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 21294 21500 gene locus_tag LOCUS_01900 21294 21500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 21406 21729 gene locus_tag LOCUS_01910 21406 21729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 21868 22083 gene locus_tag LOCUS_01920 21868 22083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 22444 23286 gene locus_tag LOCUS_01930 22444 23286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 23567 24376 gene locus_tag LOCUS_01940 23567 24376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 24397 24687 gene locus_tag LOCUS_01950 24397 24687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 24937 26895 gene locus_tag LOCUS_01960 24937 26895 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922418.1 protein_id gnl|my_center|LOCUS_01960 26892 28091 gene locus_tag LOCUS_01970 26892 28091 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403856.1 protein_id gnl|my_center|LOCUS_01970 28106 30046 gene locus_tag LOCUS_01980 28106 30046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01980 30112 31239 gene locus_tag LOCUS_01990 30112 31239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01990 31730 32626 gene locus_tag LOCUS_02000 31730 32626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 32702 33193 gene locus_tag LOCUS_02010 32702 33193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02010 33304 34662 gene locus_tag LOCUS_02020 33304 34662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02020 35582 35917 gene locus_tag LOCUS_02030 35582 35917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 36175 36642 gene locus_tag LOCUS_02040 36175 36642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02040 36974 37942 gene locus_tag LOCUS_02050 36974 37942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 37950 38450 gene locus_tag LOCUS_02060 37950 38450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02060 38521 39288 gene locus_tag LOCUS_02070 38521 39288 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_02070 39381 40382 gene locus_tag LOCUS_02080 39381 40382 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742148.1 protein_id gnl|my_center|LOCUS_02080 40598 41170 gene locus_tag LOCUS_02090 40598 41170 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_02090 41185 41733 gene locus_tag LOCUS_02100 41185 41733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 41784 41990 gene locus_tag LOCUS_02110 41784 41990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 42451 42092 gene locus_tag LOCUS_02120 42451 42092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 42708 42406 gene locus_tag LOCUS_02130 42708 42406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 43346 42666 gene locus_tag LOCUS_02140 43346 42666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 43474 43944 gene locus_tag LOCUS_02150 43474 43944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 44387 45757 gene locus_tag LOCUS_02160 44387 45757 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976194.1 protein_id gnl|my_center|LOCUS_02160 45785 45973 gene locus_tag LOCUS_02170 45785 45973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 45974 46681 gene locus_tag LOCUS_02180 45974 46681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 46671 46877 gene locus_tag LOCUS_02190 46671 46877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 46874 47314 gene locus_tag LOCUS_02200 46874 47314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02200 47580 48971 gene locus_tag LOCUS_02210 47580 48971 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804122.1 protein_id gnl|my_center|LOCUS_02210 49293 50087 gene locus_tag LOCUS_02220 49293 50087 CDS product DUF2935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828311.1 protein_id gnl|my_center|LOCUS_02220 50319 52598 gene locus_tag LOCUS_02230 gene yesS 50319 52598 CDS product transcriptional regulator YesS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966769.1 protein_id gnl|my_center|LOCUS_02230 52806 53756 gene locus_tag LOCUS_02240 52806 53756 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_02240 53777 54040 gene locus_tag LOCUS_02250 53777 54040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02250 54443 54658 gene locus_tag LOCUS_02260 54443 54658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02260 54729 55571 gene locus_tag LOCUS_02270 54729 55571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02270 55568 56302 gene locus_tag LOCUS_02280 55568 56302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02280 56472 57080 gene locus_tag LOCUS_02290 56472 57080 CDS product YesU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233822.1 protein_id gnl|my_center|LOCUS_02290 57238 60123 gene locus_tag LOCUS_02300 57238 60123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243379.1 protein_id gnl|my_center|LOCUS_02300 61047 60127 gene locus_tag LOCUS_02310 61047 60127 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058303659.1 protein_id gnl|my_center|LOCUS_02310 >Feature sequence007 1955 39 gene locus_tag LOCUS_02320 1955 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 2363 3196 gene locus_tag LOCUS_02330 2363 3196 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258662.1 protein_id gnl|my_center|LOCUS_02330 3258 3812 gene locus_tag LOCUS_02340 3258 3812 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361269.1 protein_id gnl|my_center|LOCUS_02340 3976 4734 gene locus_tag LOCUS_02350 3976 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 5000 6322 gene locus_tag LOCUS_02360 5000 6322 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060609.1 protein_id gnl|my_center|LOCUS_02360 6408 7358 gene locus_tag LOCUS_02370 6408 7358 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974323.1 protein_id gnl|my_center|LOCUS_02370 7423 8172 gene locus_tag LOCUS_02380 7423 8172 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898651.1 protein_id gnl|my_center|LOCUS_02380 8222 8974 gene locus_tag LOCUS_02390 8222 8974 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868825.1 protein_id gnl|my_center|LOCUS_02390 8971 10047 gene locus_tag LOCUS_02400 8971 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 10135 10875 gene locus_tag LOCUS_02410 10135 10875 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_02410 11235 13187 gene locus_tag LOCUS_02420 11235 13187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 13193 14152 gene locus_tag LOCUS_02430 13193 14152 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_02430 14164 15045 gene locus_tag LOCUS_02440 14164 15045 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_02440 15110 16672 gene locus_tag LOCUS_02450 15110 16672 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972693.1 protein_id gnl|my_center|LOCUS_02450 16771 18615 gene locus_tag LOCUS_02460 16771 18615 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011285644.1 protein_id gnl|my_center|LOCUS_02460 18587 19675 gene locus_tag LOCUS_02470 18587 19675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 20333 19749 gene locus_tag LOCUS_02480 20333 19749 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068762.1 protein_id gnl|my_center|LOCUS_02480 20509 21252 gene locus_tag LOCUS_02490 20509 21252 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_02490 21258 22460 gene locus_tag LOCUS_02500 21258 22460 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053727.1 protein_id gnl|my_center|LOCUS_02500 22840 25515 gene locus_tag LOCUS_02510 22840 25515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 25668 26069 gene locus_tag LOCUS_02520 25668 26069 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546565.1 protein_id gnl|my_center|LOCUS_02520 26156 26719 gene locus_tag LOCUS_02530 26156 26719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02530 27203 28132 gene locus_tag LOCUS_02540 27203 28132 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02540 28340 29275 gene locus_tag LOCUS_02550 gene rmgP 28340 29275 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_02550 29275 29934 gene locus_tag LOCUS_02560 29275 29934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02560 29868 30203 gene locus_tag LOCUS_02570 29868 30203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02570 30325 30567 gene locus_tag LOCUS_02580 30325 30567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02580 >Feature sequence008 48 1070 gene locus_tag LOCUS_02590 gene ribD 48 1070 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_02590 1171 1845 gene locus_tag LOCUS_02600 gene ribE 1171 1845 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493908.1 protein_id gnl|my_center|LOCUS_02600 1906 3156 gene locus_tag LOCUS_02610 gene ribBA 1906 3156 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468974.1 protein_id gnl|my_center|LOCUS_02610 3153 3635 gene locus_tag LOCUS_02620 gene ribH 3153 3635 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230892.1 protein_id gnl|my_center|LOCUS_02620 3659 4438 gene locus_tag LOCUS_02630 3659 4438 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723598.1 protein_id gnl|my_center|LOCUS_02630 4368 4937 gene locus_tag LOCUS_02640 gene scpB 4368 4937 CDS product segregation/condensation protein ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375167.1 protein_id gnl|my_center|LOCUS_02640 4880 5041 gene locus_tag LOCUS_02650 4880 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 5103 5789 gene locus_tag LOCUS_02660 5103 5789 CDS product DUF2953 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399127.1 protein_id gnl|my_center|LOCUS_02660 5762 6235 gene locus_tag LOCUS_02670 gene ytfJ 5762 6235 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398631.1 protein_id gnl|my_center|LOCUS_02670 6399 7562 gene locus_tag LOCUS_02680 gene dacB 6399 7562 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_02680 7588 8235 gene locus_tag LOCUS_02690 gene spmA 7588 8235 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247811.1 protein_id gnl|my_center|LOCUS_02690 8317 8850 gene locus_tag LOCUS_02700 8317 8850 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392868.1 protein_id gnl|my_center|LOCUS_02700 8995 9744 gene locus_tag LOCUS_02710 gene rluB 8995 9744 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 protein_id gnl|my_center|LOCUS_02710 9839 10150 gene locus_tag LOCUS_02720 9839 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02720 10135 10368 gene locus_tag LOCUS_02730 10135 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02730 10388 10606 gene locus_tag LOCUS_02740 10388 10606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02740 10603 10959 gene locus_tag LOCUS_02750 10603 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02750 11067 12044 gene locus_tag LOCUS_02760 11067 12044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02760 12041 12628 gene locus_tag LOCUS_02770 12041 12628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02770 12613 13299 gene locus_tag LOCUS_02780 12613 13299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02780 13345 14067 gene locus_tag LOCUS_02790 gene resD 13345 14067 CDS product DNA-binding response regulator ResD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426862.1 protein_id gnl|my_center|LOCUS_02790 14071 15525 gene locus_tag LOCUS_02800 14071 15525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 16497 15628 gene locus_tag LOCUS_02810 16497 15628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02810 17219 16410 gene locus_tag LOCUS_02820 17219 16410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02820 17440 17766 gene locus_tag LOCUS_02830 17440 17766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 18021 17836 gene locus_tag LOCUS_02840 18021 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 18058 18681 gene locus_tag LOCUS_02850 18058 18681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 18678 18926 gene locus_tag LOCUS_02860 18678 18926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 18933 19817 gene locus_tag LOCUS_02870 18933 19817 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637817.1 protein_id gnl|my_center|LOCUS_02870 20542 19745 gene locus_tag LOCUS_02880 20542 19745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 20730 21074 gene locus_tag LOCUS_02890 20730 21074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 21300 21905 gene locus_tag LOCUS_02900 21300 21905 CDS product genetic competence negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230533.1 protein_id gnl|my_center|LOCUS_02900 22043 22969 gene locus_tag LOCUS_02910 22043 22969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02910 22906 23295 gene locus_tag LOCUS_02920 22906 23295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02920 23329 24024 gene locus_tag LOCUS_02930 gene prsW 23329 24024 CDS product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 protein_id gnl|my_center|LOCUS_02930 24096 24251 gene locus_tag LOCUS_02940 24096 24251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 24356 25714 gene locus_tag LOCUS_02950 gene ypeB 24356 25714 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943704.1 protein_id gnl|my_center|LOCUS_02950 25778 26443 gene locus_tag LOCUS_02960 25778 26443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 26535 26738 gene locus_tag LOCUS_02970 26535 26738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 26872 27570 gene locus_tag LOCUS_02980 gene cmk 26872 27570 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_02980 27574 28149 gene locus_tag LOCUS_02990 27574 28149 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_02990 28258 29475 gene locus_tag LOCUS_03000 gene rpsA 28258 29475 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230556.1 protein_id gnl|my_center|LOCUS_03000 29590 30207 gene locus_tag LOCUS_03010 29590 30207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 30309 31523 gene locus_tag LOCUS_03020 gene der 30309 31523 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_03020 31643 32245 gene locus_tag LOCUS_03030 gene plsY 31643 32245 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_03030 32249 33280 gene locus_tag LOCUS_03040 gene gpsA 32249 33280 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230566.1 protein_id gnl|my_center|LOCUS_03040 33403 33678 gene locus_tag LOCUS_03050 33403 33678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 33860 33994 gene locus_tag LOCUS_03060 33860 33994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 34023 34319 gene locus_tag LOCUS_03070 34023 34319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 34339 34938 gene locus_tag LOCUS_03080 34339 34938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 34913 35275 gene locus_tag LOCUS_03090 34913 35275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 35306 36055 gene locus_tag LOCUS_03100 35306 36055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755475.1 protein_id gnl|my_center|LOCUS_03100 36346 37824 gene locus_tag LOCUS_03110 gene spoIVA 36346 37824 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230572.1 protein_id gnl|my_center|LOCUS_03110 38079 38354 gene locus_tag LOCUS_03120 gene hbs 38079 38354 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_03120 38487 38563 gene locus_tag LOCUS_t00020 38487 38563 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 38642 38863 gene locus_tag LOCUS_03130 gene mtrB 38642 38863 CDS product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393370.1 protein_id gnl|my_center|LOCUS_03130 38979 39560 gene locus_tag LOCUS_03140 38979 39560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 39675 40544 gene locus_tag LOCUS_03150 39675 40544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 40555 41271 gene locus_tag LOCUS_03160 gene menG 40555 41271 CDS product 2-heptaprenyl-1,4-naphthoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187674.1 protein_id gnl|my_center|LOCUS_03160 41291 42145 gene locus_tag LOCUS_03170 gene ubiA 41291 42145 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_03170 42234 42773 gene locus_tag LOCUS_03180 42234 42773 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941109.1 protein_id gnl|my_center|LOCUS_03180 42763 43623 gene locus_tag LOCUS_03190 42763 43623 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_03190 43620 44594 gene locus_tag LOCUS_03200 gene hepT 43620 44594 CDS product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776077.1 protein_id gnl|my_center|LOCUS_03200 44626 44745 gene locus_tag LOCUS_03210 44626 44745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03210 44736 45068 gene locus_tag LOCUS_03220 44736 45068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03220 45102 45884 gene locus_tag LOCUS_03230 gene cheR 45102 45884 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 protein_id gnl|my_center|LOCUS_03230 45944 46111 gene locus_tag LOCUS_03240 45944 46111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 46417 47586 gene locus_tag LOCUS_03250 gene aroC 46417 47586 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398727.1 protein_id gnl|my_center|LOCUS_03250 47707 48690 gene locus_tag LOCUS_03260 gene aroB 47707 48690 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439843.1 protein_id gnl|my_center|LOCUS_03260 48687 49055 gene locus_tag LOCUS_03270 gene aroH 48687 49055 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967606.1 protein_id gnl|my_center|LOCUS_03270 49474 51045 gene locus_tag LOCUS_03280 gene trpE 49474 51045 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_03280 51051 52091 gene locus_tag LOCUS_03290 gene trpD 51051 52091 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_03290 52081 52515 gene locus_tag LOCUS_03300 52081 52515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03300 52561 52875 gene locus_tag LOCUS_03310 52561 52875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03310 52872 53180 gene locus_tag LOCUS_03320 52872 53180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03320 53177 53539 gene locus_tag LOCUS_03330 53177 53539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03330 53536 54741 gene locus_tag LOCUS_03340 gene trpB 53536 54741 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392850.1 protein_id gnl|my_center|LOCUS_03340 54728 55534 gene locus_tag LOCUS_03350 gene trpA 54728 55534 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230608.1 protein_id gnl|my_center|LOCUS_03350 55693 56790 gene locus_tag LOCUS_03360 gene hisC 55693 56790 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 protein_id gnl|my_center|LOCUS_03360 56952 57884 gene locus_tag LOCUS_03370 56952 57884 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989842.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03370 58323 58916 gene locus_tag LOCUS_03380 gene rpoE 58323 58916 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_03380 58913 59527 gene locus_tag LOCUS_03390 58913 59527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 59579 60157 gene locus_tag LOCUS_03400 gene phoE 59579 60157 CDS product phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233157.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence009 121 1701 gene locus_tag LOCUS_03410 gene ggt 121 1701 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227847.1 protein_id gnl|my_center|LOCUS_03410 2003 2848 gene locus_tag LOCUS_03420 2003 2848 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 protein_id gnl|my_center|LOCUS_03420 2854 3735 gene locus_tag LOCUS_03430 2854 3735 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384595.1 protein_id gnl|my_center|LOCUS_03430 3821 4840 gene locus_tag LOCUS_03440 3821 4840 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922054.1 protein_id gnl|my_center|LOCUS_03440 4885 6219 gene locus_tag LOCUS_03450 4885 6219 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_03450 6216 8006 gene locus_tag LOCUS_03460 6216 8006 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_03460 8042 8824 gene locus_tag LOCUS_03470 8042 8824 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088892.1 protein_id gnl|my_center|LOCUS_03470 8821 9252 gene locus_tag LOCUS_03480 8821 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 9249 9911 gene locus_tag LOCUS_03490 9249 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 9941 10570 gene locus_tag LOCUS_03500 9941 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 10751 11584 gene locus_tag LOCUS_03510 10751 11584 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 protein_id gnl|my_center|LOCUS_03510 11625 12995 gene locus_tag LOCUS_03520 11625 12995 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391998.1 protein_id gnl|my_center|LOCUS_03520 13424 14470 gene locus_tag LOCUS_03530 gene thiL 13424 14470 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234080.1 protein_id gnl|my_center|LOCUS_03530 14485 15009 gene locus_tag LOCUS_03540 gene tsaE 14485 15009 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_03540 14999 15868 gene locus_tag LOCUS_03550 gene tsaB 14999 15868 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865740.1 protein_id gnl|my_center|LOCUS_03550 15865 16347 gene locus_tag LOCUS_03560 gene rimI 15865 16347 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_03560 16344 17177 gene locus_tag LOCUS_03570 16344 17177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03570 17171 17473 gene locus_tag LOCUS_03580 17171 17473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03580 18558 20135 gene locus_tag LOCUS_03590 18558 20135 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_03590 20449 21633 gene locus_tag LOCUS_03600 20449 21633 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002374726.1 protein_id gnl|my_center|LOCUS_03600 22253 25180 gene locus_tag LOCUS_03610 22253 25180 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085775.1 protein_id gnl|my_center|LOCUS_03610 27051 25969 gene locus_tag LOCUS_03620 27051 25969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03620 28034 27024 gene locus_tag LOCUS_03630 28034 27024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03630 28281 28898 gene locus_tag LOCUS_03640 28281 28898 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792977.1 protein_id gnl|my_center|LOCUS_03640 28901 29392 gene locus_tag LOCUS_03650 gene moaC 28901 29392 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094151.1 protein_id gnl|my_center|LOCUS_03650 29417 29917 gene locus_tag LOCUS_03660 29417 29917 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_03660 29907 30941 gene locus_tag LOCUS_03670 29907 30941 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392449.1 protein_id gnl|my_center|LOCUS_03670 31033 31266 gene locus_tag LOCUS_03680 31033 31266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 31478 32134 gene locus_tag LOCUS_03690 31478 32134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03690 32101 32310 gene locus_tag LOCUS_03700 32101 32310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03700 32499 32780 gene locus_tag LOCUS_03710 gene groES 32499 32780 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003155970.1 protein_id gnl|my_center|LOCUS_03710 32844 34469 gene locus_tag LOCUS_03720 gene groEL 32844 34469 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029999.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence010 146 742 gene locus_tag LOCUS_03730 gene yyaC 146 742 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243890.1 protein_id gnl|my_center|LOCUS_03730 771 1598 gene locus_tag LOCUS_03740 771 1598 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_03740 1610 2275 gene locus_tag LOCUS_03750 1610 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 2359 4047 gene locus_tag LOCUS_03760 2359 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 4156 5238 gene locus_tag LOCUS_03770 4156 5238 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_03770 5399 6283 gene locus_tag LOCUS_03780 5399 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 7589 6345 gene locus_tag LOCUS_03790 gene ytrF 7589 6345 CDS product ABC transporter permease YtrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398682.1 protein_id gnl|my_center|LOCUS_03790 8299 7586 gene locus_tag LOCUS_03800 gene ytrE 8299 7586 CDS product ABC transporter ATP-binding protein YtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229129.1 protein_id gnl|my_center|LOCUS_03800 8469 10346 gene locus_tag LOCUS_03810 8469 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 11050 11205 gene locus_tag LOCUS_03820 11050 11205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 12015 11794 gene locus_tag LOCUS_03830 12015 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 12239 12090 gene locus_tag LOCUS_03840 12239 12090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 12592 12735 gene locus_tag LOCUS_03850 12592 12735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 12732 12992 gene locus_tag LOCUS_03860 12732 12992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 12994 13626 gene locus_tag LOCUS_03870 12994 13626 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871221.1 protein_id gnl|my_center|LOCUS_03870 13984 13739 gene locus_tag LOCUS_03880 13984 13739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 14272 14466 gene locus_tag LOCUS_03890 14272 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 14391 16019 gene locus_tag LOCUS_03900 14391 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 16273 16494 gene locus_tag LOCUS_03910 16273 16494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 16823 16635 gene locus_tag LOCUS_03920 16823 16635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03920 17356 16802 gene locus_tag LOCUS_03930 17356 16802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03930 18397 17621 gene locus_tag LOCUS_03940 18397 17621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03940 18614 20920 gene locus_tag LOCUS_03950 18614 20920 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_03950 21715 21362 gene locus_tag LOCUS_03960 21715 21362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence011 3609 2191 gene locus_tag LOCUS_03970 3609 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 4658 3606 gene locus_tag LOCUS_03980 4658 3606 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989474.1 protein_id gnl|my_center|LOCUS_03980 6396 4768 gene locus_tag LOCUS_03990 6396 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 7455 6508 gene locus_tag LOCUS_04000 7455 6508 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 protein_id gnl|my_center|LOCUS_04000 9505 7646 gene locus_tag LOCUS_04010 9505 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 10181 9594 gene locus_tag LOCUS_04020 gene gmk 10181 9594 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931939.1 protein_id gnl|my_center|LOCUS_04020 10946 10482 gene locus_tag LOCUS_04030 gene bcp 10946 10482 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633710.1 protein_id gnl|my_center|LOCUS_04030 11083 13326 gene locus_tag LOCUS_04040 11083 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 13617 13991 gene locus_tag LOCUS_04050 13617 13991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04050 13979 14512 gene locus_tag LOCUS_04060 13979 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04060 14526 15167 gene locus_tag LOCUS_04070 14526 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04070 15116 15385 gene locus_tag LOCUS_04080 15116 15385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04080 15437 15958 gene locus_tag LOCUS_04090 15437 15958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04090 15955 17049 gene locus_tag LOCUS_04100 15955 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04100 17917 17129 gene locus_tag LOCUS_04110 17917 17129 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965773.1 protein_id gnl|my_center|LOCUS_04110 18601 17924 gene locus_tag LOCUS_04120 18601 17924 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521519.1 protein_id gnl|my_center|LOCUS_04120 18717 18541 gene locus_tag LOCUS_04130 18717 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04130 19831 18710 gene locus_tag LOCUS_04140 19831 18710 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843645.1 protein_id gnl|my_center|LOCUS_04140 20063 20479 gene locus_tag LOCUS_04150 20063 20479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04150 20482 21141 gene locus_tag LOCUS_04160 20482 21141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04160 21416 22654 gene locus_tag LOCUS_04170 gene hemL 21416 22654 CDS product glutamate-1-semialdehyde-2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181462.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence012 470 285 gene locus_tag LOCUS_04180 470 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 2025 613 gene locus_tag LOCUS_04190 2025 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3114 2194 gene locus_tag LOCUS_04200 3114 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 4790 3213 gene locus_tag LOCUS_04210 4790 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 5800 4865 gene locus_tag LOCUS_04220 5800 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 7628 5793 gene locus_tag LOCUS_04230 7628 5793 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_04230 8463 7663 gene locus_tag LOCUS_04240 8463 7663 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_04240 10009 8636 gene locus_tag LOCUS_04250 10009 8636 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929633.1 protein_id gnl|my_center|LOCUS_04250 10742 10113 gene locus_tag LOCUS_04260 10742 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04260 10942 10727 gene locus_tag LOCUS_04270 10942 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04270 11041 11208 gene locus_tag LOCUS_04280 11041 11208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 11297 12034 gene locus_tag LOCUS_04290 11297 12034 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243004.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04290 14610 12025 gene locus_tag LOCUS_04300 14610 12025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 >Feature sequence013 635 1585 gene locus_tag LOCUS_04310 gene glcK 635 1585 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_04310 1671 2558 gene locus_tag LOCUS_04320 gene rapZ 1671 2558 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990001.1 protein_id gnl|my_center|LOCUS_04320 2570 3556 gene locus_tag LOCUS_04330 gene mgfK 2570 3556 CDS product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 protein_id gnl|my_center|LOCUS_04330 3563 4135 gene locus_tag LOCUS_04340 3563 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04340 4198 4344 gene locus_tag LOCUS_04350 4198 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04350 4356 4490 gene locus_tag LOCUS_04360 4356 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04360 4613 4885 gene locus_tag LOCUS_04370 4613 4885 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_04370 5394 5104 gene locus_tag LOCUS_04380 5394 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 6264 5677 gene locus_tag LOCUS_04390 gene clpP 6264 5677 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228214.1 protein_id gnl|my_center|LOCUS_04390 6494 6420 gene locus_tag LOCUS_t00030 6494 6420 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6686 7732 gene locus_tag LOCUS_04400 gene cggR 6686 7732 CDS product gapA transcriptional regulator CggR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258187.1 protein_id gnl|my_center|LOCUS_04400 7818 8822 gene locus_tag LOCUS_04410 gene gap 7818 8822 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161236.1 protein_id gnl|my_center|LOCUS_04410 8905 10176 gene locus_tag LOCUS_04420 8905 10176 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036339.1 protein_id gnl|my_center|LOCUS_04420 10210 10962 gene locus_tag LOCUS_04430 gene tpiA 10210 10962 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243394.1 protein_id gnl|my_center|LOCUS_04430 11275 10988 gene locus_tag LOCUS_04440 11275 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 11311 12501 gene locus_tag LOCUS_04450 gene gpmI 11311 12501 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04450 12548 13741 gene locus_tag LOCUS_04460 gene eno 12548 13741 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_04460 14181 14417 gene locus_tag LOCUS_04470 gene secG 14181 14417 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 protein_id gnl|my_center|LOCUS_04470 14605 17286 gene locus_tag LOCUS_04480 gene rnr 14605 17286 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_04480 17697 18173 gene locus_tag LOCUS_04490 gene smpB 17697 18173 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_04490 18365 18732 gene locus_tag LOCUS_tm00010 18365 18732 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 19106 18894 gene locus_tag LOCUS_04500 19106 18894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 20440 19583 gene locus_tag LOCUS_04510 20440 19583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 21552 21839 gene locus_tag LOCUS_04520 21552 21839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 22992 22405 gene locus_tag LOCUS_04530 22992 22405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04530 23542 22973 gene locus_tag LOCUS_04540 23542 22973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 24341 23793 gene locus_tag LOCUS_04550 24341 23793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04550 <24859 24343 gene locus_tag LOCUS_04560 <24859 24343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011922436.1:AAA family ATPase >Feature sequence014 1564 569 gene locus_tag LOCUS_04570 1564 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 1704 2045 gene locus_tag LOCUS_04580 1704 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 3024 2476 gene locus_tag LOCUS_04590 3024 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04590 4387 3059 gene locus_tag LOCUS_04600 4387 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 4771 5061 gene locus_tag LOCUS_04610 4771 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5063 6139 gene locus_tag LOCUS_04620 5063 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 6315 7373 gene locus_tag LOCUS_04630 gene glmD 6315 7373 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250706.1 protein_id gnl|my_center|LOCUS_04630 7370 8398 gene locus_tag LOCUS_04640 7370 8398 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_04640 8401 9267 gene locus_tag LOCUS_04650 gene fba 8401 9267 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392146.1 protein_id gnl|my_center|LOCUS_04650 9274 10206 gene locus_tag LOCUS_04660 gene pfkB 9274 10206 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392148.1 protein_id gnl|my_center|LOCUS_04660 11176 11901 gene locus_tag LOCUS_04670 11176 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04670 12443 12847 gene locus_tag LOCUS_04680 12443 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 12928 13197 gene locus_tag LOCUS_04690 12928 13197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 13261 13803 gene locus_tag LOCUS_04700 13261 13803 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864729.1 protein_id gnl|my_center|LOCUS_04700 14012 14380 gene locus_tag LOCUS_04710 14012 14380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 14592 15257 gene locus_tag LOCUS_04720 14592 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 15570 16859 gene locus_tag LOCUS_04730 15570 16859 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061331.1 protein_id gnl|my_center|LOCUS_04730 16966 17412 gene locus_tag LOCUS_04740 16966 17412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04740 17499 17879 gene locus_tag LOCUS_04750 17499 17879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04750 17944 19278 gene locus_tag LOCUS_04760 17944 19278 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803812.1 protein_id gnl|my_center|LOCUS_04760 19297 20160 gene locus_tag LOCUS_04770 19297 20160 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_04770 20174 21001 gene locus_tag LOCUS_04780 20174 21001 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_04780 21026 21856 gene locus_tag LOCUS_04790 21026 21856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 22386 21835 gene locus_tag LOCUS_04800 22386 21835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 >Feature sequence015 1644 190 gene locus_tag LOCUS_04810 1644 190 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150184.1 protein_id gnl|my_center|LOCUS_04810 2199 1657 gene locus_tag LOCUS_04820 2199 1657 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243099.1 protein_id gnl|my_center|LOCUS_04820 2512 2715 gene locus_tag LOCUS_04830 2512 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 2712 2915 gene locus_tag LOCUS_04840 2712 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 3469 3044 gene locus_tag LOCUS_04850 gene mntR 3469 3044 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143076.1 protein_id gnl|my_center|LOCUS_04850 4400 3687 gene locus_tag LOCUS_04860 gene ccdA 4400 3687 CDS product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152676.1 protein_id gnl|my_center|LOCUS_04860 5163 4420 gene locus_tag LOCUS_04870 5163 4420 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815052.1 protein_id gnl|my_center|LOCUS_04870 5452 5228 gene locus_tag LOCUS_04880 5452 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 6032 5529 gene locus_tag LOCUS_04890 6032 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04890 7163 6057 gene locus_tag LOCUS_04900 7163 6057 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458890.1 protein_id gnl|my_center|LOCUS_04900 9780 7657 gene locus_tag LOCUS_04910 gene metG 9780 7657 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134147.1 protein_id gnl|my_center|LOCUS_04910 10329 10075 gene locus_tag LOCUS_04920 gene yidD 10329 10075 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 protein_id gnl|my_center|LOCUS_04920 10769 10347 gene locus_tag LOCUS_04930 gene zur 10769 10347 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398578.1 protein_id gnl|my_center|LOCUS_04930 10968 11960 gene locus_tag LOCUS_04940 10968 11960 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803848.1 protein_id gnl|my_center|LOCUS_04940 12046 12975 gene locus_tag LOCUS_04950 12046 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 13059 13388 gene locus_tag LOCUS_04960 13059 13388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04960 13355 14137 gene locus_tag LOCUS_04970 13355 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04970 15424 14237 gene locus_tag LOCUS_04980 15424 14237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04980 16209 15421 gene locus_tag LOCUS_04990 16209 15421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 16632 16414 gene locus_tag LOCUS_05000 16632 16414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 16825 17292 gene locus_tag LOCUS_05010 16825 17292 CDS product PCYCGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761026.1 protein_id gnl|my_center|LOCUS_05010 18145 17384 gene locus_tag LOCUS_05020 gene rhaR 18145 17384 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_05020 19654 18173 gene locus_tag LOCUS_05030 gene rhaB 19654 18173 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_05030 20349 19651 gene locus_tag LOCUS_05040 20349 19651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05040 20876 20301 gene locus_tag LOCUS_05050 20876 20301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05050 21285 20899 gene locus_tag LOCUS_05060 21285 20899 CDS product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080417.1 protein_id gnl|my_center|LOCUS_05060 23442 21373 gene locus_tag LOCUS_05070 23442 21373 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_05070 23876 23628 gene locus_tag LOCUS_05080 23876 23628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 24372 23944 gene locus_tag LOCUS_05090 24372 23944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 24595 24837 gene locus_tag LOCUS_05100 gene gerPA 24595 24837 CDS product spore germination protein GerPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111188.1 protein_id gnl|my_center|LOCUS_05100 24834 25037 gene locus_tag LOCUS_05110 gene gerPB 24834 25037 CDS product spore germination protein GerPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233090.1 protein_id gnl|my_center|LOCUS_05110 25087 25770 gene locus_tag LOCUS_05120 25087 25770 CDS product spore germination protein GerPC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245548.1 protein_id gnl|my_center|LOCUS_05120 25767 26057 gene locus_tag LOCUS_05130 25767 26057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 26054 26518 gene locus_tag LOCUS_05140 26054 26518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 29122 26894 gene locus_tag LOCUS_05150 29122 26894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 >Feature sequence016 2533 134 gene locus_tag LOCUS_05160 2533 134 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_05160 2775 3740 gene locus_tag LOCUS_05170 2775 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 3797 4801 gene locus_tag LOCUS_05180 3797 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 4922 5188 gene locus_tag LOCUS_05190 4922 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05190 5131 5550 gene locus_tag LOCUS_05200 5131 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05200 5571 6842 gene locus_tag LOCUS_05210 gene wecB 5571 6842 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140145.1 protein_id gnl|my_center|LOCUS_05210 6920 7141 gene locus_tag LOCUS_05220 6920 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 7134 7514 gene locus_tag LOCUS_05230 7134 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 7525 8286 gene locus_tag LOCUS_05240 gene atpB 7525 8286 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399877.1 protein_id gnl|my_center|LOCUS_05240 8414 8626 gene locus_tag LOCUS_05250 8414 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 8723 9205 gene locus_tag LOCUS_05260 gene atpF 8723 9205 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244051.1 protein_id gnl|my_center|LOCUS_05260 9202 9750 gene locus_tag LOCUS_05270 gene atpH 9202 9750 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064683.1 protein_id gnl|my_center|LOCUS_05270 9766 10338 gene locus_tag LOCUS_05280 9766 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05280 10335 11279 gene locus_tag LOCUS_05290 10335 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05290 11428 12297 gene locus_tag LOCUS_05300 gene atpG 11428 12297 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157696.1 protein_id gnl|my_center|LOCUS_05300 12324 13730 gene locus_tag LOCUS_05310 gene atpD 12324 13730 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032600.1 protein_id gnl|my_center|LOCUS_05310 13752 14168 gene locus_tag LOCUS_05320 gene atpC 13752 14168 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847211.1 protein_id gnl|my_center|LOCUS_05320 14304 15095 gene locus_tag LOCUS_05330 14304 15095 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099684015.1 protein_id gnl|my_center|LOCUS_05330 15252 15740 gene locus_tag LOCUS_05340 15252 15740 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105199.1 protein_id gnl|my_center|LOCUS_05340 15971 16342 gene locus_tag LOCUS_05350 gene nuoA 15971 16342 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179273.1 protein_id gnl|my_center|LOCUS_05350 16327 16641 gene locus_tag LOCUS_05360 16327 16641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05360 16587 16844 gene locus_tag LOCUS_05370 16587 16844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05370 16841 17527 gene locus_tag LOCUS_05380 16841 17527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 17535 18635 gene locus_tag LOCUS_05390 gene nuoD 17535 18635 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_05390 18635 18979 gene locus_tag LOCUS_05400 18635 18979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05400 18988 19650 gene locus_tag LOCUS_05410 18988 19650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05410 19666 20115 gene locus_tag LOCUS_05420 gene nuoI 19666 20115 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677191.1 protein_id gnl|my_center|LOCUS_05420 20115 20630 gene locus_tag LOCUS_05430 20115 20630 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012812.1 protein_id gnl|my_center|LOCUS_05430 20632 20934 gene locus_tag LOCUS_05440 gene nuoK 20632 20934 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100078.1 protein_id gnl|my_center|LOCUS_05440 20939 22801 gene locus_tag LOCUS_05450 gene nuoL 20939 22801 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568473.1 protein_id gnl|my_center|LOCUS_05450 22801 24429 gene locus_tag LOCUS_05460 22801 24429 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998901.1 protein_id gnl|my_center|LOCUS_05460 24433 25230 gene locus_tag LOCUS_05470 24433 25230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05470 25278 25994 gene locus_tag LOCUS_05480 25278 25994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05480 26139 26390 gene locus_tag LOCUS_05490 26139 26390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 26953 28107 gene locus_tag LOCUS_05500 26953 28107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 28292 29464 gene locus_tag LOCUS_05510 28292 29464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 29575 30303 gene locus_tag LOCUS_05520 29575 30303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 30550 30936 gene locus_tag LOCUS_05530 30550 30936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 30939 31979 gene locus_tag LOCUS_05540 30939 31979 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457984.1 protein_id gnl|my_center|LOCUS_05540 32125 32994 gene locus_tag LOCUS_05550 gene flhO 32125 32994 CDS product flagellar hook-basal body complex protein FlhO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244097.1 protein_id gnl|my_center|LOCUS_05550 33012 33854 gene locus_tag LOCUS_05560 gene flgG 33012 33854 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880505.1 protein_id gnl|my_center|LOCUS_05560 33869 34219 gene locus_tag LOCUS_05570 33869 34219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 34385 34843 gene locus_tag LOCUS_05580 gene pgsA 34385 34843 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_05580 35096 34779 gene locus_tag LOCUS_05590 35096 34779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 35095 35271 gene locus_tag LOCUS_05600 35095 35271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05600 35256 35525 gene locus_tag LOCUS_05610 35256 35525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05610 35595 37301 gene locus_tag LOCUS_05620 35595 37301 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454107.1 protein_id gnl|my_center|LOCUS_05620 37305 39398 gene locus_tag LOCUS_05630 37305 39398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence017 1241 2317 gene locus_tag LOCUS_05640 1241 2317 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223454.1 protein_id gnl|my_center|LOCUS_05640 3155 2571 gene locus_tag LOCUS_05650 3155 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 3423 3139 gene locus_tag LOCUS_05660 3423 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 5067 4741 gene locus_tag LOCUS_05670 5067 4741 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428999.1 protein_id gnl|my_center|LOCUS_05670 5680 5594 gene locus_tag LOCUS_t00040 5680 5594 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5946 6431 gene locus_tag LOCUS_05680 5946 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 6362 6757 gene locus_tag LOCUS_05690 6362 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05690 8112 6883 gene locus_tag LOCUS_05700 8112 6883 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461637.1 protein_id gnl|my_center|LOCUS_05700 8677 8102 gene locus_tag LOCUS_05710 8677 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 9520 8783 gene locus_tag LOCUS_05720 9520 8783 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_05720 9678 9517 gene locus_tag LOCUS_05730 9678 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05730 10298 9675 gene locus_tag LOCUS_05740 10298 9675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185981.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05740 11263 10295 gene locus_tag LOCUS_05750 11263 10295 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_05750 12136 11264 gene locus_tag LOCUS_05760 12136 11264 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262676.1 protein_id gnl|my_center|LOCUS_05760 12563 12198 gene locus_tag LOCUS_05770 12563 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 13282 12611 gene locus_tag LOCUS_05780 13282 12611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05780 13710 13634 gene locus_tag LOCUS_t00050 13710 13634 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 13795 13721 gene locus_tag LOCUS_t00060 13795 13721 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 14197 14853 gene locus_tag LOCUS_05790 14197 14853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05790 15575 14916 gene locus_tag LOCUS_05800 15575 14916 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643910.1 protein_id gnl|my_center|LOCUS_05800 15867 16673 gene locus_tag LOCUS_05810 15867 16673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 16782 16979 gene locus_tag LOCUS_05820 16782 16979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 16976 17125 gene locus_tag LOCUS_05830 16976 17125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 17230 18225 gene locus_tag LOCUS_05840 17230 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 18247 19080 gene locus_tag LOCUS_05850 18247 19080 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_05850 19723 19244 gene locus_tag LOCUS_05860 19723 19244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 20864 19872 gene locus_tag LOCUS_05870 20864 19872 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_05870 21694 20861 gene locus_tag LOCUS_05880 21694 20861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05880 22862 21873 gene locus_tag LOCUS_05890 22862 21873 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_05890 23830 22859 gene locus_tag LOCUS_05900 gene appB 23830 22859 CDS product oligopeptide ABC transporter permease AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245828.1 protein_id gnl|my_center|LOCUS_05900 25686 23905 gene locus_tag LOCUS_05910 25686 23905 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_05910 26097 27338 gene locus_tag LOCUS_05920 26097 27338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05920 27233 28060 gene locus_tag LOCUS_05930 27233 28060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05930 28454 28293 gene locus_tag LOCUS_05940 28454 28293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 28768 28451 gene locus_tag LOCUS_05950 28768 28451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 29838 28987 gene locus_tag LOCUS_05960 29838 28987 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245605.1 protein_id gnl|my_center|LOCUS_05960 30912 29839 gene locus_tag LOCUS_05970 gene uxuA 30912 29839 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 protein_id gnl|my_center|LOCUS_05970 31638 30934 gene locus_tag LOCUS_05980 31638 30934 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728678.1 protein_id gnl|my_center|LOCUS_05980 33096 31969 gene locus_tag LOCUS_05990 33096 31969 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_05990 33558 34520 gene locus_tag LOCUS_06000 33558 34520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence018 1324 113 gene locus_tag LOCUS_06010 gene cls 1324 113 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722636.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06010 1810 1484 gene locus_tag LOCUS_06020 1810 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 2145 1837 gene locus_tag LOCUS_06030 2145 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 3045 2644 gene locus_tag LOCUS_06040 3045 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 3693 5972 gene locus_tag LOCUS_06050 3693 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 6165 6707 gene locus_tag LOCUS_06060 6165 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 6704 8071 gene locus_tag LOCUS_06070 6704 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06070 9536 8136 gene locus_tag LOCUS_06080 gene uxaC 9536 8136 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245001.1 protein_id gnl|my_center|LOCUS_06080 10395 9670 gene locus_tag LOCUS_06090 10395 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 11110 10397 gene locus_tag LOCUS_06100 11110 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 12021 11107 gene locus_tag LOCUS_06110 12021 11107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128974497.1 protein_id gnl|my_center|LOCUS_06110 13479 12082 gene locus_tag LOCUS_06120 13479 12082 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082232609.1 protein_id gnl|my_center|LOCUS_06120 14150 13476 gene locus_tag LOCUS_06130 14150 13476 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808110.1 protein_id gnl|my_center|LOCUS_06130 14324 14878 gene locus_tag LOCUS_06140 14324 14878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06140 14878 15033 gene locus_tag LOCUS_06150 14878 15033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06150 15040 16548 gene locus_tag LOCUS_06160 15040 16548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 16758 17441 gene locus_tag LOCUS_06170 16758 17441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_06170 17438 20218 gene locus_tag LOCUS_06180 17438 20218 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127531460.1 protein_id gnl|my_center|LOCUS_06180 20442 20966 gene locus_tag LOCUS_06190 20442 20966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence019 1171 119 gene locus_tag LOCUS_06200 1171 119 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031699.1 protein_id gnl|my_center|LOCUS_06200 2362 1265 gene locus_tag LOCUS_06210 2362 1265 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530504.1 protein_id gnl|my_center|LOCUS_06210 4000 2405 gene locus_tag LOCUS_06220 4000 2405 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387242.1 protein_id gnl|my_center|LOCUS_06220 5791 4046 gene locus_tag LOCUS_06230 5791 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 6012 7895 gene locus_tag LOCUS_06240 6012 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 8779 8045 gene locus_tag LOCUS_06250 8779 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 9579 8776 gene locus_tag LOCUS_06260 9579 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 10100 9525 gene locus_tag LOCUS_06270 10100 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 12378 10219 gene locus_tag LOCUS_06280 12378 10219 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537441.1 protein_id gnl|my_center|LOCUS_06280 13301 12411 gene locus_tag LOCUS_06290 13301 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 13947 13306 gene locus_tag LOCUS_06300 13947 13306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06300 14690 13908 gene locus_tag LOCUS_06310 14690 13908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 15322 14795 gene locus_tag LOCUS_06320 15322 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06320 16623 15274 gene locus_tag LOCUS_06330 16623 15274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06330 18222 16723 gene locus_tag LOCUS_06340 18222 16723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 20061 18325 gene locus_tag LOCUS_06350 20061 18325 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_06350 20445 20113 gene locus_tag LOCUS_06360 20445 20113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06360 20777 20397 gene locus_tag LOCUS_06370 20777 20397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06370 20998 20774 gene locus_tag LOCUS_06380 20998 20774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06380 21725 21015 gene locus_tag LOCUS_06390 21725 21015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06390 21976 21680 gene locus_tag LOCUS_06400 21976 21680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06400 22792 22385 gene locus_tag LOCUS_06410 22792 22385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06410 23412 22717 gene locus_tag LOCUS_06420 23412 22717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06420 24467 23412 gene locus_tag LOCUS_06430 24467 23412 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733843.1 protein_id gnl|my_center|LOCUS_06430 25626 24802 gene locus_tag LOCUS_06440 25626 24802 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209999.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06440 27314 25821 gene locus_tag LOCUS_06450 27314 25821 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210000.1 protein_id gnl|my_center|LOCUS_06450 28351 27314 gene locus_tag LOCUS_06460 gene iolX 28351 27314 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_06460 28694 28410 gene locus_tag LOCUS_06470 28694 28410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06470 29455 28637 gene locus_tag LOCUS_06480 29455 28637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06480 30539 29490 gene locus_tag LOCUS_06490 30539 29490 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582778.1 protein_id gnl|my_center|LOCUS_06490 31486 30551 gene locus_tag LOCUS_06500 31486 30551 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970027.1 protein_id gnl|my_center|LOCUS_06500 32522 31587 gene locus_tag LOCUS_06510 32522 31587 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_06510 33193 32507 gene locus_tag LOCUS_06520 33193 32507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 33780 33196 gene locus_tag LOCUS_06530 gene pgiA 33780 33196 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147196.1 protein_id gnl|my_center|LOCUS_06530 35303 33795 gene locus_tag LOCUS_06540 gene xylB 35303 33795 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764573.1 protein_id gnl|my_center|LOCUS_06540 35891 35403 gene locus_tag LOCUS_06550 35891 35403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06550 36154 35879 gene locus_tag LOCUS_06560 36154 35879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06560 37886 36396 gene locus_tag LOCUS_06570 gene araA 37886 36396 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_06570 38186 38013 gene locus_tag LOCUS_06580 38186 38013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 38336 38659 gene locus_tag LOCUS_06590 38336 38659 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232719.1 protein_id gnl|my_center|LOCUS_06590 38873 38724 gene locus_tag LOCUS_06600 38873 38724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 39951 39037 gene locus_tag LOCUS_06610 39951 39037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 41126 39951 gene locus_tag LOCUS_06620 41126 39951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06620 41203 41928 gene locus_tag LOCUS_06630 41203 41928 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_06630 41915 42784 gene locus_tag LOCUS_06640 41915 42784 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_06640 42781 43518 gene locus_tag LOCUS_06650 42781 43518 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence020 96 962 gene locus_tag LOCUS_06660 gene speE 96 962 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943180.1 protein_id gnl|my_center|LOCUS_06660 1138 1905 gene locus_tag LOCUS_06670 1138 1905 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_06670 2176 2817 gene locus_tag LOCUS_06680 gene frlR 2176 2817 CDS product DNA-binding transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276847.1 protein_id gnl|my_center|LOCUS_06680 3047 3937 gene locus_tag LOCUS_06690 3047 3937 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530805.1 protein_id gnl|my_center|LOCUS_06690 3962 4246 gene locus_tag LOCUS_06700 3962 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06700 4246 4782 gene locus_tag LOCUS_06710 4246 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06710 4786 5571 gene locus_tag LOCUS_06720 4786 5571 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530807.1 protein_id gnl|my_center|LOCUS_06720 5581 6114 gene locus_tag LOCUS_06730 5581 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06730 6111 6656 gene locus_tag LOCUS_06740 6111 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06740 6816 7604 gene locus_tag LOCUS_06750 6816 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 7613 8173 gene locus_tag LOCUS_06760 7613 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06760 8170 8634 gene locus_tag LOCUS_06770 8170 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 8835 9686 gene locus_tag LOCUS_06780 8835 9686 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626499.1 protein_id gnl|my_center|LOCUS_06780 9819 11519 gene locus_tag LOCUS_06790 9819 11519 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_06790 12220 11666 gene locus_tag LOCUS_06800 12220 11666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 12496 12227 gene locus_tag LOCUS_06810 12496 12227 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070523.1 protein_id gnl|my_center|LOCUS_06810 12716 13204 gene locus_tag LOCUS_06820 12716 13204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 13201 13890 gene locus_tag LOCUS_06830 13201 13890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 14364 13954 gene locus_tag LOCUS_06840 14364 13954 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963869.1 protein_id gnl|my_center|LOCUS_06840 14790 14377 gene locus_tag LOCUS_06850 14790 14377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 15021 15635 gene locus_tag LOCUS_06860 15021 15635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 15932 16360 gene locus_tag LOCUS_06870 15932 16360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 16357 16521 gene locus_tag LOCUS_06880 16357 16521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 16523 17821 gene locus_tag LOCUS_06890 16523 17821 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817303.1 protein_id gnl|my_center|LOCUS_06890 17842 18315 gene locus_tag LOCUS_06900 17842 18315 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817302.1 protein_id gnl|my_center|LOCUS_06900 18335 18748 gene locus_tag LOCUS_06910 18335 18748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 18729 19157 gene locus_tag LOCUS_06920 18729 19157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 19135 20991 gene locus_tag LOCUS_06930 19135 20991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461488.1 protein_id gnl|my_center|LOCUS_06930 21067 21528 gene locus_tag LOCUS_06940 21067 21528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06940 21521 22387 gene locus_tag LOCUS_06950 21521 22387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817294.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06950 22351 22488 gene locus_tag LOCUS_06960 22351 22488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06960 22485 22778 gene locus_tag LOCUS_06970 22485 22778 CDS product DUF2577 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817292.1 protein_id gnl|my_center|LOCUS_06970 22775 23179 gene locus_tag LOCUS_06980 22775 23179 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047655.1 protein_id gnl|my_center|LOCUS_06980 23172 24248 gene locus_tag LOCUS_06990 23172 24248 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461486.1 protein_id gnl|my_center|LOCUS_06990 24241 24834 gene locus_tag LOCUS_07000 24241 24834 CDS product DUF2313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943415.1 protein_id gnl|my_center|LOCUS_07000 24831 25112 gene locus_tag LOCUS_07010 24831 25112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817286.1 protein_id gnl|my_center|LOCUS_07010 25116 25730 gene locus_tag LOCUS_07020 25116 25730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 25733 26563 gene locus_tag LOCUS_07030 25733 26563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence021 50 538 gene locus_tag LOCUS_07040 50 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 535 771 gene locus_tag LOCUS_07050 535 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 841 1203 gene locus_tag LOCUS_07060 841 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 1521 2441 gene locus_tag LOCUS_07070 1521 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 2585 2734 gene locus_tag LOCUS_07080 2585 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 2739 3143 gene locus_tag LOCUS_07090 2739 3143 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861737.1 protein_id gnl|my_center|LOCUS_07090 3426 4427 gene locus_tag LOCUS_07100 3426 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 4472 4897 gene locus_tag LOCUS_07110 4472 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 4949 5653 gene locus_tag LOCUS_07120 4949 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 6242 6502 gene locus_tag LOCUS_07130 6242 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 6579 8297 gene locus_tag LOCUS_07140 6579 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 8260 8502 gene locus_tag LOCUS_07150 8260 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 8503 8760 gene locus_tag LOCUS_07160 8503 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 8799 10622 gene locus_tag LOCUS_07170 8799 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 10622 10885 gene locus_tag LOCUS_07180 10622 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 10902 11093 gene locus_tag LOCUS_07190 10902 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 11216 12106 gene locus_tag LOCUS_07200 11216 12106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 12110 12550 gene locus_tag LOCUS_07210 12110 12550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 12565 13500 gene locus_tag LOCUS_07220 12565 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 13475 13702 gene locus_tag LOCUS_07230 13475 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 13747 13908 gene locus_tag LOCUS_07240 13747 13908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 13911 14285 gene locus_tag LOCUS_07250 13911 14285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 14286 15518 gene locus_tag LOCUS_07260 14286 15518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 15534 16691 gene locus_tag LOCUS_07270 15534 16691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 17509 18015 gene locus_tag LOCUS_07280 17509 18015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 18031 18606 gene locus_tag LOCUS_07290 18031 18606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 >Feature sequence022 1787 93 gene locus_tag LOCUS_07300 1787 93 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584022.1 protein_id gnl|my_center|LOCUS_07300 2623 1784 gene locus_tag LOCUS_07310 2623 1784 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360454.1 protein_id gnl|my_center|LOCUS_07310 3480 2620 gene locus_tag LOCUS_07320 3480 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07320 3932 3453 gene locus_tag LOCUS_07330 3932 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07330 4739 4041 gene locus_tag LOCUS_07340 4739 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07340 5410 4637 gene locus_tag LOCUS_07350 5410 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07350 5840 6865 gene locus_tag LOCUS_07360 gene malR 5840 6865 CDS product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219053.1 protein_id gnl|my_center|LOCUS_07360 7593 7066 gene locus_tag LOCUS_07370 7593 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07370 8297 7590 gene locus_tag LOCUS_07380 8297 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07380 8815 8294 gene locus_tag LOCUS_07390 8815 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07390 >Feature sequence023 1211 795 gene locus_tag LOCUS_07400 1211 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 2416 1343 gene locus_tag LOCUS_07410 2416 1343 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721374.1 protein_id gnl|my_center|LOCUS_07410 3216 2413 gene locus_tag LOCUS_07420 3216 2413 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721373.1 protein_id gnl|my_center|LOCUS_07420 4019 3213 gene locus_tag LOCUS_07430 4019 3213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721372.1 protein_id gnl|my_center|LOCUS_07430 5124 4009 gene locus_tag LOCUS_07440 5124 4009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014601365.1 protein_id gnl|my_center|LOCUS_07440 5790 5488 gene locus_tag LOCUS_07450 5790 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 6200 5814 gene locus_tag LOCUS_07460 6200 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 6412 6194 gene locus_tag LOCUS_07470 6412 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 6784 7002 gene locus_tag LOCUS_07480 6784 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 7596 7030 gene locus_tag LOCUS_07490 7596 7030 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583077.1 protein_id gnl|my_center|LOCUS_07490 9145 7940 gene locus_tag LOCUS_07500 9145 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 10306 9149 gene locus_tag LOCUS_07510 10306 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 10629 10303 gene locus_tag LOCUS_07520 10629 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07520 11051 10560 gene locus_tag LOCUS_07530 11051 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07530 11850 11485 gene locus_tag LOCUS_07540 11850 11485 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_07540 12277 11852 gene locus_tag LOCUS_07550 12277 11852 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231627.1 protein_id gnl|my_center|LOCUS_07550 12502 13497 gene locus_tag LOCUS_07560 12502 13497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 14171 13512 gene locus_tag LOCUS_07570 14171 13512 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711168.1 protein_id gnl|my_center|LOCUS_07570 14709 14224 gene locus_tag LOCUS_07580 14709 14224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07580 14759 15247 gene locus_tag LOCUS_07590 14759 15247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 15999 15238 gene locus_tag LOCUS_07600 15999 15238 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812699.1 protein_id gnl|my_center|LOCUS_07600 18152 16689 gene locus_tag LOCUS_07610 18152 16689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 18890 18174 gene locus_tag LOCUS_07620 18890 18174 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532679.1 protein_id gnl|my_center|LOCUS_07620 19330 19587 gene locus_tag LOCUS_07630 19330 19587 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015947.1 protein_id gnl|my_center|LOCUS_07630 19691 19951 gene locus_tag LOCUS_07640 19691 19951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 20578 21468 gene locus_tag LOCUS_07650 20578 21468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 22486 21644 gene locus_tag LOCUS_07660 gene ytbE 22486 21644 CDS product aldo/keto reductase YtbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229455.1 protein_id gnl|my_center|LOCUS_07660 22968 22489 gene locus_tag LOCUS_07670 22968 22489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07670 23272 23706 gene locus_tag LOCUS_07680 23272 23706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 23915 24217 gene locus_tag LOCUS_07690 23915 24217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07690 24388 25338 gene locus_tag LOCUS_07700 24388 25338 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903312.1 protein_id gnl|my_center|LOCUS_07700 26200 25439 gene locus_tag LOCUS_07710 26200 25439 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391974.1 protein_id gnl|my_center|LOCUS_07710 26414 26283 gene locus_tag LOCUS_07720 26414 26283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 28042 26888 gene locus_tag LOCUS_07730 28042 26888 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243061.1 protein_id gnl|my_center|LOCUS_07730 28188 28039 gene locus_tag LOCUS_07740 28188 28039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07740 28912 28205 gene locus_tag LOCUS_07750 gene deoD 28912 28205 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110707.1 protein_id gnl|my_center|LOCUS_07750 30146 28938 gene locus_tag LOCUS_07760 gene deoB 30146 28938 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723601.1 protein_id gnl|my_center|LOCUS_07760 30286 30149 gene locus_tag LOCUS_07770 30286 30149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 30671 30279 gene locus_tag LOCUS_07780 30671 30279 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_07780 31790 30816 gene locus_tag LOCUS_07790 31790 30816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 32207 31881 gene locus_tag LOCUS_07800 32207 31881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07800 32884 32180 gene locus_tag LOCUS_07810 32884 32180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07810 33813 32911 gene locus_tag LOCUS_07820 33813 32911 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_07820 35456 33810 gene locus_tag LOCUS_07830 35456 33810 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583938.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07830 36385 35426 gene locus_tag LOCUS_07840 36385 35426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 37021 36401 gene locus_tag LOCUS_07850 37021 36401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 38456 37002 gene locus_tag LOCUS_07860 38456 37002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07860 39349 38483 gene locus_tag LOCUS_07870 39349 38483 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_07870 40322 39354 gene locus_tag LOCUS_07880 40322 39354 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_07880 43255 40337 gene locus_tag LOCUS_07890 43255 40337 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_07890 44780 43437 gene locus_tag LOCUS_07900 44780 43437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence024 655 371 gene locus_tag LOCUS_07910 655 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 737 1231 gene locus_tag LOCUS_07920 gene spoVAC 737 1231 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147736.1 protein_id gnl|my_center|LOCUS_07920 1231 1482 gene locus_tag LOCUS_07930 1231 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07930 1482 2252 gene locus_tag LOCUS_07940 1482 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07940 2249 2599 gene locus_tag LOCUS_07950 gene spoVAE 2249 2599 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575919.1 protein_id gnl|my_center|LOCUS_07950 2766 3722 gene locus_tag LOCUS_07960 2766 3722 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_07960 3734 4969 gene locus_tag LOCUS_07970 3734 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 4969 6552 gene locus_tag LOCUS_07980 4969 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07980 6486 7199 gene locus_tag LOCUS_07990 6486 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07990 7400 7924 gene locus_tag LOCUS_08000 7400 7924 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765314.1 protein_id gnl|my_center|LOCUS_08000 7921 9045 gene locus_tag LOCUS_08010 gene yqeH 7921 9045 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229966.1 protein_id gnl|my_center|LOCUS_08010 9159 10082 gene locus_tag LOCUS_08020 gene aroE 9159 10082 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812076.1 protein_id gnl|my_center|LOCUS_08020 10198 10488 gene locus_tag LOCUS_08030 gene yhbY 10198 10488 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955224.1 protein_id gnl|my_center|LOCUS_08030 10530 11120 gene locus_tag LOCUS_08040 10530 11120 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674578.1 protein_id gnl|my_center|LOCUS_08040 11110 11679 gene locus_tag LOCUS_08050 gene yqeK 11110 11679 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 protein_id gnl|my_center|LOCUS_08050 11676 12023 gene locus_tag LOCUS_08060 gene rsfS 11676 12023 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 protein_id gnl|my_center|LOCUS_08060 12020 13006 gene locus_tag LOCUS_08070 12020 13006 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886474.1 protein_id gnl|my_center|LOCUS_08070 13025 13747 gene locus_tag LOCUS_08080 13025 13747 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873069.1 protein_id gnl|my_center|LOCUS_08080 14039 14929 gene locus_tag LOCUS_08090 14039 14929 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776833.1 protein_id gnl|my_center|LOCUS_08090 15564 14926 gene locus_tag LOCUS_08100 15564 14926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 15988 16968 gene locus_tag LOCUS_08110 15988 16968 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_08110 17426 18136 gene locus_tag LOCUS_08120 17426 18136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 18133 19455 gene locus_tag LOCUS_08130 18133 19455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 19783 20061 gene locus_tag LOCUS_08140 19783 20061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 20100 20573 gene locus_tag LOCUS_08150 20100 20573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 20480 20722 gene locus_tag LOCUS_08160 20480 20722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 21420 23030 gene locus_tag LOCUS_08170 21420 23030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 22991 27427 gene locus_tag LOCUS_08180 22991 27427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 27565 27750 gene locus_tag LOCUS_08190 27565 27750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 27883 28350 gene locus_tag LOCUS_08200 27883 28350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08200 28323 30317 gene locus_tag LOCUS_08210 gene leuS 28323 30317 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08210 30420 30328 gene locus_tag LOCUS_t00070 30420 30328 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 31201 30362 gene locus_tag LOCUS_08220 gene comER 31201 30362 CDS product late competence protein ComER inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020551.1 protein_id gnl|my_center|LOCUS_08220 31312 32016 gene locus_tag LOCUS_08230 31312 32016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 32098 33174 gene locus_tag LOCUS_08240 32098 33174 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08240 33171 33386 gene locus_tag LOCUS_08250 33171 33386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08250 33435 33965 gene locus_tag LOCUS_08260 33435 33965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 34165 37101 gene locus_tag LOCUS_08270 34165 37101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 37288 37692 gene locus_tag LOCUS_08280 37288 37692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08280 37611 37835 gene locus_tag LOCUS_08290 37611 37835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08290 37832 38935 gene locus_tag LOCUS_08300 37832 38935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 39166 39456 gene locus_tag LOCUS_08310 39166 39456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 39420 40199 gene locus_tag LOCUS_08320 39420 40199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08320 40840 41844 gene locus_tag LOCUS_08330 gene gpr 40840 41844 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662627.1 protein_id gnl|my_center|LOCUS_08330 42026 43267 gene locus_tag LOCUS_08340 gene spoIIP 42026 43267 CDS product spore autolysin SpoIIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229993.1 protein_id gnl|my_center|LOCUS_08340 43327 43731 gene locus_tag LOCUS_08350 43327 43731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 43878 45695 gene locus_tag LOCUS_08360 gene lepA 43878 45695 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030950.1 protein_id gnl|my_center|LOCUS_08360 45699 46847 gene locus_tag LOCUS_08370 gene hemW 45699 46847 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398764.1 protein_id gnl|my_center|LOCUS_08370 46939 47403 gene locus_tag LOCUS_08380 46939 47403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 47535 48560 gene locus_tag LOCUS_08390 gene hrcA 47535 48560 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_08390 48607 49251 gene locus_tag LOCUS_08400 48607 49251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 49309 51156 gene locus_tag LOCUS_08410 gene dnaK 49309 51156 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_08410 51256 52356 gene locus_tag LOCUS_08420 gene dnaJ 51256 52356 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230010.1 protein_id gnl|my_center|LOCUS_08420 52561 52746 gene locus_tag LOCUS_08430 52561 52746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 52724 52981 gene locus_tag LOCUS_08440 52724 52981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 53329 53096 gene locus_tag LOCUS_08450 53329 53096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence025 1074 202 gene locus_tag LOCUS_08460 1074 202 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_08460 1201 2061 gene locus_tag LOCUS_08470 gene araC 1201 2061 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045790020.1 protein_id gnl|my_center|LOCUS_08470 2175 3071 gene locus_tag LOCUS_08480 2175 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3064 4068 gene locus_tag LOCUS_08490 3064 4068 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_08490 4210 5784 gene locus_tag LOCUS_08500 4210 5784 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 protein_id gnl|my_center|LOCUS_08500 7506 5881 gene locus_tag LOCUS_08510 7506 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 7765 8694 gene locus_tag LOCUS_08520 7765 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08520 8697 9647 gene locus_tag LOCUS_08530 8697 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08530 10095 11423 gene locus_tag LOCUS_08540 10095 11423 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989563.1 protein_id gnl|my_center|LOCUS_08540 13238 12492 gene locus_tag LOCUS_08550 13238 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08550 13518 13219 gene locus_tag LOCUS_08560 13518 13219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08560 13809 15134 gene locus_tag LOCUS_08570 13809 15134 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732367.1 protein_id gnl|my_center|LOCUS_08570 15227 16021 gene locus_tag LOCUS_08580 15227 16021 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724790.1 protein_id gnl|my_center|LOCUS_08580 16008 16409 gene locus_tag LOCUS_08590 16008 16409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08590 16412 16846 gene locus_tag LOCUS_08600 16412 16846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08600 16869 17861 gene locus_tag LOCUS_08610 16869 17861 CDS product DUF1861 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213840.1 protein_id gnl|my_center|LOCUS_08610 17878 18942 gene locus_tag LOCUS_08620 17878 18942 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989598.1 protein_id gnl|my_center|LOCUS_08620 19083 20093 gene locus_tag LOCUS_08630 19083 20093 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170440.1 protein_id gnl|my_center|LOCUS_08630 20169 21527 gene locus_tag LOCUS_08640 20169 21527 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 protein_id gnl|my_center|LOCUS_08640 21576 22544 gene locus_tag LOCUS_08650 21576 22544 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024995.1 protein_id gnl|my_center|LOCUS_08650 22744 22616 gene locus_tag LOCUS_08660 22744 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 24078 22750 gene locus_tag LOCUS_08670 24078 22750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08670 24434 26008 gene locus_tag LOCUS_08680 24434 26008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 26025 27767 gene locus_tag LOCUS_08690 26025 27767 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_08690 27856 29529 gene locus_tag LOCUS_08700 27856 29529 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08700 29484 29660 gene locus_tag LOCUS_08710 29484 29660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 29742 30647 gene locus_tag LOCUS_08720 29742 30647 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_08720 30660 30908 gene locus_tag LOCUS_08730 30660 30908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08730 30917 31582 gene locus_tag LOCUS_08740 30917 31582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08740 31660 32142 gene locus_tag LOCUS_08750 31660 32142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 32076 33740 gene locus_tag LOCUS_08760 gene aguA 32076 33740 CDS product xylan alpha-(1->2)-glucuronosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082543.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08760 33763 34803 gene locus_tag LOCUS_08770 33763 34803 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583995.1 protein_id gnl|my_center|LOCUS_08770 35623 34901 gene locus_tag LOCUS_08780 35623 34901 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590206.1 protein_id gnl|my_center|LOCUS_08780 35837 35616 gene locus_tag LOCUS_08790 35837 35616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08790 36583 35801 gene locus_tag LOCUS_08800 36583 35801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08800 37050 36640 gene locus_tag LOCUS_08810 37050 36640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08810 37267 37452 gene locus_tag LOCUS_08820 37267 37452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08820 38482 38243 gene locus_tag LOCUS_08830 38482 38243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08830 38707 38952 gene locus_tag LOCUS_08840 38707 38952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 41597 40200 gene locus_tag LOCUS_08850 41597 40200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 42495 41620 gene locus_tag LOCUS_08860 42495 41620 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_08860 43503 42598 gene locus_tag LOCUS_08870 43503 42598 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722079.1 protein_id gnl|my_center|LOCUS_08870 44858 43506 gene locus_tag LOCUS_08880 44858 43506 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530183.1 protein_id gnl|my_center|LOCUS_08880 46726 45095 gene locus_tag LOCUS_08890 46726 45095 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_08890 48461 46752 gene locus_tag LOCUS_08900 gene yesM 48461 46752 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_08900 48748 48927 gene locus_tag LOCUS_08910 48748 48927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 48969 50168 gene locus_tag LOCUS_08920 48969 50168 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095906.1 protein_id gnl|my_center|LOCUS_08920 50515 51471 gene locus_tag LOCUS_08930 50515 51471 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723125.1 protein_id gnl|my_center|LOCUS_08930 52016 51465 gene locus_tag LOCUS_08940 52016 51465 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438024.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence026 3146 1230 gene locus_tag LOCUS_08950 3146 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 3336 3836 gene locus_tag LOCUS_08960 3336 3836 CDS product YpuI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067563.1 protein_id gnl|my_center|LOCUS_08960 3892 4092 gene locus_tag LOCUS_08970 3892 4092 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115477.1 protein_id gnl|my_center|LOCUS_08970 4098 4478 gene locus_tag LOCUS_08980 4098 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 4637 5239 gene locus_tag LOCUS_08990 4637 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08990 5170 5385 gene locus_tag LOCUS_09000 5170 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 5499 6665 gene locus_tag LOCUS_09010 5499 6665 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638992.1 protein_id gnl|my_center|LOCUS_09010 6662 7879 gene locus_tag LOCUS_09020 gene thiI 6662 7879 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188892867.1 protein_id gnl|my_center|LOCUS_09020 8602 7901 gene locus_tag LOCUS_09030 8602 7901 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346925.1 protein_id gnl|my_center|LOCUS_09030 8754 9422 gene locus_tag LOCUS_09040 8754 9422 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232944.1 protein_id gnl|my_center|LOCUS_09040 9660 10148 gene locus_tag LOCUS_09050 9660 10148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 10178 10393 gene locus_tag LOCUS_09060 10178 10393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09060 10401 10829 gene locus_tag LOCUS_09070 10401 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09070 10823 12049 gene locus_tag LOCUS_09080 10823 12049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09080 12139 12450 gene locus_tag LOCUS_09090 12139 12450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 12576 12848 gene locus_tag LOCUS_09100 12576 12848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258143.1 protein_id gnl|my_center|LOCUS_09100 12997 13326 gene locus_tag LOCUS_09110 12997 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 13323 13907 gene locus_tag LOCUS_09120 13323 13907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09120 13994 14446 gene locus_tag LOCUS_09130 13994 14446 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024593.1 protein_id gnl|my_center|LOCUS_09130 15003 14458 gene locus_tag LOCUS_09140 15003 14458 CDS product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854053.1 protein_id gnl|my_center|LOCUS_09140 15108 16439 gene locus_tag LOCUS_09150 15108 16439 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245272.1 protein_id gnl|my_center|LOCUS_09150 16635 17879 gene locus_tag LOCUS_09160 16635 17879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 18942 17863 gene locus_tag LOCUS_09170 18942 17863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence027 2073 259 gene locus_tag LOCUS_09180 2073 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2441 4630 gene locus_tag LOCUS_09190 2441 4630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_09190 4102 4028 gene locus_tag LOCUS_t00080 4102 4028 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4627 5124 gene locus_tag LOCUS_09200 4627 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 5777 5193 gene locus_tag LOCUS_09210 5777 5193 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074910.1 protein_id gnl|my_center|LOCUS_09210 6512 5781 gene locus_tag LOCUS_09220 6512 5781 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242345.1 protein_id gnl|my_center|LOCUS_09220 7511 6660 gene locus_tag LOCUS_09230 7511 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09230 8059 7514 gene locus_tag LOCUS_09240 8059 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09240 8765 8037 gene locus_tag LOCUS_09250 8765 8037 CDS product FeoB small GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033855.1 protein_id gnl|my_center|LOCUS_09250 9019 8762 gene locus_tag LOCUS_09260 9019 8762 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252989.1 protein_id gnl|my_center|LOCUS_09260 10230 9376 gene locus_tag LOCUS_09270 10230 9376 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_09270 11144 10323 gene locus_tag LOCUS_09280 11144 10323 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228670.1 protein_id gnl|my_center|LOCUS_09280 11988 11248 gene locus_tag LOCUS_09290 gene fabI 11988 11248 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421886.1 protein_id gnl|my_center|LOCUS_09290 12369 12139 gene locus_tag LOCUS_09300 12369 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 <13147 12474 gene locus_tag LOCUS_09310 <13147 12474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003234325.1:D-alanine--D-alanine ligase >Feature sequence028 351 1298 gene locus_tag LOCUS_09320 351 1298 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082266.1 protein_id gnl|my_center|LOCUS_09320 1360 1947 gene locus_tag LOCUS_09330 1360 1947 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168663.1 protein_id gnl|my_center|LOCUS_09330 1940 2392 gene locus_tag LOCUS_09340 1940 2392 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246529.1 protein_id gnl|my_center|LOCUS_09340 2472 3374 gene locus_tag LOCUS_09350 2472 3374 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810614.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence029 1998 235 gene locus_tag LOCUS_09360 1998 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 3547 2594 gene locus_tag LOCUS_09370 3547 2594 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448350.1 protein_id gnl|my_center|LOCUS_09370 3775 3563 gene locus_tag LOCUS_09380 3775 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09380 4872 3670 gene locus_tag LOCUS_09390 gene hemL 4872 3670 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712943.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09390 6036 5023 gene locus_tag LOCUS_09400 gene hemB 6036 5023 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087065.1 protein_id gnl|my_center|LOCUS_09400 7094 6033 gene locus_tag LOCUS_09410 7094 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09410 7609 7094 gene locus_tag LOCUS_09420 7609 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09420 8429 7602 gene locus_tag LOCUS_09430 gene hemC 8429 7602 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226416.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09430 9319 8426 gene locus_tag LOCUS_09440 9319 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 11025 9640 gene locus_tag LOCUS_09450 gene hemA 11025 9640 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 protein_id gnl|my_center|LOCUS_09450 11660 11262 gene locus_tag LOCUS_09460 gene speH1 11660 11262 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456824.1 protein_id gnl|my_center|LOCUS_09460 12563 11973 gene locus_tag LOCUS_09470 12563 11973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 13170 12772 gene locus_tag LOCUS_09480 13170 12772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09480 13367 13182 gene locus_tag LOCUS_09490 13367 13182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09490 15742 13364 gene locus_tag LOCUS_09500 gene lon 15742 13364 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 protein_id gnl|my_center|LOCUS_09500 16601 15777 gene locus_tag LOCUS_09510 16601 15777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09510 17113 16562 gene locus_tag LOCUS_09520 17113 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09520 18834 17629 gene locus_tag LOCUS_09530 gene ispG 18834 17629 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_09530 19305 18835 gene locus_tag LOCUS_09540 19305 18835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09540 20090 19302 gene locus_tag LOCUS_09550 20090 19302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09550 20709 20116 gene locus_tag LOCUS_09560 gene clpP 20709 20116 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_09560 22313 21012 gene locus_tag LOCUS_09570 gene tig 22313 21012 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_09570 23271 22405 gene locus_tag LOCUS_09580 23271 22405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 23496 23569 gene locus_tag LOCUS_t00090 23496 23569 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23615 23691 gene locus_tag LOCUS_t00100 23615 23691 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24586 24458 gene locus_tag LOCUS_09590 24586 24458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 24970 24641 gene locus_tag LOCUS_09600 24970 24641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 25109 26809 gene locus_tag LOCUS_09610 gene asnB 25109 26809 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392813.1 protein_id gnl|my_center|LOCUS_09610 26815 26952 gene locus_tag LOCUS_09620 26815 26952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09620 >Feature sequence030 1083 64 gene locus_tag LOCUS_09630 1083 64 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530527.1 protein_id gnl|my_center|LOCUS_09630 2123 2308 gene locus_tag LOCUS_09640 2123 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 3143 2322 gene locus_tag LOCUS_09650 3143 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3381 4427 gene locus_tag LOCUS_09660 3381 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 5240 4449 gene locus_tag LOCUS_09670 5240 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 5403 5693 gene locus_tag LOCUS_09680 5403 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09680 5782 7425 gene locus_tag LOCUS_09690 5782 7425 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582883.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09690 7574 7422 gene locus_tag LOCUS_09700 7574 7422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 8224 7532 gene locus_tag LOCUS_09710 8224 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 8678 8265 gene locus_tag LOCUS_09720 8678 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 9769 8600 gene locus_tag LOCUS_09730 9769 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 10700 9840 gene locus_tag LOCUS_09740 10700 9840 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_09740 11656 10694 gene locus_tag LOCUS_09750 gene rmgP 11656 10694 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_09750 13597 11774 gene locus_tag LOCUS_09760 13597 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 15256 13631 gene locus_tag LOCUS_09770 15256 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 16275 15505 gene locus_tag LOCUS_09780 16275 15505 CDS product chlorinating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525107.1 protein_id gnl|my_center|LOCUS_09780 16525 16376 gene locus_tag LOCUS_09790 16525 16376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 16710 16546 gene locus_tag LOCUS_09800 16710 16546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 17207 16686 gene locus_tag LOCUS_09810 17207 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 17723 17235 gene locus_tag LOCUS_09820 17723 17235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 19501 17720 gene locus_tag LOCUS_09830 19501 17720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 19624 20439 gene locus_tag LOCUS_09840 19624 20439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 20765 20436 gene locus_tag LOCUS_09850 20765 20436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 21310 20762 gene locus_tag LOCUS_09860 21310 20762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 23034 21448 gene locus_tag LOCUS_09870 23034 21448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 24517 23123 gene locus_tag LOCUS_09880 24517 23123 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_09880 25402 24572 gene locus_tag LOCUS_09890 25402 24572 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546230.1 protein_id gnl|my_center|LOCUS_09890 26344 25421 gene locus_tag LOCUS_09900 26344 25421 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032532.1 protein_id gnl|my_center|LOCUS_09900 27755 26436 gene locus_tag LOCUS_09910 27755 26436 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225468.1 protein_id gnl|my_center|LOCUS_09910 28399 27866 gene locus_tag LOCUS_09920 28399 27866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 29682 28414 gene locus_tag LOCUS_09930 29682 28414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 30508 29978 gene locus_tag LOCUS_09940 30508 29978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 31390 30770 gene locus_tag LOCUS_09950 31390 30770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 32527 31688 gene locus_tag LOCUS_09960 32527 31688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459029.1 protein_id gnl|my_center|LOCUS_09960 34176 33001 gene locus_tag LOCUS_09970 gene gguB 34176 33001 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257795.1 protein_id gnl|my_center|LOCUS_09970 35710 34187 gene locus_tag LOCUS_09980 gene gguA 35710 34187 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257794.1 protein_id gnl|my_center|LOCUS_09980 36809 35796 gene locus_tag LOCUS_09990 gene chvE 36809 35796 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257793.1 protein_id gnl|my_center|LOCUS_09990 39077 37017 gene locus_tag LOCUS_10000 39077 37017 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812357.1 protein_id gnl|my_center|LOCUS_10000 39745 39281 gene locus_tag LOCUS_10010 39745 39281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10010 40380 39649 gene locus_tag LOCUS_10020 40380 39649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10020 >Feature sequence031 441 815 gene locus_tag LOCUS_10030 441 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 929 1315 gene locus_tag LOCUS_10040 929 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10040 1327 1713 gene locus_tag LOCUS_10050 1327 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10050 1777 3048 gene locus_tag LOCUS_10060 1777 3048 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870047.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10060 3217 3558 gene locus_tag LOCUS_10070 3217 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 3589 4143 gene locus_tag LOCUS_10080 3589 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 4136 4804 gene locus_tag LOCUS_10090 4136 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 5007 5705 gene locus_tag LOCUS_10100 gene rpsB 5007 5705 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_10100 5889 6485 gene locus_tag LOCUS_10110 gene tsf 5889 6485 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_10110 6601 7314 gene locus_tag LOCUS_10120 gene pyrH 6601 7314 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042663.1 protein_id gnl|my_center|LOCUS_10120 7331 7885 gene locus_tag LOCUS_10130 gene frr 7331 7885 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_10130 7975 8739 gene locus_tag LOCUS_10140 gene uppS 7975 8739 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971301.1 protein_id gnl|my_center|LOCUS_10140 8768 9562 gene locus_tag LOCUS_10150 8768 9562 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565800.1 protein_id gnl|my_center|LOCUS_10150 9600 10745 gene locus_tag LOCUS_10160 9600 10745 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188776689.1 protein_id gnl|my_center|LOCUS_10160 10829 12109 gene locus_tag LOCUS_10170 gene rseP 10829 12109 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090228.1 protein_id gnl|my_center|LOCUS_10170 12116 12778 gene locus_tag LOCUS_10180 12116 12778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10180 12667 13563 gene locus_tag LOCUS_10190 12667 13563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10190 13668 14342 gene locus_tag LOCUS_10200 13668 14342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10200 14237 17614 gene locus_tag LOCUS_10210 14237 17614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10210 17662 17973 gene locus_tag LOCUS_10220 17662 17973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10220 18137 18595 gene locus_tag LOCUS_10230 gene rimP 18137 18595 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_10230 18743 19843 gene locus_tag LOCUS_10240 gene nusA 18743 19843 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_10240 19899 20210 gene locus_tag LOCUS_10250 19899 20210 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460394.1 protein_id gnl|my_center|LOCUS_10250 20203 20526 gene locus_tag LOCUS_10260 20203 20526 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286523.1 protein_id gnl|my_center|LOCUS_10260 20519 21814 gene locus_tag LOCUS_10270 20519 21814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10270 21811 23118 gene locus_tag LOCUS_10280 21811 23118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10280 23126 23482 gene locus_tag LOCUS_10290 gene rbfA 23126 23482 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 protein_id gnl|my_center|LOCUS_10290 23529 24467 gene locus_tag LOCUS_10300 23529 24467 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_10300 24467 25399 gene locus_tag LOCUS_10310 gene truB 24467 25399 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244678.1 protein_id gnl|my_center|LOCUS_10310 25420 26394 gene locus_tag LOCUS_10320 gene ribF 25420 26394 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245551.1 protein_id gnl|my_center|LOCUS_10320 26590 26859 gene locus_tag LOCUS_10330 gene rpsO 26590 26859 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220957.1 protein_id gnl|my_center|LOCUS_10330 27034 27201 gene locus_tag LOCUS_10340 27034 27201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10340 27198 29132 gene locus_tag LOCUS_10350 gene pnp 27198 29132 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076750.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence032 3802 500 gene locus_tag LOCUS_10360 3802 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 7200 4012 gene locus_tag LOCUS_10370 7200 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 10235 7536 gene locus_tag LOCUS_10380 10235 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 13011 10318 gene locus_tag LOCUS_10390 13011 10318 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_10390 13692 13183 gene locus_tag LOCUS_10400 13692 13183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10400 14350 13859 gene locus_tag LOCUS_10410 14350 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 15034 14441 gene locus_tag LOCUS_10420 15034 14441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10420 15268 15083 gene locus_tag LOCUS_10430 15268 15083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 15693 15202 gene locus_tag LOCUS_10440 15693 15202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence033 1859 537 gene locus_tag LOCUS_10450 1859 537 CDS product DUF3900 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233793.1 protein_id gnl|my_center|LOCUS_10450 3237 2149 gene locus_tag LOCUS_10460 gene nosA 3237 2149 CDS product nitric oxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243309.1 protein_id gnl|my_center|LOCUS_10460 4123 3215 gene locus_tag LOCUS_10470 4123 3215 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246628.1 protein_id gnl|my_center|LOCUS_10470 5665 4304 gene locus_tag LOCUS_10480 5665 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10480 6381 5620 gene locus_tag LOCUS_10490 6381 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10490 6938 7612 gene locus_tag LOCUS_10500 6938 7612 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 protein_id gnl|my_center|LOCUS_10500 10343 7737 gene locus_tag LOCUS_10510 gene hrpB 10343 7737 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_10510 10702 10547 gene locus_tag LOCUS_10520 10702 10547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 11499 10717 gene locus_tag LOCUS_10530 11499 10717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10530 11914 12885 gene locus_tag LOCUS_10540 gene gluQRS 11914 12885 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_10540 13179 13021 gene locus_tag LOCUS_10550 13179 13021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 13835 13146 gene locus_tag LOCUS_10560 13835 13146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10560 14545 13934 gene locus_tag LOCUS_10570 gene cobU 14545 13934 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258421.1 protein_id gnl|my_center|LOCUS_10570 15628 14552 gene locus_tag LOCUS_10580 gene cobT 15628 14552 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211350.1 protein_id gnl|my_center|LOCUS_10580 16414 15635 gene locus_tag LOCUS_10590 16414 15635 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460056.1 protein_id gnl|my_center|LOCUS_10590 17448 16411 gene locus_tag LOCUS_10600 17448 16411 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_10600 18422 17454 gene locus_tag LOCUS_10610 18422 17454 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 protein_id gnl|my_center|LOCUS_10610 19170 19610 gene locus_tag LOCUS_10620 19170 19610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 20548 19865 gene locus_tag LOCUS_10630 20548 19865 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074301.1 protein_id gnl|my_center|LOCUS_10630 22419 20545 gene locus_tag LOCUS_10640 gene copA 22419 20545 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10640 22808 22401 gene locus_tag LOCUS_10650 22808 22401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10650 24082 23786 gene locus_tag LOCUS_10660 24082 23786 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661811.1 protein_id gnl|my_center|LOCUS_10660 24483 24079 gene locus_tag LOCUS_10670 24483 24079 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382363.1 protein_id gnl|my_center|LOCUS_10670 25479 24895 gene locus_tag LOCUS_10680 25479 24895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 27836 25467 gene locus_tag LOCUS_10690 27836 25467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10690 29856 27820 gene locus_tag LOCUS_10700 29856 27820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 30171 29908 gene locus_tag LOCUS_10710 30171 29908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 30851 30132 gene locus_tag LOCUS_10720 30851 30132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10720 31837 30848 gene locus_tag LOCUS_10730 31837 30848 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence034 899 48 gene locus_tag LOCUS_10740 899 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1127 912 gene locus_tag LOCUS_10750 1127 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1248 1457 gene locus_tag LOCUS_10760 1248 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 5377 1658 gene locus_tag LOCUS_10770 5377 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 5785 5516 gene locus_tag LOCUS_10780 5785 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10780 7449 5806 gene locus_tag LOCUS_10790 7449 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 7808 7539 gene locus_tag LOCUS_10800 7808 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 8719 7850 gene locus_tag LOCUS_10810 8719 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence035 2470 218 gene locus_tag LOCUS_10820 2470 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4237 2474 gene locus_tag LOCUS_10830 4237 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4554 4234 gene locus_tag LOCUS_10840 4554 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 5510 4551 gene locus_tag LOCUS_10850 5510 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 5769 5554 gene locus_tag LOCUS_10860 5769 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10860 6428 5721 gene locus_tag LOCUS_10870 6428 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10870 7191 6481 gene locus_tag LOCUS_10880 7191 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10880 7748 7473 gene locus_tag LOCUS_10890 7748 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 8014 7709 gene locus_tag LOCUS_10900 8014 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 9102 8002 gene locus_tag LOCUS_10910 9102 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10910 11124 9481 gene locus_tag LOCUS_10920 11124 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 11705 11121 gene locus_tag LOCUS_10930 11705 11121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence036 1140 250 gene locus_tag LOCUS_10940 1140 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1314 1685 gene locus_tag LOCUS_10950 1314 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3482 1818 gene locus_tag LOCUS_10960 3482 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 4102 3668 gene locus_tag LOCUS_10970 gene perR 4102 3668 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 protein_id gnl|my_center|LOCUS_10970 5386 4205 gene locus_tag LOCUS_10980 5386 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 6144 5383 gene locus_tag LOCUS_10990 6144 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 6398 6123 gene locus_tag LOCUS_11000 6398 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 7875 6583 gene locus_tag LOCUS_11010 gene gatB 7875 6583 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219444.1 protein_id gnl|my_center|LOCUS_11010 9524 8067 gene locus_tag LOCUS_11020 gene gatA 9524 8067 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051434.1 protein_id gnl|my_center|LOCUS_11020 9844 9557 gene locus_tag LOCUS_11030 gene gatC 9844 9557 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219442.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence037 1283 429 gene locus_tag LOCUS_11040 1283 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 2067 1540 gene locus_tag LOCUS_11050 2067 1540 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701534.1 protein_id gnl|my_center|LOCUS_11050 2614 2117 gene locus_tag LOCUS_11060 2614 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11060 3459 2554 gene locus_tag LOCUS_11070 3459 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11070 4363 3461 gene locus_tag LOCUS_11080 gene galU 4363 3461 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757774.1 protein_id gnl|my_center|LOCUS_11080 5646 4462 gene locus_tag LOCUS_11090 5646 4462 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 protein_id gnl|my_center|LOCUS_11090 6384 5698 gene locus_tag LOCUS_11100 6384 5698 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228268.1 protein_id gnl|my_center|LOCUS_11100 8168 6381 gene locus_tag LOCUS_11110 8168 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 9180 8125 gene locus_tag LOCUS_11120 9180 8125 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_11120 10403 9177 gene locus_tag LOCUS_11130 10403 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 11300 10638 gene locus_tag LOCUS_11140 11300 10638 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257362.1 protein_id gnl|my_center|LOCUS_11140 12688 11390 gene locus_tag LOCUS_11150 12688 11390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 13847 12666 gene locus_tag LOCUS_11160 13847 12666 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_11160 15052 13844 gene locus_tag LOCUS_11170 15052 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 15606 15049 gene locus_tag LOCUS_11180 15606 15049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 16493 15591 gene locus_tag LOCUS_11190 16493 15591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 18306 16483 gene locus_tag LOCUS_11200 18306 16483 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_11200 18992 18303 gene locus_tag LOCUS_11210 18992 18303 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207193.1 protein_id gnl|my_center|LOCUS_11210 19737 18976 gene locus_tag LOCUS_11220 gene capA 19737 18976 CDS product capsular polysaccharide type 5/8 biosynthesis protein CapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446299.1 protein_id gnl|my_center|LOCUS_11220 21399 20473 gene locus_tag LOCUS_11230 gene rhaR 21399 20473 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368942.1 protein_id gnl|my_center|LOCUS_11230 21608 24313 gene locus_tag LOCUS_11240 21608 24313 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_11240 24916 24419 gene locus_tag LOCUS_11250 24916 24419 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351108.1 protein_id gnl|my_center|LOCUS_11250 25255 25064 gene locus_tag LOCUS_11260 25255 25064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 26056 25289 gene locus_tag LOCUS_11270 26056 25289 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_11270 26219 27031 gene locus_tag LOCUS_11280 gene araC 26219 27031 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045790020.1 protein_id gnl|my_center|LOCUS_11280 27175 28023 gene locus_tag LOCUS_11290 27175 28023 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_11290 28217 28444 gene locus_tag LOCUS_11300 28217 28444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 30611 28497 gene locus_tag LOCUS_11310 gene metE 30611 28497 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989783.1 protein_id gnl|my_center|LOCUS_11310 30782 31339 gene locus_tag LOCUS_11320 30782 31339 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003499036.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence038 444 1130 gene locus_tag LOCUS_11330 444 1130 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 protein_id gnl|my_center|LOCUS_11330 1337 1657 gene locus_tag LOCUS_11340 1337 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11340 1641 1862 gene locus_tag LOCUS_11350 1641 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1840 2079 gene locus_tag LOCUS_11360 1840 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 2106 2597 gene locus_tag LOCUS_11370 2106 2597 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966757.1 protein_id gnl|my_center|LOCUS_11370 2881 3630 gene locus_tag LOCUS_11380 2881 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 3842 3669 gene locus_tag LOCUS_11390 3842 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 4113 3814 gene locus_tag LOCUS_11400 4113 3814 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272202.1 protein_id gnl|my_center|LOCUS_11400 5507 4191 gene locus_tag LOCUS_11410 5507 4191 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775027.1 protein_id gnl|my_center|LOCUS_11410 6511 6236 gene locus_tag LOCUS_11420 6511 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 6898 7758 gene locus_tag LOCUS_11430 6898 7758 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246384.1 protein_id gnl|my_center|LOCUS_11430 8252 7854 gene locus_tag LOCUS_11440 8252 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 10686 8410 gene locus_tag LOCUS_11450 10686 8410 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731969.1 protein_id gnl|my_center|LOCUS_11450 11465 10944 gene locus_tag LOCUS_11460 11465 10944 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993326.1 protein_id gnl|my_center|LOCUS_11460 12443 12186 gene locus_tag LOCUS_11470 12443 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 13075 13797 gene locus_tag LOCUS_11480 13075 13797 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013859.1 protein_id gnl|my_center|LOCUS_11480 15225 14620 gene locus_tag LOCUS_11490 gene raiA 15225 14620 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289771.1 protein_id gnl|my_center|LOCUS_11490 15947 15222 gene locus_tag LOCUS_11500 gene pflA 15947 15222 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002446860.1 protein_id gnl|my_center|LOCUS_11500 16298 16041 gene locus_tag LOCUS_11510 16298 16041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11510 17232 16237 gene locus_tag LOCUS_11520 17232 16237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11520 17939 17187 gene locus_tag LOCUS_11530 17939 17187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11530 18229 17936 gene locus_tag LOCUS_11540 18229 17936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11540 18698 18330 gene locus_tag LOCUS_11550 18698 18330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11550 19834 18620 gene locus_tag LOCUS_11560 19834 18620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11560 20941 19877 gene locus_tag LOCUS_11570 20941 19877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11570 21568 21077 gene locus_tag LOCUS_11580 21568 21077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 23514 21790 gene locus_tag LOCUS_11590 23514 21790 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_11590 23999 23529 gene locus_tag LOCUS_11600 gene cbaB 23999 23529 CDS product ba3-type cytochrome C oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173203.1 protein_id gnl|my_center|LOCUS_11600 24158 24024 gene locus_tag LOCUS_11610 24158 24024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 25492 25070 gene locus_tag LOCUS_11620 25492 25070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 26198 25944 gene locus_tag LOCUS_11630 26198 25944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 26937 27131 gene locus_tag LOCUS_11640 26937 27131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence039 182 562 gene locus_tag LOCUS_11650 182 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 978 790 gene locus_tag LOCUS_11660 978 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 2227 1814 gene locus_tag LOCUS_11670 2227 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 3248 2727 gene locus_tag LOCUS_11680 3248 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 3901 3245 gene locus_tag LOCUS_11690 3901 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 4370 4158 gene locus_tag LOCUS_11700 4370 4158 CDS product DUF6366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031475.1 protein_id gnl|my_center|LOCUS_11700 5055 5216 gene locus_tag LOCUS_11710 5055 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 5961 5242 gene locus_tag LOCUS_11720 5961 5242 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065023.1 protein_id gnl|my_center|LOCUS_11720 7073 6585 gene locus_tag LOCUS_11730 7073 6585 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905253.1 protein_id gnl|my_center|LOCUS_11730 8011 7379 gene locus_tag LOCUS_11740 8011 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11740 8558 8001 gene locus_tag LOCUS_11750 8558 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11750 9154 8615 gene locus_tag LOCUS_11760 9154 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 9953 9492 gene locus_tag LOCUS_11770 9953 9492 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920736.1 protein_id gnl|my_center|LOCUS_11770 10389 10192 gene locus_tag LOCUS_11780 10389 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 10554 10399 gene locus_tag LOCUS_11790 10554 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 11185 10649 gene locus_tag LOCUS_11800 11185 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 12057 11227 gene locus_tag LOCUS_11810 12057 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 12455 12087 gene locus_tag LOCUS_11820 12455 12087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 13184 12546 gene locus_tag LOCUS_11830 13184 12546 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_11830 13781 14425 gene locus_tag LOCUS_11840 13781 14425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11840 14466 15155 gene locus_tag LOCUS_11850 14466 15155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 15614 15234 gene locus_tag LOCUS_11860 15614 15234 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540529.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11860 15875 15684 gene locus_tag LOCUS_11870 15875 15684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 17021 16434 gene locus_tag LOCUS_11880 17021 16434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 17826 17656 gene locus_tag LOCUS_11890 17826 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 18103 17750 gene locus_tag LOCUS_11900 18103 17750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 18903 18316 gene locus_tag LOCUS_11910 18903 18316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 19575 18997 gene locus_tag LOCUS_11920 19575 18997 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064460030.1 protein_id gnl|my_center|LOCUS_11920 19808 19638 gene locus_tag LOCUS_11930 19808 19638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 20410 20132 gene locus_tag LOCUS_11940 20410 20132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 20850 20542 gene locus_tag LOCUS_11950 20850 20542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231564.1 protein_id gnl|my_center|LOCUS_11950 21056 20847 gene locus_tag LOCUS_11960 21056 20847 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_11960 21287 21622 gene locus_tag LOCUS_11970 21287 21622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence040 70 684 gene locus_tag LOCUS_11980 70 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 699 848 gene locus_tag LOCUS_11990 699 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 911 1963 gene locus_tag LOCUS_12000 911 1963 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_12000 2162 2947 gene locus_tag LOCUS_12010 2162 2947 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635337.1 protein_id gnl|my_center|LOCUS_12010 3143 4405 gene locus_tag LOCUS_12020 3143 4405 CDS product ribulose-bisphosphate carboxylase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064440.1 protein_id gnl|my_center|LOCUS_12020 4427 5803 gene locus_tag LOCUS_12030 4427 5803 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975268.1 protein_id gnl|my_center|LOCUS_12030 5844 6557 gene locus_tag LOCUS_12040 5844 6557 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903683.1 protein_id gnl|my_center|LOCUS_12040 6532 7554 gene locus_tag LOCUS_12050 gene bdhA 6532 7554 CDS product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645822.1 protein_id gnl|my_center|LOCUS_12050 7645 8190 gene locus_tag LOCUS_12060 7645 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12060 8178 8675 gene locus_tag LOCUS_12070 8178 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12070 8764 9288 gene locus_tag LOCUS_12080 8764 9288 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810020.1 protein_id gnl|my_center|LOCUS_12080 9289 10563 gene locus_tag LOCUS_12090 9289 10563 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039498.1 protein_id gnl|my_center|LOCUS_12090 10659 11321 gene locus_tag LOCUS_12100 10659 11321 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390891.1 protein_id gnl|my_center|LOCUS_12100 11370 12194 gene locus_tag LOCUS_12110 11370 12194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12110 12107 12655 gene locus_tag LOCUS_12120 12107 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12120 13411 12722 gene locus_tag LOCUS_12130 13411 12722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 14301 13408 gene locus_tag LOCUS_12140 14301 13408 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804332.1 protein_id gnl|my_center|LOCUS_12140 14669 14298 gene locus_tag LOCUS_12150 14669 14298 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462187.1 protein_id gnl|my_center|LOCUS_12150 14871 15764 gene locus_tag LOCUS_12160 14871 15764 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114196.1 protein_id gnl|my_center|LOCUS_12160 15891 16811 gene locus_tag LOCUS_12170 15891 16811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12170 16766 17008 gene locus_tag LOCUS_12180 16766 17008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12180 17365 17144 gene locus_tag LOCUS_12190 17365 17144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 18240 17665 gene locus_tag LOCUS_12200 18240 17665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 19437 18511 gene locus_tag LOCUS_12210 19437 18511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 19693 20709 gene locus_tag LOCUS_12220 19693 20709 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735580.1 protein_id gnl|my_center|LOCUS_12220 20722 21204 gene locus_tag LOCUS_12230 20722 21204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 21206 22489 gene locus_tag LOCUS_12240 21206 22489 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902212.1 protein_id gnl|my_center|LOCUS_12240 23196 22624 gene locus_tag LOCUS_12250 23196 22624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 24426 23350 gene locus_tag LOCUS_12260 24426 23350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 25888 24404 gene locus_tag LOCUS_12270 25888 24404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 26355 25825 gene locus_tag LOCUS_12280 26355 25825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 26597 28906 gene locus_tag LOCUS_12290 26597 28906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 28978 30390 gene locus_tag LOCUS_12300 28978 30390 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122964585.1 protein_id gnl|my_center|LOCUS_12300 30415 31380 gene locus_tag LOCUS_12310 30415 31380 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_12310 31408 32232 gene locus_tag LOCUS_12320 31408 32232 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_12320 32345 33112 gene locus_tag LOCUS_12330 32345 33112 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_12330 33466 37608 gene locus_tag LOCUS_12340 33466 37608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 37915 38697 gene locus_tag LOCUS_12350 37915 38697 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_12350 38816 39790 gene locus_tag LOCUS_12360 gene axeA 38816 39790 CDS product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 protein_id gnl|my_center|LOCUS_12360 41043 40153 gene locus_tag LOCUS_12370 41043 40153 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105258.1 protein_id gnl|my_center|LOCUS_12370 41500 41673 gene locus_tag LOCUS_12380 41500 41673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 41747 42328 gene locus_tag LOCUS_12390 41747 42328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12390 42250 43092 gene locus_tag LOCUS_12400 42250 43092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12400 46375 43178 gene locus_tag LOCUS_12410 46375 43178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 46902 47666 gene locus_tag LOCUS_12420 46902 47666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12420 47872 48234 gene locus_tag LOCUS_12430 47872 48234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 48321 49964 gene locus_tag LOCUS_12440 48321 49964 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930161.1 protein_id gnl|my_center|LOCUS_12440 50104 50751 gene locus_tag LOCUS_12450 gene sleB 50104 50751 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249045.1 protein_id gnl|my_center|LOCUS_12450 50828 51649 gene locus_tag LOCUS_12460 50828 51649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 53558 51714 gene locus_tag LOCUS_12470 gene ltaP 53558 51714 CDS product lipoteichoic acid primase LtaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931059.1 protein_id gnl|my_center|LOCUS_12470 55992 54121 gene locus_tag LOCUS_12480 55992 54121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 56921 55992 gene locus_tag LOCUS_12490 56921 55992 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925219.1 protein_id gnl|my_center|LOCUS_12490 57204 57443 gene locus_tag LOCUS_12500 57204 57443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 57452 57742 gene locus_tag LOCUS_12510 57452 57742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12510 57742 58278 gene locus_tag LOCUS_12520 57742 58278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12520 58636 58370 gene locus_tag LOCUS_12530 58636 58370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12530 59457 58585 gene locus_tag LOCUS_12540 59457 58585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12540 60154 61284 gene locus_tag LOCUS_12550 60154 61284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12550 61281 61544 gene locus_tag LOCUS_12560 61281 61544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12560 61531 63375 gene locus_tag LOCUS_12570 61531 63375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_12570 64279 63410 gene locus_tag LOCUS_12580 64279 63410 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459701.1 protein_id gnl|my_center|LOCUS_12580 64376 64756 gene locus_tag LOCUS_12590 64376 64756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 64907 65614 gene locus_tag LOCUS_12600 64907 65614 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229333.1 protein_id gnl|my_center|LOCUS_12600 66079 66915 gene locus_tag LOCUS_12610 66079 66915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 66872 67021 gene locus_tag LOCUS_12620 66872 67021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 67149 68642 gene locus_tag LOCUS_12630 gene abfB 67149 68642 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_12630 68646 68945 gene locus_tag LOCUS_12640 68646 68945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 68965 69951 gene locus_tag LOCUS_12650 68965 69951 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_12650 70563 69943 gene locus_tag LOCUS_12660 70563 69943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 71882 70806 gene locus_tag LOCUS_12670 71882 70806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 73087 72314 gene locus_tag LOCUS_12680 73087 72314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12680 73746 73084 gene locus_tag LOCUS_12690 73746 73084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12690 74075 74150 gene locus_tag LOCUS_t00110 74075 74150 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence041 281 997 gene locus_tag LOCUS_12700 281 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1256 1086 gene locus_tag LOCUS_12710 1256 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1416 1195 gene locus_tag LOCUS_12720 1416 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1593 1751 gene locus_tag LOCUS_12730 1593 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 1748 2608 gene locus_tag LOCUS_12740 1748 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12740 3077 2826 gene locus_tag LOCUS_12750 3077 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3223 3732 gene locus_tag LOCUS_12760 3223 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12760 3965 4276 gene locus_tag LOCUS_12770 3965 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4321 5124 gene locus_tag LOCUS_12780 4321 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12780 5121 7073 gene locus_tag LOCUS_12790 5121 7073 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192966.1 protein_id gnl|my_center|LOCUS_12790 7114 8691 gene locus_tag LOCUS_12800 7114 8691 CDS product SagB family peptide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175516.1 protein_id gnl|my_center|LOCUS_12800 8930 8688 gene locus_tag LOCUS_12810 8930 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 9191 10693 gene locus_tag LOCUS_12820 9191 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12820 10615 11301 gene locus_tag LOCUS_12830 10615 11301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12830 11313 12062 gene locus_tag LOCUS_12840 11313 12062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12840 12065 12403 gene locus_tag LOCUS_12850 12065 12403 CDS product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220730.1 protein_id gnl|my_center|LOCUS_12850 12396 13430 gene locus_tag LOCUS_12860 12396 13430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12860 13427 13882 gene locus_tag LOCUS_12870 13427 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12870 13879 14364 gene locus_tag LOCUS_12880 13879 14364 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244015.1 protein_id gnl|my_center|LOCUS_12880 14361 14654 gene locus_tag LOCUS_12890 14361 14654 CDS product Na(+)/H(+) antiporter subunit F1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461656.1 protein_id gnl|my_center|LOCUS_12890 14623 14898 gene locus_tag LOCUS_12900 14623 14898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12900 15228 16943 gene locus_tag LOCUS_12910 15228 16943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944620.1 protein_id gnl|my_center|LOCUS_12910 17160 18155 gene locus_tag LOCUS_12920 17160 18155 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_12920 18152 19135 gene locus_tag LOCUS_12930 18152 19135 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_12930 19522 19680 gene locus_tag LOCUS_12940 19522 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 20874 19774 gene locus_tag LOCUS_12950 20874 19774 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147460.1 protein_id gnl|my_center|LOCUS_12950 21095 21382 gene locus_tag LOCUS_12960 21095 21382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 21540 22151 gene locus_tag LOCUS_12970 21540 22151 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 protein_id gnl|my_center|LOCUS_12970 22216 22779 gene locus_tag LOCUS_12980 22216 22779 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 protein_id gnl|my_center|LOCUS_12980 24227 23226 gene locus_tag LOCUS_12990 gene namA 24227 23226 CDS product NADPH dehydrogenase NamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086174.1 protein_id gnl|my_center|LOCUS_12990 24379 24699 gene locus_tag LOCUS_13000 24379 24699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13000 24927 25700 gene locus_tag LOCUS_13010 24927 25700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 26734 25727 gene locus_tag LOCUS_13020 26734 25727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 27895 26774 gene locus_tag LOCUS_13030 27895 26774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 28129 28392 gene locus_tag LOCUS_13040 28129 28392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence042 50 376 gene locus_tag LOCUS_13050 50 376 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460053.1 protein_id gnl|my_center|LOCUS_13050 390 2036 gene locus_tag LOCUS_13060 390 2036 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460052.1 protein_id gnl|my_center|LOCUS_13060 2753 2088 gene locus_tag LOCUS_13070 2753 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13070 3356 5782 gene locus_tag LOCUS_13080 3356 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 5821 7302 gene locus_tag LOCUS_13090 5821 7302 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_13090 7299 7457 gene locus_tag LOCUS_13100 7299 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 7639 8469 gene locus_tag LOCUS_13110 7639 8469 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13110 8482 9375 gene locus_tag LOCUS_13120 8482 9375 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_13120 9384 9710 gene locus_tag LOCUS_13130 9384 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 9770 10609 gene locus_tag LOCUS_13140 9770 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 11130 12452 gene locus_tag LOCUS_13150 11130 12452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 12630 13409 gene locus_tag LOCUS_13160 12630 13409 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868944.1 protein_id gnl|my_center|LOCUS_13160 13787 14158 gene locus_tag LOCUS_13170 gene fra 13787 14158 CDS product iron chaperone frataxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244145.1 protein_id gnl|my_center|LOCUS_13170 14369 15202 gene locus_tag LOCUS_13180 14369 15202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13180 15091 15696 gene locus_tag LOCUS_13190 15091 15696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13190 15711 16505 gene locus_tag LOCUS_13200 15711 16505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13200 16558 16725 gene locus_tag LOCUS_13210 16558 16725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 17026 16859 gene locus_tag LOCUS_13220 17026 16859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 17709 17038 gene locus_tag LOCUS_13230 17709 17038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 18023 18202 gene locus_tag LOCUS_13240 18023 18202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 18724 19935 gene locus_tag LOCUS_13250 18724 19935 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017008.1 protein_id gnl|my_center|LOCUS_13250 20045 20368 gene locus_tag LOCUS_13260 20045 20368 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461621.1 protein_id gnl|my_center|LOCUS_13260 20387 20635 gene locus_tag LOCUS_13270 20387 20635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13270 20647 21444 gene locus_tag LOCUS_13280 20647 21444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13280 21512 21877 gene locus_tag LOCUS_13290 21512 21877 CDS product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 protein_id gnl|my_center|LOCUS_13290 22004 23044 gene locus_tag LOCUS_13300 22004 23044 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649461.1 protein_id gnl|my_center|LOCUS_13300 23121 23633 gene locus_tag LOCUS_13310 23121 23633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 23591 25687 gene locus_tag LOCUS_13320 23591 25687 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259699.1 protein_id gnl|my_center|LOCUS_13320 27143 25677 gene locus_tag LOCUS_13330 27143 25677 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799204.1 protein_id gnl|my_center|LOCUS_13330 27391 27969 gene locus_tag LOCUS_13340 27391 27969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 28246 27953 gene locus_tag LOCUS_13350 28246 27953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13350 28509 28243 gene locus_tag LOCUS_13360 28509 28243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13360 28709 28506 gene locus_tag LOCUS_13370 28709 28506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13370 29437 28670 gene locus_tag LOCUS_13380 29437 28670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13380 29567 29764 gene locus_tag LOCUS_13390 29567 29764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13390 29791 30057 gene locus_tag LOCUS_13400 29791 30057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13400 29961 30809 gene locus_tag LOCUS_13410 29961 30809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13410 30945 32078 gene locus_tag LOCUS_13420 gene ald 30945 32078 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243280.1 protein_id gnl|my_center|LOCUS_13420 32168 33427 gene locus_tag LOCUS_13430 gene alr 32168 33427 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_13430 33405 34472 gene locus_tag LOCUS_13440 33405 34472 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229459.1 protein_id gnl|my_center|LOCUS_13440 34745 34530 gene locus_tag LOCUS_13450 34745 34530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 35629 34742 gene locus_tag LOCUS_13460 35629 34742 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392970.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13460 35881 35654 gene locus_tag LOCUS_13470 35881 35654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 37080 35896 gene locus_tag LOCUS_13480 37080 35896 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890704.1 protein_id gnl|my_center|LOCUS_13480 38675 37098 gene locus_tag LOCUS_13490 38675 37098 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_13490 39133 41802 gene locus_tag LOCUS_13500 gene ppdK 39133 41802 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392144.1 protein_id gnl|my_center|LOCUS_13500 41845 42507 gene locus_tag LOCUS_13510 41845 42507 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416703.1 protein_id gnl|my_center|LOCUS_13510 43610 42591 gene locus_tag LOCUS_13520 43610 42591 CDS product DUF1835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112344.1 protein_id gnl|my_center|LOCUS_13520 43741 44163 gene locus_tag LOCUS_13530 43741 44163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 44719 45138 gene locus_tag LOCUS_13540 44719 45138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 45723 46664 gene locus_tag LOCUS_13550 45723 46664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13550 46619 47203 gene locus_tag LOCUS_13560 46619 47203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13560 47203 48384 gene locus_tag LOCUS_13570 47203 48384 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243672.1 protein_id gnl|my_center|LOCUS_13570 48769 48608 gene locus_tag LOCUS_13580 48769 48608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 48964 49503 gene locus_tag LOCUS_13590 48964 49503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 49500 49712 gene locus_tag LOCUS_13600 49500 49712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 49734 50345 gene locus_tag LOCUS_13610 49734 50345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13610 50249 50509 gene locus_tag LOCUS_13620 50249 50509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13620 50587 52248 gene locus_tag LOCUS_13630 50587 52248 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460052.1 protein_id gnl|my_center|LOCUS_13630 52396 52629 gene locus_tag LOCUS_13640 52396 52629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13640 52662 53660 gene locus_tag LOCUS_13650 52662 53660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13650 54644 53655 gene locus_tag LOCUS_13660 54644 53655 CDS product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 protein_id gnl|my_center|LOCUS_13660 54881 55294 gene locus_tag LOCUS_13670 54881 55294 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400443.1 protein_id gnl|my_center|LOCUS_13670 55371 56288 gene locus_tag LOCUS_13680 55371 56288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 56335 56583 gene locus_tag LOCUS_13690 56335 56583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 56638 57048 gene locus_tag LOCUS_13700 56638 57048 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063587.1 protein_id gnl|my_center|LOCUS_13700 57329 58294 gene locus_tag LOCUS_13710 gene ytlI 57329 58294 CDS product LysR family transcriptional regulator YtlI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398915.1 protein_id gnl|my_center|LOCUS_13710 58455 59222 gene locus_tag LOCUS_13720 58455 59222 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084111.1 protein_id gnl|my_center|LOCUS_13720 59219 59719 gene locus_tag LOCUS_13730 59219 59719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 59686 59943 gene locus_tag LOCUS_13740 59686 59943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 59936 60778 gene locus_tag LOCUS_13750 59936 60778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13750 60775 61062 gene locus_tag LOCUS_13760 60775 61062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13760 61069 61716 gene locus_tag LOCUS_13770 61069 61716 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103707.1 protein_id gnl|my_center|LOCUS_13770 61724 62938 gene locus_tag LOCUS_13780 61724 62938 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815298.1 protein_id gnl|my_center|LOCUS_13780 62960 63241 gene locus_tag LOCUS_13790 62960 63241 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399148.1 protein_id gnl|my_center|LOCUS_13790 63268 64284 gene locus_tag LOCUS_13800 63268 64284 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 protein_id gnl|my_center|LOCUS_13800 64321 65157 gene locus_tag LOCUS_13810 gene ssuC 64321 65157 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367447.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence043 445 248 gene locus_tag LOCUS_13820 gene cspC 445 248 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_13820 1528 941 gene locus_tag LOCUS_13830 1528 941 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403384.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13830 2553 1546 gene locus_tag LOCUS_13840 2553 1546 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_13840 3022 2612 gene locus_tag LOCUS_13850 3022 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13850 3255 3034 gene locus_tag LOCUS_13860 3255 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 4346 3267 gene locus_tag LOCUS_13870 gene neuB 4346 3267 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403381.1 protein_id gnl|my_center|LOCUS_13870 5014 4343 gene locus_tag LOCUS_13880 5014 4343 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403380.1 protein_id gnl|my_center|LOCUS_13880 5919 5011 gene locus_tag LOCUS_13890 5919 5011 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403379.1 protein_id gnl|my_center|LOCUS_13890 6593 5916 gene locus_tag LOCUS_13900 6593 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13900 6886 6599 gene locus_tag LOCUS_13910 6886 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13910 7077 6889 gene locus_tag LOCUS_13920 7077 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13920 8267 7074 gene locus_tag LOCUS_13930 8267 7074 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403377.1 protein_id gnl|my_center|LOCUS_13930 9252 8323 gene locus_tag LOCUS_13940 9252 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 10330 9323 gene locus_tag LOCUS_13950 10330 9323 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600889.1 protein_id gnl|my_center|LOCUS_13950 11169 10351 gene locus_tag LOCUS_13960 11169 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 12029 11166 gene locus_tag LOCUS_13970 12029 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13970 12818 12219 gene locus_tag LOCUS_13980 12818 12219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 13745 12927 gene locus_tag LOCUS_13990 gene hag 13745 12927 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_13990 14226 13849 gene locus_tag LOCUS_14000 14226 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 14608 14213 gene locus_tag LOCUS_14010 gene fliS 14608 14213 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987025.1 protein_id gnl|my_center|LOCUS_14010 15154 14636 gene locus_tag LOCUS_14020 15154 14636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14020 15800 15108 gene locus_tag LOCUS_14030 15800 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14030 16044 15859 gene locus_tag LOCUS_14040 16044 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 16450 16085 gene locus_tag LOCUS_14050 16450 16085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 16714 16469 gene locus_tag LOCUS_14060 16714 16469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 17139 16708 gene locus_tag LOCUS_14070 17139 16708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 17638 17177 gene locus_tag LOCUS_14080 17638 17177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 18546 17650 gene locus_tag LOCUS_14090 gene flgL 18546 17650 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_14090 20130 18553 gene locus_tag LOCUS_14100 gene flgK 20130 18553 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228001.1 protein_id gnl|my_center|LOCUS_14100 20648 20151 gene locus_tag LOCUS_14110 20648 20151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 20944 20666 gene locus_tag LOCUS_14120 20944 20666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 21480 21076 gene locus_tag LOCUS_14130 21480 21076 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227995.1 protein_id gnl|my_center|LOCUS_14130 22537 21575 gene locus_tag LOCUS_14140 22537 21575 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099097343.1 protein_id gnl|my_center|LOCUS_14140 23903 22539 gene locus_tag LOCUS_14150 23903 22539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence044 1916 930 gene locus_tag LOCUS_14160 1916 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14160 2590 1928 gene locus_tag LOCUS_14170 2590 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 3408 2689 gene locus_tag LOCUS_14180 3408 2689 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830948.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14180 3584 3345 gene locus_tag LOCUS_14190 3584 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 4176 3598 gene locus_tag LOCUS_14200 4176 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14200 4508 4125 gene locus_tag LOCUS_14210 4508 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14210 4908 6425 gene locus_tag LOCUS_14220 4908 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14220 6344 6964 gene locus_tag LOCUS_14230 6344 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 8143 7190 gene locus_tag LOCUS_14240 8143 7190 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_14240 8973 8140 gene locus_tag LOCUS_14250 8973 8140 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245334.1 protein_id gnl|my_center|LOCUS_14250 10348 8966 gene locus_tag LOCUS_14260 10348 8966 CDS product NADPH-dependent assimilatory sulfite reductase hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256582.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14260 10659 10303 gene locus_tag LOCUS_14270 10659 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14270 10906 12357 gene locus_tag LOCUS_14280 10906 12357 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454957.1 protein_id gnl|my_center|LOCUS_14280 13755 12535 gene locus_tag LOCUS_14290 13755 12535 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_14290 14390 14112 gene locus_tag LOCUS_14300 14390 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence045 565 281 gene locus_tag LOCUS_14310 565 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14310 1588 1187 gene locus_tag LOCUS_14320 1588 1187 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877650.1 protein_id gnl|my_center|LOCUS_14320 3024 1711 gene locus_tag LOCUS_14330 3024 1711 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246604.1 protein_id gnl|my_center|LOCUS_14330 3821 3174 gene locus_tag LOCUS_14340 3821 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 4630 4193 gene locus_tag LOCUS_14350 4630 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 5433 5119 gene locus_tag LOCUS_14360 gene trxA 5433 5119 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222500.1 protein_id gnl|my_center|LOCUS_14360 6438 5779 gene locus_tag LOCUS_14370 6438 5779 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228294.1 protein_id gnl|my_center|LOCUS_14370 7187 6543 gene locus_tag LOCUS_14380 7187 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 8262 7231 gene locus_tag LOCUS_14390 8262 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 8714 9442 gene locus_tag LOCUS_14400 8714 9442 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929888.1 protein_id gnl|my_center|LOCUS_14400 9444 9944 gene locus_tag LOCUS_14410 9444 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 9941 10777 gene locus_tag LOCUS_14420 9941 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 11407 11919 gene locus_tag LOCUS_14430 11407 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 12761 13027 gene locus_tag LOCUS_14440 12761 13027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 13268 13092 gene locus_tag LOCUS_14450 13268 13092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 14067 13321 gene locus_tag LOCUS_14460 14067 13321 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628423.1 protein_id gnl|my_center|LOCUS_14460 14659 14075 gene locus_tag LOCUS_14470 14659 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 15447 15193 gene locus_tag LOCUS_14480 15447 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14480 15674 15462 gene locus_tag LOCUS_14490 15674 15462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 16541 16296 gene locus_tag LOCUS_14500 16541 16296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 16425 17078 gene locus_tag LOCUS_14510 16425 17078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14510 >Feature sequence046 482 6 gene locus_tag LOCUS_14520 482 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14520 710 958 gene locus_tag LOCUS_14530 710 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2329 1247 gene locus_tag LOCUS_14540 2329 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 3442 2561 gene locus_tag LOCUS_14550 3442 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 4641 3763 gene locus_tag LOCUS_14560 4641 3763 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_14560 4896 4654 gene locus_tag LOCUS_14570 4896 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14570 5507 4905 gene locus_tag LOCUS_14580 5507 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14580 6499 5825 gene locus_tag LOCUS_14590 6499 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14590 7621 6926 gene locus_tag LOCUS_14600 7621 6926 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822492.1 protein_id gnl|my_center|LOCUS_14600 8200 7778 gene locus_tag LOCUS_14610 8200 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 <9020 8197 gene locus_tag LOCUS_14620 <9020 8197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000759406.1:D-Ala-D-Ala carboxypeptidase VanY >Feature sequence047 1279 5193 gene locus_tag LOCUS_14630 1279 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 5338 5748 gene locus_tag LOCUS_14640 5338 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 5868 6032 gene locus_tag LOCUS_14650 5868 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 6032 6523 gene locus_tag LOCUS_14660 6032 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14660 >Feature sequence048 785 1483 gene locus_tag LOCUS_14670 785 1483 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_14670 1485 2630 gene locus_tag LOCUS_14680 1485 2630 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_14680 2650 3183 gene locus_tag LOCUS_14690 2650 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 3176 4408 gene locus_tag LOCUS_14700 gene fabF 3176 4408 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227920.1 protein_id gnl|my_center|LOCUS_14700 4787 4509 gene locus_tag LOCUS_14710 4787 4509 CDS product DUF2653 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447750.1 protein_id gnl|my_center|LOCUS_14710 5218 4790 gene locus_tag LOCUS_14720 5218 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 5365 5916 gene locus_tag LOCUS_14730 5365 5916 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230498.1 protein_id gnl|my_center|LOCUS_14730 6512 5913 gene locus_tag LOCUS_14740 6512 5913 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838169.1 protein_id gnl|my_center|LOCUS_14740 6921 6604 gene locus_tag LOCUS_14750 6921 6604 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723978.1 protein_id gnl|my_center|LOCUS_14750 7017 7679 gene locus_tag LOCUS_14760 7017 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14760 7625 8533 gene locus_tag LOCUS_14770 7625 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14770 8816 9841 gene locus_tag LOCUS_14780 8816 9841 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733143.1 protein_id gnl|my_center|LOCUS_14780 9903 10694 gene locus_tag LOCUS_14790 9903 10694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927109.1 protein_id gnl|my_center|LOCUS_14790 10687 11697 gene locus_tag LOCUS_14800 10687 11697 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229090.1 protein_id gnl|my_center|LOCUS_14800 11739 12749 gene locus_tag LOCUS_14810 11739 12749 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472679.1 protein_id gnl|my_center|LOCUS_14810 12812 13375 gene locus_tag LOCUS_14820 gene cotE 12812 13375 CDS product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288799.1 protein_id gnl|my_center|LOCUS_14820 13598 15331 gene locus_tag LOCUS_14830 13598 15331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 15657 15887 gene locus_tag LOCUS_14840 15657 15887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14840 15952 16578 gene locus_tag LOCUS_14850 15952 16578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14850 16533 17027 gene locus_tag LOCUS_14860 16533 17027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14860 17024 18430 gene locus_tag LOCUS_14870 17024 18430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14870 18447 20570 gene locus_tag LOCUS_14880 18447 20570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 20567 21334 gene locus_tag LOCUS_14890 20567 21334 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230795.1 protein_id gnl|my_center|LOCUS_14890 21341 21937 gene locus_tag LOCUS_14900 21341 21937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14900 21934 22332 gene locus_tag LOCUS_14910 21934 22332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14910 22339 22578 gene locus_tag LOCUS_14920 gene hfq 22339 22578 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813896.1 protein_id gnl|my_center|LOCUS_14920 22782 23546 gene locus_tag LOCUS_14930 22782 23546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14930 23546 23911 gene locus_tag LOCUS_14940 23546 23911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 24064 25473 gene locus_tag LOCUS_14950 24064 25473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14950 25504 26169 gene locus_tag LOCUS_14960 25504 26169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 26406 26921 gene locus_tag LOCUS_14970 26406 26921 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824675.1 protein_id gnl|my_center|LOCUS_14970 26980 27573 gene locus_tag LOCUS_14980 26980 27573 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220030.1 protein_id gnl|my_center|LOCUS_14980 27685 28671 gene locus_tag LOCUS_14990 gene spoVK 27685 28671 CDS product stage V sporulation protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231746.1 protein_id gnl|my_center|LOCUS_14990 28699 29379 gene locus_tag LOCUS_15000 28699 29379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15000 29367 29999 gene locus_tag LOCUS_15010 29367 29999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15010 30036 31331 gene locus_tag LOCUS_15020 30036 31331 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245218.1 protein_id gnl|my_center|LOCUS_15020 31395 31802 gene locus_tag LOCUS_15030 gene glnR 31395 31802 CDS product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238341.1 protein_id gnl|my_center|LOCUS_15030 31838 33166 gene locus_tag LOCUS_15040 gene glnA 31838 33166 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135328.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence049 373 104 gene locus_tag LOCUS_15050 373 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 611 360 gene locus_tag LOCUS_15060 611 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 973 620 gene locus_tag LOCUS_15070 973 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1485 1114 gene locus_tag LOCUS_15080 1485 1114 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208652.1 protein_id gnl|my_center|LOCUS_15080 2092 1487 gene locus_tag LOCUS_15090 2092 1487 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179836.1 protein_id gnl|my_center|LOCUS_15090 2223 2092 gene locus_tag LOCUS_15100 2223 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 3788 2205 gene locus_tag LOCUS_15110 gene qoxB 3788 2205 CDS product cytochrome aa3 quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762372.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15110 4066 3785 gene locus_tag LOCUS_15120 4066 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15120 5267 4089 gene locus_tag LOCUS_15130 5267 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6842 5382 gene locus_tag LOCUS_15140 6842 5382 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067976.1 protein_id gnl|my_center|LOCUS_15140 7695 6889 gene locus_tag LOCUS_15150 gene trpA 7695 6889 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921372.1 protein_id gnl|my_center|LOCUS_15150 8609 7707 gene locus_tag LOCUS_15160 8609 7707 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383769.1 protein_id gnl|my_center|LOCUS_15160 10178 8658 gene locus_tag LOCUS_15170 gene rbsA 10178 8658 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368992.1 protein_id gnl|my_center|LOCUS_15170 11143 10205 gene locus_tag LOCUS_15180 11143 10205 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383771.1 protein_id gnl|my_center|LOCUS_15180 12170 11178 gene locus_tag LOCUS_15190 12170 11178 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453966.1 protein_id gnl|my_center|LOCUS_15190 12412 13257 gene locus_tag LOCUS_15200 gene modA 12412 13257 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 protein_id gnl|my_center|LOCUS_15200 13295 13957 gene locus_tag LOCUS_15210 gene modB 13295 13957 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906541.1 protein_id gnl|my_center|LOCUS_15210 14392 14114 gene locus_tag LOCUS_15220 14392 14114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 15523 14615 gene locus_tag LOCUS_15230 15523 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15230 16421 15582 gene locus_tag LOCUS_15240 gene opuAB 16421 15582 CDS product glycine/proline betaine ABC transporter permease subunit OpuAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234703.1 protein_id gnl|my_center|LOCUS_15240 17617 16418 gene locus_tag LOCUS_15250 gene opuAA 17617 16418 CDS product glycine/proline betaine ABC transporter ATP-binding protein OpuAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246301.1 protein_id gnl|my_center|LOCUS_15250 17751 17590 gene locus_tag LOCUS_15260 17751 17590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 17999 18487 gene locus_tag LOCUS_15270 gene gbsR 17999 18487 CDS product transcriptional regulator GbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244320.1 protein_id gnl|my_center|LOCUS_15270 19146 18622 gene locus_tag LOCUS_15280 19146 18622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 19832 19143 gene locus_tag LOCUS_15290 19832 19143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15290 >Feature sequence050 443 793 gene locus_tag LOCUS_15300 443 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15300 913 1692 gene locus_tag LOCUS_15310 913 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15310 2439 2287 gene locus_tag LOCUS_15320 2439 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3376 2606 gene locus_tag LOCUS_15330 3376 2606 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723203.1 protein_id gnl|my_center|LOCUS_15330 3628 4131 gene locus_tag LOCUS_15340 3628 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4921 4277 gene locus_tag LOCUS_15350 gene dhaL 4921 4277 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008607.1 protein_id gnl|my_center|LOCUS_15350 5946 4942 gene locus_tag LOCUS_15360 5946 4942 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533065.1 protein_id gnl|my_center|LOCUS_15360 6403 5909 gene locus_tag LOCUS_15370 gene rpiB 6403 5909 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187340.1 protein_id gnl|my_center|LOCUS_15370 6814 6425 gene locus_tag LOCUS_15380 6814 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15380 7506 6811 gene locus_tag LOCUS_15390 7506 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15390 8624 7521 gene locus_tag LOCUS_15400 gene ugpC 8624 7521 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_15400 9618 8617 gene locus_tag LOCUS_15410 9618 8617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867312.1 protein_id gnl|my_center|LOCUS_15410 10543 9773 gene locus_tag LOCUS_15420 10543 9773 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894672.1 protein_id gnl|my_center|LOCUS_15420 11576 10608 gene locus_tag LOCUS_15430 11576 10608 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536394.1 protein_id gnl|my_center|LOCUS_15430 12899 11652 gene locus_tag LOCUS_15440 12899 11652 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536396.1 protein_id gnl|my_center|LOCUS_15440 13816 14244 gene locus_tag LOCUS_15450 13816 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15450 14718 14260 gene locus_tag LOCUS_15460 14718 14260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15460 15416 14673 gene locus_tag LOCUS_15470 15416 14673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15470 15695 15528 gene locus_tag LOCUS_15480 15695 15528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 15883 15710 gene locus_tag LOCUS_15490 15883 15710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 16734 16156 gene locus_tag LOCUS_15500 16734 16156 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940263.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15500 16902 17516 gene locus_tag LOCUS_15510 16902 17516 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170049.1 protein_id gnl|my_center|LOCUS_15510 17554 19014 gene locus_tag LOCUS_15520 17554 19014 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445737.1 protein_id gnl|my_center|LOCUS_15520 19132 20271 gene locus_tag LOCUS_15530 19132 20271 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103456.1 protein_id gnl|my_center|LOCUS_15530 20450 20782 gene locus_tag LOCUS_15540 20450 20782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 22573 20993 gene locus_tag LOCUS_15550 22573 20993 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031371.1 protein_id gnl|my_center|LOCUS_15550 23297 22695 gene locus_tag LOCUS_15560 23297 22695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 23558 23316 gene locus_tag LOCUS_15570 23558 23316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 23830 23552 gene locus_tag LOCUS_15580 23830 23552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 24552 23827 gene locus_tag LOCUS_15590 gene phnC 24552 23827 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905272.1 protein_id gnl|my_center|LOCUS_15590 24704 24928 gene locus_tag LOCUS_15600 24704 24928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 26403 25009 gene locus_tag LOCUS_15610 26403 25009 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804149.1 protein_id gnl|my_center|LOCUS_15610 27691 26447 gene locus_tag LOCUS_15620 27691 26447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 29746 27827 gene locus_tag LOCUS_15630 29746 27827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15630 30240 29743 gene locus_tag LOCUS_15640 30240 29743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15640 31110 30325 gene locus_tag LOCUS_15650 31110 30325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15650 31364 31131 gene locus_tag LOCUS_15660 31364 31131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15660 32855 31713 gene locus_tag LOCUS_15670 32855 31713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15670 33935 32868 gene locus_tag LOCUS_15680 33935 32868 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_15680 34290 33979 gene locus_tag LOCUS_15690 34290 33979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15690 34909 34226 gene locus_tag LOCUS_15700 34909 34226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15700 35903 34968 gene locus_tag LOCUS_15710 35903 34968 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259693.1 protein_id gnl|my_center|LOCUS_15710 36849 35851 gene locus_tag LOCUS_15720 36849 35851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15720 38123 36750 gene locus_tag LOCUS_15730 38123 36750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 38416 38261 gene locus_tag LOCUS_15740 38416 38261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 40206 38392 gene locus_tag LOCUS_15750 40206 38392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259691.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15750 40484 40221 gene locus_tag LOCUS_15760 40484 40221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15760 41095 40406 gene locus_tag LOCUS_15770 41095 40406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15770 42027 41122 gene locus_tag LOCUS_15780 42027 41122 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259689.1 protein_id gnl|my_center|LOCUS_15780 43472 42024 gene locus_tag LOCUS_15790 43472 42024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15790 44857 43580 gene locus_tag LOCUS_15800 44857 43580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15800 45078 44854 gene locus_tag LOCUS_15810 45078 44854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 46594 45188 gene locus_tag LOCUS_15820 46594 45188 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259687.1 protein_id gnl|my_center|LOCUS_15820 47614 46970 gene locus_tag LOCUS_15830 47614 46970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15830 48096 47686 gene locus_tag LOCUS_15840 48096 47686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 48882 48112 gene locus_tag LOCUS_15850 48882 48112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 49726 48986 gene locus_tag LOCUS_15860 49726 48986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 50103 50849 gene locus_tag LOCUS_15870 50103 50849 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626347.1 protein_id gnl|my_center|LOCUS_15870 52225 50855 gene locus_tag LOCUS_15880 52225 50855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15880 53100 52186 gene locus_tag LOCUS_15890 53100 52186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15890 53439 53107 gene locus_tag LOCUS_15900 53439 53107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 55596 54151 gene locus_tag LOCUS_15910 55596 54151 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434751.1 protein_id gnl|my_center|LOCUS_15910 56306 55593 gene locus_tag LOCUS_15920 56306 55593 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434748.1 protein_id gnl|my_center|LOCUS_15920 57126 56335 gene locus_tag LOCUS_15930 57126 56335 CDS product lantibiotic immunity ABC transporter MutG family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860831.1 protein_id gnl|my_center|LOCUS_15930 57887 57129 gene locus_tag LOCUS_15940 57887 57129 CDS product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888312.1 protein_id gnl|my_center|LOCUS_15940 58596 57880 gene locus_tag LOCUS_15950 58596 57880 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434737.1 protein_id gnl|my_center|LOCUS_15950 59093 58851 gene locus_tag LOCUS_15960 59093 58851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 59612 59355 gene locus_tag LOCUS_15970 59612 59355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15970 59740 59591 gene locus_tag LOCUS_15980 59740 59591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15980 60840 59734 gene locus_tag LOCUS_15990 60840 59734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15990 61547 61062 gene locus_tag LOCUS_16000 gene dfrA 61547 61062 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_16000 62363 61569 gene locus_tag LOCUS_16010 gene thyA 62363 61569 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704637.1 protein_id gnl|my_center|LOCUS_16010 62913 62422 gene locus_tag LOCUS_16020 62913 62422 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 protein_id gnl|my_center|LOCUS_16020 64466 63051 gene locus_tag LOCUS_16030 gene lpdA 64466 63051 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_16030 65283 64471 gene locus_tag LOCUS_16040 65283 64471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16040 65795 65331 gene locus_tag LOCUS_16050 65795 65331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16050 66806 65829 gene locus_tag LOCUS_16060 gene pdhB 66806 65829 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232313.1 protein_id gnl|my_center|LOCUS_16060 67918 66839 gene locus_tag LOCUS_16070 gene pdhA 67918 66839 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222294.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence051 355 648 gene locus_tag LOCUS_16080 355 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 661 1935 gene locus_tag LOCUS_16090 661 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16090 1929 2672 gene locus_tag LOCUS_16100 1929 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16100 2763 5477 gene locus_tag LOCUS_16110 2763 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 5562 6392 gene locus_tag LOCUS_16120 5562 6392 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942855.1 protein_id gnl|my_center|LOCUS_16120 6457 7494 gene locus_tag LOCUS_16130 6457 7494 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545234.1 protein_id gnl|my_center|LOCUS_16130 7555 7677 gene locus_tag LOCUS_16140 7555 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence052 1749 769 gene locus_tag LOCUS_16150 1749 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16150 2629 1835 gene locus_tag LOCUS_16160 2629 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16160 2973 2788 gene locus_tag LOCUS_16170 2973 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 3372 2995 gene locus_tag LOCUS_16180 3372 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3599 4276 gene locus_tag LOCUS_16190 3599 4276 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 protein_id gnl|my_center|LOCUS_16190 4326 4523 gene locus_tag LOCUS_16200 gene cspD 4326 4523 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193054.1 protein_id gnl|my_center|LOCUS_16200 5484 4849 gene locus_tag LOCUS_16210 5484 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358943.1 protein_id gnl|my_center|LOCUS_16210 6350 5703 gene locus_tag LOCUS_16220 6350 5703 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105288.1 protein_id gnl|my_center|LOCUS_16220 7187 6417 gene locus_tag LOCUS_16230 7187 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 7606 7112 gene locus_tag LOCUS_16240 7606 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 8901 7603 gene locus_tag LOCUS_16250 8901 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 9158 9475 gene locus_tag LOCUS_16260 9158 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 9506 10591 gene locus_tag LOCUS_16270 9506 10591 CDS product tetraprenyl-beta-curcumene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102461.1 protein_id gnl|my_center|LOCUS_16270 10652 10891 gene locus_tag LOCUS_16280 10652 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16280 10888 11619 gene locus_tag LOCUS_16290 gene pfkA 10888 11619 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963839.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16290 12178 11723 gene locus_tag LOCUS_16300 12178 11723 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 protein_id gnl|my_center|LOCUS_16300 12272 12472 gene locus_tag LOCUS_16310 12272 12472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 12812 12618 gene locus_tag LOCUS_16320 12812 12618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 13091 12963 gene locus_tag LOCUS_16330 13091 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 13795 13106 gene locus_tag LOCUS_16340 13795 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16340 13930 15459 gene locus_tag LOCUS_16350 13930 15459 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206592.1 protein_id gnl|my_center|LOCUS_16350 15654 16169 gene locus_tag LOCUS_16360 15654 16169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16360 16187 16411 gene locus_tag LOCUS_16370 16187 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 16810 17202 gene locus_tag LOCUS_16380 16810 17202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 17615 17265 gene locus_tag LOCUS_16390 17615 17265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16390 17782 17624 gene locus_tag LOCUS_16400 17782 17624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16400 18057 18515 gene locus_tag LOCUS_16410 18057 18515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16410 18539 18934 gene locus_tag LOCUS_16420 18539 18934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16420 18919 19437 gene locus_tag LOCUS_16430 18919 19437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16430 19809 19522 gene locus_tag LOCUS_16440 19809 19522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16440 20204 19803 gene locus_tag LOCUS_16450 20204 19803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16450 20714 20238 gene locus_tag LOCUS_16460 gene cueR 20714 20238 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886460.1 protein_id gnl|my_center|LOCUS_16460 21173 22552 gene locus_tag LOCUS_16470 21173 22552 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083240.1 protein_id gnl|my_center|LOCUS_16470 22595 23686 gene locus_tag LOCUS_16480 22595 23686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 23683 24417 gene locus_tag LOCUS_16490 23683 24417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 24867 24391 gene locus_tag LOCUS_16500 24867 24391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 26323 25025 gene locus_tag LOCUS_16510 26323 25025 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245414.1 protein_id gnl|my_center|LOCUS_16510 26461 27027 gene locus_tag LOCUS_16520 26461 27027 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733163.1 protein_id gnl|my_center|LOCUS_16520 28739 27129 gene locus_tag LOCUS_16530 gene cimA 28739 27129 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_16530 28950 30218 gene locus_tag LOCUS_16540 28950 30218 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_16540 30326 30562 gene locus_tag LOCUS_16550 30326 30562 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151997.1 protein_id gnl|my_center|LOCUS_16550 30701 31852 gene locus_tag LOCUS_16560 30701 31852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 31849 32118 gene locus_tag LOCUS_16570 31849 32118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 33103 33576 gene locus_tag LOCUS_16580 33103 33576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16580 33780 34394 gene locus_tag LOCUS_16590 33780 34394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16590 34391 34921 gene locus_tag LOCUS_16600 34391 34921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 35074 35658 gene locus_tag LOCUS_16610 35074 35658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16610 35655 36725 gene locus_tag LOCUS_16620 35655 36725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16620 36727 37476 gene locus_tag LOCUS_16630 36727 37476 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229226.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence053 32 295 gene locus_tag LOCUS_16640 32 295 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640811.1 protein_id gnl|my_center|LOCUS_16640 591 1028 gene locus_tag LOCUS_16650 591 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1192 980 gene locus_tag LOCUS_16660 1192 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2199 1273 gene locus_tag LOCUS_16670 2199 1273 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243358.1 protein_id gnl|my_center|LOCUS_16670 2388 3299 gene locus_tag LOCUS_16680 2388 3299 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_16680 3290 4141 gene locus_tag LOCUS_16690 3290 4141 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_16690 5958 4207 gene locus_tag LOCUS_16700 5958 4207 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863284.1 protein_id gnl|my_center|LOCUS_16700 6135 8918 gene locus_tag LOCUS_16710 6135 8918 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104785.1 protein_id gnl|my_center|LOCUS_16710 9125 9964 gene locus_tag LOCUS_16720 gene dapF 9125 9964 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_16720 9979 11859 gene locus_tag LOCUS_16730 9979 11859 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245847.1 protein_id gnl|my_center|LOCUS_16730 12074 12256 gene locus_tag LOCUS_16740 12074 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 12237 12497 gene locus_tag LOCUS_16750 12237 12497 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_16750 12513 13133 gene locus_tag LOCUS_16760 gene gmk 12513 13133 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_16760 13154 13354 gene locus_tag LOCUS_16770 gene rpoZ 13154 13354 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728294.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence054 824 480 gene locus_tag LOCUS_16780 824 480 CDS product YugN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160950.1 protein_id gnl|my_center|LOCUS_16780 1061 2248 gene locus_tag LOCUS_16790 gene sndC 1061 2248 CDS product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 protein_id gnl|my_center|LOCUS_16790 2325 2765 gene locus_tag LOCUS_16800 2325 2765 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199022.1 protein_id gnl|my_center|LOCUS_16800 2859 3584 gene locus_tag LOCUS_16810 2859 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3733 4407 gene locus_tag LOCUS_16820 3733 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16820 4368 5438 gene locus_tag LOCUS_16830 4368 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16830 5503 7521 gene locus_tag LOCUS_16840 5503 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 7597 8085 gene locus_tag LOCUS_16850 7597 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence055 842 1867 gene locus_tag LOCUS_16860 842 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16860 1882 2871 gene locus_tag LOCUS_16870 1882 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16870 2874 4103 gene locus_tag LOCUS_16880 2874 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16880 4100 4549 gene locus_tag LOCUS_16890 4100 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16890 4627 5517 gene locus_tag LOCUS_16900 4627 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16900 5517 6992 gene locus_tag LOCUS_16910 5517 6992 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027387.1 protein_id gnl|my_center|LOCUS_16910 8808 7612 gene locus_tag LOCUS_16920 8808 7612 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188967.1 protein_id gnl|my_center|LOCUS_16920 9485 8805 gene locus_tag LOCUS_16930 9485 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 10514 9645 gene locus_tag LOCUS_16940 10514 9645 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962922.1 protein_id gnl|my_center|LOCUS_16940 10937 11173 gene locus_tag LOCUS_16950 10937 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 11735 11893 gene locus_tag LOCUS_16960 11735 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 12744 12902 gene locus_tag LOCUS_16970 12744 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence056 1528 563 gene locus_tag LOCUS_16980 1528 563 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_16980 1662 3428 gene locus_tag LOCUS_16990 gene yesM 1662 3428 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_16990 3425 5083 gene locus_tag LOCUS_17000 3425 5083 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_17000 5172 6842 gene locus_tag LOCUS_17010 5172 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 6764 6940 gene locus_tag LOCUS_17020 6764 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 7038 9116 gene locus_tag LOCUS_17030 7038 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 9190 11265 gene locus_tag LOCUS_17040 9190 11265 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462224.1 protein_id gnl|my_center|LOCUS_17040 11235 11372 gene locus_tag LOCUS_17050 11235 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 11549 11722 gene locus_tag LOCUS_17060 11549 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 11664 12509 gene locus_tag LOCUS_17070 11664 12509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17070 12669 13931 gene locus_tag LOCUS_17080 12669 13931 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_17080 14038 14550 gene locus_tag LOCUS_17090 14038 14550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17090 14547 14912 gene locus_tag LOCUS_17100 14547 14912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17100 14909 15748 gene locus_tag LOCUS_17110 14909 15748 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_17110 15805 16002 gene locus_tag LOCUS_17120 15805 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 15978 16436 gene locus_tag LOCUS_17130 15978 16436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 16495 17595 gene locus_tag LOCUS_17140 16495 17595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 17892 19313 gene locus_tag LOCUS_17150 gene malL 17892 19313 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_17150 19498 19361 gene locus_tag LOCUS_17160 19498 19361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 20075 20296 gene locus_tag LOCUS_17170 20075 20296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 20185 21339 gene locus_tag LOCUS_17180 20185 21339 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775953.1 protein_id gnl|my_center|LOCUS_17180 21496 21897 gene locus_tag LOCUS_17190 21496 21897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17190 21822 22376 gene locus_tag LOCUS_17200 21822 22376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17200 22402 22740 gene locus_tag LOCUS_17210 22402 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17210 22737 23225 gene locus_tag LOCUS_17220 22737 23225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17220 23704 24129 gene locus_tag LOCUS_17230 23704 24129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 24435 25076 gene locus_tag LOCUS_17240 24435 25076 CDS product phosphoserine phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858827.1 protein_id gnl|my_center|LOCUS_17240 26792 25182 gene locus_tag LOCUS_17250 26792 25182 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_17250 27705 26794 gene locus_tag LOCUS_17260 27705 26794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 protein_id gnl|my_center|LOCUS_17260 27862 28452 gene locus_tag LOCUS_17270 27862 28452 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722193.1 protein_id gnl|my_center|LOCUS_17270 29208 28480 gene locus_tag LOCUS_17280 29208 28480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258569.1 protein_id gnl|my_center|LOCUS_17280 29911 29195 gene locus_tag LOCUS_17290 29911 29195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 30744 29908 gene locus_tag LOCUS_17300 30744 29908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005130012.1 protein_id gnl|my_center|LOCUS_17300 31381 30770 gene locus_tag LOCUS_17310 31381 30770 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430243.1 protein_id gnl|my_center|LOCUS_17310 31521 31913 gene locus_tag LOCUS_17320 31521 31913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence057 1605 208 gene locus_tag LOCUS_17330 1605 208 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_17330 3211 1616 gene locus_tag LOCUS_17340 3211 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 5047 3284 gene locus_tag LOCUS_17350 5047 3284 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_17350 7446 5080 gene locus_tag LOCUS_17360 7446 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 8291 7452 gene locus_tag LOCUS_17370 8291 7452 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776898.1 protein_id gnl|my_center|LOCUS_17370 9203 8307 gene locus_tag LOCUS_17380 9203 8307 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776897.1 protein_id gnl|my_center|LOCUS_17380 10655 9303 gene locus_tag LOCUS_17390 10655 9303 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776896.1 protein_id gnl|my_center|LOCUS_17390 11915 10992 gene locus_tag LOCUS_17400 11915 10992 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970438.1 protein_id gnl|my_center|LOCUS_17400 13326 12985 gene locus_tag LOCUS_17410 13326 12985 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706385.1 protein_id gnl|my_center|LOCUS_17410 14683 13436 gene locus_tag LOCUS_17420 gene glyA 14683 13436 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110494.1 protein_id gnl|my_center|LOCUS_17420 15349 14753 gene locus_tag LOCUS_17430 15349 14753 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227667.1 protein_id gnl|my_center|LOCUS_17430 15824 15366 gene locus_tag LOCUS_17440 gene rpiB 15824 15366 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221910.1 protein_id gnl|my_center|LOCUS_17440 16836 16078 gene locus_tag LOCUS_17450 16836 16078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 17484 16924 gene locus_tag LOCUS_17460 17484 16924 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227661.1 protein_id gnl|my_center|LOCUS_17460 18775 17645 gene locus_tag LOCUS_17470 18775 17645 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227659.1 protein_id gnl|my_center|LOCUS_17470 19979 18984 gene locus_tag LOCUS_17480 19979 18984 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222782.1 protein_id gnl|my_center|LOCUS_17480 20823 20050 gene locus_tag LOCUS_17490 20823 20050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17490 21554 20811 gene locus_tag LOCUS_17500 21554 20811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17500 22681 21608 gene locus_tag LOCUS_17510 gene gutB 22681 21608 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_17510 24453 22816 gene locus_tag LOCUS_17520 24453 22816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 24881 24543 gene locus_tag LOCUS_17530 24881 24543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 25549 24776 gene locus_tag LOCUS_17540 25549 24776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 26118 25546 gene locus_tag LOCUS_17550 26118 25546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 26223 27005 gene locus_tag LOCUS_17560 26223 27005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17560 26996 27607 gene locus_tag LOCUS_17570 26996 27607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 28305 27697 gene locus_tag LOCUS_17580 28305 27697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17580 28717 28418 gene locus_tag LOCUS_17590 28717 28418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17590 29536 28745 gene locus_tag LOCUS_17600 29536 28745 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896977.1 protein_id gnl|my_center|LOCUS_17600 30467 29556 gene locus_tag LOCUS_17610 30467 29556 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222784.1 protein_id gnl|my_center|LOCUS_17610 31931 30492 gene locus_tag LOCUS_17620 31931 30492 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197580.1 protein_id gnl|my_center|LOCUS_17620 32058 31828 gene locus_tag LOCUS_17630 32058 31828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 32983 32195 gene locus_tag LOCUS_17640 32983 32195 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_17640 34140 33088 gene locus_tag LOCUS_17650 34140 33088 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384594.1 protein_id gnl|my_center|LOCUS_17650 35638 34055 gene locus_tag LOCUS_17660 gene xylB 35638 34055 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_17660 36520 35666 gene locus_tag LOCUS_17670 gene fba 36520 35666 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392146.1 protein_id gnl|my_center|LOCUS_17670 37168 36554 gene locus_tag LOCUS_17680 37168 36554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17680 37494 37165 gene locus_tag LOCUS_17690 37494 37165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17690 38958 37795 gene locus_tag LOCUS_17700 gene gguB 38958 37795 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727841.1 protein_id gnl|my_center|LOCUS_17700 39230 38958 gene locus_tag LOCUS_17710 39230 38958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17710 40489 39140 gene locus_tag LOCUS_17720 gene gguA 40489 39140 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976401.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17720 41692 40568 gene locus_tag LOCUS_17730 gene chvE 41692 40568 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727839.1 protein_id gnl|my_center|LOCUS_17730 43015 41795 gene locus_tag LOCUS_17740 43015 41795 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161410139.1 protein_id gnl|my_center|LOCUS_17740 44818 43019 gene locus_tag LOCUS_17750 44818 43019 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_17750 45859 44840 gene locus_tag LOCUS_17760 45859 44840 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082691.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence058 1330 704 gene locus_tag LOCUS_17770 gene lexA 1330 704 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_17770 1516 1896 gene locus_tag LOCUS_17780 1516 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 2062 2259 gene locus_tag LOCUS_17790 2062 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2295 2807 gene locus_tag LOCUS_17800 2295 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 2833 3621 gene locus_tag LOCUS_17810 2833 3621 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398978.1 protein_id gnl|my_center|LOCUS_17810 4258 3707 gene locus_tag LOCUS_17820 4258 3707 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057305.1 protein_id gnl|my_center|LOCUS_17820 4403 7342 gene locus_tag LOCUS_17830 gene metH 4403 7342 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17830 7309 7842 gene locus_tag LOCUS_17840 7309 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17840 8025 8939 gene locus_tag LOCUS_17850 gene rnz 8025 8939 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640772.1 protein_id gnl|my_center|LOCUS_17850 9259 9041 gene locus_tag LOCUS_17860 gene tlp 9259 9041 CDS product small acid-soluble spore protein Tlp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231568.1 protein_id gnl|my_center|LOCUS_17860 9971 9369 gene locus_tag LOCUS_17870 9971 9369 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968293.1 protein_id gnl|my_center|LOCUS_17870 10212 11027 gene locus_tag LOCUS_17880 10212 11027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17880 10985 12496 gene locus_tag LOCUS_17890 10985 12496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17890 12612 13949 gene locus_tag LOCUS_17900 gene mrfB 12612 13949 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_17900 14069 15187 gene locus_tag LOCUS_17910 14069 15187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 15184 15627 gene locus_tag LOCUS_17920 15184 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17920 15624 15995 gene locus_tag LOCUS_17930 15624 15995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17930 16210 16851 gene locus_tag LOCUS_17940 gene mutM 16210 16851 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17940 17022 17693 gene locus_tag LOCUS_17950 17022 17693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 17690 18055 gene locus_tag LOCUS_17960 17690 18055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 18056 18841 gene locus_tag LOCUS_17970 18056 18841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232156.1 protein_id gnl|my_center|LOCUS_17970 18838 19635 gene locus_tag LOCUS_17980 18838 19635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17980 19653 19856 gene locus_tag LOCUS_17990 19653 19856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17990 19884 21641 gene locus_tag LOCUS_18000 gene yesM 19884 21641 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_18000 21643 23529 gene locus_tag LOCUS_18010 21643 23529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 23538 24512 gene locus_tag LOCUS_18020 23538 24512 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243860.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18020 24885 25607 gene locus_tag LOCUS_18030 24885 25607 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233835.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18030 25611 26444 gene locus_tag LOCUS_18040 25611 26444 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233833.1 protein_id gnl|my_center|LOCUS_18040 26475 27509 gene locus_tag LOCUS_18050 gene yesR 26475 27509 CDS product rhamnogalacturonyl hydrolase YesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243366.1 protein_id gnl|my_center|LOCUS_18050 27743 29305 gene locus_tag LOCUS_18060 27743 29305 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_18060 29340 30248 gene locus_tag LOCUS_18070 gene rmgP 29340 30248 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_18070 30269 30511 gene locus_tag LOCUS_18080 30269 30511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18080 30508 32343 gene locus_tag LOCUS_18090 30508 32343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 33608 32379 gene locus_tag LOCUS_18100 33608 32379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18100 34675 33587 gene locus_tag LOCUS_18110 34675 33587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18110 34599 34811 gene locus_tag LOCUS_18120 34599 34811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 34808 36361 gene locus_tag LOCUS_18130 34808 36361 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_18130 36532 38556 gene locus_tag LOCUS_18140 36532 38556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 38507 39817 gene locus_tag LOCUS_18150 38507 39817 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055404.1 protein_id gnl|my_center|LOCUS_18150 40018 40728 gene locus_tag LOCUS_18160 gene ykoG 40018 40728 CDS product two-component system response regulator YkoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232551.1 protein_id gnl|my_center|LOCUS_18160 40721 42079 gene locus_tag LOCUS_18170 gene ykoH 40721 42079 CDS product two-component system sensor histidine kinase YkoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245526.1 protein_id gnl|my_center|LOCUS_18170 42651 42172 gene locus_tag LOCUS_18180 42651 42172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 42837 43613 gene locus_tag LOCUS_18190 42837 43613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18190 43736 44401 gene locus_tag LOCUS_18200 43736 44401 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245627.1 protein_id gnl|my_center|LOCUS_18200 44420 45088 gene locus_tag LOCUS_18210 44420 45088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 45247 46053 gene locus_tag LOCUS_18220 45247 46053 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_18220 46691 48304 gene locus_tag LOCUS_18230 46691 48304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 48834 49052 gene locus_tag LOCUS_18240 48834 49052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 49360 49058 gene locus_tag LOCUS_18250 49360 49058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 49379 49729 gene locus_tag LOCUS_18260 49379 49729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 49900 50577 gene locus_tag LOCUS_18270 49900 50577 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219999.1 protein_id gnl|my_center|LOCUS_18270 50582 51070 gene locus_tag LOCUS_18280 50582 51070 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250917.1 protein_id gnl|my_center|LOCUS_18280 51599 51189 gene locus_tag LOCUS_18290 51599 51189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18290 >Feature sequence059 554 841 gene locus_tag LOCUS_18300 554 841 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047976.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18300 931 1809 gene locus_tag LOCUS_18310 931 1809 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891289.1 protein_id gnl|my_center|LOCUS_18310 1793 2431 gene locus_tag LOCUS_18320 1793 2431 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_18320 3347 2484 gene locus_tag LOCUS_18330 3347 2484 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 protein_id gnl|my_center|LOCUS_18330 3517 5391 gene locus_tag LOCUS_18340 3517 5391 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_18340 5717 6364 gene locus_tag LOCUS_18350 5717 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 6349 6549 gene locus_tag LOCUS_18360 6349 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 7328 6630 gene locus_tag LOCUS_18370 7328 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 8607 7420 gene locus_tag LOCUS_18380 8607 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 9140 8514 gene locus_tag LOCUS_18390 9140 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 9400 9098 gene locus_tag LOCUS_18400 9400 9098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 9641 10363 gene locus_tag LOCUS_18410 9641 10363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 10538 11506 gene locus_tag LOCUS_18420 10538 11506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 11566 12462 gene locus_tag LOCUS_18430 11566 12462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 14828 12558 gene locus_tag LOCUS_18440 14828 12558 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086363.1 protein_id gnl|my_center|LOCUS_18440 14965 15330 gene locus_tag LOCUS_18450 14965 15330 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948232.1 protein_id gnl|my_center|LOCUS_18450 15450 16199 gene locus_tag LOCUS_18460 15450 16199 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_18460 17297 16227 gene locus_tag LOCUS_18470 17297 16227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_18470 18346 17294 gene locus_tag LOCUS_18480 18346 17294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 19515 18349 gene locus_tag LOCUS_18490 19515 18349 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107521.1 protein_id gnl|my_center|LOCUS_18490 19732 20328 gene locus_tag LOCUS_18500 19732 20328 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_18500 20325 21011 gene locus_tag LOCUS_18510 20325 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 21315 21956 gene locus_tag LOCUS_18520 21315 21956 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025356.1 protein_id gnl|my_center|LOCUS_18520 22011 22373 gene locus_tag LOCUS_18530 22011 22373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 22950 23759 gene locus_tag LOCUS_18540 22950 23759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18540 23810 25912 gene locus_tag LOCUS_18550 23810 25912 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_18550 25909 27408 gene locus_tag LOCUS_18560 25909 27408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 27398 29164 gene locus_tag LOCUS_18570 27398 29164 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538267.1 protein_id gnl|my_center|LOCUS_18570 29364 30122 gene locus_tag LOCUS_18580 29364 30122 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_18580 30147 31019 gene locus_tag LOCUS_18590 30147 31019 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777129.1 protein_id gnl|my_center|LOCUS_18590 31196 32899 gene locus_tag LOCUS_18600 31196 32899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 32842 33447 gene locus_tag LOCUS_18610 32842 33447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 33444 35078 gene locus_tag LOCUS_18620 33444 35078 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804913.1 protein_id gnl|my_center|LOCUS_18620 35393 35806 gene locus_tag LOCUS_18630 35393 35806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18630 35794 36186 gene locus_tag LOCUS_18640 35794 36186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18640 36186 36371 gene locus_tag LOCUS_18650 36186 36371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18650 36389 37288 gene locus_tag LOCUS_18660 36389 37288 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_18660 37319 38944 gene locus_tag LOCUS_18670 37319 38944 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804913.1 protein_id gnl|my_center|LOCUS_18670 39175 39822 gene locus_tag LOCUS_18680 39175 39822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 39819 40697 gene locus_tag LOCUS_18690 39819 40697 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974649.1 protein_id gnl|my_center|LOCUS_18690 40957 41169 gene locus_tag LOCUS_18700 40957 41169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 41251 41883 gene locus_tag LOCUS_18710 41251 41883 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454936.1 protein_id gnl|my_center|LOCUS_18710 41996 42394 gene locus_tag LOCUS_18720 41996 42394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 43008 42865 gene locus_tag LOCUS_18730 43008 42865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 44535 44035 gene locus_tag LOCUS_18740 44535 44035 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_18740 44861 44583 gene locus_tag LOCUS_18750 44861 44583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 45071 45865 gene locus_tag LOCUS_18760 gene dppA 45071 45865 CDS product D-aminopeptidase DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245814.1 protein_id gnl|my_center|LOCUS_18760 46418 45954 gene locus_tag LOCUS_18770 gene def 46418 45954 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392416.1 protein_id gnl|my_center|LOCUS_18770 47599 46658 gene locus_tag LOCUS_18780 47599 46658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 48468 47794 gene locus_tag LOCUS_18790 48468 47794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18790 48970 48593 gene locus_tag LOCUS_18800 48970 48593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18800 49441 49010 gene locus_tag LOCUS_18810 49441 49010 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115309.1 protein_id gnl|my_center|LOCUS_18810 49833 50456 gene locus_tag LOCUS_18820 49833 50456 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522508.1 protein_id gnl|my_center|LOCUS_18820 51060 51398 gene locus_tag LOCUS_18830 51060 51398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18830 51395 51634 gene locus_tag LOCUS_18840 51395 51634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18840 51628 53355 gene locus_tag LOCUS_18850 51628 53355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18850 54703 53468 gene locus_tag LOCUS_18860 54703 53468 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380194.1 protein_id gnl|my_center|LOCUS_18860 55200 54706 gene locus_tag LOCUS_18870 55200 54706 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393559.1 protein_id gnl|my_center|LOCUS_18870 55466 56308 gene locus_tag LOCUS_18880 55466 56308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 56688 56912 gene locus_tag LOCUS_18890 56688 56912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18890 57107 57259 gene locus_tag LOCUS_18900 57107 57259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 57316 58437 gene locus_tag LOCUS_18910 57316 58437 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898649.1 protein_id gnl|my_center|LOCUS_18910 58491 59555 gene locus_tag LOCUS_18920 58491 59555 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436292.1 protein_id gnl|my_center|LOCUS_18920 59557 60429 gene locus_tag LOCUS_18930 59557 60429 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416903.1 protein_id gnl|my_center|LOCUS_18930 60446 61369 gene locus_tag LOCUS_18940 60446 61369 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898651.1 protein_id gnl|my_center|LOCUS_18940 61525 62310 gene locus_tag LOCUS_18950 61525 62310 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975366.1 protein_id gnl|my_center|LOCUS_18950 63029 62373 gene locus_tag LOCUS_18960 63029 62373 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257063.1 protein_id gnl|my_center|LOCUS_18960 63938 63033 gene locus_tag LOCUS_18970 63938 63033 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246287.1 protein_id gnl|my_center|LOCUS_18970 64406 64167 gene locus_tag LOCUS_18980 64406 64167 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_18980 65473 64427 gene locus_tag LOCUS_18990 65473 64427 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256628.1 protein_id gnl|my_center|LOCUS_18990 65693 66115 gene locus_tag LOCUS_19000 65693 66115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 66487 68079 gene locus_tag LOCUS_19010 66487 68079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence060 1299 1027 gene locus_tag LOCUS_19020 1299 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2270 1410 gene locus_tag LOCUS_19030 2270 1410 CDS product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258500.1 protein_id gnl|my_center|LOCUS_19030 3435 2272 gene locus_tag LOCUS_19040 3435 2272 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179100.1 protein_id gnl|my_center|LOCUS_19040 3575 5374 gene locus_tag LOCUS_19050 3575 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 6641 5442 gene locus_tag LOCUS_19060 6641 5442 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531927.1 protein_id gnl|my_center|LOCUS_19060 7420 6638 gene locus_tag LOCUS_19070 7420 6638 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531924.1 protein_id gnl|my_center|LOCUS_19070 8348 7539 gene locus_tag LOCUS_19080 8348 7539 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329342.1 protein_id gnl|my_center|LOCUS_19080 9758 8409 gene locus_tag LOCUS_19090 9758 8409 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531926.1 protein_id gnl|my_center|LOCUS_19090 10582 9893 gene locus_tag LOCUS_19100 10582 9893 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_19100 11635 10724 gene locus_tag LOCUS_19110 11635 10724 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171047034.1 protein_id gnl|my_center|LOCUS_19110 12960 11857 gene locus_tag LOCUS_19120 12960 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 15506 12957 gene locus_tag LOCUS_19130 15506 12957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 16678 16031 gene locus_tag LOCUS_19140 16678 16031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 17050 17214 gene locus_tag LOCUS_19150 17050 17214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 18552 17278 gene locus_tag LOCUS_19160 18552 17278 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_19160 18780 20162 gene locus_tag LOCUS_19170 18780 20162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 20736 20185 gene locus_tag LOCUS_19180 20736 20185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19180 21074 20730 gene locus_tag LOCUS_19190 21074 20730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 21637 21089 gene locus_tag LOCUS_19200 21637 21089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19200 22043 21777 gene locus_tag LOCUS_19210 22043 21777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19210 22266 22117 gene locus_tag LOCUS_19220 22266 22117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 23748 22429 gene locus_tag LOCUS_19230 23748 22429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 25839 24124 gene locus_tag LOCUS_19240 25839 24124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127588486.1 protein_id gnl|my_center|LOCUS_19240 27114 25849 gene locus_tag LOCUS_19250 27114 25849 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_19250 28093 27107 gene locus_tag LOCUS_19260 28093 27107 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171047034.1 protein_id gnl|my_center|LOCUS_19260 29210 28311 gene locus_tag LOCUS_19270 29210 28311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 33198 29923 gene locus_tag LOCUS_19280 33198 29923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 34563 33244 gene locus_tag LOCUS_19290 34563 33244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19290 35432 34482 gene locus_tag LOCUS_19300 35432 34482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19300 >Feature sequence061 692 429 gene locus_tag LOCUS_19310 692 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19310 1273 704 gene locus_tag LOCUS_19320 1273 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19320 1659 1354 gene locus_tag LOCUS_19330 1659 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 1880 2407 gene locus_tag LOCUS_19340 1880 2407 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289109.1 protein_id gnl|my_center|LOCUS_19340 3047 2436 gene locus_tag LOCUS_19350 3047 2436 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722300.1 protein_id gnl|my_center|LOCUS_19350 3221 3979 gene locus_tag LOCUS_19360 3221 3979 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722299.1 protein_id gnl|my_center|LOCUS_19360 4360 5295 gene locus_tag LOCUS_19370 4360 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 6723 5305 gene locus_tag LOCUS_19380 6723 5305 CDS product malate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338924.1 protein_id gnl|my_center|LOCUS_19380 7930 6815 gene locus_tag LOCUS_19390 7930 6815 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_19390 8100 8489 gene locus_tag LOCUS_19400 8100 8489 CDS product kinase-associated lipoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209350.1 protein_id gnl|my_center|LOCUS_19400 9790 8492 gene locus_tag LOCUS_19410 9790 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 10113 12674 gene locus_tag LOCUS_19420 10113 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19420 12647 14716 gene locus_tag LOCUS_19430 12647 14716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19430 15035 14859 gene locus_tag LOCUS_19440 15035 14859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 15619 15296 gene locus_tag LOCUS_19450 15619 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 15905 16327 gene locus_tag LOCUS_19460 15905 16327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 16473 17120 gene locus_tag LOCUS_19470 16473 17120 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19470 17101 17784 gene locus_tag LOCUS_19480 17101 17784 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467939.1 protein_id gnl|my_center|LOCUS_19480 18069 18893 gene locus_tag LOCUS_19490 gene galU 18069 18893 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227944.1 protein_id gnl|my_center|LOCUS_19490 18890 19582 gene locus_tag LOCUS_19500 18890 19582 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060578.1 protein_id gnl|my_center|LOCUS_19500 19786 20547 gene locus_tag LOCUS_19510 19786 20547 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19510 20575 21555 gene locus_tag LOCUS_19520 gene gmd 20575 21555 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_19520 21570 22919 gene locus_tag LOCUS_19530 21570 22919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 24387 24671 gene locus_tag LOCUS_19540 24387 24671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 24665 25399 gene locus_tag LOCUS_19550 24665 25399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 25571 26761 gene locus_tag LOCUS_19560 25571 26761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 26766 27011 gene locus_tag LOCUS_19570 26766 27011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 26984 27235 gene locus_tag LOCUS_19580 26984 27235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 27369 27911 gene locus_tag LOCUS_19590 27369 27911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19590 27908 29071 gene locus_tag LOCUS_19600 27908 29071 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_19600 29049 29639 gene locus_tag LOCUS_19610 gene wcaF 29049 29639 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153593.1 protein_id gnl|my_center|LOCUS_19610 29636 29950 gene locus_tag LOCUS_19620 29636 29950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 29947 30876 gene locus_tag LOCUS_19630 29947 30876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19630 30906 32276 gene locus_tag LOCUS_19640 30906 32276 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046233294.1 protein_id gnl|my_center|LOCUS_19640 32305 33102 gene locus_tag LOCUS_19650 32305 33102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19650 33045 33641 gene locus_tag LOCUS_19660 33045 33641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19660 33669 34643 gene locus_tag LOCUS_19670 gene lytR 33669 34643 CDS product transcription antiterminator LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227949.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence062 1 76 gene locus_tag LOCUS_t00120 1 76 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 88 164 gene locus_tag LOCUS_t00130 88 164 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 200 276 gene locus_tag LOCUS_t00140 200 276 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 284 359 gene locus_tag LOCUS_t00150 284 359 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 377 452 gene locus_tag LOCUS_t00160 377 452 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 457 542 gene locus_tag LOCUS_t00170 457 542 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 551 624 gene locus_tag LOCUS_t00180 551 624 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 638 713 gene locus_tag LOCUS_t00190 638 713 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 725 799 gene locus_tag LOCUS_t00200 725 799 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 804 878 gene locus_tag LOCUS_t00210 804 878 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 888 961 gene locus_tag LOCUS_t00220 888 961 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 973 1049 gene locus_tag LOCUS_t00230 973 1049 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1062 1147 gene locus_tag LOCUS_t00240 1062 1147 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1737 2024 gene locus_tag LOCUS_19680 1737 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19680 2663 2448 gene locus_tag LOCUS_19690 2663 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3399 3217 gene locus_tag LOCUS_19700 3399 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 4160 3966 gene locus_tag LOCUS_19710 4160 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19710 4805 4368 gene locus_tag LOCUS_19720 4805 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460111.1 protein_id gnl|my_center|LOCUS_19720 5653 4880 gene locus_tag LOCUS_19730 5653 4880 CDS product DUF4367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460112.1 protein_id gnl|my_center|LOCUS_19730 6215 5637 gene locus_tag LOCUS_19740 6215 5637 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944541.1 protein_id gnl|my_center|LOCUS_19740 7932 8171 gene locus_tag LOCUS_19750 7932 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 8141 8539 gene locus_tag LOCUS_19760 8141 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 8702 9121 gene locus_tag LOCUS_19770 8702 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 9356 9868 gene locus_tag LOCUS_19780 9356 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19780 11344 10664 gene locus_tag LOCUS_19790 11344 10664 CDS product putative immunity/bacteriocin fusion bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691527.1 protein_id gnl|my_center|LOCUS_19790 12371 11592 gene locus_tag LOCUS_19800 12371 11592 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477868.1 protein_id gnl|my_center|LOCUS_19800 12463 13164 gene locus_tag LOCUS_19810 12463 13164 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175234.1 protein_id gnl|my_center|LOCUS_19810 13424 13260 gene locus_tag LOCUS_19820 13424 13260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 13723 13953 gene locus_tag LOCUS_19830 13723 13953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19830 13950 14195 gene locus_tag LOCUS_19840 13950 14195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19840 14333 14911 gene locus_tag LOCUS_19850 14333 14911 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529110.1 protein_id gnl|my_center|LOCUS_19850 16074 15040 gene locus_tag LOCUS_19860 16074 15040 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584083.1 protein_id gnl|my_center|LOCUS_19860 16208 17212 gene locus_tag LOCUS_19870 16208 17212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19870 17239 17478 gene locus_tag LOCUS_19880 17239 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19880 18579 17611 gene locus_tag LOCUS_19890 18579 17611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 19096 19413 gene locus_tag LOCUS_19900 19096 19413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 19450 20148 gene locus_tag LOCUS_19910 19450 20148 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110280.1 protein_id gnl|my_center|LOCUS_19910 20210 20629 gene locus_tag LOCUS_19920 20210 20629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 20631 21260 gene locus_tag LOCUS_19930 20631 21260 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811261.1 protein_id gnl|my_center|LOCUS_19930 21474 21725 gene locus_tag LOCUS_19940 21474 21725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 21722 22483 gene locus_tag LOCUS_19950 21722 22483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 22504 23154 gene locus_tag LOCUS_19960 22504 23154 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598709.1 protein_id gnl|my_center|LOCUS_19960 23509 23171 gene locus_tag LOCUS_19970 23509 23171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 24014 23664 gene locus_tag LOCUS_19980 24014 23664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 24216 24998 gene locus_tag LOCUS_19990 24216 24998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 25126 26679 gene locus_tag LOCUS_20000 gene zwf 25126 26679 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393785.1 protein_id gnl|my_center|LOCUS_20000 26728 27354 gene locus_tag LOCUS_20010 26728 27354 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393784.1 protein_id gnl|my_center|LOCUS_20010 27413 28405 gene locus_tag LOCUS_20020 27413 28405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20020 28402 28998 gene locus_tag LOCUS_20030 28402 28998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20030 29255 30193 gene locus_tag LOCUS_20040 29255 30193 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_20040 30209 31372 gene locus_tag LOCUS_20050 30209 31372 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_20050 31434 32519 gene locus_tag LOCUS_20060 31434 32519 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_20060 32669 33874 gene locus_tag LOCUS_20070 32669 33874 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435857.1 protein_id gnl|my_center|LOCUS_20070 34095 33862 gene locus_tag LOCUS_20080 gene sspI 34095 33862 CDS product small acid-soluble spore protein SspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009509.1 protein_id gnl|my_center|LOCUS_20080 34258 34923 gene locus_tag LOCUS_20090 34258 34923 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_20090 34931 35197 gene locus_tag LOCUS_20100 34931 35197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20100 35197 35751 gene locus_tag LOCUS_20110 35197 35751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20110 >Feature sequence063 87 350 gene locus_tag LOCUS_20120 87 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 266 1333 gene locus_tag LOCUS_20130 266 1333 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228574.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20130 1363 3162 gene locus_tag LOCUS_20140 gene fadE 1363 3162 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244094.1 protein_id gnl|my_center|LOCUS_20140 3178 4884 gene locus_tag LOCUS_20150 3178 4884 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 protein_id gnl|my_center|LOCUS_20150 4900 5343 gene locus_tag LOCUS_20160 4900 5343 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944306.1 protein_id gnl|my_center|LOCUS_20160 5468 5680 gene locus_tag LOCUS_20170 5468 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 5875 6069 gene locus_tag LOCUS_20180 5875 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 6236 6907 gene locus_tag LOCUS_20190 6236 6907 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966256.1 protein_id gnl|my_center|LOCUS_20190 7066 8466 gene locus_tag LOCUS_20200 gene fumC 7066 8466 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456604.1 protein_id gnl|my_center|LOCUS_20200 8534 9844 gene locus_tag LOCUS_20210 8534 9844 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_20210 10588 9851 gene locus_tag LOCUS_20220 10588 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 10712 12574 gene locus_tag LOCUS_20230 10712 12574 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20230 12496 12741 gene locus_tag LOCUS_20240 12496 12741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20240 12760 13389 gene locus_tag LOCUS_20250 12760 13389 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461121.1 protein_id gnl|my_center|LOCUS_20250 13936 13499 gene locus_tag LOCUS_20260 13936 13499 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229083.1 protein_id gnl|my_center|LOCUS_20260 14203 13994 gene locus_tag LOCUS_20270 14203 13994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20270 14934 14200 gene locus_tag LOCUS_20280 14934 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20280 15541 15137 gene locus_tag LOCUS_20290 15541 15137 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243483.1 protein_id gnl|my_center|LOCUS_20290 15726 16280 gene locus_tag LOCUS_20300 15726 16280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 16281 17162 gene locus_tag LOCUS_20310 gene galU 16281 17162 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817120.1 protein_id gnl|my_center|LOCUS_20310 17477 18295 gene locus_tag LOCUS_20320 17477 18295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 18268 18585 gene locus_tag LOCUS_20330 18268 18585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20330 18599 19735 gene locus_tag LOCUS_20340 18599 19735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 19812 20918 gene locus_tag LOCUS_20350 gene araR 19812 20918 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_20350 21148 21873 gene locus_tag LOCUS_20360 gene araD 21148 21873 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964650.1 protein_id gnl|my_center|LOCUS_20360 21870 23582 gene locus_tag LOCUS_20370 gene araB 21870 23582 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_20370 24167 23730 gene locus_tag LOCUS_20380 24167 23730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20380 25045 24431 gene locus_tag LOCUS_20390 gene sodA 25045 24431 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_20390 25374 25778 gene locus_tag LOCUS_20400 25374 25778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 26012 26608 gene locus_tag LOCUS_20410 gene lepB 26012 26608 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232348.1 protein_id gnl|my_center|LOCUS_20410 26622 27059 gene locus_tag LOCUS_20420 gene rnhA 26622 27059 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392156.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence064 520 1065 gene locus_tag LOCUS_20430 520 1065 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268255.1 protein_id gnl|my_center|LOCUS_20430 1151 1921 gene locus_tag LOCUS_20440 1151 1921 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_20440 2533 2661 gene locus_tag LOCUS_20450 2533 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2661 3332 gene locus_tag LOCUS_20460 2661 3332 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588494.1 protein_id gnl|my_center|LOCUS_20460 3465 3914 gene locus_tag LOCUS_20470 3465 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 3965 4777 gene locus_tag LOCUS_20480 3965 4777 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_20480 4823 5077 gene locus_tag LOCUS_20490 4823 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 5482 5847 gene locus_tag LOCUS_20500 5482 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 5844 6341 gene locus_tag LOCUS_20510 5844 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20510 6227 6553 gene locus_tag LOCUS_20520 6227 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20520 7672 6614 gene locus_tag LOCUS_20530 7672 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244712.1 protein_id gnl|my_center|LOCUS_20530 7829 8398 gene locus_tag LOCUS_20540 7829 8398 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866483.1 protein_id gnl|my_center|LOCUS_20540 8478 8798 gene locus_tag LOCUS_20550 8478 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 8948 9211 gene locus_tag LOCUS_20560 8948 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 9208 9669 gene locus_tag LOCUS_20570 9208 9669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 10322 9777 gene locus_tag LOCUS_20580 gene adaB 10322 9777 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246311.1 protein_id gnl|my_center|LOCUS_20580 10908 10339 gene locus_tag LOCUS_20590 gene adaA 10908 10339 CDS product bifunctional transcriptional activator/DNA repair enzyme AdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234924.1 protein_id gnl|my_center|LOCUS_20590 11358 11044 gene locus_tag LOCUS_20600 11358 11044 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732635.1 protein_id gnl|my_center|LOCUS_20600 11975 11370 gene locus_tag LOCUS_20610 11975 11370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 12214 11960 gene locus_tag LOCUS_20620 12214 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 12451 12365 gene locus_tag LOCUS_t00250 12451 12365 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14643 12562 gene locus_tag LOCUS_20630 14643 12562 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116616.1 protein_id gnl|my_center|LOCUS_20630 14975 14649 gene locus_tag LOCUS_20640 14975 14649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20640 16402 14978 gene locus_tag LOCUS_20650 gene bmrC 16402 14978 CDS product multidrug ABC transporter ATP-binding protein BmrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245157.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20650 16815 16582 gene locus_tag LOCUS_20660 16815 16582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 16985 16899 gene locus_tag LOCUS_t00260 16985 16899 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17179 18012 gene locus_tag LOCUS_20670 17179 18012 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549805.1 protein_id gnl|my_center|LOCUS_20670 18284 18009 gene locus_tag LOCUS_20680 18284 18009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20680 18323 18544 gene locus_tag LOCUS_20690 18323 18544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 18909 19151 gene locus_tag LOCUS_20700 18909 19151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 20036 19110 gene locus_tag LOCUS_20710 20036 19110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 20633 20190 gene locus_tag LOCUS_20720 20633 20190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20720 21130 20642 gene locus_tag LOCUS_20730 21130 20642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 21629 21024 gene locus_tag LOCUS_20740 21629 21024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20740 22110 21676 gene locus_tag LOCUS_20750 22110 21676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20750 22934 22107 gene locus_tag LOCUS_20760 22934 22107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20760 23268 25841 gene locus_tag LOCUS_20770 23268 25841 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_20770 26028 26708 gene locus_tag LOCUS_20780 26028 26708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20780 26705 26947 gene locus_tag LOCUS_20790 26705 26947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20790 27094 28152 gene locus_tag LOCUS_20800 27094 28152 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 protein_id gnl|my_center|LOCUS_20800 28415 28618 gene locus_tag LOCUS_20810 28415 28618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 28744 29694 gene locus_tag LOCUS_20820 28744 29694 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_20820 29969 31474 gene locus_tag LOCUS_20830 29969 31474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 31471 33216 gene locus_tag LOCUS_20840 gene yesM 31471 33216 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_20840 33332 34309 gene locus_tag LOCUS_20850 33332 34309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 34306 34686 gene locus_tag LOCUS_20860 34306 34686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 34765 35631 gene locus_tag LOCUS_20870 34765 35631 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_20870 35628 36455 gene locus_tag LOCUS_20880 35628 36455 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330566.1 protein_id gnl|my_center|LOCUS_20880 36492 39383 gene locus_tag LOCUS_20890 36492 39383 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_20890 39744 40340 gene locus_tag LOCUS_20900 39744 40340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 40733 41689 gene locus_tag LOCUS_20910 40733 41689 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097002.1 protein_id gnl|my_center|LOCUS_20910 41686 42345 gene locus_tag LOCUS_20920 41686 42345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 protein_id gnl|my_center|LOCUS_20920 42419 43264 gene locus_tag LOCUS_20930 42419 43264 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099728.1 protein_id gnl|my_center|LOCUS_20930 44633 43353 gene locus_tag LOCUS_20940 44633 43353 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_20940 46321 44738 gene locus_tag LOCUS_20950 gene yvrG 46321 44738 CDS product two-component system sensor histidine kinase YvrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243980.1 protein_id gnl|my_center|LOCUS_20950 46563 46234 gene locus_tag LOCUS_20960 46563 46234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 47276 46560 gene locus_tag LOCUS_20970 47276 46560 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283871.1 protein_id gnl|my_center|LOCUS_20970 47497 48555 gene locus_tag LOCUS_20980 47497 48555 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044441.1 protein_id gnl|my_center|LOCUS_20980 48829 48614 gene locus_tag LOCUS_20990 48829 48614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20990 49306 48989 gene locus_tag LOCUS_21000 49306 48989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21000 49600 50595 gene locus_tag LOCUS_21010 49600 50595 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964016.1 protein_id gnl|my_center|LOCUS_21010 50626 51327 gene locus_tag LOCUS_21020 gene bdbD 50626 51327 CDS product disulfide bond formation protein BdbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228414.1 protein_id gnl|my_center|LOCUS_21020 51329 51763 gene locus_tag LOCUS_21030 51329 51763 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_21030 52735 51881 gene locus_tag LOCUS_21040 gene araC 52735 51881 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095551.1 protein_id gnl|my_center|LOCUS_21040 52964 53956 gene locus_tag LOCUS_21050 52964 53956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 53953 54993 gene locus_tag LOCUS_21060 53953 54993 CDS product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003293891.1 protein_id gnl|my_center|LOCUS_21060 55239 57047 gene locus_tag LOCUS_21070 gene glgB 55239 57047 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398803.1 protein_id gnl|my_center|LOCUS_21070 57181 58347 gene locus_tag LOCUS_21080 57181 58347 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_21080 58344 59456 gene locus_tag LOCUS_21090 gene glgD 58344 59456 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_21090 59501 60931 gene locus_tag LOCUS_21100 gene glgA 59501 60931 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_21100 60949 62118 gene locus_tag LOCUS_21110 60949 62118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21110 62042 62929 gene locus_tag LOCUS_21120 62042 62929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21120 >Feature sequence065 317 48 gene locus_tag LOCUS_21130 317 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 698 468 gene locus_tag LOCUS_21140 698 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 975 688 gene locus_tag LOCUS_21150 975 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 1145 972 gene locus_tag LOCUS_21160 1145 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 1751 1149 gene locus_tag LOCUS_21170 1751 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 2221 1736 gene locus_tag LOCUS_21180 2221 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2609 2226 gene locus_tag LOCUS_21190 2609 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2991 2653 gene locus_tag LOCUS_21200 2991 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3347 2991 gene locus_tag LOCUS_21210 3347 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 3963 3640 gene locus_tag LOCUS_21220 3963 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 4143 4538 gene locus_tag LOCUS_21230 4143 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 5550 4585 gene locus_tag LOCUS_21240 gene xerC 5550 4585 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692390.1 protein_id gnl|my_center|LOCUS_21240 5917 5842 gene locus_tag LOCUS_t00270 5917 5842 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5997 5923 gene locus_tag LOCUS_t00280 5997 5923 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6076 6001 gene locus_tag LOCUS_t00290 6076 6001 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6154 6080 gene locus_tag LOCUS_t00300 6154 6080 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6241 6166 gene locus_tag LOCUS_t00310 6241 6166 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6323 6248 gene locus_tag LOCUS_t00320 6323 6248 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence066 42 497 gene locus_tag LOCUS_21250 42 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 591 1520 gene locus_tag LOCUS_21260 591 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 1493 1834 gene locus_tag LOCUS_21270 1493 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 1831 2628 gene locus_tag LOCUS_21280 1831 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2622 3710 gene locus_tag LOCUS_21290 2622 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21290 3796 3924 gene locus_tag LOCUS_21300 3796 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 4018 4971 gene locus_tag LOCUS_21310 4018 4971 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389232.1 protein_id gnl|my_center|LOCUS_21310 4968 5276 gene locus_tag LOCUS_21320 4968 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 5292 5753 gene locus_tag LOCUS_21330 5292 5753 CDS product lasso peptide biosynthesis B2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390771.1 protein_id gnl|my_center|LOCUS_21330 5768 6463 gene locus_tag LOCUS_21340 5768 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 6346 6954 gene locus_tag LOCUS_21350 6346 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 6957 7934 gene locus_tag LOCUS_21360 6957 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 8072 8752 gene locus_tag LOCUS_21370 8072 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21370 9625 8978 gene locus_tag LOCUS_21380 gene cysC 9625 8978 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_21380 9976 10191 gene locus_tag LOCUS_21390 9976 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 10536 11570 gene locus_tag LOCUS_21400 10536 11570 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974677.1 protein_id gnl|my_center|LOCUS_21400 11735 11929 gene locus_tag LOCUS_21410 11735 11929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 11878 12996 gene locus_tag LOCUS_21420 11878 12996 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242083.1 protein_id gnl|my_center|LOCUS_21420 13085 14017 gene locus_tag LOCUS_21430 13085 14017 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226190.1 protein_id gnl|my_center|LOCUS_21430 14014 14847 gene locus_tag LOCUS_21440 14014 14847 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226189.1 protein_id gnl|my_center|LOCUS_21440 14880 15851 gene locus_tag LOCUS_21450 14880 15851 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943768.1 protein_id gnl|my_center|LOCUS_21450 15883 18204 gene locus_tag LOCUS_21460 gene yicI 15883 18204 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582725.1 protein_id gnl|my_center|LOCUS_21460 18490 19428 gene locus_tag LOCUS_21470 18490 19428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245448.1 protein_id gnl|my_center|LOCUS_21470 19421 19690 gene locus_tag LOCUS_21480 19421 19690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 19648 20202 gene locus_tag LOCUS_21490 19648 20202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 20677 20222 gene locus_tag LOCUS_21500 20677 20222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 21726 20830 gene locus_tag LOCUS_21510 21726 20830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 22720 21731 gene locus_tag LOCUS_21520 gene ligD 22720 21731 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879221.1 protein_id gnl|my_center|LOCUS_21520 23023 24168 gene locus_tag LOCUS_21530 23023 24168 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402273.1 protein_id gnl|my_center|LOCUS_21530 24464 24201 gene locus_tag LOCUS_21540 24464 24201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 25180 24524 gene locus_tag LOCUS_21550 25180 24524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21550 25381 25587 gene locus_tag LOCUS_21560 25381 25587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 25587 25778 gene locus_tag LOCUS_21570 25587 25778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 25981 25775 gene locus_tag LOCUS_21580 25981 25775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 25956 26195 gene locus_tag LOCUS_21590 25956 26195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence067 1232 96 gene locus_tag LOCUS_21600 1232 96 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_21600 1717 1307 gene locus_tag LOCUS_21610 1717 1307 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963869.1 protein_id gnl|my_center|LOCUS_21610 2151 1735 gene locus_tag LOCUS_21620 2151 1735 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101082.1 protein_id gnl|my_center|LOCUS_21620 2255 2467 gene locus_tag LOCUS_21630 2255 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 2594 2869 gene locus_tag LOCUS_21640 2594 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2884 3084 gene locus_tag LOCUS_21650 2884 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3086 3397 gene locus_tag LOCUS_21660 3086 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 3414 3755 gene locus_tag LOCUS_21670 3414 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 3771 3962 gene locus_tag LOCUS_21680 3771 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 4411 4656 gene locus_tag LOCUS_21690 4411 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 4637 5836 gene locus_tag LOCUS_21700 4637 5836 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_21700 5843 6445 gene locus_tag LOCUS_21710 5843 6445 CDS product DUF2815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 protein_id gnl|my_center|LOCUS_21710 6505 7086 gene locus_tag LOCUS_21720 6505 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 7083 9035 gene locus_tag LOCUS_21730 7083 9035 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_21730 9859 9032 gene locus_tag LOCUS_21740 9859 9032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 9989 11314 gene locus_tag LOCUS_21750 9989 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 11547 12533 gene locus_tag LOCUS_21760 11547 12533 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025227807.1 protein_id gnl|my_center|LOCUS_21760 12530 13549 gene locus_tag LOCUS_21770 12530 13549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21770 13546 14889 gene locus_tag LOCUS_21780 13546 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21780 15152 15409 gene locus_tag LOCUS_21790 15152 15409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 15406 15687 gene locus_tag LOCUS_21800 15406 15687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 15684 15992 gene locus_tag LOCUS_21810 15684 15992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21810 15989 17059 gene locus_tag LOCUS_21820 15989 17059 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21820 17056 17235 gene locus_tag LOCUS_21830 17056 17235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 17216 17815 gene locus_tag LOCUS_21840 17216 17815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 18080 18256 gene locus_tag LOCUS_21850 18080 18256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 18310 18813 gene locus_tag LOCUS_21860 18310 18813 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047635.1 protein_id gnl|my_center|LOCUS_21860 18810 19880 gene locus_tag LOCUS_21870 18810 19880 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047636.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21870 19894 20049 gene locus_tag LOCUS_21880 19894 20049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21880 20064 20465 gene locus_tag LOCUS_21890 20064 20465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21890 20462 21523 gene locus_tag LOCUS_21900 20462 21523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21900 21495 21689 gene locus_tag LOCUS_21910 21495 21689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 21696 21908 gene locus_tag LOCUS_21920 21696 21908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 21977 23059 gene locus_tag LOCUS_21930 21977 23059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21930 22996 23388 gene locus_tag LOCUS_21940 22996 23388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 23385 23549 gene locus_tag LOCUS_21950 23385 23549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 23916 24560 gene locus_tag LOCUS_21960 23916 24560 CDS product phage scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047641.1 protein_id gnl|my_center|LOCUS_21960 24582 25553 gene locus_tag LOCUS_21970 24582 25553 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047642.1 protein_id gnl|my_center|LOCUS_21970 25599 25907 gene locus_tag LOCUS_21980 25599 25907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 25798 26262 gene locus_tag LOCUS_21990 25798 26262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 26265 26624 gene locus_tag LOCUS_22000 26265 26624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047644.1 protein_id gnl|my_center|LOCUS_22000 26624 27025 gene locus_tag LOCUS_22010 26624 27025 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861030.1 protein_id gnl|my_center|LOCUS_22010 27030 27281 gene locus_tag LOCUS_22020 27030 27281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 27278 27706 gene locus_tag LOCUS_22030 27278 27706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817307.1 protein_id gnl|my_center|LOCUS_22030 27703 27942 gene locus_tag LOCUS_22040 27703 27942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 27939 28115 gene locus_tag LOCUS_22050 27939 28115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 28117 28965 gene locus_tag LOCUS_22060 28117 28965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22060 28923 29414 gene locus_tag LOCUS_22070 28923 29414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22070 29442 29912 gene locus_tag LOCUS_22080 29442 29912 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817302.1 protein_id gnl|my_center|LOCUS_22080 29948 30241 gene locus_tag LOCUS_22090 29948 30241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22090 30213 30368 gene locus_tag LOCUS_22100 30213 30368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 30580 30924 gene locus_tag LOCUS_22110 30580 30924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 30968 31966 gene locus_tag LOCUS_22120 30968 31966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22120 32152 33066 gene locus_tag LOCUS_22130 32152 33066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 33066 33740 gene locus_tag LOCUS_22140 33066 33740 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817296.1 protein_id gnl|my_center|LOCUS_22140 33740 34714 gene locus_tag LOCUS_22150 33740 34714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817294.1 protein_id gnl|my_center|LOCUS_22150 34711 35007 gene locus_tag LOCUS_22160 34711 35007 CDS product DUF2577 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047654.1 protein_id gnl|my_center|LOCUS_22160 35004 35405 gene locus_tag LOCUS_22170 35004 35405 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817290.1 protein_id gnl|my_center|LOCUS_22170 35398 36477 gene locus_tag LOCUS_22180 35398 36477 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461486.1 protein_id gnl|my_center|LOCUS_22180 36470 37057 gene locus_tag LOCUS_22190 36470 37057 CDS product DUF2313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943415.1 protein_id gnl|my_center|LOCUS_22190 37054 37335 gene locus_tag LOCUS_22200 37054 37335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817286.1 protein_id gnl|my_center|LOCUS_22200 37339 38538 gene locus_tag LOCUS_22210 37339 38538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 38554 39009 gene locus_tag LOCUS_22220 38554 39009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 39009 39149 gene locus_tag LOCUS_22230 39009 39149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 39201 39653 gene locus_tag LOCUS_22240 39201 39653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence068 148 678 gene locus_tag LOCUS_22250 148 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 872 1027 gene locus_tag LOCUS_22260 872 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 1024 1326 gene locus_tag LOCUS_22270 1024 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 1502 2296 gene locus_tag LOCUS_22280 1502 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2296 2484 gene locus_tag LOCUS_22290 2296 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2471 2722 gene locus_tag LOCUS_22300 2471 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2685 3107 gene locus_tag LOCUS_22310 2685 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 3107 3310 gene locus_tag LOCUS_22320 3107 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 3750 5165 gene locus_tag LOCUS_22330 3750 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 5156 6253 gene locus_tag LOCUS_22340 5156 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 7373 7693 gene locus_tag LOCUS_22350 7373 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 7694 7900 gene locus_tag LOCUS_22360 7694 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 7897 8145 gene locus_tag LOCUS_22370 7897 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 8142 8345 gene locus_tag LOCUS_22380 8142 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 8342 8578 gene locus_tag LOCUS_22390 8342 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 8529 9077 gene locus_tag LOCUS_22400 8529 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 9074 9553 gene locus_tag LOCUS_22410 9074 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 9603 10235 gene locus_tag LOCUS_22420 9603 10235 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086135.1 protein_id gnl|my_center|LOCUS_22420 10296 12392 gene locus_tag LOCUS_22430 gene nrdE 10296 12392 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855514.1 protein_id gnl|my_center|LOCUS_22430 12414 13385 gene locus_tag LOCUS_22440 gene nrdF 12414 13385 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829597.1 protein_id gnl|my_center|LOCUS_22440 13439 13615 gene locus_tag LOCUS_22450 13439 13615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 13622 13912 gene locus_tag LOCUS_22460 13622 13912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 13909 14664 gene locus_tag LOCUS_22470 13909 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 14671 15429 gene locus_tag LOCUS_22480 gene thyX 14671 15429 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459086.1 protein_id gnl|my_center|LOCUS_22480 15431 15736 gene locus_tag LOCUS_22490 15431 15736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 15682 16029 gene locus_tag LOCUS_22500 15682 16029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 16038 16421 gene locus_tag LOCUS_22510 16038 16421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 16425 16811 gene locus_tag LOCUS_22520 16425 16811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 16856 17296 gene locus_tag LOCUS_22530 16856 17296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 17296 17508 gene locus_tag LOCUS_22540 17296 17508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 17505 18083 gene locus_tag LOCUS_22550 17505 18083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 18405 18058 gene locus_tag LOCUS_22560 18405 18058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 18494 19864 gene locus_tag LOCUS_22570 18494 19864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22570 19864 21090 gene locus_tag LOCUS_22580 19864 21090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22580 21138 21527 gene locus_tag LOCUS_22590 21138 21527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 21528 21923 gene locus_tag LOCUS_22600 21528 21923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 21920 22447 gene locus_tag LOCUS_22610 21920 22447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 23256 22894 gene locus_tag LOCUS_22620 23256 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 24041 23793 gene locus_tag LOCUS_22630 24041 23793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 24353 24150 gene locus_tag LOCUS_22640 24353 24150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 24734 24354 gene locus_tag LOCUS_22650 24734 24354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 25035 24832 gene locus_tag LOCUS_22660 25035 24832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 25177 25332 gene locus_tag LOCUS_22670 25177 25332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 25529 26185 gene locus_tag LOCUS_22680 25529 26185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 26822 26959 gene locus_tag LOCUS_22690 26822 26959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 27569 28144 gene locus_tag LOCUS_22700 27569 28144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 28166 28606 gene locus_tag LOCUS_22710 28166 28606 CDS product phBC6A51 family helix-turn-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086032.1 protein_id gnl|my_center|LOCUS_22710 28607 29917 gene locus_tag LOCUS_22720 28607 29917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22720 30004 30366 gene locus_tag LOCUS_22730 30004 30366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 30392 30646 gene locus_tag LOCUS_22740 30392 30646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877351.1 protein_id gnl|my_center|LOCUS_22740 30687 32252 gene locus_tag LOCUS_22750 30687 32252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 32252 33094 gene locus_tag LOCUS_22760 32252 33094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 33091 33339 gene locus_tag LOCUS_22770 33091 33339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 33341 33988 gene locus_tag LOCUS_22780 33341 33988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 33985 34572 gene locus_tag LOCUS_22790 33985 34572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 34651 35151 gene locus_tag LOCUS_22800 34651 35151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 35178 35363 gene locus_tag LOCUS_22810 35178 35363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 35424 36392 gene locus_tag LOCUS_22820 35424 36392 CDS product DUF5309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145076.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22820 36611 36847 gene locus_tag LOCUS_22830 36611 36847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 36866 37255 gene locus_tag LOCUS_22840 36866 37255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 37573 37986 gene locus_tag LOCUS_22850 37573 37986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 37974 38348 gene locus_tag LOCUS_22860 37974 38348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 38414 38950 gene locus_tag LOCUS_22870 38414 38950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 39004 39429 gene locus_tag LOCUS_22880 39004 39429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 39504 39743 gene locus_tag LOCUS_22890 39504 39743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 39743 41980 gene locus_tag LOCUS_22900 39743 41980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 42073 42732 gene locus_tag LOCUS_22910 42073 42732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 43082 43930 gene locus_tag LOCUS_22920 43082 43930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 43931 44482 gene locus_tag LOCUS_22930 43931 44482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 44512 44907 gene locus_tag LOCUS_22940 44512 44907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 45937 46314 gene locus_tag LOCUS_22950 45937 46314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 46311 46463 gene locus_tag LOCUS_22960 46311 46463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 46450 46965 gene locus_tag LOCUS_22970 46450 46965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 46984 47895 gene locus_tag LOCUS_22980 46984 47895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22980 47808 49100 gene locus_tag LOCUS_22990 47808 49100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 49169 49711 gene locus_tag LOCUS_23000 49169 49711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 49779 49964 gene locus_tag LOCUS_23010 49779 49964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 49961 50167 gene locus_tag LOCUS_23020 49961 50167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 50167 50376 gene locus_tag LOCUS_23030 50167 50376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 50373 51035 gene locus_tag LOCUS_23040 50373 51035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 51206 51285 gene locus_tag LOCUS_t00330 51206 51285 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 51700 52209 gene locus_tag LOCUS_23050 51700 52209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23050 >Feature sequence069 123 1508 gene locus_tag LOCUS_23060 123 1508 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23060 1505 1645 gene locus_tag LOCUS_23070 1505 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 1719 4064 gene locus_tag LOCUS_23080 gene yesS 1719 4064 CDS product transcriptional regulator YesS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966769.1 protein_id gnl|my_center|LOCUS_23080 4252 4569 gene locus_tag LOCUS_23090 4252 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 5335 6081 gene locus_tag LOCUS_23100 5335 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23100 6021 6692 gene locus_tag LOCUS_23110 6021 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23110 6692 7000 gene locus_tag LOCUS_23120 6692 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23120 7168 7986 gene locus_tag LOCUS_23130 7168 7986 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243397.1 protein_id gnl|my_center|LOCUS_23130 9504 8374 gene locus_tag LOCUS_23140 9504 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 9717 11456 gene locus_tag LOCUS_23150 9717 11456 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_23150 11459 11800 gene locus_tag LOCUS_23160 11459 11800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 11698 12021 gene locus_tag LOCUS_23170 11698 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 12051 12551 gene locus_tag LOCUS_23180 12051 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23180 12792 14024 gene locus_tag LOCUS_23190 12792 14024 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 protein_id gnl|my_center|LOCUS_23190 14190 15158 gene locus_tag LOCUS_23200 14190 15158 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228906.1 protein_id gnl|my_center|LOCUS_23200 15155 16129 gene locus_tag LOCUS_23210 15155 16129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23210 16057 16353 gene locus_tag LOCUS_23220 16057 16353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23220 >Feature sequence070 434 57 gene locus_tag LOCUS_23230 gene acpS 434 57 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234281.1 protein_id gnl|my_center|LOCUS_23230 1301 492 gene locus_tag LOCUS_23240 gene nadE 1301 492 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263445.1 protein_id gnl|my_center|LOCUS_23240 1752 1318 gene locus_tag LOCUS_23250 gene brxA 1752 1318 CDS product bacilliredoxin BrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230794.1 protein_id gnl|my_center|LOCUS_23250 1918 1736 gene locus_tag LOCUS_23260 1918 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2377 1979 gene locus_tag LOCUS_23270 2377 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2531 2391 gene locus_tag LOCUS_23280 2531 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 3717 2587 gene locus_tag LOCUS_23290 3717 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 4247 3687 gene locus_tag LOCUS_23300 4247 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 5256 4396 gene locus_tag LOCUS_23310 5256 4396 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_23310 5386 6660 gene locus_tag LOCUS_23320 5386 6660 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558883.1 protein_id gnl|my_center|LOCUS_23320 7161 6775 gene locus_tag LOCUS_23330 7161 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 8489 7158 gene locus_tag LOCUS_23340 8489 7158 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816703.1 protein_id gnl|my_center|LOCUS_23340 9205 8504 gene locus_tag LOCUS_23350 9205 8504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816701.1 protein_id gnl|my_center|LOCUS_23350 10251 9346 gene locus_tag LOCUS_23360 10251 9346 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence071 147 614 gene locus_tag LOCUS_23370 147 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 533 1336 gene locus_tag LOCUS_23380 533 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1407 1913 gene locus_tag LOCUS_23390 1407 1913 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640212.1 protein_id gnl|my_center|LOCUS_23390 1936 2118 gene locus_tag LOCUS_23400 1936 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 2294 2740 gene locus_tag LOCUS_23410 2294 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 2898 3491 gene locus_tag LOCUS_23420 2898 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 3509 4180 gene locus_tag LOCUS_23430 gene qcrB 3509 4180 CDS product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932700.1 protein_id gnl|my_center|LOCUS_23430 4199 4633 gene locus_tag LOCUS_23440 4199 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 4633 5085 gene locus_tag LOCUS_23450 4633 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 5170 5529 gene locus_tag LOCUS_23460 5170 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23460 5544 5813 gene locus_tag LOCUS_23470 5544 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 5939 6874 gene locus_tag LOCUS_23480 5939 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 7730 6861 gene locus_tag LOCUS_23490 7730 6861 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230635.1 protein_id gnl|my_center|LOCUS_23490 7894 8229 gene locus_tag LOCUS_23500 7894 8229 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398996.1 protein_id gnl|my_center|LOCUS_23500 8284 8829 gene locus_tag LOCUS_23510 8284 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 8880 9638 gene locus_tag LOCUS_23520 gene dapB 8880 9638 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922354.1 protein_id gnl|my_center|LOCUS_23520 9725 10114 gene locus_tag LOCUS_23530 gene mgsA 9725 10114 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_23530 10111 10809 gene locus_tag LOCUS_23540 gene bshB1 10111 10809 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015666.1 protein_id gnl|my_center|LOCUS_23540 10899 11705 gene locus_tag LOCUS_23550 10899 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23550 11618 12061 gene locus_tag LOCUS_23560 11618 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23560 12065 13366 gene locus_tag LOCUS_23570 12065 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 13369 13926 gene locus_tag LOCUS_23580 13369 13926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23580 13935 14300 gene locus_tag LOCUS_23590 13935 14300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 14696 15406 gene locus_tag LOCUS_23600 14696 15406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23600 15295 15582 gene locus_tag LOCUS_23610 15295 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23610 15579 16478 gene locus_tag LOCUS_23620 gene panC 15579 16478 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458948.1 protein_id gnl|my_center|LOCUS_23620 16463 16846 gene locus_tag LOCUS_23630 16463 16846 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458949.1 protein_id gnl|my_center|LOCUS_23630 16975 17463 gene locus_tag LOCUS_23640 16975 17463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 17406 17675 gene locus_tag LOCUS_23650 17406 17675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 17692 20559 gene locus_tag LOCUS_23660 gene dinG 17692 20559 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044941.1 protein_id gnl|my_center|LOCUS_23660 20556 21212 gene locus_tag LOCUS_23670 20556 21212 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_23670 21193 22491 gene locus_tag LOCUS_23680 21193 22491 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_23680 22491 23018 gene locus_tag LOCUS_23690 22491 23018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 23133 23672 gene locus_tag LOCUS_23700 23133 23672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 23665 23934 gene locus_tag LOCUS_23710 23665 23934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 23928 25166 gene locus_tag LOCUS_23720 23928 25166 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812900.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23720 >Feature sequence072 1341 433 gene locus_tag LOCUS_23730 1341 433 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_23730 3001 1439 gene locus_tag LOCUS_23740 3001 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 3620 3219 gene locus_tag LOCUS_23750 3620 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23750 3883 3551 gene locus_tag LOCUS_23760 3883 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 4575 3910 gene locus_tag LOCUS_23770 4575 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 5531 4695 gene locus_tag LOCUS_23780 5531 4695 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532486.1 protein_id gnl|my_center|LOCUS_23780 6452 5538 gene locus_tag LOCUS_23790 6452 5538 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972768.1 protein_id gnl|my_center|LOCUS_23790 8119 6515 gene locus_tag LOCUS_23800 8119 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 9314 8094 gene locus_tag LOCUS_23810 9314 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 9913 9200 gene locus_tag LOCUS_23820 9913 9200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 10175 10029 gene locus_tag LOCUS_23830 10175 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence073 98 1390 gene locus_tag LOCUS_23840 gene ltrA 98 1390 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_23840 1985 2218 gene locus_tag LOCUS_23850 1985 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 3973 2339 gene locus_tag LOCUS_23860 3973 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 4130 4615 gene locus_tag LOCUS_23870 4130 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23870 4622 4855 gene locus_tag LOCUS_23880 4622 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23880 4902 5276 gene locus_tag LOCUS_23890 4902 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23890 5560 5838 gene locus_tag LOCUS_23900 5560 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 5934 6947 gene locus_tag LOCUS_23910 gene sirA 5934 6947 CDS product staphyloferrin B ABC transporter substrate-binding protein SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045111.1 protein_id gnl|my_center|LOCUS_23910 7026 8039 gene locus_tag LOCUS_23920 7026 8039 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925219.1 protein_id gnl|my_center|LOCUS_23920 8262 9077 gene locus_tag LOCUS_23930 8262 9077 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267802.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23930 9092 9913 gene locus_tag LOCUS_23940 9092 9913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886609.1 protein_id gnl|my_center|LOCUS_23940 9882 10661 gene locus_tag LOCUS_23950 9882 10661 CDS product IucA/IucC family C-terminal-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267803.1 protein_id gnl|my_center|LOCUS_23950 10892 11287 gene locus_tag LOCUS_23960 10892 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 11284 12060 gene locus_tag LOCUS_23970 11284 12060 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235568.1 protein_id gnl|my_center|LOCUS_23970 12057 13292 gene locus_tag LOCUS_23980 gene sbnH 12057 13292 CDS product staphyloferrin B biosynthesis decarboxylase SbnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223713.1 protein_id gnl|my_center|LOCUS_23980 13317 15050 gene locus_tag LOCUS_23990 13317 15050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23990 14936 15151 gene locus_tag LOCUS_24000 14936 15151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 15390 15566 gene locus_tag LOCUS_24010 15390 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 15678 15992 gene locus_tag LOCUS_24020 15678 15992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24020 16144 16332 gene locus_tag LOCUS_24030 16144 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 16493 16621 gene locus_tag LOCUS_24040 16493 16621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 17134 17823 gene locus_tag LOCUS_24050 17134 17823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 18149 18730 gene locus_tag LOCUS_24060 18149 18730 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 protein_id gnl|my_center|LOCUS_24060 18828 19535 gene locus_tag LOCUS_24070 18828 19535 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346313.1 protein_id gnl|my_center|LOCUS_24070 19907 20266 gene locus_tag LOCUS_24080 19907 20266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 20426 20626 gene locus_tag LOCUS_24090 20426 20626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 20890 22407 gene locus_tag LOCUS_24100 20890 22407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24100 22404 23504 gene locus_tag LOCUS_24110 22404 23504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24110 23899 25596 gene locus_tag LOCUS_24120 23899 25596 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_24120 25589 27037 gene locus_tag LOCUS_24130 25589 27037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 27175 28371 gene locus_tag LOCUS_24140 27175 28371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 28374 28910 gene locus_tag LOCUS_24150 28374 28910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 28935 29831 gene locus_tag LOCUS_24160 28935 29831 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_24160 29862 30224 gene locus_tag LOCUS_24170 29862 30224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 30146 30748 gene locus_tag LOCUS_24180 30146 30748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24180 30865 32502 gene locus_tag LOCUS_24190 30865 32502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 32528 33061 gene locus_tag LOCUS_24200 32528 33061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 33058 33363 gene locus_tag LOCUS_24210 33058 33363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 33302 35662 gene locus_tag LOCUS_24220 33302 35662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 35674 35958 gene locus_tag LOCUS_24230 35674 35958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 36009 36407 gene locus_tag LOCUS_24240 36009 36407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24240 38210 37173 gene locus_tag LOCUS_24250 38210 37173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 39094 38216 gene locus_tag LOCUS_24260 39094 38216 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244562.1 protein_id gnl|my_center|LOCUS_24260 39457 39137 gene locus_tag LOCUS_24270 39457 39137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 39443 39853 gene locus_tag LOCUS_24280 39443 39853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 40868 41962 gene locus_tag LOCUS_24290 40868 41962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24290 41977 42462 gene locus_tag LOCUS_24300 41977 42462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24300 42838 42656 gene locus_tag LOCUS_24310 42838 42656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 43203 42994 gene locus_tag LOCUS_24320 43203 42994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 43376 43741 gene locus_tag LOCUS_24330 43376 43741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24330 43783 44595 gene locus_tag LOCUS_24340 43783 44595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24340 44616 44840 gene locus_tag LOCUS_24350 44616 44840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 44761 44949 gene locus_tag LOCUS_24360 44761 44949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 44973 46013 gene locus_tag LOCUS_24370 gene ccpA 44973 46013 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 protein_id gnl|my_center|LOCUS_24370 46200 47501 gene locus_tag LOCUS_24380 46200 47501 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975930.1 protein_id gnl|my_center|LOCUS_24380 47562 48053 gene locus_tag LOCUS_24390 47562 48053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24390 48041 48499 gene locus_tag LOCUS_24400 48041 48499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24400 48499 49335 gene locus_tag LOCUS_24410 48499 49335 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975929.1 protein_id gnl|my_center|LOCUS_24410 49355 51796 gene locus_tag LOCUS_24420 49355 51796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 52065 52277 gene locus_tag LOCUS_24430 52065 52277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 52265 53275 gene locus_tag LOCUS_24440 52265 53275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24440 53332 54012 gene locus_tag LOCUS_24450 53332 54012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24450 54018 54338 gene locus_tag LOCUS_24460 54018 54338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24460 54393 54806 gene locus_tag LOCUS_24470 54393 54806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24470 54752 55267 gene locus_tag LOCUS_24480 54752 55267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24480 >Feature sequence074 108 1403 gene locus_tag LOCUS_24490 108 1403 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989563.1 protein_id gnl|my_center|LOCUS_24490 1465 2544 gene locus_tag LOCUS_24500 1465 2544 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989566.1 protein_id gnl|my_center|LOCUS_24500 2563 3711 gene locus_tag LOCUS_24510 2563 3711 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026824.1 protein_id gnl|my_center|LOCUS_24510 3831 5387 gene locus_tag LOCUS_24520 3831 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 5515 8358 gene locus_tag LOCUS_24530 5515 8358 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_24530 8383 8895 gene locus_tag LOCUS_24540 8383 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24540 8841 9362 gene locus_tag LOCUS_24550 8841 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24550 9364 10236 gene locus_tag LOCUS_24560 9364 10236 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_24560 10331 12313 gene locus_tag LOCUS_24570 10331 12313 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583939.1 protein_id gnl|my_center|LOCUS_24570 12451 15081 gene locus_tag LOCUS_24580 12451 15081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 15449 15144 gene locus_tag LOCUS_24590 15449 15144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 15644 16069 gene locus_tag LOCUS_24600 15644 16069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24600 16077 17081 gene locus_tag LOCUS_24610 16077 17081 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_24610 17671 17111 gene locus_tag LOCUS_24620 17671 17111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 19760 17712 gene locus_tag LOCUS_24630 19760 17712 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086395854.1 protein_id gnl|my_center|LOCUS_24630 19966 20988 gene locus_tag LOCUS_24640 19966 20988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 21058 21636 gene locus_tag LOCUS_24650 21058 21636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 21633 22556 gene locus_tag LOCUS_24660 21633 22556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 22706 23593 gene locus_tag LOCUS_24670 22706 23593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 23800 24444 gene locus_tag LOCUS_24680 23800 24444 CDS product YoaP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948704.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24680 24429 25049 gene locus_tag LOCUS_24690 24429 25049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 25334 26299 gene locus_tag LOCUS_24700 25334 26299 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_24700 >Feature sequence075 2126 333 gene locus_tag LOCUS_24710 gene cstA 2126 333 CDS product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229512.1 protein_id gnl|my_center|LOCUS_24710 3018 2272 gene locus_tag LOCUS_24720 3018 2272 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921829.1 protein_id gnl|my_center|LOCUS_24720 4123 2993 gene locus_tag LOCUS_24730 4123 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24730 4770 4102 gene locus_tag LOCUS_24740 4770 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24740 5193 5513 gene locus_tag LOCUS_24750 5193 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 7201 6053 gene locus_tag LOCUS_24760 gene gerKC 7201 6053 CDS product spore germination protein GerKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246578.1 protein_id gnl|my_center|LOCUS_24760 8669 7263 gene locus_tag LOCUS_24770 gene gerKA 8669 7263 CDS product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 protein_id gnl|my_center|LOCUS_24770 9762 8716 gene locus_tag LOCUS_24780 9762 8716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 10805 9927 gene locus_tag LOCUS_24790 gene aguB 10805 9927 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 protein_id gnl|my_center|LOCUS_24790 11874 10843 gene locus_tag LOCUS_24800 11874 10843 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356689.1 protein_id gnl|my_center|LOCUS_24800 12100 13128 gene locus_tag LOCUS_24810 12100 13128 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_24810 13389 13195 gene locus_tag LOCUS_24820 13389 13195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 15182 13461 gene locus_tag LOCUS_24830 gene ptsP 15182 13461 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218638.1 protein_id gnl|my_center|LOCUS_24830 16355 15204 gene locus_tag LOCUS_24840 16355 15204 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246548.1 protein_id gnl|my_center|LOCUS_24840 16786 16352 gene locus_tag LOCUS_24850 16786 16352 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246714.1 protein_id gnl|my_center|LOCUS_24850 18255 16789 gene locus_tag LOCUS_24860 18255 16789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24860 20365 18932 gene locus_tag LOCUS_24870 20365 18932 CDS product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886406.1 protein_id gnl|my_center|LOCUS_24870 20797 20636 gene locus_tag LOCUS_24880 20797 20636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 21255 20956 gene locus_tag LOCUS_24890 21255 20956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24890 21492 21334 gene locus_tag LOCUS_24900 21492 21334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 21463 22503 gene locus_tag LOCUS_24910 21463 22503 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649461.1 protein_id gnl|my_center|LOCUS_24910 22744 22965 gene locus_tag LOCUS_24920 22744 22965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 22962 23930 gene locus_tag LOCUS_24930 22962 23930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24930 23946 24554 gene locus_tag LOCUS_24940 23946 24554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 25808 24567 gene locus_tag LOCUS_24950 25808 24567 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988751.1 protein_id gnl|my_center|LOCUS_24950 26236 25805 gene locus_tag LOCUS_24960 26236 25805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 26594 26277 gene locus_tag LOCUS_24970 26594 26277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 27277 26768 gene locus_tag LOCUS_24980 27277 26768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24980 27864 27289 gene locus_tag LOCUS_24990 27864 27289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24990 28262 27861 gene locus_tag LOCUS_25000 28262 27861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25000 29199 28747 gene locus_tag LOCUS_25010 29199 28747 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577652.1 protein_id gnl|my_center|LOCUS_25010 30403 29708 gene locus_tag LOCUS_25020 30403 29708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 30889 31407 gene locus_tag LOCUS_25030 30889 31407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 34934 31641 gene locus_tag LOCUS_25040 34934 31641 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074836736.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25040 35707 34931 gene locus_tag LOCUS_25050 35707 34931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25050 36550 36104 gene locus_tag LOCUS_25060 36550 36104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 37273 36551 gene locus_tag LOCUS_25070 37273 36551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 37409 37771 gene locus_tag LOCUS_25080 37409 37771 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436216.1 protein_id gnl|my_center|LOCUS_25080 38502 38020 gene locus_tag LOCUS_25090 gene rlmH 38502 38020 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 protein_id gnl|my_center|LOCUS_25090 39003 38836 gene locus_tag LOCUS_25100 39003 38836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 40597 39260 gene locus_tag LOCUS_25110 40597 39260 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542646.1 protein_id gnl|my_center|LOCUS_25110 40911 41129 gene locus_tag LOCUS_25120 40911 41129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 41904 41098 gene locus_tag LOCUS_25130 41904 41098 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522833.1 protein_id gnl|my_center|LOCUS_25130 42694 41906 gene locus_tag LOCUS_25140 42694 41906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 44421 42694 gene locus_tag LOCUS_25150 44421 42694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 46250 44418 gene locus_tag LOCUS_25160 gene walK 46250 44418 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968432.1 protein_id gnl|my_center|LOCUS_25160 46996 46247 gene locus_tag LOCUS_25170 gene yycF 46996 46247 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101976.1 protein_id gnl|my_center|LOCUS_25170 48814 47234 gene locus_tag LOCUS_25180 48814 47234 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811628.1 protein_id gnl|my_center|LOCUS_25180 49763 48885 gene locus_tag LOCUS_25190 49763 48885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 51256 49973 gene locus_tag LOCUS_25200 gene purA 51256 49973 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243325.1 protein_id gnl|my_center|LOCUS_25200 52816 51461 gene locus_tag LOCUS_25210 gene dnaB 52816 51461 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286244.1 protein_id gnl|my_center|LOCUS_25210 53279 52836 gene locus_tag LOCUS_25220 gene rplI 53279 52836 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864235.1 protein_id gnl|my_center|LOCUS_25220 55237 53276 gene locus_tag LOCUS_25230 55237 53276 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113900.1 protein_id gnl|my_center|LOCUS_25230 55831 55253 gene locus_tag LOCUS_25240 55831 55253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 56157 55864 gene locus_tag LOCUS_25250 56157 55864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 56788 56321 gene locus_tag LOCUS_25260 56788 56321 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966935.1 protein_id gnl|my_center|LOCUS_25260 57894 56839 gene locus_tag LOCUS_25270 57894 56839 CDS product LytR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227554.1 protein_id gnl|my_center|LOCUS_25270 58108 58458 gene locus_tag LOCUS_25280 58108 58458 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 protein_id gnl|my_center|LOCUS_25280 58811 58539 gene locus_tag LOCUS_25290 gene rpsR 58811 58539 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897044.1 protein_id gnl|my_center|LOCUS_25290 59354 58830 gene locus_tag LOCUS_25300 gene ssb 59354 58830 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981967.1 protein_id gnl|my_center|LOCUS_25300 59674 59390 gene locus_tag LOCUS_25310 gene rpsF 59674 59390 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_25310 60363 59995 gene locus_tag LOCUS_25320 gene hxlR 60363 59995 CDS product transcriptional activator HxlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246265.1 protein_id gnl|my_center|LOCUS_25320 60499 61656 gene locus_tag LOCUS_25330 gene solA 60499 61656 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419095.1 protein_id gnl|my_center|LOCUS_25330 61708 62793 gene locus_tag LOCUS_25340 61708 62793 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 protein_id gnl|my_center|LOCUS_25340 62899 63699 gene locus_tag LOCUS_25350 gene ssuC 62899 63699 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089746.1 protein_id gnl|my_center|LOCUS_25350 63799 64980 gene locus_tag LOCUS_25360 63799 64980 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 protein_id gnl|my_center|LOCUS_25360 65354 65965 gene locus_tag LOCUS_25370 65354 65965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence076 998 99 gene locus_tag LOCUS_25380 gene ssuB 998 99 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102311.1 protein_id gnl|my_center|LOCUS_25380 1761 1030 gene locus_tag LOCUS_25390 gene ssuC 1761 1030 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089746.1 protein_id gnl|my_center|LOCUS_25390 2041 1778 gene locus_tag LOCUS_25400 2041 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25400 2922 1981 gene locus_tag LOCUS_25410 2922 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25410 3941 2925 gene locus_tag LOCUS_25420 3941 2925 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 protein_id gnl|my_center|LOCUS_25420 4125 3934 gene locus_tag LOCUS_25430 4125 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 4487 4122 gene locus_tag LOCUS_25440 4487 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25440 4895 5662 gene locus_tag LOCUS_25450 4895 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 5832 6008 gene locus_tag LOCUS_25460 5832 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 6153 6341 gene locus_tag LOCUS_25470 6153 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 6441 6719 gene locus_tag LOCUS_25480 6441 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25480 6728 7051 gene locus_tag LOCUS_25490 6728 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 7021 7551 gene locus_tag LOCUS_25500 7021 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25500 7503 8054 gene locus_tag LOCUS_25510 7503 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 8485 8096 gene locus_tag LOCUS_25520 8485 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 8742 8482 gene locus_tag LOCUS_25530 8742 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 8823 9260 gene locus_tag LOCUS_25540 8823 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 10306 9524 gene locus_tag LOCUS_25550 10306 9524 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_25550 10575 11144 gene locus_tag LOCUS_25560 10575 11144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25560 11150 11356 gene locus_tag LOCUS_25570 11150 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 11495 12226 gene locus_tag LOCUS_25580 11495 12226 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_25580 12262 13098 gene locus_tag LOCUS_25590 12262 13098 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434154.1 protein_id gnl|my_center|LOCUS_25590 14060 13266 gene locus_tag LOCUS_25600 14060 13266 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_25600 14258 15157 gene locus_tag LOCUS_25610 14258 15157 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398188.1 protein_id gnl|my_center|LOCUS_25610 16139 15186 gene locus_tag LOCUS_25620 gene glsA 16139 15186 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149849.1 protein_id gnl|my_center|LOCUS_25620 16340 17563 gene locus_tag LOCUS_25630 gene nagZ 16340 17563 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_25630 18629 17769 gene locus_tag LOCUS_25640 18629 17769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 18783 18968 gene locus_tag LOCUS_25650 18783 18968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 18896 20275 gene locus_tag LOCUS_25660 18896 20275 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245710.1 protein_id gnl|my_center|LOCUS_25660 20272 21075 gene locus_tag LOCUS_25670 20272 21075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25670 21003 21794 gene locus_tag LOCUS_25680 21003 21794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25680 21822 22838 gene locus_tag LOCUS_25690 21822 22838 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330392.1 protein_id gnl|my_center|LOCUS_25690 23762 22941 gene locus_tag LOCUS_25700 23762 22941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 23886 24203 gene locus_tag LOCUS_25710 23886 24203 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131392.1 protein_id gnl|my_center|LOCUS_25710 24428 25111 gene locus_tag LOCUS_25720 24428 25111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence077 1572 1084 gene locus_tag LOCUS_25730 1572 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2580 1780 gene locus_tag LOCUS_25740 gene degU 2580 1780 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_25740 3230 2577 gene locus_tag LOCUS_25750 3230 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25750 3742 3155 gene locus_tag LOCUS_25760 3742 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 6353 3813 gene locus_tag LOCUS_25770 6353 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 11058 6691 gene locus_tag LOCUS_25780 11058 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 11871 11275 gene locus_tag LOCUS_25790 11871 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 12443 11772 gene locus_tag LOCUS_25800 12443 11772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 13838 12636 gene locus_tag LOCUS_25810 gene metK 13838 12636 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_25810 14293 14024 gene locus_tag LOCUS_25820 14293 14024 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048070.1 protein_id gnl|my_center|LOCUS_25820 14919 14401 gene locus_tag LOCUS_25830 14919 14401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 17323 14999 gene locus_tag LOCUS_25840 17323 14999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 20260 17684 gene locus_tag LOCUS_25850 20260 17684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 24984 20923 gene locus_tag LOCUS_25860 24984 20923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 26267 25131 gene locus_tag LOCUS_25870 26267 25131 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378318.1 protein_id gnl|my_center|LOCUS_25870 27217 26369 gene locus_tag LOCUS_25880 27217 26369 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290748.1 protein_id gnl|my_center|LOCUS_25880 27625 27245 gene locus_tag LOCUS_25890 27625 27245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25890 >Feature sequence078 1149 1469 gene locus_tag LOCUS_25900 1149 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 1755 1510 gene locus_tag LOCUS_25910 1755 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 1940 2101 gene locus_tag LOCUS_25920 1940 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2269 2538 gene locus_tag LOCUS_25930 2269 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 3005 3664 gene locus_tag LOCUS_25940 3005 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 3975 3885 gene locus_tag LOCUS_t00340 3975 3885 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4382 4164 gene locus_tag LOCUS_25950 4382 4164 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728659.1 protein_id gnl|my_center|LOCUS_25950 5275 4424 gene locus_tag LOCUS_25960 5275 4424 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382909.1 protein_id gnl|my_center|LOCUS_25960 5516 5259 gene locus_tag LOCUS_25970 5516 5259 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434250.1 protein_id gnl|my_center|LOCUS_25970 5594 6184 gene locus_tag LOCUS_25980 gene yyaC 5594 6184 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815163.1 protein_id gnl|my_center|LOCUS_25980 6542 6159 gene locus_tag LOCUS_25990 6542 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 7037 6723 gene locus_tag LOCUS_26000 7037 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26000 7891 7034 gene locus_tag LOCUS_26010 7891 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26010 8945 8100 gene locus_tag LOCUS_26020 gene spo0J 8945 8100 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051832.1 protein_id gnl|my_center|LOCUS_26020 9333 8926 gene locus_tag LOCUS_26030 9333 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26030 9698 9330 gene locus_tag LOCUS_26040 9698 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26040 10865 10047 gene locus_tag LOCUS_26050 gene noc 10865 10047 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799016.1 protein_id gnl|my_center|LOCUS_26050 11674 11174 gene locus_tag LOCUS_26060 11674 11174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26060 11894 11772 gene locus_tag LOCUS_26070 11894 11772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 13784 11898 gene locus_tag LOCUS_26080 gene mnmG 13784 11898 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000541039.1 protein_id gnl|my_center|LOCUS_26080 14993 13812 gene locus_tag LOCUS_26090 gene mnmE 14993 13812 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393757.1 protein_id gnl|my_center|LOCUS_26090 15196 14999 gene locus_tag LOCUS_26100 15196 14999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26100 16026 15403 gene locus_tag LOCUS_26110 16026 15403 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393997.1 protein_id gnl|my_center|LOCUS_26110 16751 16023 gene locus_tag LOCUS_26120 gene spoIIIJ 16751 16023 CDS product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886648.1 protein_id gnl|my_center|LOCUS_26120 17285 16938 gene locus_tag LOCUS_26130 gene rnpA 17285 16938 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723727.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence079 2281 122 gene locus_tag LOCUS_26140 2281 122 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964123.1 protein_id gnl|my_center|LOCUS_26140 3606 2503 gene locus_tag LOCUS_26150 3606 2503 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229802.1 protein_id gnl|my_center|LOCUS_26150 4711 3497 gene locus_tag LOCUS_26160 4711 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 5843 4701 gene locus_tag LOCUS_26170 gene mltG 5843 4701 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572132.1 protein_id gnl|my_center|LOCUS_26170 6238 5936 gene locus_tag LOCUS_26180 6238 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 6540 6235 gene locus_tag LOCUS_26190 6540 6235 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017620.1 protein_id gnl|my_center|LOCUS_26190 6965 6549 gene locus_tag LOCUS_26200 gene ruvX 6965 6549 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221197.1 protein_id gnl|my_center|LOCUS_26200 7257 6988 gene locus_tag LOCUS_26210 7257 6988 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 protein_id gnl|my_center|LOCUS_26210 8028 7303 gene locus_tag LOCUS_26220 8028 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26220 9677 7929 gene locus_tag LOCUS_26230 9677 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26230 9934 9710 gene locus_tag LOCUS_26240 9934 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26240 11402 10332 gene locus_tag LOCUS_26250 11402 10332 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967889.1 protein_id gnl|my_center|LOCUS_26250 11751 11554 gene locus_tag LOCUS_26260 11751 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225893.1 protein_id gnl|my_center|LOCUS_26260 12075 11755 gene locus_tag LOCUS_26270 12075 11755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 13477 12026 gene locus_tag LOCUS_26280 13477 12026 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439913.1 protein_id gnl|my_center|LOCUS_26280 13922 13503 gene locus_tag LOCUS_26290 gene cymR 13922 13503 CDS product cysteine metabolism transcriptional regulator CymR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225879.1 protein_id gnl|my_center|LOCUS_26290 14520 15320 gene locus_tag LOCUS_26300 14520 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26300 16728 15454 gene locus_tag LOCUS_26310 16728 15454 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_26310 17882 17019 gene locus_tag LOCUS_26320 17882 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26320 18355 17879 gene locus_tag LOCUS_26330 18355 17879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26330 19682 18927 gene locus_tag LOCUS_26340 19682 18927 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903177.1 protein_id gnl|my_center|LOCUS_26340 21551 19719 gene locus_tag LOCUS_26350 gene aspS 21551 19719 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 protein_id gnl|my_center|LOCUS_26350 22825 21572 gene locus_tag LOCUS_26360 gene hisS 22825 21572 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027084.1 protein_id gnl|my_center|LOCUS_26360 23844 23644 gene locus_tag LOCUS_26370 23844 23644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26370 25156 24230 gene locus_tag LOCUS_26380 25156 24230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26380 25340 25170 gene locus_tag LOCUS_26390 25340 25170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 25892 25449 gene locus_tag LOCUS_26400 25892 25449 CDS product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266965.1 protein_id gnl|my_center|LOCUS_26400 28100 25917 gene locus_tag LOCUS_26410 gene relA 28100 25917 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 protein_id gnl|my_center|LOCUS_26410 28869 28357 gene locus_tag LOCUS_26420 28869 28357 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229745.1 protein_id gnl|my_center|LOCUS_26420 29067 28873 gene locus_tag LOCUS_26430 29067 28873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 31325 29064 gene locus_tag LOCUS_26440 gene recJ 31325 29064 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246110.1 protein_id gnl|my_center|LOCUS_26440 32025 31366 gene locus_tag LOCUS_26450 32025 31366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26450 33257 32319 gene locus_tag LOCUS_26460 33257 32319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26460 34488 33247 gene locus_tag LOCUS_26470 34488 33247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26470 34804 34562 gene locus_tag LOCUS_26480 34804 34562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 35058 36614 gene locus_tag LOCUS_26490 gene spoVB 35058 36614 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198280.1 protein_id gnl|my_center|LOCUS_26490 36838 36611 gene locus_tag LOCUS_26500 36838 36611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 37362 36790 gene locus_tag LOCUS_26510 37362 36790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 37601 37987 gene locus_tag LOCUS_26520 37601 37987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 38102 38953 gene locus_tag LOCUS_26530 38102 38953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 39465 39151 gene locus_tag LOCUS_26540 39465 39151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 40582 39479 gene locus_tag LOCUS_26550 gene tgt 40582 39479 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125365.1 protein_id gnl|my_center|LOCUS_26550 41685 40642 gene locus_tag LOCUS_26560 gene queA 41685 40642 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229723.1 protein_id gnl|my_center|LOCUS_26560 43792 41699 gene locus_tag LOCUS_26570 43792 41699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 44905 43877 gene locus_tag LOCUS_26580 gene ruvB 44905 43877 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344449.1 protein_id gnl|my_center|LOCUS_26580 45398 44925 gene locus_tag LOCUS_26590 45398 44925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26590 46047 45544 gene locus_tag LOCUS_26600 gene ruvC 46047 45544 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_26600 46876 46238 gene locus_tag LOCUS_26610 46876 46238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence080 607 212 gene locus_tag LOCUS_26620 607 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966463.1 protein_id gnl|my_center|LOCUS_26620 826 1851 gene locus_tag LOCUS_26630 826 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 1903 2607 gene locus_tag LOCUS_26640 gene ispD 1903 2607 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_26640 2604 3086 gene locus_tag LOCUS_26650 gene ispF 2604 3086 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225745.1 protein_id gnl|my_center|LOCUS_26650 3131 4597 gene locus_tag LOCUS_26660 gene gltX 3131 4597 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 protein_id gnl|my_center|LOCUS_26660 5141 5797 gene locus_tag LOCUS_26670 gene cysE 5141 5797 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 protein_id gnl|my_center|LOCUS_26670 5799 7244 gene locus_tag LOCUS_26680 gene cysS 5799 7244 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631969.1 protein_id gnl|my_center|LOCUS_26680 7241 8515 gene locus_tag LOCUS_26690 7241 8515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 8518 9081 gene locus_tag LOCUS_26700 8518 9081 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997886.1 protein_id gnl|my_center|LOCUS_26700 9175 9825 gene locus_tag LOCUS_26710 gene sigH 9175 9825 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393956.1 protein_id gnl|my_center|LOCUS_26710 10174 10323 gene locus_tag LOCUS_26720 gene rpmG 10174 10323 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_26720 10338 10547 gene locus_tag LOCUS_26730 10338 10547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 10568 11104 gene locus_tag LOCUS_26740 gene nusG 10568 11104 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_26740 11199 11624 gene locus_tag LOCUS_26750 gene rplK 11199 11624 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085872.1 protein_id gnl|my_center|LOCUS_26750 11755 12447 gene locus_tag LOCUS_26760 gene rplA 11755 12447 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 protein_id gnl|my_center|LOCUS_26760 12694 13191 gene locus_tag LOCUS_26770 gene rplJ 12694 13191 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048716.1 protein_id gnl|my_center|LOCUS_26770 13262 13627 gene locus_tag LOCUS_26780 gene rplL 13262 13627 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966422.1 protein_id gnl|my_center|LOCUS_26780 13810 14334 gene locus_tag LOCUS_26790 13810 14334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26790 14940 18485 gene locus_tag LOCUS_26800 gene rpoB 14940 18485 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 protein_id gnl|my_center|LOCUS_26800 18561 19133 gene locus_tag LOCUS_26810 18561 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26810 19957 19031 gene locus_tag LOCUS_26820 19957 19031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 20314 22185 gene locus_tag LOCUS_26830 20314 22185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26830 22339 22569 gene locus_tag LOCUS_26840 22339 22569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 22718 22927 gene locus_tag LOCUS_26850 22718 22927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26850 22918 23136 gene locus_tag LOCUS_26860 22918 23136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26860 23210 23680 gene locus_tag LOCUS_26870 gene rpsG 23210 23680 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137491.1 protein_id gnl|my_center|LOCUS_26870 23709 25784 gene locus_tag LOCUS_26880 gene fusA 23709 25784 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090364.1 protein_id gnl|my_center|LOCUS_26880 25894 27084 gene locus_tag LOCUS_26890 gene tuf 25894 27084 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723640.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence081 583 215 gene locus_tag LOCUS_26900 583 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 876 1157 gene locus_tag LOCUS_26910 876 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 1157 1522 gene locus_tag LOCUS_26920 1157 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26920 1693 2682 gene locus_tag LOCUS_26930 1693 2682 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232206.1 protein_id gnl|my_center|LOCUS_26930 2702 3037 gene locus_tag LOCUS_26940 2702 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 3263 4669 gene locus_tag LOCUS_26950 3263 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26950 4633 4935 gene locus_tag LOCUS_26960 4633 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 4973 6241 gene locus_tag LOCUS_26970 4973 6241 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_26970 6627 6364 gene locus_tag LOCUS_26980 6627 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 6863 7300 gene locus_tag LOCUS_26990 gene mraZ 6863 7300 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 protein_id gnl|my_center|LOCUS_26990 7331 8293 gene locus_tag LOCUS_27000 gene rsmH 7331 8293 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245724.1 protein_id gnl|my_center|LOCUS_27000 8347 8748 gene locus_tag LOCUS_27010 8347 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 8759 10969 gene locus_tag LOCUS_27020 8759 10969 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_27020 11117 13075 gene locus_tag LOCUS_27030 11117 13075 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 protein_id gnl|my_center|LOCUS_27030 13125 14612 gene locus_tag LOCUS_27040 gene murE 13125 14612 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766313.1 protein_id gnl|my_center|LOCUS_27040 14609 16042 gene locus_tag LOCUS_27050 14609 16042 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 protein_id gnl|my_center|LOCUS_27050 16056 17018 gene locus_tag LOCUS_27060 gene mraY 16056 17018 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_27060 17069 17359 gene locus_tag LOCUS_27070 17069 17359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27070 17323 18507 gene locus_tag LOCUS_27080 gene murD 17323 18507 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27080 18554 19651 gene locus_tag LOCUS_27090 gene spoVE 18554 19651 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_27090 19657 20766 gene locus_tag LOCUS_27100 gene murG 19657 20766 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_27100 20973 21872 gene locus_tag LOCUS_27110 gene murB 20973 21872 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437038.1 protein_id gnl|my_center|LOCUS_27110 21891 22904 gene locus_tag LOCUS_27120 gene murA 21891 22904 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27120 22892 23173 gene locus_tag LOCUS_27130 22892 23173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27130 23247 23996 gene locus_tag LOCUS_27140 23247 23996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 24223 25467 gene locus_tag LOCUS_27150 gene ftsA 24223 25467 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087551.1 protein_id gnl|my_center|LOCUS_27150 25482 26588 gene locus_tag LOCUS_27160 gene ftsZ 25482 26588 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888984.1 protein_id gnl|my_center|LOCUS_27160 26829 27761 gene locus_tag LOCUS_27170 gene spoIIGA 26829 27761 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261975.1 protein_id gnl|my_center|LOCUS_27170 27794 28165 gene locus_tag LOCUS_27180 27794 28165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27180 28165 28515 gene locus_tag LOCUS_27190 28165 28515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27190 28642 29424 gene locus_tag LOCUS_27200 gene sigG 28642 29424 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967190.1 protein_id gnl|my_center|LOCUS_27200 29740 29874 gene locus_tag LOCUS_27210 29740 29874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 29928 30788 gene locus_tag LOCUS_27220 gene pgeF 29928 30788 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209009.1 protein_id gnl|my_center|LOCUS_27220 30797 31513 gene locus_tag LOCUS_27230 30797 31513 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245324.1 protein_id gnl|my_center|LOCUS_27230 31518 31967 gene locus_tag LOCUS_27240 gene sepF 31518 31967 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 protein_id gnl|my_center|LOCUS_27240 31980 32246 gene locus_tag LOCUS_27250 31980 32246 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214233.1 protein_id gnl|my_center|LOCUS_27250 32280 33074 gene locus_tag LOCUS_27260 32280 33074 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002164454.1 protein_id gnl|my_center|LOCUS_27260 33160 33675 gene locus_tag LOCUS_27270 gene divIVA 33160 33675 CDS product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131611.1 protein_id gnl|my_center|LOCUS_27270 33760 33963 gene locus_tag LOCUS_27280 33760 33963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 34152 37256 gene locus_tag LOCUS_27290 gene ileS 34152 37256 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416534.1 protein_id gnl|my_center|LOCUS_27290 37385 37711 gene locus_tag LOCUS_27300 37385 37711 CDS product DUF5665 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392384.1 protein_id gnl|my_center|LOCUS_27300 38526 37801 gene locus_tag LOCUS_27310 38526 37801 CDS product yteA family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229046.1 protein_id gnl|my_center|LOCUS_27310 38679 38867 gene locus_tag LOCUS_27320 38679 38867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 38864 39313 gene locus_tag LOCUS_27330 38864 39313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27330 39288 40232 gene locus_tag LOCUS_27340 39288 40232 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005831.1 protein_id gnl|my_center|LOCUS_27340 40396 41631 gene locus_tag LOCUS_27350 40396 41631 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_27350 41956 42480 gene locus_tag LOCUS_27360 gene pyrR 41956 42480 CDS product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156487.1 protein_id gnl|my_center|LOCUS_27360 42493 43398 gene locus_tag LOCUS_27370 42493 43398 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245123.1 protein_id gnl|my_center|LOCUS_27370 43441 44727 gene locus_tag LOCUS_27380 43441 44727 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245035.1 protein_id gnl|my_center|LOCUS_27380 44760 45914 gene locus_tag LOCUS_27390 44760 45914 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232115.1 protein_id gnl|my_center|LOCUS_27390 45901 49122 gene locus_tag LOCUS_27400 gene carB 45901 49122 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232113.1 protein_id gnl|my_center|LOCUS_27400 49244 49972 gene locus_tag LOCUS_27410 gene pyrF 49244 49972 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_27410 49969 50616 gene locus_tag LOCUS_27420 gene pyrE 49969 50616 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357418.1 protein_id gnl|my_center|LOCUS_27420 50950 51960 gene locus_tag LOCUS_27430 50950 51960 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259152.1 protein_id gnl|my_center|LOCUS_27430 51957 52142 gene locus_tag LOCUS_27440 51957 52142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 52139 52408 gene locus_tag LOCUS_27450 52139 52408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 52294 52755 gene locus_tag LOCUS_27460 52294 52755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27460 52739 53848 gene locus_tag LOCUS_27470 52739 53848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 53958 54902 gene locus_tag LOCUS_27480 53958 54902 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_27480 54902 56014 gene locus_tag LOCUS_27490 54902 56014 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_27490 56203 57192 gene locus_tag LOCUS_27500 56203 57192 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_27500 57223 58170 gene locus_tag LOCUS_27510 57223 58170 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732378.1 protein_id gnl|my_center|LOCUS_27510 58167 59000 gene locus_tag LOCUS_27520 58167 59000 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 protein_id gnl|my_center|LOCUS_27520 60511 60744 gene locus_tag LOCUS_27530 60511 60744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 61149 61808 gene locus_tag LOCUS_27540 61149 61808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_27540 61774 62853 gene locus_tag LOCUS_27550 61774 62853 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815858.1 protein_id gnl|my_center|LOCUS_27550 62857 65769 gene locus_tag LOCUS_27560 62857 65769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 65773 66657 gene locus_tag LOCUS_27570 65773 66657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_27570 66664 68226 gene locus_tag LOCUS_27580 66664 68226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 68867 68355 gene locus_tag LOCUS_27590 68867 68355 CDS product YjcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232861.1 protein_id gnl|my_center|LOCUS_27590 68975 69139 gene locus_tag LOCUS_27600 68975 69139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 69224 69300 gene locus_tag LOCUS_t00350 69224 69300 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 69324 69400 gene locus_tag LOCUS_t00360 69324 69400 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 69561 69649 gene locus_tag LOCUS_t00370 69561 69649 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 70447 70229 gene locus_tag LOCUS_27610 70447 70229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 >Feature sequence082 77 2 gene locus_tag LOCUS_t00380 77 2 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 735 235 gene locus_tag LOCUS_27620 735 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27620 1519 722 gene locus_tag LOCUS_27630 1519 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27630 3082 1538 gene locus_tag LOCUS_27640 3082 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 3973 3113 gene locus_tag LOCUS_27650 3973 3113 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_27650 4878 3967 gene locus_tag LOCUS_27660 gene rmgP 4878 3967 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_27660 6540 5053 gene locus_tag LOCUS_27670 6540 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 7306 6518 gene locus_tag LOCUS_27680 7306 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 8307 7405 gene locus_tag LOCUS_27690 8307 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence083 340 522 gene locus_tag LOCUS_27700 340 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 541 1134 gene locus_tag LOCUS_27710 541 1134 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 protein_id gnl|my_center|LOCUS_27710 1756 1355 gene locus_tag LOCUS_27720 1756 1355 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258310.1 protein_id gnl|my_center|LOCUS_27720 2271 1891 gene locus_tag LOCUS_27730 2271 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27730 2716 2228 gene locus_tag LOCUS_27740 2716 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27740 3069 3308 gene locus_tag LOCUS_27750 3069 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 4255 3512 gene locus_tag LOCUS_27760 4255 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27760 5012 4158 gene locus_tag LOCUS_27770 5012 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27770 >Feature sequence084 422 1948 gene locus_tag LOCUS_27780 gene mazG 422 1948 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226718.1 protein_id gnl|my_center|LOCUS_27780 2199 2471 gene locus_tag LOCUS_27790 2199 2471 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043863.1 protein_id gnl|my_center|LOCUS_27790 2472 2753 gene locus_tag LOCUS_27800 2472 2753 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226716.1 protein_id gnl|my_center|LOCUS_27800 3340 2837 gene locus_tag LOCUS_27810 3340 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 3509 3793 gene locus_tag LOCUS_27820 gene yabP 3509 3793 CDS product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059101.1 protein_id gnl|my_center|LOCUS_27820 3790 4392 gene locus_tag LOCUS_27830 3790 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 4405 4716 gene locus_tag LOCUS_27840 4405 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 4882 5337 gene locus_tag LOCUS_27850 4882 5337 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021452.1 protein_id gnl|my_center|LOCUS_27850 5701 6294 gene locus_tag LOCUS_27860 5701 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27860 6291 7709 gene locus_tag LOCUS_27870 6291 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27870 7643 8194 gene locus_tag LOCUS_27880 7643 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27880 8383 9402 gene locus_tag LOCUS_27890 8383 9402 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977723.1 protein_id gnl|my_center|LOCUS_27890 9522 10250 gene locus_tag LOCUS_27900 9522 10250 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068698953.1 protein_id gnl|my_center|LOCUS_27900 10234 11163 gene locus_tag LOCUS_27910 10234 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 11192 11710 gene locus_tag LOCUS_27920 11192 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27920 11707 12621 gene locus_tag LOCUS_27930 11707 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27930 12703 13242 gene locus_tag LOCUS_27940 12703 13242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 13364 15382 gene locus_tag LOCUS_27950 gene ftsH 13364 15382 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079659.1 protein_id gnl|my_center|LOCUS_27950 >Feature sequence085 1293 415 gene locus_tag LOCUS_27960 1293 415 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690802.1 protein_id gnl|my_center|LOCUS_27960 2461 1313 gene locus_tag LOCUS_27970 gene dgoD 2461 1313 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199088.1 protein_id gnl|my_center|LOCUS_27970 3186 2683 gene locus_tag LOCUS_27980 3186 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 3725 3144 gene locus_tag LOCUS_27990 3725 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 5201 3771 gene locus_tag LOCUS_28000 5201 3771 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822525.1 protein_id gnl|my_center|LOCUS_28000 5896 5198 gene locus_tag LOCUS_28010 gene yycF 5896 5198 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_28010 6956 6102 gene locus_tag LOCUS_28020 6956 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 8620 7337 gene locus_tag LOCUS_28030 8620 7337 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167274874.1 protein_id gnl|my_center|LOCUS_28030 9051 8821 gene locus_tag LOCUS_28040 9051 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 9579 9184 gene locus_tag LOCUS_28050 9579 9184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 11496 9682 gene locus_tag LOCUS_28060 11496 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 13517 11790 gene locus_tag LOCUS_28070 13517 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28070 14112 13405 gene locus_tag LOCUS_28080 14112 13405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28080 15874 14171 gene locus_tag LOCUS_28090 15874 14171 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_28090 16883 15978 gene locus_tag LOCUS_28100 16883 15978 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_28100 <17816 16896 gene locus_tag LOCUS_28110 <17816 16896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582719.1:ABC transporter permease subunit >Feature sequence086 <1 2057 gene locus_tag LOCUS_28120 <1 2057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062695108.1:alpha-L-rhamnosidase C-terminal domain-containing protein 2421 4649 gene locus_tag LOCUS_28130 2421 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 4801 6618 gene locus_tag LOCUS_28140 4801 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 6646 7017 gene locus_tag LOCUS_28150 6646 7017 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887618.1 protein_id gnl|my_center|LOCUS_28150 7021 7638 gene locus_tag LOCUS_28160 7021 7638 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153584.1 protein_id gnl|my_center|LOCUS_28160 7743 8636 gene locus_tag LOCUS_28170 7743 8636 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226059.1 protein_id gnl|my_center|LOCUS_28170 9838 8873 gene locus_tag LOCUS_28180 9838 8873 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_28180 >Feature sequence087 674 315 gene locus_tag LOCUS_28190 674 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28190 1837 671 gene locus_tag LOCUS_28200 1837 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28200 2388 1912 gene locus_tag LOCUS_28210 gene greA 2388 1912 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_28210 3655 2642 gene locus_tag LOCUS_28220 gene dusB 3655 2642 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243741.1 protein_id gnl|my_center|LOCUS_28220 3928 3710 gene locus_tag LOCUS_28230 3928 3710 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387031.1 protein_id gnl|my_center|LOCUS_28230 4482 3880 gene locus_tag LOCUS_28240 gene folK 4482 3880 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059445.1 protein_id gnl|my_center|LOCUS_28240 4840 4454 gene locus_tag LOCUS_28250 gene folB 4840 4454 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242949.1 protein_id gnl|my_center|LOCUS_28250 5112 4879 gene locus_tag LOCUS_28260 5112 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28260 5738 5112 gene locus_tag LOCUS_28270 5738 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28270 6588 5791 gene locus_tag LOCUS_28280 gene pabC 6588 5791 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909893.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28280 7246 6665 gene locus_tag LOCUS_28290 gene pabA 7246 6665 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602293.1 protein_id gnl|my_center|LOCUS_28290 8895 7288 gene locus_tag LOCUS_28300 gene pabB 8895 7288 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189680.1 protein_id gnl|my_center|LOCUS_28300 >Feature sequence088 1084 584 gene locus_tag LOCUS_28310 gene thpR 1084 584 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229239.1 protein_id gnl|my_center|LOCUS_28310 1288 2043 gene locus_tag LOCUS_28320 1288 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28320 1956 2375 gene locus_tag LOCUS_28330 1956 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28330 3176 2460 gene locus_tag LOCUS_28340 gene phoP 3176 2460 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065220.1 protein_id gnl|my_center|LOCUS_28340 3292 3756 gene locus_tag LOCUS_28350 gene trmL 3292 3756 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_28350 3879 4130 gene locus_tag LOCUS_28360 3879 4130 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047831.1 protein_id gnl|my_center|LOCUS_28360 6128 4515 gene locus_tag LOCUS_28370 6128 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 6642 6235 gene locus_tag LOCUS_28380 6642 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28380 7550 6654 gene locus_tag LOCUS_28390 7550 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28390 7903 7547 gene locus_tag LOCUS_28400 7903 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 8105 8986 gene locus_tag LOCUS_28410 8105 8986 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_28410 8986 9819 gene locus_tag LOCUS_28420 8986 9819 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_28420 9921 10379 gene locus_tag LOCUS_28430 9921 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28430 10349 11212 gene locus_tag LOCUS_28440 10349 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28440 11444 12640 gene locus_tag LOCUS_28450 11444 12640 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275469.1 protein_id gnl|my_center|LOCUS_28450 13112 12702 gene locus_tag LOCUS_28460 13112 12702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 13677 13081 gene locus_tag LOCUS_28470 13677 13081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28470 14113 15378 gene locus_tag LOCUS_28480 14113 15378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28480 15327 15749 gene locus_tag LOCUS_28490 15327 15749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28490 15746 16006 gene locus_tag LOCUS_28500 15746 16006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28500 16530 16934 gene locus_tag LOCUS_28510 16530 16934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 17451 17642 gene locus_tag LOCUS_28520 17451 17642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 17620 18018 gene locus_tag LOCUS_28530 17620 18018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 18226 19569 gene locus_tag LOCUS_28540 18226 19569 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947936.1 protein_id gnl|my_center|LOCUS_28540 19720 20733 gene locus_tag LOCUS_28550 19720 20733 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901881.1 protein_id gnl|my_center|LOCUS_28550 21117 20785 gene locus_tag LOCUS_28560 21117 20785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 21594 21202 gene locus_tag LOCUS_28570 21594 21202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28570 22313 21549 gene locus_tag LOCUS_28580 22313 21549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28580 22313 22501 gene locus_tag LOCUS_28590 22313 22501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 22635 22444 gene locus_tag LOCUS_28600 22635 22444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28600 24598 22718 gene locus_tag LOCUS_28610 24598 22718 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928147.1 protein_id gnl|my_center|LOCUS_28610 24981 24793 gene locus_tag LOCUS_28620 24981 24793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28620 25919 24978 gene locus_tag LOCUS_28630 25919 24978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28630 26334 26519 gene locus_tag LOCUS_28640 26334 26519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 26519 27145 gene locus_tag LOCUS_28650 26519 27145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28650 27097 27387 gene locus_tag LOCUS_28660 27097 27387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 27517 29013 gene locus_tag LOCUS_28670 gene nupO 27517 29013 CDS product guanosine ABC transporter ATP-binding protein NupO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228830.1 protein_id gnl|my_center|LOCUS_28670 29010 30080 gene locus_tag LOCUS_28680 29010 30080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_28680 30064 30525 gene locus_tag LOCUS_28690 30064 30525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28690 30432 30986 gene locus_tag LOCUS_28700 30432 30986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28700 31017 31679 gene locus_tag LOCUS_28710 31017 31679 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_28710 31740 32483 gene locus_tag LOCUS_28720 gene udp 31740 32483 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_28720 32535 32975 gene locus_tag LOCUS_28730 32535 32975 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_28730 33073 34986 gene locus_tag LOCUS_28740 33073 34986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 35516 35001 gene locus_tag LOCUS_28750 35516 35001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 35823 36128 gene locus_tag LOCUS_28760 35823 36128 CDS product DUF1805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248463.1 protein_id gnl|my_center|LOCUS_28760 37335 36277 gene locus_tag LOCUS_28770 gene mtnA 37335 36277 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025237.1 protein_id gnl|my_center|LOCUS_28770 37647 38426 gene locus_tag LOCUS_28780 gene sufC 37647 38426 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151872.1 protein_id gnl|my_center|LOCUS_28780 38438 39709 gene locus_tag LOCUS_28790 gene sufD 38438 39709 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152167.1 protein_id gnl|my_center|LOCUS_28790 39750 40976 gene locus_tag LOCUS_28800 gene sufS 39750 40976 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 protein_id gnl|my_center|LOCUS_28800 40963 41391 gene locus_tag LOCUS_28810 gene sufU 40963 41391 CDS product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009523.1 protein_id gnl|my_center|LOCUS_28810 41412 42809 gene locus_tag LOCUS_28820 gene sufB 41412 42809 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228608.1 protein_id gnl|my_center|LOCUS_28820 43158 42919 gene locus_tag LOCUS_28830 43158 42919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 >Feature sequence089 877 104 gene locus_tag LOCUS_28840 gene racE 877 104 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774002.1 protein_id gnl|my_center|LOCUS_28840 2334 1036 gene locus_tag LOCUS_28850 gene melA 2334 1036 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_28850 2492 3340 gene locus_tag LOCUS_28860 2492 3340 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548912.1 protein_id gnl|my_center|LOCUS_28860 3927 3460 gene locus_tag LOCUS_28870 3927 3460 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398549.1 protein_id gnl|my_center|LOCUS_28870 4430 3930 gene locus_tag LOCUS_28880 4430 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 4894 4655 gene locus_tag LOCUS_28890 4894 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 5082 4894 gene locus_tag LOCUS_28900 5082 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 5503 5216 gene locus_tag LOCUS_28910 5503 5216 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943600.1 protein_id gnl|my_center|LOCUS_28910 5744 5905 gene locus_tag LOCUS_28920 5744 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 6350 5967 gene locus_tag LOCUS_28930 6350 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 6916 6524 gene locus_tag LOCUS_28940 6916 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 7394 6963 gene locus_tag LOCUS_28950 7394 6963 CDS product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721755.1 protein_id gnl|my_center|LOCUS_28950 7691 7554 gene locus_tag LOCUS_28960 7691 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 8551 7802 gene locus_tag LOCUS_28970 8551 7802 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 protein_id gnl|my_center|LOCUS_28970 9979 8594 gene locus_tag LOCUS_28980 9979 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 10879 10262 gene locus_tag LOCUS_28990 10879 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28990 11558 10986 gene locus_tag LOCUS_29000 11558 10986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29000 14443 11894 gene locus_tag LOCUS_29010 14443 11894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 16507 14450 gene locus_tag LOCUS_29020 16507 14450 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583939.1 protein_id gnl|my_center|LOCUS_29020 17417 16530 gene locus_tag LOCUS_29030 17417 16530 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_29030 18360 17407 gene locus_tag LOCUS_29040 18360 17407 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_29040 19611 18376 gene locus_tag LOCUS_29050 19611 18376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29050 21236 19599 gene locus_tag LOCUS_29060 21236 19599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29060 22733 21351 gene locus_tag LOCUS_29070 22733 21351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence090 1521 574 gene locus_tag LOCUS_29080 1521 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 1943 1416 gene locus_tag LOCUS_29090 1943 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 2342 1959 gene locus_tag LOCUS_29100 2342 1959 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358356.1 protein_id gnl|my_center|LOCUS_29100 2637 3602 gene locus_tag LOCUS_29110 gene rmgP 2637 3602 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_29110 3619 4509 gene locus_tag LOCUS_29120 3619 4509 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 protein_id gnl|my_center|LOCUS_29120 4614 6143 gene locus_tag LOCUS_29130 4614 6143 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_29130 6234 10157 gene locus_tag LOCUS_29140 6234 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 10145 10879 gene locus_tag LOCUS_29150 10145 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 11023 11253 gene locus_tag LOCUS_29160 11023 11253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 11157 12260 gene locus_tag LOCUS_29170 11157 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence091 137 334 gene locus_tag LOCUS_29180 137 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 566 2548 gene locus_tag LOCUS_29190 566 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 2575 2757 gene locus_tag LOCUS_29200 2575 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 4127 2832 gene locus_tag LOCUS_29210 gene serS 4127 2832 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_29210 4531 6669 gene locus_tag LOCUS_29220 4531 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 7647 6757 gene locus_tag LOCUS_29230 7647 6757 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948557.1 protein_id gnl|my_center|LOCUS_29230 7863 9443 gene locus_tag LOCUS_29240 7863 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 9581 10261 gene locus_tag LOCUS_29250 9581 10261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 10298 10744 gene locus_tag LOCUS_29260 10298 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 10893 11870 gene locus_tag LOCUS_29270 10893 11870 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398762.1 protein_id gnl|my_center|LOCUS_29270 >Feature sequence092 485 258 gene locus_tag LOCUS_29280 485 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901147.1 protein_id gnl|my_center|LOCUS_29280 1209 589 gene locus_tag LOCUS_29290 1209 589 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188542542.1 protein_id gnl|my_center|LOCUS_29290 1475 2104 gene locus_tag LOCUS_29300 gene pdaB 1475 2104 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464710.1 protein_id gnl|my_center|LOCUS_29300 2742 2116 gene locus_tag LOCUS_29310 gene kbaA 2742 2116 CDS product KinB signaling pathway activation protein KbaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088527.1 protein_id gnl|my_center|LOCUS_29310 2904 3203 gene locus_tag LOCUS_29320 2904 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 3203 3613 gene locus_tag LOCUS_29330 3203 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 4114 3635 gene locus_tag LOCUS_29340 4114 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29340 4719 3997 gene locus_tag LOCUS_29350 4719 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29350 5368 4832 gene locus_tag LOCUS_29360 5368 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29360 5604 5380 gene locus_tag LOCUS_29370 5604 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29370 6928 5762 gene locus_tag LOCUS_29380 gene sat 6928 5762 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245745.1 protein_id gnl|my_center|LOCUS_29380 7638 6943 gene locus_tag LOCUS_29390 7638 6943 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830661.1 protein_id gnl|my_center|LOCUS_29390 8203 7676 gene locus_tag LOCUS_29400 8203 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 8658 8302 gene locus_tag LOCUS_29410 gene rplM 8658 8302 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727703.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29410 9652 8897 gene locus_tag LOCUS_29420 gene truA 9652 8897 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_29420 10152 9787 gene locus_tag LOCUS_29430 gene rplQ 10152 9787 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331490.1 protein_id gnl|my_center|LOCUS_29430 11202 10258 gene locus_tag LOCUS_29440 gene rpoA 11202 10258 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_29440 11715 11320 gene locus_tag LOCUS_29450 gene rpsK 11715 11320 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_29450 12004 11735 gene locus_tag LOCUS_29460 12004 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29460 12232 12080 gene locus_tag LOCUS_29470 12232 12080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 12493 12278 gene locus_tag LOCUS_29480 gene infA 12493 12278 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_29480 12777 12496 gene locus_tag LOCUS_29490 12777 12496 CDS product ribosome-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969230.1 protein_id gnl|my_center|LOCUS_29490 13544 12792 gene locus_tag LOCUS_29500 gene map 13544 12792 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_29500 14287 13544 gene locus_tag LOCUS_29510 14287 13544 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048989.1 protein_id gnl|my_center|LOCUS_29510 15679 14378 gene locus_tag LOCUS_29520 gene secY 15679 14378 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490114.1 protein_id gnl|my_center|LOCUS_29520 16119 15679 gene locus_tag LOCUS_29530 gene rplO 16119 15679 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766074.1 protein_id gnl|my_center|LOCUS_29530 16351 16172 gene locus_tag LOCUS_29540 16351 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 16862 16365 gene locus_tag LOCUS_29550 gene rpsE 16862 16365 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_29550 17144 16893 gene locus_tag LOCUS_29560 17144 16893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29560 17851 17309 gene locus_tag LOCUS_29570 gene rplF 17851 17309 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 protein_id gnl|my_center|LOCUS_29570 18282 17884 gene locus_tag LOCUS_29580 gene rpsH 18282 17884 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245511.1 protein_id gnl|my_center|LOCUS_29580 19065 18313 gene locus_tag LOCUS_29590 19065 18313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 19448 19095 gene locus_tag LOCUS_29600 gene rplX 19448 19095 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_29600 19873 19505 gene locus_tag LOCUS_29610 gene rplN 19873 19505 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459101.1 protein_id gnl|my_center|LOCUS_29610 20179 19916 gene locus_tag LOCUS_29620 gene rpsQ 20179 19916 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225804.1 protein_id gnl|my_center|LOCUS_29620 20436 20236 gene locus_tag LOCUS_29630 gene rpmC 20436 20236 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855718.1 protein_id gnl|my_center|LOCUS_29630 20860 20426 gene locus_tag LOCUS_29640 gene rplP 20860 20426 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_29640 21525 20863 gene locus_tag LOCUS_29650 gene rpsC 21525 20863 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 protein_id gnl|my_center|LOCUS_29650 21874 21539 gene locus_tag LOCUS_29660 gene rplV 21874 21539 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148024.1 protein_id gnl|my_center|LOCUS_29660 22117 21920 gene locus_tag LOCUS_29670 22117 21920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29670 22491 22267 gene locus_tag LOCUS_29680 22491 22267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29680 23096 22512 gene locus_tag LOCUS_29690 23096 22512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29690 23417 23115 gene locus_tag LOCUS_29700 gene rplW 23417 23115 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156467.1 protein_id gnl|my_center|LOCUS_29700 24040 23417 gene locus_tag LOCUS_29710 gene rplD 24040 23417 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_29710 24404 24066 gene locus_tag LOCUS_29720 24404 24066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29720 24688 24401 gene locus_tag LOCUS_29730 24688 24401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29730 25054 24746 gene locus_tag LOCUS_29740 gene rpsJ 25054 24746 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_29740 >Feature sequence093 719 63 gene locus_tag LOCUS_29750 719 63 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_29750 1029 3017 gene locus_tag LOCUS_29760 1029 3017 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986153.1 protein_id gnl|my_center|LOCUS_29760 3333 3082 gene locus_tag LOCUS_29770 3333 3082 CDS product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222050.1 protein_id gnl|my_center|LOCUS_29770 3632 3330 gene locus_tag LOCUS_29780 3632 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 3962 3720 gene locus_tag LOCUS_29790 3962 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 5245 4043 gene locus_tag LOCUS_29800 5245 4043 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948973.1 protein_id gnl|my_center|LOCUS_29800 >Feature sequence094 1466 1194 gene locus_tag LOCUS_29810 1466 1194 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_29810 2211 1483 gene locus_tag LOCUS_29820 2211 1483 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_29820 2912 2217 gene locus_tag LOCUS_29830 2912 2217 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990032.1 protein_id gnl|my_center|LOCUS_29830 3968 2976 gene locus_tag LOCUS_29840 3968 2976 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723635.1 protein_id gnl|my_center|LOCUS_29840 5319 4018 gene locus_tag LOCUS_29850 5319 4018 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990033.1 protein_id gnl|my_center|LOCUS_29850 5605 5342 gene locus_tag LOCUS_29860 5605 5342 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723637.1 protein_id gnl|my_center|LOCUS_29860 6072 5635 gene locus_tag LOCUS_29870 6072 5635 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723139.1 protein_id gnl|my_center|LOCUS_29870 8217 6097 gene locus_tag LOCUS_29880 8217 6097 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990035.1 protein_id gnl|my_center|LOCUS_29880 8789 10054 gene locus_tag LOCUS_29890 gene hflX 8789 10054 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393283.1 protein_id gnl|my_center|LOCUS_29890 10691 11533 gene locus_tag LOCUS_29900 gene rsmA 10691 11533 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546868.1 protein_id gnl|my_center|LOCUS_29900 12382 11591 gene locus_tag LOCUS_29910 12382 11591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 13215 12379 gene locus_tag LOCUS_29920 13215 12379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 13962 13255 gene locus_tag LOCUS_29930 13962 13255 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085510.1 protein_id gnl|my_center|LOCUS_29930 14267 13959 gene locus_tag LOCUS_29940 14267 13959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 15608 14430 gene locus_tag LOCUS_29950 15608 14430 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103525.1 protein_id gnl|my_center|LOCUS_29950 16610 15699 gene locus_tag LOCUS_29960 16610 15699 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_29960 17675 16614 gene locus_tag LOCUS_29970 17675 16614 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878388.1 protein_id gnl|my_center|LOCUS_29970 19213 17672 gene locus_tag LOCUS_29980 19213 17672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528956.1 protein_id gnl|my_center|LOCUS_29980 19526 19344 gene locus_tag LOCUS_29990 19526 19344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 >Feature sequence095 420 1052 gene locus_tag LOCUS_30000 420 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 1179 2414 gene locus_tag LOCUS_30010 gene pepT 1179 2414 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806995.1 protein_id gnl|my_center|LOCUS_30010 2518 3444 gene locus_tag LOCUS_30020 2518 3444 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947921.1 protein_id gnl|my_center|LOCUS_30020 3463 4335 gene locus_tag LOCUS_30030 3463 4335 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_30030 4437 5309 gene locus_tag LOCUS_30040 4437 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 6581 5379 gene locus_tag LOCUS_30050 6581 5379 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272496.1 protein_id gnl|my_center|LOCUS_30050 6995 7282 gene locus_tag LOCUS_30060 6995 7282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30060 7225 7440 gene locus_tag LOCUS_30070 7225 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 7534 8073 gene locus_tag LOCUS_30080 7534 8073 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_30080 8110 9072 gene locus_tag LOCUS_30090 8110 9072 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_30090 9298 9447 gene locus_tag LOCUS_30100 9298 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 9559 9798 gene locus_tag LOCUS_30110 9559 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30110 9904 11988 gene locus_tag LOCUS_30120 gene nrdE 9904 11988 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215839.1 protein_id gnl|my_center|LOCUS_30120 12011 12550 gene locus_tag LOCUS_30130 12011 12550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30130 12460 12969 gene locus_tag LOCUS_30140 12460 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30140 13236 13030 gene locus_tag LOCUS_30150 13236 13030 CDS product DUF1657 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215909.1 protein_id gnl|my_center|LOCUS_30150 13645 13983 gene locus_tag LOCUS_30160 13645 13983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30160 14021 14407 gene locus_tag LOCUS_30170 14021 14407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30170 14527 15006 gene locus_tag LOCUS_30180 gene spoVAC 14527 15006 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095399.1 protein_id gnl|my_center|LOCUS_30180 15009 15260 gene locus_tag LOCUS_30190 15009 15260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30190 15305 16021 gene locus_tag LOCUS_30200 15305 16021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30200 16023 16373 gene locus_tag LOCUS_30210 gene spoVAE 16023 16373 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575919.1 protein_id gnl|my_center|LOCUS_30210 >Feature sequence096 1569 145 gene locus_tag LOCUS_30220 gene glnA 1569 145 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125190.1 protein_id gnl|my_center|LOCUS_30220 2891 1827 gene locus_tag LOCUS_30230 gene aroF 2891 1827 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_30230 4009 3059 gene locus_tag LOCUS_30240 gene ispH 4009 3059 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706669.1 protein_id gnl|my_center|LOCUS_30240 5545 4046 gene locus_tag LOCUS_30250 5545 4046 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392644.1 protein_id gnl|my_center|LOCUS_30250 6244 5552 gene locus_tag LOCUS_30260 6244 5552 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392645.1 protein_id gnl|my_center|LOCUS_30260 6705 6370 gene locus_tag LOCUS_30270 6705 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 8018 6672 gene locus_tag LOCUS_30280 8018 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30280 8630 8217 gene locus_tag LOCUS_30290 8630 8217 CDS product YugN-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612334.1 protein_id gnl|my_center|LOCUS_30290 9354 8692 gene locus_tag LOCUS_30300 9354 8692 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564604.1 protein_id gnl|my_center|LOCUS_30300 10104 9364 gene locus_tag LOCUS_30310 10104 9364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30310 11390 10401 gene locus_tag LOCUS_30320 11390 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 12128 11601 gene locus_tag LOCUS_30330 12128 11601 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461816.1 protein_id gnl|my_center|LOCUS_30330 12856 12248 gene locus_tag LOCUS_30340 12856 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 14736 12919 gene locus_tag LOCUS_30350 gene thrS 14736 12919 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786086.1 protein_id gnl|my_center|LOCUS_30350 14855 14673 gene locus_tag LOCUS_30360 14855 14673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 14854 15093 gene locus_tag LOCUS_30370 14854 15093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 15119 15319 gene locus_tag LOCUS_30380 15119 15319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 16119 15217 gene locus_tag LOCUS_30390 16119 15217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 16193 16339 gene locus_tag LOCUS_30400 16193 16339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 17471 16326 gene locus_tag LOCUS_30410 gene mqnC 17471 16326 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_30410 18795 17620 gene locus_tag LOCUS_30420 gene metC 18795 17620 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244787.1 protein_id gnl|my_center|LOCUS_30420 19964 18792 gene locus_tag LOCUS_30430 19964 18792 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817365.1 protein_id gnl|my_center|LOCUS_30430 20330 20025 gene locus_tag LOCUS_30440 20330 20025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30440 20941 20219 gene locus_tag LOCUS_30450 20941 20219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30450 21807 22286 gene locus_tag LOCUS_30460 21807 22286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 22286 22741 gene locus_tag LOCUS_30470 22286 22741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30470 22844 23044 gene locus_tag LOCUS_30480 22844 23044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 >Feature sequence097 1103 60 gene locus_tag LOCUS_30490 1103 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 1339 1163 gene locus_tag LOCUS_30500 1339 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 2247 1438 gene locus_tag LOCUS_30510 2247 1438 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_30510 3560 2268 gene locus_tag LOCUS_30520 3560 2268 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898649.1 protein_id gnl|my_center|LOCUS_30520 4381 3641 gene locus_tag LOCUS_30530 4381 3641 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898651.1 protein_id gnl|my_center|LOCUS_30530 5108 4512 gene locus_tag LOCUS_30540 5108 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30540 5410 5021 gene locus_tag LOCUS_30550 5410 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30550 5625 5449 gene locus_tag LOCUS_30560 5625 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 6209 5622 gene locus_tag LOCUS_30570 6209 5622 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722392.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30570 7475 6378 gene locus_tag LOCUS_30580 7475 6378 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476685.1 protein_id gnl|my_center|LOCUS_30580 8925 8389 gene locus_tag LOCUS_30590 8925 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424637.1 protein_id gnl|my_center|LOCUS_30590 9828 9088 gene locus_tag LOCUS_30600 9828 9088 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903317.1 protein_id gnl|my_center|LOCUS_30600 11109 10321 gene locus_tag LOCUS_30610 11109 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30610 11369 11088 gene locus_tag LOCUS_30620 11369 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 12488 11445 gene locus_tag LOCUS_30630 12488 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30630 13084 12419 gene locus_tag LOCUS_30640 13084 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30640 14043 13159 gene locus_tag LOCUS_30650 14043 13159 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_30650 14583 14059 gene locus_tag LOCUS_30660 14583 14059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30660 14954 14532 gene locus_tag LOCUS_30670 14954 14532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30670 15177 17429 gene locus_tag LOCUS_30680 15177 17429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence098 76 927 gene locus_tag LOCUS_30690 76 927 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932614.1 protein_id gnl|my_center|LOCUS_30690 2387 1308 gene locus_tag LOCUS_30700 2387 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 3501 2500 gene locus_tag LOCUS_30710 3501 2500 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555762.1 protein_id gnl|my_center|LOCUS_30710 3789 4325 gene locus_tag LOCUS_30720 3789 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 4481 5884 gene locus_tag LOCUS_30730 4481 5884 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583943.1 protein_id gnl|my_center|LOCUS_30730 6743 5958 gene locus_tag LOCUS_30740 6743 5958 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989345.1 protein_id gnl|my_center|LOCUS_30740 6882 7958 gene locus_tag LOCUS_30750 6882 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 8079 9584 gene locus_tag LOCUS_30760 8079 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 9581 9760 gene locus_tag LOCUS_30770 9581 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 9782 11530 gene locus_tag LOCUS_30780 gene yesM 9782 11530 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_30780 11523 13154 gene locus_tag LOCUS_30790 11523 13154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 13329 15074 gene locus_tag LOCUS_30800 13329 15074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 15279 16016 gene locus_tag LOCUS_30810 15279 16016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 protein_id gnl|my_center|LOCUS_30810 16033 17043 gene locus_tag LOCUS_30820 gene macA 16033 17043 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706787.1 protein_id gnl|my_center|LOCUS_30820 17092 18477 gene locus_tag LOCUS_30830 17092 18477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 18413 19972 gene locus_tag LOCUS_30840 18413 19972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 19976 20866 gene locus_tag LOCUS_30850 19976 20866 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_30850 21737 20979 gene locus_tag LOCUS_30860 21737 20979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 21739 21921 gene locus_tag LOCUS_30870 21739 21921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 22000 23382 gene locus_tag LOCUS_30880 22000 23382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 23473 26382 gene locus_tag LOCUS_30890 23473 26382 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_30890 26389 27345 gene locus_tag LOCUS_30900 26389 27345 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_30900 27342 28223 gene locus_tag LOCUS_30910 27342 28223 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_30910 28240 29715 gene locus_tag LOCUS_30920 28240 29715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30920 29687 30322 gene locus_tag LOCUS_30930 29687 30322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 30509 32887 gene locus_tag LOCUS_30940 30509 32887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 32884 33798 gene locus_tag LOCUS_30950 32884 33798 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_30950 33817 34806 gene locus_tag LOCUS_30960 33817 34806 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_30960 34944 36260 gene locus_tag LOCUS_30970 34944 36260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 36386 37411 gene locus_tag LOCUS_30980 36386 37411 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583995.1 protein_id gnl|my_center|LOCUS_30980 37415 38935 gene locus_tag LOCUS_30990 37415 38935 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_30990 39037 39846 gene locus_tag LOCUS_31000 39037 39846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31000 39843 40928 gene locus_tag LOCUS_31010 39843 40928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 41124 41564 gene locus_tag LOCUS_31020 41124 41564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 41847 43151 gene locus_tag LOCUS_31030 41847 43151 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713010.1 protein_id gnl|my_center|LOCUS_31030 43120 43977 gene locus_tag LOCUS_31040 43120 43977 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447171.1 protein_id gnl|my_center|LOCUS_31040 44224 43874 gene locus_tag LOCUS_31050 44224 43874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 44939 44454 gene locus_tag LOCUS_31060 44939 44454 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246360.1 protein_id gnl|my_center|LOCUS_31060 45193 46293 gene locus_tag LOCUS_31070 45193 46293 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087740.1 protein_id gnl|my_center|LOCUS_31070 46696 47244 gene locus_tag LOCUS_31080 46696 47244 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103131.1 protein_id gnl|my_center|LOCUS_31080 47228 47761 gene locus_tag LOCUS_31090 47228 47761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 48045 48200 gene locus_tag LOCUS_31100 48045 48200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 48333 48833 gene locus_tag LOCUS_31110 48333 48833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 >Feature sequence099 1501 173 gene locus_tag LOCUS_31120 1501 173 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223881838.1 protein_id gnl|my_center|LOCUS_31120 >Feature sequence100 455 108 gene locus_tag LOCUS_31130 455 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31130 1351 377 gene locus_tag LOCUS_31140 1351 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31140 1891 1505 gene locus_tag LOCUS_31150 1891 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 2433 2612 gene locus_tag LOCUS_31160 2433 2612 CDS product H-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025739.1 protein_id gnl|my_center|LOCUS_31160 2644 2805 gene locus_tag LOCUS_31170 2644 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 3264 2926 gene locus_tag LOCUS_31180 3264 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31180 4154 3261 gene locus_tag LOCUS_31190 4154 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31190 5334 4216 gene locus_tag LOCUS_31200 5334 4216 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533013.1 protein_id gnl|my_center|LOCUS_31200 5618 5965 gene locus_tag LOCUS_31210 5618 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 7564 5960 gene locus_tag LOCUS_31220 7564 5960 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721321.1 protein_id gnl|my_center|LOCUS_31220 8584 7568 gene locus_tag LOCUS_31230 8584 7568 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245533.1 protein_id gnl|my_center|LOCUS_31230 8771 10063 gene locus_tag LOCUS_31240 8771 10063 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_31240 10835 10182 gene locus_tag LOCUS_31250 10835 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 12502 10832 gene locus_tag LOCUS_31260 12502 10832 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099178.1 protein_id gnl|my_center|LOCUS_31260 12681 12493 gene locus_tag LOCUS_31270 12681 12493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31270 13688 12690 gene locus_tag LOCUS_31280 13688 12690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31280 14288 13812 gene locus_tag LOCUS_31290 14288 13812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803992.1 protein_id gnl|my_center|LOCUS_31290 15613 14312 gene locus_tag LOCUS_31300 15613 14312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244912.1 protein_id gnl|my_center|LOCUS_31300 16004 15606 gene locus_tag LOCUS_31310 16004 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31310 16507 15998 gene locus_tag LOCUS_31320 16507 15998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31320 17437 16592 gene locus_tag LOCUS_31330 17437 16592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392678.1 protein_id gnl|my_center|LOCUS_31330 17913 17464 gene locus_tag LOCUS_31340 17913 17464 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392679.1 protein_id gnl|my_center|LOCUS_31340 18620 17943 gene locus_tag LOCUS_31350 18620 17943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 20322 19861 gene locus_tag LOCUS_31360 20322 19861 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538766.1 protein_id gnl|my_center|LOCUS_31360 20660 20358 gene locus_tag LOCUS_31370 20660 20358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31370 21256 20549 gene locus_tag LOCUS_31380 21256 20549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31380 21673 21335 gene locus_tag LOCUS_31390 21673 21335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 22297 21677 gene locus_tag LOCUS_31400 gene ctaE 22297 21677 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557860.1 protein_id gnl|my_center|LOCUS_31400 24081 22294 gene locus_tag LOCUS_31410 gene ctaD 24081 22294 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 protein_id gnl|my_center|LOCUS_31410 25053 24193 gene locus_tag LOCUS_31420 gene coxB 25053 24193 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745271.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31420 25235 25026 gene locus_tag LOCUS_31430 25235 25026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 25593 26531 gene locus_tag LOCUS_31440 25593 26531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 27619 26660 gene locus_tag LOCUS_31450 27619 26660 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584156.1 protein_id gnl|my_center|LOCUS_31450 27700 27873 gene locus_tag LOCUS_31460 27700 27873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 27864 28133 gene locus_tag LOCUS_31470 27864 28133 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966217.1 protein_id gnl|my_center|LOCUS_31470 28867 29127 gene locus_tag LOCUS_31480 28867 29127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 30075 29293 gene locus_tag LOCUS_31490 30075 29293 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803873.1 protein_id gnl|my_center|LOCUS_31490 31208 30273 gene locus_tag LOCUS_31500 gene ppaC 31208 30273 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416849.1 protein_id gnl|my_center|LOCUS_31500 31840 31301 gene locus_tag LOCUS_31510 31840 31301 CDS product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232389.1 protein_id gnl|my_center|LOCUS_31510 >Feature sequence101 977 2125 gene locus_tag LOCUS_31520 977 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31520 2170 3468 gene locus_tag LOCUS_31530 2170 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31530 3497 4870 gene locus_tag LOCUS_31540 gene folC 3497 4870 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582053.1 protein_id gnl|my_center|LOCUS_31540 4877 5593 gene locus_tag LOCUS_31550 4877 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31550 5590 6276 gene locus_tag LOCUS_31560 5590 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31560 6433 7980 gene locus_tag LOCUS_31570 6433 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 8109 8279 gene locus_tag LOCUS_31580 8109 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 8258 8953 gene locus_tag LOCUS_31590 8258 8953 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_31590 9034 9723 gene locus_tag LOCUS_31600 gene radC 9034 9723 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 protein_id gnl|my_center|LOCUS_31600 9766 10800 gene locus_tag LOCUS_31610 gene mreB 9766 10800 CDS product cell shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466737.1 protein_id gnl|my_center|LOCUS_31610 10834 11718 gene locus_tag LOCUS_31620 gene mreC 10834 11718 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135485.1 protein_id gnl|my_center|LOCUS_31620 11715 12239 gene locus_tag LOCUS_31630 11715 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 12303 12962 gene locus_tag LOCUS_31640 gene minC 12303 12962 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398901.1 protein_id gnl|my_center|LOCUS_31640 12966 13757 gene locus_tag LOCUS_31650 gene minD 12966 13757 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398624.1 protein_id gnl|my_center|LOCUS_31650 13923 14912 gene locus_tag LOCUS_31660 gene rodA 13923 14912 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_31660 14999 15961 gene locus_tag LOCUS_31670 14999 15961 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271954.1 protein_id gnl|my_center|LOCUS_31670 16167 17135 gene locus_tag LOCUS_31680 16167 17135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 17128 18024 gene locus_tag LOCUS_31690 gene spoIVFB 17128 18024 CDS product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599058.1 protein_id gnl|my_center|LOCUS_31690 18314 19240 gene locus_tag LOCUS_31700 18314 19240 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_31700 19588 22104 gene locus_tag LOCUS_31710 19588 22104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 22101 22976 gene locus_tag LOCUS_31720 22101 22976 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582429.1 protein_id gnl|my_center|LOCUS_31720 23676 24668 gene locus_tag LOCUS_31730 23676 24668 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379233.1 protein_id gnl|my_center|LOCUS_31730 24708 24863 gene locus_tag LOCUS_31740 24708 24863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31740 24860 25759 gene locus_tag LOCUS_31750 24860 25759 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078295.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31750 25961 26272 gene locus_tag LOCUS_31760 gene rplU 25961 26272 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_31760 26283 26621 gene locus_tag LOCUS_31770 26283 26621 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229669.1 protein_id gnl|my_center|LOCUS_31770 26637 26897 gene locus_tag LOCUS_31780 gene rpmA 26637 26897 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_31780 27137 27874 gene locus_tag LOCUS_31790 27137 27874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 27919 29247 gene locus_tag LOCUS_31800 gene obgE 27919 29247 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_31800 29418 29855 gene locus_tag LOCUS_31810 29418 29855 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_31810 29881 31167 gene locus_tag LOCUS_31820 29881 31167 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228694.1 protein_id gnl|my_center|LOCUS_31820 31228 32295 gene locus_tag LOCUS_31830 gene thrC 31228 32295 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392819.1 protein_id gnl|my_center|LOCUS_31830 32295 33269 gene locus_tag LOCUS_31840 gene thrB 32295 33269 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_31840 33266 34132 gene locus_tag LOCUS_31850 gene pheA 33266 34132 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621730.1 protein_id gnl|my_center|LOCUS_31850 34179 35057 gene locus_tag LOCUS_31860 gene ilvE 34179 35057 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005489.1 protein_id gnl|my_center|LOCUS_31860 >Feature sequence102 1105 89 gene locus_tag LOCUS_31870 1105 89 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594045.1 protein_id gnl|my_center|LOCUS_31870 1826 1107 gene locus_tag LOCUS_31880 1826 1107 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687920.1 protein_id gnl|my_center|LOCUS_31880 2543 2013 gene locus_tag LOCUS_31890 2543 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 2836 2534 gene locus_tag LOCUS_31900 2836 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 3226 3630 gene locus_tag LOCUS_31910 3226 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31910 3798 4349 gene locus_tag LOCUS_31920 3798 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 4349 4780 gene locus_tag LOCUS_31930 4349 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31930 5347 6858 gene locus_tag LOCUS_31940 5347 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 6836 8347 gene locus_tag LOCUS_31950 6836 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 8477 9751 gene locus_tag LOCUS_31960 8477 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 9821 10033 gene locus_tag LOCUS_31970 9821 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 10445 10711 gene locus_tag LOCUS_31980 10445 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31980 10708 11535 gene locus_tag LOCUS_31990 10708 11535 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966931.1 protein_id gnl|my_center|LOCUS_31990 12526 11597 gene locus_tag LOCUS_32000 12526 11597 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760047.1 protein_id gnl|my_center|LOCUS_32000 12774 12523 gene locus_tag LOCUS_32010 12774 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32010 13655 12705 gene locus_tag LOCUS_32020 13655 12705 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925219.1 protein_id gnl|my_center|LOCUS_32020 14139 13738 gene locus_tag LOCUS_32030 14139 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32030 14762 14124 gene locus_tag LOCUS_32040 14762 14124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32040 15611 14823 gene locus_tag LOCUS_32050 15611 14823 CDS product IucA/IucC family C-terminal-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267803.1 protein_id gnl|my_center|LOCUS_32050 17476 15644 gene locus_tag LOCUS_32060 17476 15644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 17770 18855 gene locus_tag LOCUS_32070 17770 18855 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276931.1 protein_id gnl|my_center|LOCUS_32070 19320 18910 gene locus_tag LOCUS_32080 19320 18910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 19387 19608 gene locus_tag LOCUS_32090 19387 19608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 20791 19586 gene locus_tag LOCUS_32100 20791 19586 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727463.1 protein_id gnl|my_center|LOCUS_32100 21776 20901 gene locus_tag LOCUS_32110 21776 20901 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886451.1 protein_id gnl|my_center|LOCUS_32110 22135 21857 gene locus_tag LOCUS_32120 22135 21857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32120 22581 22021 gene locus_tag LOCUS_32130 22581 22021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32130 23796 22597 gene locus_tag LOCUS_32140 gene ssuD 23796 22597 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422255.1 protein_id gnl|my_center|LOCUS_32140 24160 23966 gene locus_tag LOCUS_32150 24160 23966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 24842 24189 gene locus_tag LOCUS_32160 24842 24189 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970601.1 protein_id gnl|my_center|LOCUS_32160 25111 24917 gene locus_tag LOCUS_32170 25111 24917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 26203 25478 gene locus_tag LOCUS_32180 26203 25478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32180 26544 26182 gene locus_tag LOCUS_32190 26544 26182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32190 26704 27252 gene locus_tag LOCUS_32200 26704 27252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 27375 28391 gene locus_tag LOCUS_32210 27375 28391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 28609 28989 gene locus_tag LOCUS_32220 28609 28989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32220 28974 29159 gene locus_tag LOCUS_32230 28974 29159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 29354 29779 gene locus_tag LOCUS_32240 29354 29779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 30675 30361 gene locus_tag LOCUS_32250 30675 30361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 31361 30606 gene locus_tag LOCUS_32260 31361 30606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32260 32019 31756 gene locus_tag LOCUS_32270 32019 31756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 32226 33011 gene locus_tag LOCUS_32280 32226 33011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 33104 34051 gene locus_tag LOCUS_32290 33104 34051 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086540.1 protein_id gnl|my_center|LOCUS_32290 34471 34824 gene locus_tag LOCUS_32300 34471 34824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32300 34821 35543 gene locus_tag LOCUS_32310 34821 35543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32310 35848 36030 gene locus_tag LOCUS_32320 35848 36030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32320 36167 36850 gene locus_tag LOCUS_32330 36167 36850 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126322.1 protein_id gnl|my_center|LOCUS_32330 37014 36939 gene locus_tag LOCUS_t00390 37014 36939 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 38506 37166 gene locus_tag LOCUS_32340 38506 37166 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_32340 38774 38699 gene locus_tag LOCUS_t00400 38774 38699 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 39506 39018 gene locus_tag LOCUS_32350 gene nrdR 39506 39018 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_32350 39637 39855 gene locus_tag LOCUS_32360 gene sasP 39637 39855 CDS product small acid-soluble spore protein, SasP family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013338.1 protein_id gnl|my_center|LOCUS_32360 40446 39937 gene locus_tag LOCUS_32370 40446 39937 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964415.1 protein_id gnl|my_center|LOCUS_32370 40819 40502 gene locus_tag LOCUS_32380 40819 40502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32380 41118 40816 gene locus_tag LOCUS_32390 41118 40816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32390 41834 41136 gene locus_tag LOCUS_32400 gene ytaF 41834 41136 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229449.1 protein_id gnl|my_center|LOCUS_32400 42820 41951 gene locus_tag LOCUS_32410 gene mutM 42820 41951 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246122.1 protein_id gnl|my_center|LOCUS_32410 45633 42964 gene locus_tag LOCUS_32420 gene polA 45633 42964 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_32420 45824 46897 gene locus_tag LOCUS_32430 45824 46897 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243652.1 protein_id gnl|my_center|LOCUS_32430 47468 47115 gene locus_tag LOCUS_32440 47468 47115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 48242 47580 gene locus_tag LOCUS_32450 gene phoU 48242 47580 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_32450 49026 48271 gene locus_tag LOCUS_32460 gene pstB 49026 48271 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536449.1 protein_id gnl|my_center|LOCUS_32460 49926 49051 gene locus_tag LOCUS_32470 gene pstA 49926 49051 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831209.1 protein_id gnl|my_center|LOCUS_32470 50886 49930 gene locus_tag LOCUS_32480 gene pstC 50886 49930 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_32480 51976 50996 gene locus_tag LOCUS_32490 51976 50996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 52415 52116 gene locus_tag LOCUS_32500 52415 52116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 53314 52415 gene locus_tag LOCUS_32510 53314 52415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32510 54627 53569 gene locus_tag LOCUS_32520 54627 53569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 55040 54717 gene locus_tag LOCUS_32530 55040 54717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32530 55561 55037 gene locus_tag LOCUS_32540 55561 55037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32540 56475 55579 gene locus_tag LOCUS_32550 56475 55579 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_32550 57893 56547 gene locus_tag LOCUS_32560 57893 56547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 59278 58346 gene locus_tag LOCUS_32570 59278 58346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 59976 59272 gene locus_tag LOCUS_32580 59976 59272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 61778 59973 gene locus_tag LOCUS_32590 61778 59973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 62965 62081 gene locus_tag LOCUS_32600 62965 62081 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803678.1 protein_id gnl|my_center|LOCUS_32600 63924 63145 gene locus_tag LOCUS_32610 63924 63145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 65336 64080 gene locus_tag LOCUS_32620 65336 64080 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110815093.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32620 65584 65285 gene locus_tag LOCUS_32630 65584 65285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32630 65927 65724 gene locus_tag LOCUS_32640 65927 65724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32640 66607 65912 gene locus_tag LOCUS_32650 66607 65912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 67596 66667 gene locus_tag LOCUS_32660 67596 66667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 68571 67750 gene locus_tag LOCUS_32670 68571 67750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 69905 68661 gene locus_tag LOCUS_32680 gene egsA 69905 68661 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229504.1 protein_id gnl|my_center|LOCUS_32680 71096 70074 gene locus_tag LOCUS_32690 71096 70074 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723624.1 protein_id gnl|my_center|LOCUS_32690 72395 71262 gene locus_tag LOCUS_32700 72395 71262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 75124 72293 gene locus_tag LOCUS_32710 75124 72293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 76905 75427 gene locus_tag LOCUS_32720 76905 75427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence103 486 1733 gene locus_tag LOCUS_32730 486 1733 CDS product TIGR02677 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459214.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32730 1735 2943 gene locus_tag LOCUS_32740 1735 2943 CDS product TIGR02678 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206095830.1 protein_id gnl|my_center|LOCUS_32740 2961 7196 gene locus_tag LOCUS_32750 2961 7196 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459216.1 protein_id gnl|my_center|LOCUS_32750 7286 9100 gene locus_tag LOCUS_32760 7286 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence104 307 507 gene locus_tag LOCUS_32770 307 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 491 880 gene locus_tag LOCUS_32780 491 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 936 1085 gene locus_tag LOCUS_32790 936 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 2013 1219 gene locus_tag LOCUS_32800 2013 1219 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_32800 2537 2238 gene locus_tag LOCUS_32810 2537 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32810 3804 3352 gene locus_tag LOCUS_32820 3804 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 3979 4302 gene locus_tag LOCUS_32830 gene aseR 3979 4302 CDS product metal-responsive transcriptional regulator AseR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243257.1 protein_id gnl|my_center|LOCUS_32830 4319 5374 gene locus_tag LOCUS_32840 gene acr3 4319 5374 CDS product arsenite efflux transporter Acr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398718.1 protein_id gnl|my_center|LOCUS_32840 5395 5823 gene locus_tag LOCUS_32850 5395 5823 CDS product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 protein_id gnl|my_center|LOCUS_32850 7030 6260 gene locus_tag LOCUS_32860 7030 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 7852 7553 gene locus_tag LOCUS_32870 7852 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 9092 7845 gene locus_tag LOCUS_32880 9092 7845 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886562.1 protein_id gnl|my_center|LOCUS_32880 9465 9247 gene locus_tag LOCUS_32890 9465 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 10491 9562 gene locus_tag LOCUS_32900 10491 9562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 10872 10495 gene locus_tag LOCUS_32910 10872 10495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 11373 11098 gene locus_tag LOCUS_32920 11373 11098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 12139 13176 gene locus_tag LOCUS_32930 12139 13176 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256331.1 protein_id gnl|my_center|LOCUS_32930 13267 13566 gene locus_tag LOCUS_32940 13267 13566 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655666.1 protein_id gnl|my_center|LOCUS_32940 13556 14341 gene locus_tag LOCUS_32950 13556 14341 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057157.1 protein_id gnl|my_center|LOCUS_32950 14338 15129 gene locus_tag LOCUS_32960 14338 15129 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256330.1 protein_id gnl|my_center|LOCUS_32960 15126 16106 gene locus_tag LOCUS_32970 15126 16106 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871102.1 protein_id gnl|my_center|LOCUS_32970 17630 16698 gene locus_tag LOCUS_32980 17630 16698 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_32980 17880 18473 gene locus_tag LOCUS_32990 gene rsmD 17880 18473 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_32990 18460 18966 gene locus_tag LOCUS_33000 gene coaD 18460 18966 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245283.1 protein_id gnl|my_center|LOCUS_33000 19658 19053 gene locus_tag LOCUS_33010 19658 19053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 20284 19598 gene locus_tag LOCUS_33020 20284 19598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33020 >Feature sequence105 2452 1604 gene locus_tag LOCUS_33030 2452 1604 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_33030 3263 2577 gene locus_tag LOCUS_33040 3263 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33040 3540 3295 gene locus_tag LOCUS_33050 3540 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 4365 3568 gene locus_tag LOCUS_33060 4365 3568 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612349.1 protein_id gnl|my_center|LOCUS_33060 5479 4382 gene locus_tag LOCUS_33070 5479 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 6009 5509 gene locus_tag LOCUS_33080 6009 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 6879 6118 gene locus_tag LOCUS_33090 6879 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 7697 6912 gene locus_tag LOCUS_33100 7697 6912 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 protein_id gnl|my_center|LOCUS_33100 8502 7729 gene locus_tag LOCUS_33110 8502 7729 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893953.1 protein_id gnl|my_center|LOCUS_33110 9600 8518 gene locus_tag LOCUS_33120 9600 8518 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922070.1 protein_id gnl|my_center|LOCUS_33120 10572 9604 gene locus_tag LOCUS_33130 10572 9604 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989852.1 protein_id gnl|my_center|LOCUS_33130 11305 10589 gene locus_tag LOCUS_33140 11305 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33140 11874 11254 gene locus_tag LOCUS_33150 11874 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33150 12774 11914 gene locus_tag LOCUS_33160 gene yhfZ 12774 11914 CDS product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674092.1 protein_id gnl|my_center|LOCUS_33160 14895 12862 gene locus_tag LOCUS_33170 14895 12862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 15886 14876 gene locus_tag LOCUS_33180 15886 14876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 16568 16104 gene locus_tag LOCUS_33190 16568 16104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33190 18206 16989 gene locus_tag LOCUS_33200 18206 16989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 19318 18203 gene locus_tag LOCUS_33210 19318 18203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 19741 19334 gene locus_tag LOCUS_33220 19741 19334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 20658 19738 gene locus_tag LOCUS_33230 20658 19738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 21030 20662 gene locus_tag LOCUS_33240 21030 20662 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459856.1 protein_id gnl|my_center|LOCUS_33240 >Feature sequence106 893 189 gene locus_tag LOCUS_33250 893 189 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245964.1 protein_id gnl|my_center|LOCUS_33250 1433 1056 gene locus_tag LOCUS_33260 1433 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 2371 1595 gene locus_tag LOCUS_33270 2371 1595 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243335.1 protein_id gnl|my_center|LOCUS_33270 3291 2368 gene locus_tag LOCUS_33280 3291 2368 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244494.1 protein_id gnl|my_center|LOCUS_33280 3506 3288 gene locus_tag LOCUS_33290 3506 3288 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227293.1 protein_id gnl|my_center|LOCUS_33290 3735 3523 gene locus_tag LOCUS_33300 gene yxlD 3735 3523 CDS product sigma Y negative regulator YxlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242917.1 protein_id gnl|my_center|LOCUS_33300 4049 3720 gene locus_tag LOCUS_33310 4049 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 4569 4042 gene locus_tag LOCUS_33320 gene sigY 4569 4042 CDS product RNA polymerase sigma factor SigY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243678.1 protein_id gnl|my_center|LOCUS_33320 5980 4748 gene locus_tag LOCUS_33330 5980 4748 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_33330 5931 6119 gene locus_tag LOCUS_33340 5931 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 6190 7689 gene locus_tag LOCUS_33350 6190 7689 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802296.1 protein_id gnl|my_center|LOCUS_33350 7686 7814 gene locus_tag LOCUS_33360 7686 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 7826 8383 gene locus_tag LOCUS_33370 7826 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 8380 8844 gene locus_tag LOCUS_33380 8380 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 8969 9451 gene locus_tag LOCUS_33390 8969 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 9352 9861 gene locus_tag LOCUS_33400 9352 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 10686 10201 gene locus_tag LOCUS_33410 10686 10201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 11141 10716 gene locus_tag LOCUS_33420 11141 10716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 11284 11138 gene locus_tag LOCUS_33430 11284 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 11467 11318 gene locus_tag LOCUS_33440 11467 11318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 12346 11507 gene locus_tag LOCUS_33450 12346 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 13347 12274 gene locus_tag LOCUS_33460 13347 12274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 14741 13344 gene locus_tag LOCUS_33470 14741 13344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 15226 14738 gene locus_tag LOCUS_33480 15226 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 15576 15121 gene locus_tag LOCUS_33490 15576 15121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 16283 15573 gene locus_tag LOCUS_33500 16283 15573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 16652 18013 gene locus_tag LOCUS_33510 gene ktrD 16652 18013 CDS product Ktr system potassium transporter KtrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244672.1 protein_id gnl|my_center|LOCUS_33510 18385 18113 gene locus_tag LOCUS_33520 gene ndoA 18385 18113 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_33520 18748 18467 gene locus_tag LOCUS_33530 18748 18467 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393653.1 protein_id gnl|my_center|LOCUS_33530 20134 18950 gene locus_tag LOCUS_33540 gene alr 20134 18950 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_33540 21516 20266 gene locus_tag LOCUS_33550 21516 20266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 23408 21795 gene locus_tag LOCUS_33560 23408 21795 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140636.1 protein_id gnl|my_center|LOCUS_33560 23696 24997 gene locus_tag LOCUS_33570 23696 24997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 25473 25045 gene locus_tag LOCUS_33580 25473 25045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 26111 25545 gene locus_tag LOCUS_33590 26111 25545 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272276.1 protein_id gnl|my_center|LOCUS_33590 27117 26242 gene locus_tag LOCUS_33600 27117 26242 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548147.1 protein_id gnl|my_center|LOCUS_33600 27344 28129 gene locus_tag LOCUS_33610 27344 28129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33610 28078 28590 gene locus_tag LOCUS_33620 28078 28590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33620 28590 29849 gene locus_tag LOCUS_33630 28590 29849 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528574.1 protein_id gnl|my_center|LOCUS_33630 29854 30243 gene locus_tag LOCUS_33640 29854 30243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33640 30168 30722 gene locus_tag LOCUS_33650 30168 30722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33650 30737 31555 gene locus_tag LOCUS_33660 30737 31555 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_33660 32927 31656 gene locus_tag LOCUS_33670 32927 31656 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410209.1 protein_id gnl|my_center|LOCUS_33670 33799 33212 gene locus_tag LOCUS_33680 33799 33212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 36243 33946 gene locus_tag LOCUS_33690 36243 33946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 37243 36404 gene locus_tag LOCUS_33700 37243 36404 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975929.1 protein_id gnl|my_center|LOCUS_33700 38148 37246 gene locus_tag LOCUS_33710 38148 37246 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067530.1 protein_id gnl|my_center|LOCUS_33710 39599 38208 gene locus_tag LOCUS_33720 39599 38208 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582770.1 protein_id gnl|my_center|LOCUS_33720 41054 39741 gene locus_tag LOCUS_33730 41054 39741 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161410139.1 protein_id gnl|my_center|LOCUS_33730 42306 41059 gene locus_tag LOCUS_33740 42306 41059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 42878 42225 gene locus_tag LOCUS_33750 42878 42225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 43555 42893 gene locus_tag LOCUS_33760 43555 42893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 43860 43552 gene locus_tag LOCUS_33770 43860 43552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 45095 44262 gene locus_tag LOCUS_33780 45095 44262 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_33780 46014 45193 gene locus_tag LOCUS_33790 46014 45193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 46147 46917 gene locus_tag LOCUS_33800 46147 46917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 <48070 47022 gene locus_tag LOCUS_33810 <48070 47022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918210.1:GTP-binding protein >Feature sequence107 312 452 gene locus_tag LOCUS_33820 312 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 723 514 gene locus_tag LOCUS_33830 723 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33830 1595 717 gene locus_tag LOCUS_33840 gene xerS 1595 717 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836963.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33840 1972 3216 gene locus_tag LOCUS_33850 1972 3216 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058331.1 protein_id gnl|my_center|LOCUS_33850 3362 4483 gene locus_tag LOCUS_33860 3362 4483 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906005.1 protein_id gnl|my_center|LOCUS_33860 4872 6065 gene locus_tag LOCUS_33870 4872 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 6017 6298 gene locus_tag LOCUS_33880 6017 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 6388 9306 gene locus_tag LOCUS_33890 6388 9306 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_33890 9358 10206 gene locus_tag LOCUS_33900 9358 10206 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_33900 10208 11074 gene locus_tag LOCUS_33910 10208 11074 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_33910 11089 13146 gene locus_tag LOCUS_33920 11089 13146 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583939.1 protein_id gnl|my_center|LOCUS_33920 13186 15816 gene locus_tag LOCUS_33930 13186 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 15813 16700 gene locus_tag LOCUS_33940 15813 16700 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_33940 16719 17672 gene locus_tag LOCUS_33950 16719 17672 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_33950 17724 18764 gene locus_tag LOCUS_33960 17724 18764 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679442.1 protein_id gnl|my_center|LOCUS_33960 18934 19440 gene locus_tag LOCUS_33970 18934 19440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 20177 19503 gene locus_tag LOCUS_33980 gene cdaS 20177 19503 CDS product sporulation-specific diadenylate cyclase CdaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545252.1 protein_id gnl|my_center|LOCUS_33980 20347 21342 gene locus_tag LOCUS_33990 20347 21342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 21339 22001 gene locus_tag LOCUS_34000 21339 22001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34000 21998 23065 gene locus_tag LOCUS_34010 21998 23065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34010 23092 23832 gene locus_tag LOCUS_34020 23092 23832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34020 23790 24281 gene locus_tag LOCUS_34030 23790 24281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34030 24368 25219 gene locus_tag LOCUS_34040 24368 25219 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_34040 25238 26062 gene locus_tag LOCUS_34050 25238 26062 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972816.1 protein_id gnl|my_center|LOCUS_34050 26534 26163 gene locus_tag LOCUS_34060 26534 26163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 27257 27967 gene locus_tag LOCUS_34070 27257 27967 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532950.1 protein_id gnl|my_center|LOCUS_34070 >Feature sequence108 354 1220 gene locus_tag LOCUS_34080 gene ctaA 354 1220 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188730.1 protein_id gnl|my_center|LOCUS_34080 1262 1612 gene locus_tag LOCUS_34090 1262 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 1609 1968 gene locus_tag LOCUS_34100 1609 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 2019 2795 gene locus_tag LOCUS_34110 2019 2795 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398521.1 protein_id gnl|my_center|LOCUS_34110 3128 2883 gene locus_tag LOCUS_34120 3128 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 3209 3481 gene locus_tag LOCUS_34130 3209 3481 CDS product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595027.1 protein_id gnl|my_center|LOCUS_34130 4565 3414 gene locus_tag LOCUS_34140 4565 3414 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242518.1 protein_id gnl|my_center|LOCUS_34140 5119 4628 gene locus_tag LOCUS_34150 5119 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34150 5730 5017 gene locus_tag LOCUS_34160 5730 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34160 5974 6333 gene locus_tag LOCUS_34170 5974 6333 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 protein_id gnl|my_center|LOCUS_34170 6640 6963 gene locus_tag LOCUS_34180 6640 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34180 6903 7352 gene locus_tag LOCUS_34190 6903 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34190 7349 8668 gene locus_tag LOCUS_34200 7349 8668 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986058.1 protein_id gnl|my_center|LOCUS_34200 >Feature sequence109 601 1728 gene locus_tag LOCUS_34210 gene yjiB 601 1728 CDS product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 protein_id gnl|my_center|LOCUS_34210 2065 2967 gene locus_tag LOCUS_34220 2065 2967 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_34220 2994 3803 gene locus_tag LOCUS_34230 gene hisJ 2994 3803 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_34230 3980 4867 gene locus_tag LOCUS_34240 3980 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 5734 4880 gene locus_tag LOCUS_34250 5734 4880 CDS product DUF695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016290.1 protein_id gnl|my_center|LOCUS_34250 6718 6002 gene locus_tag LOCUS_34260 6718 6002 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_34260 7018 7326 gene locus_tag LOCUS_34270 7018 7326 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721618.1 protein_id gnl|my_center|LOCUS_34270 8098 7445 gene locus_tag LOCUS_34280 gene sdhB 8098 7445 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229569.1 protein_id gnl|my_center|LOCUS_34280 9974 8223 gene locus_tag LOCUS_34290 gene sdhA 9974 8223 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676751.1 protein_id gnl|my_center|LOCUS_34290 10670 9999 gene locus_tag LOCUS_34300 gene sdhC 10670 9999 CDS product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222512.1 protein_id gnl|my_center|LOCUS_34300 10869 11771 gene locus_tag LOCUS_34310 gene nmoR 10869 11771 CDS product LysR family transcriptional regulator NmoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114724.1 protein_id gnl|my_center|LOCUS_34310 12039 12656 gene locus_tag LOCUS_34320 12039 12656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 13325 12660 gene locus_tag LOCUS_34330 13325 12660 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_34330 13782 13342 gene locus_tag LOCUS_34340 13782 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34340 14447 13815 gene locus_tag LOCUS_34350 14447 13815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34350 14683 14507 gene locus_tag LOCUS_34360 14683 14507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 18704 16929 gene locus_tag LOCUS_34370 gene uvrC 18704 16929 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544275.1 protein_id gnl|my_center|LOCUS_34370 18865 19017 gene locus_tag LOCUS_34380 18865 19017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 19927 19094 gene locus_tag LOCUS_34390 19927 19094 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_34390 20515 19937 gene locus_tag LOCUS_34400 20515 19937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34400 20883 20422 gene locus_tag LOCUS_34410 20883 20422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34410 22236 20914 gene locus_tag LOCUS_34420 22236 20914 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258532.1 protein_id gnl|my_center|LOCUS_34420 23477 22419 gene locus_tag LOCUS_34430 23477 22419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 23974 23474 gene locus_tag LOCUS_34440 23974 23474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 24665 23952 gene locus_tag LOCUS_34450 24665 23952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 24847 24662 gene locus_tag LOCUS_34460 24847 24662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 25667 24882 gene locus_tag LOCUS_34470 25667 24882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 25978 26190 gene locus_tag LOCUS_34480 25978 26190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 27206 26232 gene locus_tag LOCUS_34490 gene dnaI 27206 26232 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229466.1 protein_id gnl|my_center|LOCUS_34490 28255 27221 gene locus_tag LOCUS_34500 28255 27221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 28743 28333 gene locus_tag LOCUS_34510 28743 28333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 29238 28990 gene locus_tag LOCUS_34520 29238 28990 CDS product YuiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027007.1 protein_id gnl|my_center|LOCUS_34520 29453 30205 gene locus_tag LOCUS_34530 29453 30205 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242896.1 protein_id gnl|my_center|LOCUS_34530 30569 30306 gene locus_tag LOCUS_34540 30569 30306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 31090 30569 gene locus_tag LOCUS_34550 31090 30569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34550 31761 31087 gene locus_tag LOCUS_34560 31761 31087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34560 32111 33109 gene locus_tag LOCUS_34570 32111 33109 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026689.1 protein_id gnl|my_center|LOCUS_34570 33623 33480 gene locus_tag LOCUS_34580 33623 33480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 34645 33887 gene locus_tag LOCUS_34590 34645 33887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 35956 34775 gene locus_tag LOCUS_34600 35956 34775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34600 36617 36009 gene locus_tag LOCUS_34610 36617 36009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34610 <37332 36690 gene locus_tag LOCUS_34620 <37332 36690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948067.1:ABC transporter ATP-binding protein >Feature sequence110 2100 916 gene locus_tag LOCUS_34630 2100 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 2916 2275 gene locus_tag LOCUS_34640 2916 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 3382 3182 gene locus_tag LOCUS_34650 3382 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 3575 3390 gene locus_tag LOCUS_34660 3575 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 3751 3572 gene locus_tag LOCUS_34670 3751 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 4095 3742 gene locus_tag LOCUS_34680 4095 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 4439 4663 gene locus_tag LOCUS_34690 4439 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 5030 4695 gene locus_tag LOCUS_34700 5030 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 5404 5027 gene locus_tag LOCUS_34710 5404 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 5705 5391 gene locus_tag LOCUS_34720 5705 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 6234 5692 gene locus_tag LOCUS_34730 6234 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 6695 6249 gene locus_tag LOCUS_34740 6695 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 7050 6688 gene locus_tag LOCUS_34750 7050 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 >Feature sequence111 617 1270 gene locus_tag LOCUS_34760 617 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34760 1204 1500 gene locus_tag LOCUS_34770 1204 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34770 1532 2428 gene locus_tag LOCUS_34780 1532 2428 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_34780 2533 3486 gene locus_tag LOCUS_34790 2533 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 3465 4187 gene locus_tag LOCUS_34800 3465 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 4191 6161 gene locus_tag LOCUS_34810 4191 6161 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34810 6179 6496 gene locus_tag LOCUS_34820 6179 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34820 8260 6641 gene locus_tag LOCUS_34830 8260 6641 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_34830 8457 9416 gene locus_tag LOCUS_34840 8457 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 >Feature sequence112 301 11 gene locus_tag LOCUS_34850 301 11 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814556.1 protein_id gnl|my_center|LOCUS_34850 1416 466 gene locus_tag LOCUS_34860 1416 466 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368706.1 protein_id gnl|my_center|LOCUS_34860 1660 1466 gene locus_tag LOCUS_34870 1660 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 3896 1932 gene locus_tag LOCUS_34880 3896 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34880 7582 3923 gene locus_tag LOCUS_34890 7582 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34890 8354 8070 gene locus_tag LOCUS_34900 8354 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34900 9489 9223 gene locus_tag LOCUS_34910 9489 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 9951 9511 gene locus_tag LOCUS_34920 9951 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 10160 9984 gene locus_tag LOCUS_34930 10160 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 10654 10157 gene locus_tag LOCUS_34940 10654 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 >Feature sequence113 630 52 gene locus_tag LOCUS_34950 630 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 892 1068 gene locus_tag LOCUS_34960 892 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 1175 2698 gene locus_tag LOCUS_34970 1175 2698 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_34970 2736 3437 gene locus_tag LOCUS_34980 2736 3437 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430452.1 protein_id gnl|my_center|LOCUS_34980 3454 5031 gene locus_tag LOCUS_34990 3454 5031 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 protein_id gnl|my_center|LOCUS_34990 5188 6525 gene locus_tag LOCUS_35000 5188 6525 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_35000 6606 7454 gene locus_tag LOCUS_35010 6606 7454 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 protein_id gnl|my_center|LOCUS_35010 7473 8309 gene locus_tag LOCUS_35020 7473 8309 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 protein_id gnl|my_center|LOCUS_35020 9851 8382 gene locus_tag LOCUS_35030 9851 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 10194 10772 gene locus_tag LOCUS_35040 10194 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35040 10742 13192 gene locus_tag LOCUS_35050 10742 13192 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375594.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35050 13604 13443 gene locus_tag LOCUS_35060 13604 13443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 15418 13793 gene locus_tag LOCUS_35070 15418 13793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 15543 15424 gene locus_tag LOCUS_35080 15543 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35080 15797 15540 gene locus_tag LOCUS_35090 15797 15540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35090 15980 16336 gene locus_tag LOCUS_35100 15980 16336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 16380 16754 gene locus_tag LOCUS_35110 16380 16754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 21074 16734 gene locus_tag LOCUS_35120 21074 16734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 21334 20990 gene locus_tag LOCUS_35130 21334 20990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 23025 21331 gene locus_tag LOCUS_35140 23025 21331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35140 23413 23634 gene locus_tag LOCUS_35150 23413 23634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 >Feature sequence114 132 719 gene locus_tag LOCUS_35160 132 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 1120 2667 gene locus_tag LOCUS_35170 gene pyrG 1120 2667 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 protein_id gnl|my_center|LOCUS_35170 2773 3171 gene locus_tag LOCUS_35180 gene spo0F 2773 3171 CDS product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398594.1 protein_id gnl|my_center|LOCUS_35180 3321 3482 gene locus_tag LOCUS_35190 3321 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35190 3488 4174 gene locus_tag LOCUS_35200 3488 4174 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35200 4433 5686 gene locus_tag LOCUS_35210 4433 5686 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227628.1 protein_id gnl|my_center|LOCUS_35210 5969 7087 gene locus_tag LOCUS_35220 gene rho 5969 7087 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053903.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35220 7126 8379 gene locus_tag LOCUS_35230 7126 8379 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_35230 8492 8689 gene locus_tag LOCUS_35240 gene rpmE 8492 8689 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_35240 8764 9174 gene locus_tag LOCUS_35250 8764 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 9727 11526 gene locus_tag LOCUS_35260 gene dnaX 9727 11526 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247135.1 protein_id gnl|my_center|LOCUS_35260 11552 11863 gene locus_tag LOCUS_35270 11552 11863 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001996460.1 protein_id gnl|my_center|LOCUS_35270 11912 12511 gene locus_tag LOCUS_35280 gene recR 11912 12511 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559169.1 protein_id gnl|my_center|LOCUS_35280 12696 12974 gene locus_tag LOCUS_35290 12696 12974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 12971 13234 gene locus_tag LOCUS_35300 12971 13234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 >Feature sequence115 253 948 gene locus_tag LOCUS_35310 253 948 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258956.1 protein_id gnl|my_center|LOCUS_35310 1910 1218 gene locus_tag LOCUS_35320 1910 1218 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_35320 2105 3220 gene locus_tag LOCUS_35330 2105 3220 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_35330 3236 4177 gene locus_tag LOCUS_35340 3236 4177 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_35340 4174 4707 gene locus_tag LOCUS_35350 4174 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35350 4707 5075 gene locus_tag LOCUS_35360 4707 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35360 5109 6431 gene locus_tag LOCUS_35370 5109 6431 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722711.1 protein_id gnl|my_center|LOCUS_35370 6450 7397 gene locus_tag LOCUS_35380 6450 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 7408 8412 gene locus_tag LOCUS_35390 7408 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35390 8409 9449 gene locus_tag LOCUS_35400 8409 9449 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_35400 9446 10456 gene locus_tag LOCUS_35410 9446 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 10453 11229 gene locus_tag LOCUS_35420 10453 11229 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088639.1 protein_id gnl|my_center|LOCUS_35420 12083 11226 gene locus_tag LOCUS_35430 12083 11226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 12880 12080 gene locus_tag LOCUS_35440 12880 12080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 13206 13946 gene locus_tag LOCUS_35450 13206 13946 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947920.1 protein_id gnl|my_center|LOCUS_35450 13955 14191 gene locus_tag LOCUS_35460 13955 14191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 14219 15007 gene locus_tag LOCUS_35470 gene nat 14219 15007 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419364.1 protein_id gnl|my_center|LOCUS_35470 15317 16300 gene locus_tag LOCUS_35480 15317 16300 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_35480 16676 18106 gene locus_tag LOCUS_35490 16676 18106 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461659.1 protein_id gnl|my_center|LOCUS_35490 18328 19560 gene locus_tag LOCUS_35500 18328 19560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 20607 19837 gene locus_tag LOCUS_35510 20607 19837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 21692 20604 gene locus_tag LOCUS_35520 21692 20604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 21951 21766 gene locus_tag LOCUS_35530 21951 21766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 24345 22066 gene locus_tag LOCUS_35540 24345 22066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 24498 25214 gene locus_tag LOCUS_35550 24498 25214 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261248.1 protein_id gnl|my_center|LOCUS_35550 25215 26606 gene locus_tag LOCUS_35560 25215 26606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 26554 26739 gene locus_tag LOCUS_35570 26554 26739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 26994 27893 gene locus_tag LOCUS_35580 26994 27893 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398709.1 protein_id gnl|my_center|LOCUS_35580 27921 28049 gene locus_tag LOCUS_35590 27921 28049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 28043 28576 gene locus_tag LOCUS_35600 28043 28576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 28507 29667 gene locus_tag LOCUS_35610 28507 29667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 29670 29834 gene locus_tag LOCUS_35620 29670 29834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 29824 31140 gene locus_tag LOCUS_35630 29824 31140 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229857.1 protein_id gnl|my_center|LOCUS_35630 31153 32328 gene locus_tag LOCUS_35640 31153 32328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 32460 32660 gene locus_tag LOCUS_35650 32460 32660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 32606 33766 gene locus_tag LOCUS_35660 32606 33766 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028589.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35660 33884 34147 gene locus_tag LOCUS_35670 33884 34147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35670 34144 34764 gene locus_tag LOCUS_35680 34144 34764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35680 34764 35669 gene locus_tag LOCUS_35690 34764 35669 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_35690 >Feature sequence116 248 535 gene locus_tag LOCUS_35700 248 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 771 1556 gene locus_tag LOCUS_35710 771 1556 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086177.1 protein_id gnl|my_center|LOCUS_35710 1694 2650 gene locus_tag LOCUS_35720 1694 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 2754 3077 gene locus_tag LOCUS_35730 2754 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 3989 4882 gene locus_tag LOCUS_35740 gene lipA 3989 4882 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166373.1 protein_id gnl|my_center|LOCUS_35740 4910 5824 gene locus_tag LOCUS_35750 4910 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 6168 5929 gene locus_tag LOCUS_35760 6168 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35760 7666 6185 gene locus_tag LOCUS_35770 7666 6185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35770 8466 7669 gene locus_tag LOCUS_35780 8466 7669 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106785139.1 protein_id gnl|my_center|LOCUS_35780 9487 8627 gene locus_tag LOCUS_35790 9487 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35790 9728 9480 gene locus_tag LOCUS_35800 9728 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 10139 10537 gene locus_tag LOCUS_35810 10139 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043381.1 protein_id gnl|my_center|LOCUS_35810 10979 10797 gene locus_tag LOCUS_35820 10979 10797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 11292 13064 gene locus_tag LOCUS_35830 11292 13064 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990142.1 protein_id gnl|my_center|LOCUS_35830 13294 13941 gene locus_tag LOCUS_35840 13294 13941 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816391.1 protein_id gnl|my_center|LOCUS_35840 13938 14744 gene locus_tag LOCUS_35850 13938 14744 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460836.1 protein_id gnl|my_center|LOCUS_35850 14775 15740 gene locus_tag LOCUS_35860 gene glpX 14775 15740 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439090.1 protein_id gnl|my_center|LOCUS_35860 15832 16236 gene locus_tag LOCUS_35870 gene ndk 15832 16236 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886554.1 protein_id gnl|my_center|LOCUS_35870 16252 16899 gene locus_tag LOCUS_35880 gene fsa 16252 16899 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723193.1 protein_id gnl|my_center|LOCUS_35880 17212 18024 gene locus_tag LOCUS_35890 17212 18024 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776936.1 protein_id gnl|my_center|LOCUS_35890 18021 18866 gene locus_tag LOCUS_35900 18021 18866 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847567.1 protein_id gnl|my_center|LOCUS_35900 18971 20752 gene locus_tag LOCUS_35910 18971 20752 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_35910 20730 21197 gene locus_tag LOCUS_35920 20730 21197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 21194 22393 gene locus_tag LOCUS_35930 21194 22393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35930 22513 23805 gene locus_tag LOCUS_35940 22513 23805 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582824.1 protein_id gnl|my_center|LOCUS_35940 24917 23997 gene locus_tag LOCUS_35950 gene rihC 24917 23997 CDS product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357149.1 protein_id gnl|my_center|LOCUS_35950 25174 26241 gene locus_tag LOCUS_35960 25174 26241 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_35960 26244 27134 gene locus_tag LOCUS_35970 26244 27134 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375198.1 protein_id gnl|my_center|LOCUS_35970 27131 27994 gene locus_tag LOCUS_35980 27131 27994 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777129.1 protein_id gnl|my_center|LOCUS_35980 28142 29671 gene locus_tag LOCUS_35990 28142 29671 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_35990 29668 30909 gene locus_tag LOCUS_36000 29668 30909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36000 30837 31514 gene locus_tag LOCUS_36010 30837 31514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36010 31511 33115 gene locus_tag LOCUS_36020 31511 33115 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_36020 >Feature sequence117 91 3117 gene locus_tag LOCUS_36030 gene smc 91 3117 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36030 3114 3671 gene locus_tag LOCUS_36040 3114 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36040 3935 4789 gene locus_tag LOCUS_36050 gene ftsY 3935 4789 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36050 4731 4895 gene locus_tag LOCUS_36060 4731 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 5100 5498 gene locus_tag LOCUS_36070 5100 5498 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238590.1 protein_id gnl|my_center|LOCUS_36070 5488 6864 gene locus_tag LOCUS_36080 gene ffh 5488 6864 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863461.1 protein_id gnl|my_center|LOCUS_36080 7057 7329 gene locus_tag LOCUS_36090 gene rpsP 7057 7329 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268750.1 protein_id gnl|my_center|LOCUS_36090 7355 7585 gene locus_tag LOCUS_36100 7355 7585 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392483.1 protein_id gnl|my_center|LOCUS_36100 7660 8208 gene locus_tag LOCUS_36110 gene rimM 7660 8208 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170268.1 protein_id gnl|my_center|LOCUS_36110 8213 8986 gene locus_tag LOCUS_36120 gene trmD 8213 8986 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_36120 9062 9553 gene locus_tag LOCUS_36130 9062 9553 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813258.1 protein_id gnl|my_center|LOCUS_36130 9697 10038 gene locus_tag LOCUS_36140 gene rplS 9697 10038 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_36140 10173 10343 gene locus_tag LOCUS_36150 10173 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 10424 10876 gene locus_tag LOCUS_36160 gene lepB 10424 10876 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662493.1 protein_id gnl|my_center|LOCUS_36160 10924 11793 gene locus_tag LOCUS_36170 gene ylqF 10924 11793 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_36170 11834 12238 gene locus_tag LOCUS_36180 11834 12238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36180 12157 12444 gene locus_tag LOCUS_36190 12157 12444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36190 12822 13307 gene locus_tag LOCUS_36200 12822 13307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36200 >Feature sequence118 1399 671 gene locus_tag LOCUS_36210 1399 671 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 protein_id gnl|my_center|LOCUS_36210 2870 1422 gene locus_tag LOCUS_36220 2870 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 4208 3075 gene locus_tag LOCUS_36230 gene hemY 4208 3075 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36230 4507 4133 gene locus_tag LOCUS_36240 4507 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36240 5444 4509 gene locus_tag LOCUS_36250 gene hemH 5444 4509 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244736.1 protein_id gnl|my_center|LOCUS_36250 6504 5437 gene locus_tag LOCUS_36260 gene hemE 6504 5437 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252605.1 protein_id gnl|my_center|LOCUS_36260 6718 8394 gene locus_tag LOCUS_36270 6718 8394 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054402.1 protein_id gnl|my_center|LOCUS_36270 8417 8647 gene locus_tag LOCUS_36280 8417 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 8649 9368 gene locus_tag LOCUS_36290 gene tatC 8649 9368 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246495.1 protein_id gnl|my_center|LOCUS_36290 9792 9433 gene locus_tag LOCUS_36300 9792 9433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 10082 9819 gene locus_tag LOCUS_36310 10082 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 10363 11445 gene locus_tag LOCUS_36320 gene mdtG 10363 11445 CDS product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075040.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36320 >Feature sequence119 696 154 gene locus_tag LOCUS_36330 696 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 1105 836 gene locus_tag LOCUS_36340 1105 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 1515 1102 gene locus_tag LOCUS_36350 1515 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36350 1770 2720 gene locus_tag LOCUS_36360 1770 2720 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880686.1 protein_id gnl|my_center|LOCUS_36360 3647 2919 gene locus_tag LOCUS_36370 3647 2919 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964732.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36370 3817 3635 gene locus_tag LOCUS_36380 3817 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36380 4345 3953 gene locus_tag LOCUS_36390 4345 3953 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 protein_id gnl|my_center|LOCUS_36390 5867 4347 gene locus_tag LOCUS_36400 5867 4347 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_36400 6942 6433 gene locus_tag LOCUS_36410 6942 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36410 8051 7281 gene locus_tag LOCUS_36420 8051 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36420 8884 8057 gene locus_tag LOCUS_36430 8884 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36430 9054 8926 gene locus_tag LOCUS_36440 9054 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 10057 9128 gene locus_tag LOCUS_36450 10057 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36450 10344 10054 gene locus_tag LOCUS_36460 10344 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 10855 10325 gene locus_tag LOCUS_36470 10855 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 11653 10880 gene locus_tag LOCUS_36480 11653 10880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_36480 11892 11572 gene locus_tag LOCUS_36490 11892 11572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 12680 11856 gene locus_tag LOCUS_36500 12680 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 13496 12726 gene locus_tag LOCUS_36510 13496 12726 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243784.1 protein_id gnl|my_center|LOCUS_36510 14509 13529 gene locus_tag LOCUS_36520 14509 13529 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809024.1 protein_id gnl|my_center|LOCUS_36520 16070 14529 gene locus_tag LOCUS_36530 16070 14529 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_36530 16925 16119 gene locus_tag LOCUS_36540 16925 16119 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943353.1 protein_id gnl|my_center|LOCUS_36540 17368 16922 gene locus_tag LOCUS_36550 17368 16922 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029306122.1 protein_id gnl|my_center|LOCUS_36550 18842 17829 gene locus_tag LOCUS_36560 18842 17829 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214261.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36560 19072 18839 gene locus_tag LOCUS_36570 19072 18839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36570 19473 20141 gene locus_tag LOCUS_36580 19473 20141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 20635 20781 gene locus_tag LOCUS_36590 20635 20781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 21154 20753 gene locus_tag LOCUS_36600 21154 20753 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968054.1 protein_id gnl|my_center|LOCUS_36600 22105 21245 gene locus_tag LOCUS_36610 22105 21245 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230452.1 protein_id gnl|my_center|LOCUS_36610 22804 22223 gene locus_tag LOCUS_36620 22804 22223 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190407.1 protein_id gnl|my_center|LOCUS_36620 23303 22827 gene locus_tag LOCUS_36630 23303 22827 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245457.1 protein_id gnl|my_center|LOCUS_36630 23814 23344 gene locus_tag LOCUS_36640 23814 23344 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288269.1 protein_id gnl|my_center|LOCUS_36640 24530 24033 gene locus_tag LOCUS_36650 24530 24033 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525695.1 protein_id gnl|my_center|LOCUS_36650 25286 24741 gene locus_tag LOCUS_36660 25286 24741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 25435 26010 gene locus_tag LOCUS_36670 25435 26010 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706237.1 protein_id gnl|my_center|LOCUS_36670 26881 25997 gene locus_tag LOCUS_36680 26881 25997 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651943.1 protein_id gnl|my_center|LOCUS_36680 27075 27413 gene locus_tag LOCUS_36690 27075 27413 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224339.1 protein_id gnl|my_center|LOCUS_36690 27499 28029 gene locus_tag LOCUS_36700 27499 28029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 28503 28033 gene locus_tag LOCUS_36710 28503 28033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 29124 28579 gene locus_tag LOCUS_36720 29124 28579 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963411.1 protein_id gnl|my_center|LOCUS_36720 30022 29162 gene locus_tag LOCUS_36730 30022 29162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 30302 30096 gene locus_tag LOCUS_36740 30302 30096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 30702 30469 gene locus_tag LOCUS_36750 30702 30469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36750 31706 30651 gene locus_tag LOCUS_36760 gene fabF 31706 30651 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36760 31823 32173 gene locus_tag LOCUS_36770 31823 32173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 32187 32507 gene locus_tag LOCUS_36780 32187 32507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 33147 32716 gene locus_tag LOCUS_36790 33147 32716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 33415 34755 gene locus_tag LOCUS_36800 33415 34755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 35694 35269 gene locus_tag LOCUS_36810 35694 35269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36810 >Feature sequence120 <1 968 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgctccctacgcgggagcgtggattgaaac 1077 2390 gene locus_tag LOCUS_36820 1077 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 2487 3422 gene locus_tag LOCUS_36830 2487 3422 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204710.1 protein_id gnl|my_center|LOCUS_36830 3419 4213 gene locus_tag LOCUS_36840 3419 4213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626546.1 protein_id gnl|my_center|LOCUS_36840 4219 4992 gene locus_tag LOCUS_36850 4219 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 5367 5609 gene locus_tag LOCUS_36860 5367 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 >Feature sequence121 180 356 gene locus_tag LOCUS_36870 180 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 1639 1124 gene locus_tag LOCUS_36880 1639 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 2394 1657 gene locus_tag LOCUS_36890 2394 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 4855 3119 gene locus_tag LOCUS_36900 4855 3119 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_36900 >Feature sequence122 574 47 gene locus_tag LOCUS_36910 574 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 802 993 gene locus_tag LOCUS_36920 802 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 1092 2633 gene locus_tag LOCUS_36930 1092 2633 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075273.1 protein_id gnl|my_center|LOCUS_36930 2708 3364 gene locus_tag LOCUS_36940 gene tmk 2708 3364 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677216.1 protein_id gnl|my_center|LOCUS_36940 3427 3756 gene locus_tag LOCUS_36950 3427 3756 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832200.1 protein_id gnl|my_center|LOCUS_36950 3774 4217 gene locus_tag LOCUS_36960 3774 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 4233 5210 gene locus_tag LOCUS_36970 gene holB 4233 5210 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244417.1 protein_id gnl|my_center|LOCUS_36970 5583 6017 gene locus_tag LOCUS_36980 5583 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36980 6047 6463 gene locus_tag LOCUS_36990 gene yabA 6047 6463 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412063.1 protein_id gnl|my_center|LOCUS_36990 6436 7242 gene locus_tag LOCUS_37000 6436 7242 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055361.1 protein_id gnl|my_center|LOCUS_37000 7289 8170 gene locus_tag LOCUS_37010 gene rsmI 7289 8170 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267819.1 protein_id gnl|my_center|LOCUS_37010 8573 8319 gene locus_tag LOCUS_37020 8573 8319 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391595.1 protein_id gnl|my_center|LOCUS_37020 8829 10145 gene locus_tag LOCUS_37030 8829 10145 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243873.1 protein_id gnl|my_center|LOCUS_37030 10153 10941 gene locus_tag LOCUS_37040 10153 10941 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_37040 11556 12704 gene locus_tag LOCUS_37050 11556 12704 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947942.1 protein_id gnl|my_center|LOCUS_37050 13097 13408 gene locus_tag LOCUS_37060 13097 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37060 13405 14313 gene locus_tag LOCUS_37070 gene rsmA 13405 14313 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_37070 14437 14781 gene locus_tag LOCUS_37080 14437 14781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37080 14789 15313 gene locus_tag LOCUS_37090 14789 15313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37090 15518 15793 gene locus_tag LOCUS_37100 15518 15793 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218330.1 protein_id gnl|my_center|LOCUS_37100 15910 16095 gene locus_tag LOCUS_37110 gene sspF 15910 16095 CDS product acid-soluble spore protein SspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985066.1 protein_id gnl|my_center|LOCUS_37110 16237 16458 gene locus_tag LOCUS_37120 16237 16458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37120 16500 17090 gene locus_tag LOCUS_37130 16500 17090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37130 17215 18015 gene locus_tag LOCUS_37140 gene purR 17215 18015 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078543208.1 protein_id gnl|my_center|LOCUS_37140 18050 18445 gene locus_tag LOCUS_37150 18050 18445 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226738.1 protein_id gnl|my_center|LOCUS_37150 18576 18911 gene locus_tag LOCUS_37160 18576 18911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 18964 20361 gene locus_tag LOCUS_37170 gene glmU 18964 20361 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226732.1 protein_id gnl|my_center|LOCUS_37170 20513 21163 gene locus_tag LOCUS_37180 20513 21163 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_37180 21444 21244 gene locus_tag LOCUS_37190 21444 21244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 21560 22123 gene locus_tag LOCUS_37200 gene pth 21560 22123 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_37200 22181 22411 gene locus_tag LOCUS_37210 22181 22411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 22501 23022 gene locus_tag LOCUS_37220 22501 23022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37220 23019 23963 gene locus_tag LOCUS_37230 23019 23963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37230 23978 25990 gene locus_tag LOCUS_37240 23978 25990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37240 26012 27103 gene locus_tag LOCUS_37250 26012 27103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 27109 28260 gene locus_tag LOCUS_37260 27109 28260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 30725 28398 gene locus_tag LOCUS_37270 30725 28398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 31105 31647 gene locus_tag LOCUS_37280 gene spoVT 31105 31647 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458938.1 protein_id gnl|my_center|LOCUS_37280 32686 31760 gene locus_tag LOCUS_37290 32686 31760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 >Feature sequence123 1170 1676 gene locus_tag LOCUS_37300 1170 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37300 1885 2559 gene locus_tag LOCUS_37310 1885 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37310 2556 2903 gene locus_tag LOCUS_37320 2556 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37320 3849 4580 gene locus_tag LOCUS_37330 3849 4580 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676157.1 protein_id gnl|my_center|LOCUS_37330 4614 5171 gene locus_tag LOCUS_37340 gene rfbC 4614 5171 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 protein_id gnl|my_center|LOCUS_37340 5177 6202 gene locus_tag LOCUS_37350 gene rfbB 5177 6202 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_37350 6186 7076 gene locus_tag LOCUS_37360 gene rfbD 6186 7076 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_37360 7054 7998 gene locus_tag LOCUS_37370 7054 7998 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258131.1 protein_id gnl|my_center|LOCUS_37370 8068 10386 gene locus_tag LOCUS_37380 8068 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 10486 11274 gene locus_tag LOCUS_37390 10486 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 11205 12941 gene locus_tag LOCUS_37400 11205 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 13100 13690 gene locus_tag LOCUS_37410 gene sugR 13100 13690 CDS product efflux SMR transporter transcriptional repressor SugR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721417.1 protein_id gnl|my_center|LOCUS_37410 13698 14045 gene locus_tag LOCUS_37420 gene sugE1 13698 14045 CDS product quaternary ammonium compound efflux SMR transporter SugE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736027.1 protein_id gnl|my_center|LOCUS_37420 14113 14433 gene locus_tag LOCUS_37430 gene sugE2 14113 14433 CDS product quaternary ammonium compound efflux SMR transporter SugE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724784.1 protein_id gnl|my_center|LOCUS_37430 14808 14539 gene locus_tag LOCUS_37440 14808 14539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 15508 15864 gene locus_tag LOCUS_37450 15508 15864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 16746 15880 gene locus_tag LOCUS_37460 16746 15880 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459554.1 protein_id gnl|my_center|LOCUS_37460 17294 16839 gene locus_tag LOCUS_37470 17294 16839 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966557.1 protein_id gnl|my_center|LOCUS_37470 17438 18280 gene locus_tag LOCUS_37480 17438 18280 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243895.1 protein_id gnl|my_center|LOCUS_37480 18399 18584 gene locus_tag LOCUS_37490 18399 18584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37490 18608 19231 gene locus_tag LOCUS_37500 18608 19231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37500 19399 19824 gene locus_tag LOCUS_37510 gene saiR 19399 19824 CDS product Rrf2-family transcriptional regulator SaiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083465.1 protein_id gnl|my_center|LOCUS_37510 19880 20191 gene locus_tag LOCUS_37520 gene trxA 19880 20191 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018928.1 protein_id gnl|my_center|LOCUS_37520 20352 22706 gene locus_tag LOCUS_37530 20352 22706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 >Feature sequence124 125 613 gene locus_tag LOCUS_37540 125 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37540 702 1967 gene locus_tag LOCUS_37550 702 1967 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 protein_id gnl|my_center|LOCUS_37550 1948 2391 gene locus_tag LOCUS_37560 gene dut 1948 2391 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 protein_id gnl|my_center|LOCUS_37560 2579 3478 gene locus_tag LOCUS_37570 gene dpaA 2579 3478 CDS product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954735.1 protein_id gnl|my_center|LOCUS_37570 3475 3996 gene locus_tag LOCUS_37580 3475 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37580 4180 4920 gene locus_tag LOCUS_37590 4180 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37590 4896 5243 gene locus_tag LOCUS_37600 4896 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37600 5325 6560 gene locus_tag LOCUS_37610 gene dapG 5325 6560 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692470.1 protein_id gnl|my_center|LOCUS_37610 6640 7518 gene locus_tag LOCUS_37620 gene dapA 6640 7518 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245816.1 protein_id gnl|my_center|LOCUS_37620 8410 9255 gene locus_tag LOCUS_37630 8410 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37630 9213 9440 gene locus_tag LOCUS_37640 9213 9440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37640 9586 10344 gene locus_tag LOCUS_37650 gene tepA 9586 10344 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139816.1 protein_id gnl|my_center|LOCUS_37650 10341 10571 gene locus_tag LOCUS_37660 10341 10571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 10633 11454 gene locus_tag LOCUS_37670 10633 11454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 11562 12590 gene locus_tag LOCUS_37680 11562 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37680 12524 13273 gene locus_tag LOCUS_37690 12524 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37690 13399 14169 gene locus_tag LOCUS_37700 gene sleB 13399 14169 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249045.1 protein_id gnl|my_center|LOCUS_37700 14321 15601 gene locus_tag LOCUS_37710 14321 15601 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886510.1 protein_id gnl|my_center|LOCUS_37710 15605 16714 gene locus_tag LOCUS_37720 15605 16714 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411976.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37720 16708 16884 gene locus_tag LOCUS_37730 16708 16884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 16887 17633 gene locus_tag LOCUS_37740 16887 17633 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_37740 17751 18002 gene locus_tag LOCUS_37750 17751 18002 CDS product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393333.1 protein_id gnl|my_center|LOCUS_37750 18196 18960 gene locus_tag LOCUS_37760 18196 18960 CDS product DUF3388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574107.1 protein_id gnl|my_center|LOCUS_37760 19006 19866 gene locus_tag LOCUS_37770 gene rodZ 19006 19866 CDS product cell shape determination protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886511.1 protein_id gnl|my_center|LOCUS_37770 19996 20487 gene locus_tag LOCUS_37780 19996 20487 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233034.1 protein_id gnl|my_center|LOCUS_37780 20616 21944 gene locus_tag LOCUS_37790 gene rimO 20616 21944 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_37790 21941 22519 gene locus_tag LOCUS_37800 gene pgsA 21941 22519 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052967.1 protein_id gnl|my_center|LOCUS_37800 22563 23822 gene locus_tag LOCUS_37810 22563 23822 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642685.1 protein_id gnl|my_center|LOCUS_37810 24066 25124 gene locus_tag LOCUS_37820 gene recA 24066 25124 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 protein_id gnl|my_center|LOCUS_37820 25218 25922 gene locus_tag LOCUS_37830 25218 25922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 26086 27627 gene locus_tag LOCUS_37840 gene rny 26086 27627 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204912.1 protein_id gnl|my_center|LOCUS_37840 28075 28512 gene locus_tag LOCUS_37850 28075 28512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37850 28656 28916 gene locus_tag LOCUS_37860 gene spoVS 28656 28916 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 protein_id gnl|my_center|LOCUS_37860 29026 29631 gene locus_tag LOCUS_37870 29026 29631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37870 29553 29957 gene locus_tag LOCUS_37880 29553 29957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37880 30157 31872 gene locus_tag LOCUS_37890 30157 31872 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625424.1 protein_id gnl|my_center|LOCUS_37890 31874 32740 gene locus_tag LOCUS_37900 31874 32740 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190155.1 protein_id gnl|my_center|LOCUS_37900 32861 33433 gene locus_tag LOCUS_37910 32861 33433 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392695.1 protein_id gnl|my_center|LOCUS_37910 33530 34402 gene locus_tag LOCUS_37920 33530 34402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37920 34294 35088 gene locus_tag LOCUS_37930 34294 35088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37930 35164 35664 gene locus_tag LOCUS_37940 35164 35664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 36381 35788 gene locus_tag LOCUS_37950 36381 35788 CDS product BioY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391133.1 protein_id gnl|my_center|LOCUS_37950 36499 38901 gene locus_tag LOCUS_37960 36499 38901 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054001.1 protein_id gnl|my_center|LOCUS_37960 40219 39044 gene locus_tag LOCUS_37970 40219 39044 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244027.1 protein_id gnl|my_center|LOCUS_37970 40427 41008 gene locus_tag LOCUS_37980 gene lepB 40427 41008 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142021.1 protein_id gnl|my_center|LOCUS_37980 41094 42056 gene locus_tag LOCUS_37990 41094 42056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 42175 42672 gene locus_tag LOCUS_38000 42175 42672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 42573 43646 gene locus_tag LOCUS_38010 42573 43646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 43624 44310 gene locus_tag LOCUS_38020 43624 44310 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001993852.1 protein_id gnl|my_center|LOCUS_38020 44337 45689 gene locus_tag LOCUS_38030 44337 45689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38030 45632 46603 gene locus_tag LOCUS_38040 45632 46603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38040 >Feature sequence125 275 637 gene locus_tag LOCUS_38050 275 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 1766 570 gene locus_tag LOCUS_38060 1766 570 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387517.1 protein_id gnl|my_center|LOCUS_38060 2694 2110 gene locus_tag LOCUS_38070 2694 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38070 3049 2681 gene locus_tag LOCUS_38080 3049 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38080 4839 3418 gene locus_tag LOCUS_38090 gene gabD 4839 3418 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358103.1 protein_id gnl|my_center|LOCUS_38090 6520 4853 gene locus_tag LOCUS_38100 gene mdlC 6520 4853 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099962.1 protein_id gnl|my_center|LOCUS_38100 7372 6542 gene locus_tag LOCUS_38110 7372 6542 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259018.1 protein_id gnl|my_center|LOCUS_38110 7891 7373 gene locus_tag LOCUS_38120 gene snaB 7891 7373 CDS product sulfur-containing aminoacid acetyltransferase SnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242734.1 protein_id gnl|my_center|LOCUS_38120 8918 7884 gene locus_tag LOCUS_38130 8918 7884 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930022.1 protein_id gnl|my_center|LOCUS_38130 10294 8915 gene locus_tag LOCUS_38140 gene purB 10294 8915 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345327.1 protein_id gnl|my_center|LOCUS_38140 11506 10340 gene locus_tag LOCUS_38150 gene sndB 11506 10340 CDS product N-acetyl-sulfur-metabolite deacetylase SndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243840.1 protein_id gnl|my_center|LOCUS_38150 11854 11531 gene locus_tag LOCUS_38160 11854 11531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 13554 11851 gene locus_tag LOCUS_38170 13554 11851 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726932.1 protein_id gnl|my_center|LOCUS_38170 15093 13588 gene locus_tag LOCUS_38180 15093 13588 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083773.1 protein_id gnl|my_center|LOCUS_38180 15599 15126 gene locus_tag LOCUS_38190 15599 15126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 16651 15599 gene locus_tag LOCUS_38200 16651 15599 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582705.1 protein_id gnl|my_center|LOCUS_38200 17653 17207 gene locus_tag LOCUS_38210 17653 17207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38210 19731 17662 gene locus_tag LOCUS_38220 19731 17662 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38220 21371 19797 gene locus_tag LOCUS_38230 21371 19797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 21828 21349 gene locus_tag LOCUS_38240 21828 21349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38240 22610 21729 gene locus_tag LOCUS_38250 22610 21729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38250 24054 23173 gene locus_tag LOCUS_38260 24054 23173 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_38260 24792 24130 gene locus_tag LOCUS_38270 24792 24130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 26400 25072 gene locus_tag LOCUS_38280 26400 25072 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243455.1 protein_id gnl|my_center|LOCUS_38280 29028 27700 gene locus_tag LOCUS_38290 29028 27700 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243743.1 protein_id gnl|my_center|LOCUS_38290 29854 29111 gene locus_tag LOCUS_38300 29854 29111 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243284.1 protein_id gnl|my_center|LOCUS_38300 30224 29868 gene locus_tag LOCUS_38310 30224 29868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38310 30538 30161 gene locus_tag LOCUS_38320 30538 30161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38320 31372 30572 gene locus_tag LOCUS_38330 31372 30572 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227109.1 protein_id gnl|my_center|LOCUS_38330 31955 31746 gene locus_tag LOCUS_38340 31955 31746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38340 32584 31976 gene locus_tag LOCUS_38350 32584 31976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38350 32819 33208 gene locus_tag LOCUS_38360 32819 33208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 33748 33311 gene locus_tag LOCUS_38370 33748 33311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 >Feature sequence126 1163 621 gene locus_tag LOCUS_38380 1163 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245720.1 protein_id gnl|my_center|LOCUS_38380 1817 1338 gene locus_tag LOCUS_38390 1817 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 3193 2234 gene locus_tag LOCUS_38400 3193 2234 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825875.1 protein_id gnl|my_center|LOCUS_38400 3674 3318 gene locus_tag LOCUS_38410 3674 3318 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583637.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38410 4974 3799 gene locus_tag LOCUS_38420 4974 3799 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948340.1 protein_id gnl|my_center|LOCUS_38420 5662 4967 gene locus_tag LOCUS_38430 5662 4967 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435805.1 protein_id gnl|my_center|LOCUS_38430 6127 7797 gene locus_tag LOCUS_38440 gene ilvD 6127 7797 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967560.1 protein_id gnl|my_center|LOCUS_38440 9316 7913 gene locus_tag LOCUS_38450 9316 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 9519 10169 gene locus_tag LOCUS_38460 9519 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 10130 10636 gene locus_tag LOCUS_38470 10130 10636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 12491 10677 gene locus_tag LOCUS_38480 12491 10677 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398903.1 protein_id gnl|my_center|LOCUS_38480 13321 12665 gene locus_tag LOCUS_38490 13321 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 >Feature sequence127 142 780 gene locus_tag LOCUS_38500 142 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 777 1085 gene locus_tag LOCUS_38510 777 1085 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545507.1 protein_id gnl|my_center|LOCUS_38510 1160 1477 gene locus_tag LOCUS_38520 1160 1477 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_38520 2458 1607 gene locus_tag LOCUS_38530 2458 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 3183 2518 gene locus_tag LOCUS_38540 3183 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38540 3736 4896 gene locus_tag LOCUS_38550 gene sucC 3736 4896 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_38550 4928 5863 gene locus_tag LOCUS_38560 gene sucD 4928 5863 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_38560 6058 7233 gene locus_tag LOCUS_38570 gene dprA 6058 7233 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_38570 7556 8929 gene locus_tag LOCUS_38580 7556 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38580 8818 9321 gene locus_tag LOCUS_38590 8818 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38590 9369 10697 gene locus_tag LOCUS_38600 gene trmFO 9369 10697 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213003.1 protein_id gnl|my_center|LOCUS_38600 10701 11246 gene locus_tag LOCUS_38610 gene hslV 10701 11246 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724001.1 protein_id gnl|my_center|LOCUS_38610 11291 12688 gene locus_tag LOCUS_38620 gene hslU 11291 12688 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550088.1 protein_id gnl|my_center|LOCUS_38620 12717 13484 gene locus_tag LOCUS_38630 gene codY 12717 13484 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726695.1 protein_id gnl|my_center|LOCUS_38630 13967 14107 gene locus_tag LOCUS_38640 13967 14107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 14110 14556 gene locus_tag LOCUS_38650 gene flgC 14110 14556 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245521.1 protein_id gnl|my_center|LOCUS_38650 14579 14887 gene locus_tag LOCUS_38660 gene fliE 14579 14887 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392291.1 protein_id gnl|my_center|LOCUS_38660 15406 15158 gene locus_tag LOCUS_38670 15406 15158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 16232 15456 gene locus_tag LOCUS_38680 16232 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 16513 17526 gene locus_tag LOCUS_38690 gene fliG 16513 17526 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_38690 17519 18355 gene locus_tag LOCUS_38700 17519 18355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 18342 19667 gene locus_tag LOCUS_38710 gene fliI 18342 19667 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090887161.1 protein_id gnl|my_center|LOCUS_38710 19676 20119 gene locus_tag LOCUS_38720 19676 20119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 20214 20645 gene locus_tag LOCUS_38730 20214 20645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 20594 21064 gene locus_tag LOCUS_38740 20594 21064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 21123 22637 gene locus_tag LOCUS_38750 21123 22637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 22673 23221 gene locus_tag LOCUS_38760 22673 23221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 23307 24125 gene locus_tag LOCUS_38770 gene flgG 23307 24125 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231968.1 protein_id gnl|my_center|LOCUS_38770 24184 24411 gene locus_tag LOCUS_38780 24184 24411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 24416 24862 gene locus_tag LOCUS_38790 24416 24862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 24972 25733 gene locus_tag LOCUS_38800 24972 25733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38800 25801 25971 gene locus_tag LOCUS_38810 25801 25971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 25961 27208 gene locus_tag LOCUS_38820 gene fliY 25961 27208 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392326.1 protein_id gnl|my_center|LOCUS_38820 27469 27594 gene locus_tag LOCUS_38830 27469 27594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38830 27603 28208 gene locus_tag LOCUS_38840 27603 28208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 28237 28953 gene locus_tag LOCUS_38850 gene fliP 28237 28953 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272500.1 protein_id gnl|my_center|LOCUS_38850 29089 29358 gene locus_tag LOCUS_38860 gene fliQ 29089 29358 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_38860 29770 30162 gene locus_tag LOCUS_38870 29770 30162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38870 30175 30651 gene locus_tag LOCUS_38880 30175 30651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38880 30708 30914 gene locus_tag LOCUS_38890 30708 30914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38890 30947 31270 gene locus_tag LOCUS_38900 30947 31270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38900 31295 32254 gene locus_tag LOCUS_38910 31295 32254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38910 32254 32961 gene locus_tag LOCUS_38920 32254 32961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38920 32919 33329 gene locus_tag LOCUS_38930 32919 33329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38930 33326 33901 gene locus_tag LOCUS_38940 33326 33901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38940 33895 34539 gene locus_tag LOCUS_38950 33895 34539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 34532 35185 gene locus_tag LOCUS_38960 34532 35185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38960 35164 35400 gene locus_tag LOCUS_38970 35164 35400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 35427 36812 gene locus_tag LOCUS_38980 35427 36812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 36828 38897 gene locus_tag LOCUS_38990 36828 38897 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392263.1 protein_id gnl|my_center|LOCUS_38990 38911 39369 gene locus_tag LOCUS_39000 38911 39369 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_39000 39372 39992 gene locus_tag LOCUS_39010 39372 39992 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943818.1 protein_id gnl|my_center|LOCUS_39010 >Feature sequence128 913 113 gene locus_tag LOCUS_39020 913 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 1428 898 gene locus_tag LOCUS_39030 1428 898 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038086004.1 protein_id gnl|my_center|LOCUS_39030 1613 2065 gene locus_tag LOCUS_39040 1613 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 2216 2569 gene locus_tag LOCUS_39050 2216 2569 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816465.1 protein_id gnl|my_center|LOCUS_39050 2656 2829 gene locus_tag LOCUS_39060 2656 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 2846 3289 gene locus_tag LOCUS_39070 2846 3289 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054571.1 protein_id gnl|my_center|LOCUS_39070 3435 4784 gene locus_tag LOCUS_39080 3435 4784 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 protein_id gnl|my_center|LOCUS_39080 4851 5660 gene locus_tag LOCUS_39090 4851 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39090 5633 5857 gene locus_tag LOCUS_39100 5633 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39100 5919 6410 gene locus_tag LOCUS_39110 5919 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 6616 6894 gene locus_tag LOCUS_39120 gene yqfC 6616 6894 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226191.1 protein_id gnl|my_center|LOCUS_39120 6908 7249 gene locus_tag LOCUS_39130 6908 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39130 7195 8100 gene locus_tag LOCUS_39140 7195 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39140 8104 9075 gene locus_tag LOCUS_39150 8104 9075 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230035.1 protein_id gnl|my_center|LOCUS_39150 9093 11336 gene locus_tag LOCUS_39160 gene pgpH 9093 11336 CDS product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886570.1 protein_id gnl|my_center|LOCUS_39160 11333 11827 gene locus_tag LOCUS_39170 gene ybeY 11333 11827 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 protein_id gnl|my_center|LOCUS_39170 11827 12192 gene locus_tag LOCUS_39180 11827 12192 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888724.1 protein_id gnl|my_center|LOCUS_39180 12381 12887 gene locus_tag LOCUS_39190 12381 12887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39190 12878 13147 gene locus_tag LOCUS_39200 12878 13147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39200 13262 13432 gene locus_tag LOCUS_39210 13262 13432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 13448 13654 gene locus_tag LOCUS_39220 13448 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39220 13651 14193 gene locus_tag LOCUS_39230 13651 14193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39230 14204 15739 gene locus_tag LOCUS_39240 14204 15739 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 protein_id gnl|my_center|LOCUS_39240 16305 17186 gene locus_tag LOCUS_39250 gene glyQ 16305 17186 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226213.1 protein_id gnl|my_center|LOCUS_39250 17186 19267 gene locus_tag LOCUS_39260 gene glyS 17186 19267 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230059.1 protein_id gnl|my_center|LOCUS_39260 19340 20125 gene locus_tag LOCUS_39270 19340 20125 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392143.1 protein_id gnl|my_center|LOCUS_39270 20208 20678 gene locus_tag LOCUS_39280 20208 20678 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721962.1 protein_id gnl|my_center|LOCUS_39280 20718 21869 gene locus_tag LOCUS_39290 20718 21869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39290 21893 22054 gene locus_tag LOCUS_39300 21893 22054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 22119 22484 gene locus_tag LOCUS_39310 22119 22484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 22581 23735 gene locus_tag LOCUS_39320 gene rpoD 22581 23735 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764065.1 protein_id gnl|my_center|LOCUS_39320 24768 25550 gene locus_tag LOCUS_39330 24768 25550 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006551.1 protein_id gnl|my_center|LOCUS_39330 25517 26638 gene locus_tag LOCUS_39340 25517 26638 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036241.1 protein_id gnl|my_center|LOCUS_39340 >Feature sequence129 955 485 gene locus_tag LOCUS_39350 955 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 1144 1311 gene locus_tag LOCUS_39360 1144 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 2399 1302 gene locus_tag LOCUS_39370 2399 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39370 2758 2396 gene locus_tag LOCUS_39380 2758 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39380 3750 2716 gene locus_tag LOCUS_39390 3750 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39390 5772 3793 gene locus_tag LOCUS_39400 gene parE 5772 3793 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062207.1 protein_id gnl|my_center|LOCUS_39400 6795 5809 gene locus_tag LOCUS_39410 6795 5809 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206500.1 protein_id gnl|my_center|LOCUS_39410 7594 6788 gene locus_tag LOCUS_39420 7594 6788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207738.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39420 8648 7824 gene locus_tag LOCUS_39430 8648 7824 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256988.1 protein_id gnl|my_center|LOCUS_39430 10233 9046 gene locus_tag LOCUS_39440 gene purT 10233 9046 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246432.1 protein_id gnl|my_center|LOCUS_39440 12208 10346 gene locus_tag LOCUS_39450 12208 10346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 protein_id gnl|my_center|LOCUS_39450 13998 12205 gene locus_tag LOCUS_39460 13998 12205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967136.1 protein_id gnl|my_center|LOCUS_39460 >Feature sequence130 196 1062 gene locus_tag LOCUS_39470 196 1062 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289657.1 protein_id gnl|my_center|LOCUS_39470 1075 1986 gene locus_tag LOCUS_39480 1075 1986 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130090.1 protein_id gnl|my_center|LOCUS_39480 2067 2903 gene locus_tag LOCUS_39490 2067 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 2798 3193 gene locus_tag LOCUS_39500 2798 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 3193 3666 gene locus_tag LOCUS_39510 3193 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 3810 4148 gene locus_tag LOCUS_39520 3810 4148 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947952.1 protein_id gnl|my_center|LOCUS_39520 4145 4357 gene locus_tag LOCUS_39530 4145 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 4345 4623 gene locus_tag LOCUS_39540 4345 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 4566 5282 gene locus_tag LOCUS_39550 4566 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 5207 6799 gene locus_tag LOCUS_39560 5207 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 6880 7152 gene locus_tag LOCUS_39570 6880 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39570 7062 7379 gene locus_tag LOCUS_39580 7062 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39580 7376 7819 gene locus_tag LOCUS_39590 7376 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39590 7833 8705 gene locus_tag LOCUS_39600 7833 8705 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_39600 8747 10345 gene locus_tag LOCUS_39610 8747 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 10369 11274 gene locus_tag LOCUS_39620 10369 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39620 11232 11522 gene locus_tag LOCUS_39630 11232 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39630 12362 11952 gene locus_tag LOCUS_39640 12362 11952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39640 12914 13882 gene locus_tag LOCUS_39650 12914 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39650 13891 14733 gene locus_tag LOCUS_39660 13891 14733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39660 14856 16052 gene locus_tag LOCUS_39670 14856 16052 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390075.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39670 16049 16237 gene locus_tag LOCUS_39680 16049 16237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39680 16263 17393 gene locus_tag LOCUS_39690 16263 17393 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878541.1 protein_id gnl|my_center|LOCUS_39690 >Feature sequence131 463 1176 gene locus_tag LOCUS_39700 463 1176 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459370.1 protein_id gnl|my_center|LOCUS_39700 1173 2522 gene locus_tag LOCUS_39710 1173 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 2738 3859 gene locus_tag LOCUS_39720 gene ugpC 2738 3859 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_39720 3889 5637 gene locus_tag LOCUS_39730 3889 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39730 5580 6905 gene locus_tag LOCUS_39740 5580 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39740 6895 7890 gene locus_tag LOCUS_39750 6895 7890 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259689.1 protein_id gnl|my_center|LOCUS_39750 7891 8802 gene locus_tag LOCUS_39760 7891 8802 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259690.1 protein_id gnl|my_center|LOCUS_39760 8828 9769 gene locus_tag LOCUS_39770 8828 9769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 9849 10928 gene locus_tag LOCUS_39780 9849 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 10925 13240 gene locus_tag LOCUS_39790 10925 13240 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259692.1 protein_id gnl|my_center|LOCUS_39790 13266 13544 gene locus_tag LOCUS_39800 13266 13544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 13511 14104 gene locus_tag LOCUS_39810 13511 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39810 14132 15103 gene locus_tag LOCUS_39820 14132 15103 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909515.1 protein_id gnl|my_center|LOCUS_39820 15891 16385 gene locus_tag LOCUS_39830 15891 16385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 16485 16931 gene locus_tag LOCUS_39840 16485 16931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 16975 18447 gene locus_tag LOCUS_39850 16975 18447 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993891.1 protein_id gnl|my_center|LOCUS_39850 19650 18601 gene locus_tag LOCUS_39860 19650 18601 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171504.1 protein_id gnl|my_center|LOCUS_39860 >Feature sequence132 1187 432 gene locus_tag LOCUS_39870 1187 432 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_39870 1331 2212 gene locus_tag LOCUS_39880 1331 2212 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243004.1 protein_id gnl|my_center|LOCUS_39880 2292 2765 gene locus_tag LOCUS_39890 2292 2765 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965933.1 protein_id gnl|my_center|LOCUS_39890 2985 4721 gene locus_tag LOCUS_39900 2985 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 4718 7621 gene locus_tag LOCUS_39910 4718 7621 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610086.1 protein_id gnl|my_center|LOCUS_39910 7659 7868 gene locus_tag LOCUS_39920 7659 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 8548 7943 gene locus_tag LOCUS_39930 gene yfbR 8548 7943 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210283.1 protein_id gnl|my_center|LOCUS_39930 8758 10308 gene locus_tag LOCUS_39940 gene fumA 8758 10308 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413503.1 protein_id gnl|my_center|LOCUS_39940 10373 11305 gene locus_tag LOCUS_39950 10373 11305 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886390.1 protein_id gnl|my_center|LOCUS_39950 11377 13179 gene locus_tag LOCUS_39960 11377 13179 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_39960 13352 14089 gene locus_tag LOCUS_39970 13352 14089 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640997.1 protein_id gnl|my_center|LOCUS_39970 15210 14341 gene locus_tag LOCUS_39980 15210 14341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 15375 16454 gene locus_tag LOCUS_39990 15375 16454 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_39990 16720 17124 gene locus_tag LOCUS_40000 16720 17124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 17511 17056 gene locus_tag LOCUS_40010 17511 17056 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313306.1 protein_id gnl|my_center|LOCUS_40010 17924 18532 gene locus_tag LOCUS_40020 17924 18532 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566514.1 protein_id gnl|my_center|LOCUS_40020 18534 18773 gene locus_tag LOCUS_40030 18534 18773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40030 18746 19819 gene locus_tag LOCUS_40040 gene pucK 18746 19819 CDS product uric acid permease PucK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244570.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40040 >Feature sequence133 2097 178 gene locus_tag LOCUS_40050 gene thrS 2097 178 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243399.1 protein_id gnl|my_center|LOCUS_40050 2678 2436 gene locus_tag LOCUS_40060 2678 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 3661 2801 gene locus_tag LOCUS_40070 3661 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 4327 4136 gene locus_tag LOCUS_40080 4327 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 4771 5652 gene locus_tag LOCUS_40090 4771 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 5685 5885 gene locus_tag LOCUS_40100 5685 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 6159 6332 gene locus_tag LOCUS_40110 6159 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40110 6341 7162 gene locus_tag LOCUS_40120 gene bioB 6341 7162 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815862.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40120 7699 7301 gene locus_tag LOCUS_40130 7699 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 9493 7757 gene locus_tag LOCUS_40140 9493 7757 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_40140 10209 9949 gene locus_tag LOCUS_40150 10209 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 10826 10599 gene locus_tag LOCUS_40160 10826 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40160 11437 10817 gene locus_tag LOCUS_40170 11437 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 11811 11434 gene locus_tag LOCUS_40180 11811 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 12611 11808 gene locus_tag LOCUS_40190 12611 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40190 13670 12618 gene locus_tag LOCUS_40200 13670 12618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_40200 14349 13702 gene locus_tag LOCUS_40210 14349 13702 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538207.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40210 15543 14542 gene locus_tag LOCUS_40220 15543 14542 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706159.1 protein_id gnl|my_center|LOCUS_40220 16277 15540 gene locus_tag LOCUS_40230 16277 15540 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180933263.1 protein_id gnl|my_center|LOCUS_40230 16815 16594 gene locus_tag LOCUS_40240 16815 16594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40240 17138 16812 gene locus_tag LOCUS_40250 17138 16812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40250 18201 17386 gene locus_tag LOCUS_40260 18201 17386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40260 18611 18201 gene locus_tag LOCUS_40270 18611 18201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40270 20326 18761 gene locus_tag LOCUS_40280 gene pruA 20326 18761 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259550.1 protein_id gnl|my_center|LOCUS_40280 21598 20489 gene locus_tag LOCUS_40290 gene pepQ 21598 20489 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994025.1 protein_id gnl|my_center|LOCUS_40290 22706 21747 gene locus_tag LOCUS_40300 22706 21747 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356506.1 protein_id gnl|my_center|LOCUS_40300 24075 23233 gene locus_tag LOCUS_40310 24075 23233 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776904.1 protein_id gnl|my_center|LOCUS_40310 24639 24079 gene locus_tag LOCUS_40320 24639 24079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40320 25015 24893 gene locus_tag LOCUS_40330 25015 24893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 26358 25072 gene locus_tag LOCUS_40340 26358 25072 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975884.1 protein_id gnl|my_center|LOCUS_40340 >Feature sequence134 <1 799 gene locus_tag LOCUS_40350 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000445335.1:glucose-6-phosphate dehydrogenase note possible pseudo, frameshifted 945 1136 gene locus_tag LOCUS_40360 945 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40360 1133 2062 gene locus_tag LOCUS_40370 gene gnd 1133 2062 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195906.1 protein_id gnl|my_center|LOCUS_40370 2200 2652 gene locus_tag LOCUS_40380 2200 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 2775 3506 gene locus_tag LOCUS_40390 2775 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 4708 3593 gene locus_tag LOCUS_40400 4708 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 5190 4705 gene locus_tag LOCUS_40410 5190 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 6110 5187 gene locus_tag LOCUS_40420 6110 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 6933 6268 gene locus_tag LOCUS_40430 6933 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 7258 8190 gene locus_tag LOCUS_40440 7258 8190 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_40440 8368 9102 gene locus_tag LOCUS_40450 8368 9102 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40450 9155 10768 gene locus_tag LOCUS_40460 9155 10768 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_40460 10987 11964 gene locus_tag LOCUS_40470 10987 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 11961 12581 gene locus_tag LOCUS_40480 11961 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 12578 13426 gene locus_tag LOCUS_40490 12578 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 13401 14102 gene locus_tag LOCUS_40500 13401 14102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 >Feature sequence135 2515 1823 gene locus_tag LOCUS_40510 2515 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 3085 2582 gene locus_tag LOCUS_40520 3085 2582 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970310.1 protein_id gnl|my_center|LOCUS_40520 3566 3072 gene locus_tag LOCUS_40530 3566 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 4773 3580 gene locus_tag LOCUS_40540 4773 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263244.1 protein_id gnl|my_center|LOCUS_40540 7131 4870 gene locus_tag LOCUS_40550 7131 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40550 8006 7035 gene locus_tag LOCUS_40560 8006 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40560 9289 8168 gene locus_tag LOCUS_40570 9289 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40570 10802 9279 gene locus_tag LOCUS_40580 10802 9279 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_40580 12405 10819 gene locus_tag LOCUS_40590 12405 10819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 14356 14132 gene locus_tag LOCUS_40600 14356 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40600 15963 14371 gene locus_tag LOCUS_40610 gene glmS 15963 14371 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808420.1 protein_id gnl|my_center|LOCUS_40610 16429 16190 gene locus_tag LOCUS_40620 16429 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 17766 16816 gene locus_tag LOCUS_40630 17766 16816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40630 18155 17766 gene locus_tag LOCUS_40640 18155 17766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40640 19706 18231 gene locus_tag LOCUS_40650 19706 18231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 20541 19699 gene locus_tag LOCUS_40660 gene cdaA 20541 19699 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_40660 21367 20750 gene locus_tag LOCUS_40670 21367 20750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 22049 21441 gene locus_tag LOCUS_40680 gene sigW 22049 21441 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_40680 25048 22250 gene locus_tag LOCUS_40690 gene ppc 25048 22250 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_40690 26427 25303 gene locus_tag LOCUS_40700 26427 25303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 26800 26727 gene locus_tag LOCUS_t00410 26800 26727 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 26891 26815 gene locus_tag LOCUS_t00420 26891 26815 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 27020 26944 gene locus_tag LOCUS_t00430 27020 26944 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27102 27028 gene locus_tag LOCUS_t00440 27102 27028 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence136 1496 381 gene locus_tag LOCUS_40710 1496 381 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088925.1 protein_id gnl|my_center|LOCUS_40710 2371 1658 gene locus_tag LOCUS_40720 2371 1658 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080944.1 protein_id gnl|my_center|LOCUS_40720 2856 2440 gene locus_tag LOCUS_40730 2856 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 3602 2883 gene locus_tag LOCUS_40740 3602 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 3871 3599 gene locus_tag LOCUS_40750 3871 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 4821 3868 gene locus_tag LOCUS_40760 4821 3868 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386917.1 protein_id gnl|my_center|LOCUS_40760 5522 4818 gene locus_tag LOCUS_40770 5522 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40770 5884 5519 gene locus_tag LOCUS_40780 5884 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40780 6468 5881 gene locus_tag LOCUS_40790 6468 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40790 6991 6419 gene locus_tag LOCUS_40800 6991 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40800 7966 7331 gene locus_tag LOCUS_40810 7966 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40810 8563 7985 gene locus_tag LOCUS_40820 8563 7985 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965644.1 protein_id gnl|my_center|LOCUS_40820 9068 8529 gene locus_tag LOCUS_40830 9068 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40830 9664 8987 gene locus_tag LOCUS_40840 9664 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40840 10451 9666 gene locus_tag LOCUS_40850 10451 9666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 11384 10542 gene locus_tag LOCUS_40860 11384 10542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 12558 11563 gene locus_tag LOCUS_40870 12558 11563 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022166.1 protein_id gnl|my_center|LOCUS_40870 13531 12632 gene locus_tag LOCUS_40880 13531 12632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 14311 13532 gene locus_tag LOCUS_40890 14311 13532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 14553 14308 gene locus_tag LOCUS_40900 14553 14308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 15295 14567 gene locus_tag LOCUS_40910 15295 14567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 15564 15289 gene locus_tag LOCUS_40920 15564 15289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 15743 16531 gene locus_tag LOCUS_40930 15743 16531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 16546 16758 gene locus_tag LOCUS_40940 16546 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 17323 16964 gene locus_tag LOCUS_40950 17323 16964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 18134 17388 gene locus_tag LOCUS_40960 18134 17388 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891335.1 protein_id gnl|my_center|LOCUS_40960 19194 18304 gene locus_tag LOCUS_40970 gene mneS 19194 18304 CDS product manganese transporter MneS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233995.1 protein_id gnl|my_center|LOCUS_40970 20462 19551 gene locus_tag LOCUS_40980 20462 19551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 21048 20767 gene locus_tag LOCUS_40990 21048 20767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40990 21365 21033 gene locus_tag LOCUS_41000 21365 21033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41000 22387 21401 gene locus_tag LOCUS_41010 22387 21401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41010 23636 22569 gene locus_tag LOCUS_41020 23636 22569 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_41020 24903 23776 gene locus_tag LOCUS_41030 24903 23776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 25076 26236 gene locus_tag LOCUS_41040 25076 26236 CDS product conserved virulence factor C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398677.1 protein_id gnl|my_center|LOCUS_41040 >Feature sequence137 905 1537 gene locus_tag LOCUS_41050 905 1537 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243016.1 protein_id gnl|my_center|LOCUS_41050 1646 2236 gene locus_tag LOCUS_41060 1646 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 2749 2570 gene locus_tag LOCUS_41070 2749 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 2957 2733 gene locus_tag LOCUS_41080 2957 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41080 3378 2965 gene locus_tag LOCUS_41090 3378 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 4226 3351 gene locus_tag LOCUS_41100 4226 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41100 5782 4223 gene locus_tag LOCUS_41110 5782 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41110 6877 6275 gene locus_tag LOCUS_41120 gene srtA 6877 6275 CDS product sortase SrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244666.1 protein_id gnl|my_center|LOCUS_41120 7151 6894 gene locus_tag LOCUS_41130 7151 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41130 7771 7154 gene locus_tag LOCUS_41140 7771 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41140 8205 7903 gene locus_tag LOCUS_41150 8205 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 8363 8175 gene locus_tag LOCUS_41160 8363 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 >Feature sequence138 602 1120 gene locus_tag LOCUS_41170 602 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 1131 1562 gene locus_tag LOCUS_41180 1131 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 1698 2408 gene locus_tag LOCUS_41190 1698 2408 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440146.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41190 2472 3404 gene locus_tag LOCUS_41200 2472 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 3520 4194 gene locus_tag LOCUS_41210 3520 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41210 4191 4667 gene locus_tag LOCUS_41220 4191 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41220 4945 5466 gene locus_tag LOCUS_41230 4945 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41230 5478 5807 gene locus_tag LOCUS_41240 5478 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41240 >Feature sequence139 1232 2146 gene locus_tag LOCUS_41250 gene murQ 1232 2146 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963499.1 protein_id gnl|my_center|LOCUS_41250 2206 3663 gene locus_tag LOCUS_41260 2206 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 3744 4649 gene locus_tag LOCUS_41270 3744 4649 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003052879.1 protein_id gnl|my_center|LOCUS_41270 4765 5529 gene locus_tag LOCUS_41280 4765 5529 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225765.1 protein_id gnl|my_center|LOCUS_41280 5719 6651 gene locus_tag LOCUS_41290 5719 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 6686 7393 gene locus_tag LOCUS_41300 6686 7393 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222498.1 protein_id gnl|my_center|LOCUS_41300 7413 8552 gene locus_tag LOCUS_41310 7413 8552 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_41310 8571 9668 gene locus_tag LOCUS_41320 8571 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 9665 10852 gene locus_tag LOCUS_41330 9665 10852 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405142.1 protein_id gnl|my_center|LOCUS_41330 10941 11717 gene locus_tag LOCUS_41340 10941 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 12058 12729 gene locus_tag LOCUS_41350 12058 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 12684 13154 gene locus_tag LOCUS_41360 12684 13154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 13408 15690 gene locus_tag LOCUS_41370 13408 15690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 15947 16780 gene locus_tag LOCUS_41380 15947 16780 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_41380 16871 17689 gene locus_tag LOCUS_41390 16871 17689 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_41390 18015 19526 gene locus_tag LOCUS_41400 18015 19526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 19559 19684 gene locus_tag LOCUS_41410 19559 19684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 >Feature sequence140 476 1495 gene locus_tag LOCUS_41420 476 1495 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537580.1 protein_id gnl|my_center|LOCUS_41420 1518 3143 gene locus_tag LOCUS_41430 1518 3143 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_41430 3167 3628 gene locus_tag LOCUS_41440 3167 3628 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033059696.1 protein_id gnl|my_center|LOCUS_41440 3802 4674 gene locus_tag LOCUS_41450 3802 4674 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41450 4936 5889 gene locus_tag LOCUS_41460 4936 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 5886 6194 gene locus_tag LOCUS_41470 5886 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 6296 6511 gene locus_tag LOCUS_41480 6296 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 6508 6855 gene locus_tag LOCUS_41490 6508 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41490 6852 7169 gene locus_tag LOCUS_41500 6852 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41500 7189 8019 gene locus_tag LOCUS_41510 7189 8019 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 protein_id gnl|my_center|LOCUS_41510 8059 9861 gene locus_tag LOCUS_41520 8059 9861 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_41520 9848 11419 gene locus_tag LOCUS_41530 9848 11419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 11592 11951 gene locus_tag LOCUS_41540 11592 11951 CDS product Lin0512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721298.1 protein_id gnl|my_center|LOCUS_41540 12033 12836 gene locus_tag LOCUS_41550 gene uppP 12033 12836 CDS product bacitracin resistance undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796255.1 protein_id gnl|my_center|LOCUS_41550 13967 12930 gene locus_tag LOCUS_41560 13967 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41560 14344 13958 gene locus_tag LOCUS_41570 14344 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41570 16614 14452 gene locus_tag LOCUS_41580 gene helD 16614 14452 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035473.1 protein_id gnl|my_center|LOCUS_41580 16661 16840 gene locus_tag LOCUS_41590 16661 16840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 17422 18213 gene locus_tag LOCUS_41600 17422 18213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41600 18242 18514 gene locus_tag LOCUS_41610 18242 18514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 18988 18509 gene locus_tag LOCUS_41620 18988 18509 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460051.1 protein_id gnl|my_center|LOCUS_41620 19619 19005 gene locus_tag LOCUS_41630 19619 19005 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418910.1 protein_id gnl|my_center|LOCUS_41630 19819 20406 gene locus_tag LOCUS_41640 19819 20406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 20571 20990 gene locus_tag LOCUS_41650 20571 20990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 21183 22391 gene locus_tag LOCUS_41660 gene dacF 21183 22391 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_41660 22532 22885 gene locus_tag LOCUS_41670 gene spoIIAA 22532 22885 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059135.1 protein_id gnl|my_center|LOCUS_41670 22882 23370 gene locus_tag LOCUS_41680 gene spoIIAB 22882 23370 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357714.1 protein_id gnl|my_center|LOCUS_41680 23348 24103 gene locus_tag LOCUS_41690 gene sigF 23348 24103 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_41690 24223 24882 gene locus_tag LOCUS_41700 gene spoVAA 24223 24882 CDS product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438361.1 protein_id gnl|my_center|LOCUS_41700 24895 25323 gene locus_tag LOCUS_41710 gene spoVAB 24895 25323 CDS product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572931.1 protein_id gnl|my_center|LOCUS_41710 25345 26979 gene locus_tag LOCUS_41720 25345 26979 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_41720 27092 28423 gene locus_tag LOCUS_41730 gene lysA 27092 28423 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280659.1 protein_id gnl|my_center|LOCUS_41730 28449 28880 gene locus_tag LOCUS_41740 28449 28880 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_41740 >Feature sequence141 127 203 gene locus_tag LOCUS_t00450 127 203 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 211 286 gene locus_tag LOCUS_t00460 211 286 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 294 370 gene locus_tag LOCUS_t00470 294 370 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 385 460 gene locus_tag LOCUS_t00480 385 460 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 499 584 gene locus_tag LOCUS_t00490 499 584 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 595 670 gene locus_tag LOCUS_t00500 595 670 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1455 1733 gene locus_tag LOCUS_41750 1455 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41750 1813 2952 gene locus_tag LOCUS_41760 1813 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 3050 4171 gene locus_tag LOCUS_41770 gene ugpC 3050 4171 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_41770 4433 5371 gene locus_tag LOCUS_41780 gene hprK 4433 5371 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_41780 5387 6436 gene locus_tag LOCUS_41790 gene lgt 5387 6436 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 protein_id gnl|my_center|LOCUS_41790 6420 7079 gene locus_tag LOCUS_41800 gene ppaX 6420 7079 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 protein_id gnl|my_center|LOCUS_41800 7076 7561 gene locus_tag LOCUS_41810 7076 7561 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255064.1 protein_id gnl|my_center|LOCUS_41810 7814 9046 gene locus_tag LOCUS_41820 7814 9046 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244441.1 protein_id gnl|my_center|LOCUS_41820 9043 9681 gene locus_tag LOCUS_41830 gene hisG 9043 9681 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968235.1 protein_id gnl|my_center|LOCUS_41830 9754 11070 gene locus_tag LOCUS_41840 gene hisD 9754 11070 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_41840 11191 11790 gene locus_tag LOCUS_41850 gene hisB 11191 11790 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 protein_id gnl|my_center|LOCUS_41850 11791 12420 gene locus_tag LOCUS_41860 gene hisH 11791 12420 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244267.1 protein_id gnl|my_center|LOCUS_41860 12443 13174 gene locus_tag LOCUS_41870 gene hisA 12443 13174 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242559.1 protein_id gnl|my_center|LOCUS_41870 13205 13963 gene locus_tag LOCUS_41880 gene hisF 13205 13963 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_41880 13960 14721 gene locus_tag LOCUS_41890 gene hisIE 13960 14721 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_41890 14764 15570 gene locus_tag LOCUS_41900 14764 15570 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_41900 15882 16610 gene locus_tag LOCUS_41910 15882 16610 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107420.1 protein_id gnl|my_center|LOCUS_41910 17045 17281 gene locus_tag LOCUS_41920 17045 17281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 17278 18471 gene locus_tag LOCUS_41930 17278 18471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41930 18615 19205 gene locus_tag LOCUS_41940 18615 19205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41940 19124 19561 gene locus_tag LOCUS_41950 19124 19561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41950 >Feature sequence142 379 1524 gene locus_tag LOCUS_41960 379 1524 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393523.1 protein_id gnl|my_center|LOCUS_41960 2374 1616 gene locus_tag LOCUS_41970 2374 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41970 2475 2338 gene locus_tag LOCUS_41980 2475 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 3293 2451 gene locus_tag LOCUS_41990 3293 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41990 3719 3300 gene locus_tag LOCUS_42000 3719 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 4907 3831 gene locus_tag LOCUS_42010 4907 3831 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_42010 5257 6093 gene locus_tag LOCUS_42020 5257 6093 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_42020 6667 6131 gene locus_tag LOCUS_42030 6667 6131 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_42030 6874 8205 gene locus_tag LOCUS_42040 6874 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 8198 8947 gene locus_tag LOCUS_42050 8198 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 8993 9340 gene locus_tag LOCUS_42060 8993 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 9286 9576 gene locus_tag LOCUS_42070 9286 9576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 9897 9646 gene locus_tag LOCUS_42080 9897 9646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 10876 10046 gene locus_tag LOCUS_42090 gene speE 10876 10046 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227543.1 protein_id gnl|my_center|LOCUS_42090 11104 13218 gene locus_tag LOCUS_42100 11104 13218 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372988.1 protein_id gnl|my_center|LOCUS_42100 13840 13325 gene locus_tag LOCUS_42110 13840 13325 CDS product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244446.1 protein_id gnl|my_center|LOCUS_42110 13993 15993 gene locus_tag LOCUS_42120 13993 15993 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123042767.1 protein_id gnl|my_center|LOCUS_42120 16142 16882 gene locus_tag LOCUS_42130 16142 16882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 17279 17749 gene locus_tag LOCUS_42140 17279 17749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 19641 18367 gene locus_tag LOCUS_42150 gene gdhA 19641 18367 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_42150 >Feature sequence143 1091 579 gene locus_tag LOCUS_42160 1091 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 2718 2332 gene locus_tag LOCUS_42170 2718 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 3482 2718 gene locus_tag LOCUS_42180 3482 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42180 5209 3479 gene locus_tag LOCUS_42190 5209 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 6489 5230 gene locus_tag LOCUS_42200 6489 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459357.1 protein_id gnl|my_center|LOCUS_42200 6748 7119 gene locus_tag LOCUS_42210 6748 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 7116 7430 gene locus_tag LOCUS_42220 7116 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 8987 7524 gene locus_tag LOCUS_42230 8987 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 9102 9782 gene locus_tag LOCUS_42240 9102 9782 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399300.1 protein_id gnl|my_center|LOCUS_42240 10124 9837 gene locus_tag LOCUS_42250 10124 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 12260 10173 gene locus_tag LOCUS_42260 gene recG 12260 10173 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000816.1 protein_id gnl|my_center|LOCUS_42260 13117 12257 gene locus_tag LOCUS_42270 13117 12257 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684725.1 protein_id gnl|my_center|LOCUS_42270 14003 13137 gene locus_tag LOCUS_42280 14003 13137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42280 14899 13997 gene locus_tag LOCUS_42290 14899 13997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42290 15275 14916 gene locus_tag LOCUS_42300 15275 14916 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 protein_id gnl|my_center|LOCUS_42300 16691 15525 gene locus_tag LOCUS_42310 16691 15525 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161410139.1 protein_id gnl|my_center|LOCUS_42310 18046 16688 gene locus_tag LOCUS_42320 18046 16688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 18360 18046 gene locus_tag LOCUS_42330 18360 18046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 19457 18657 gene locus_tag LOCUS_42340 19457 18657 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 protein_id gnl|my_center|LOCUS_42340 20461 19568 gene locus_tag LOCUS_42350 20461 19568 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_42350 21883 20546 gene locus_tag LOCUS_42360 21883 20546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 22143 22331 gene locus_tag LOCUS_42370 gene rpmB 22143 22331 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221548.1 protein_id gnl|my_center|LOCUS_42370 22621 22382 gene locus_tag LOCUS_42380 22621 22382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 23028 22741 gene locus_tag LOCUS_42390 23028 22741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 23692 23048 gene locus_tag LOCUS_42400 gene rpe 23692 23048 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_42400 24633 23695 gene locus_tag LOCUS_42410 gene rsgA 24633 23695 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_42410 24959 24630 gene locus_tag LOCUS_42420 24959 24630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 25150 24881 gene locus_tag LOCUS_42430 25150 24881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 26847 25201 gene locus_tag LOCUS_42440 gene pknB 26847 25201 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42440 27563 26853 gene locus_tag LOCUS_42450 27563 26853 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 protein_id gnl|my_center|LOCUS_42450 28658 27612 gene locus_tag LOCUS_42460 gene rlmN 28658 27612 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 protein_id gnl|my_center|LOCUS_42460 30672 28765 gene locus_tag LOCUS_42470 30672 28765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 31616 30669 gene locus_tag LOCUS_42480 gene fmt 31616 30669 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_42480 32105 31620 gene locus_tag LOCUS_42490 gene def 32105 31620 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232077.1 protein_id gnl|my_center|LOCUS_42490 34640 32154 gene locus_tag LOCUS_42500 gene priA 34640 32154 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_42500 34870 34637 gene locus_tag LOCUS_42510 34870 34637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 35904 34771 gene locus_tag LOCUS_42520 gene coaBC 35904 34771 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911730.1 protein_id gnl|my_center|LOCUS_42520 >Feature sequence144 1433 795 gene locus_tag LOCUS_42530 1433 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42530 2176 1430 gene locus_tag LOCUS_42540 2176 1430 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261764.1 protein_id gnl|my_center|LOCUS_42540 3410 2316 gene locus_tag LOCUS_42550 gene gerM 3410 2316 CDS product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126748.1 protein_id gnl|my_center|LOCUS_42550 3552 3692 gene locus_tag LOCUS_42560 3552 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 3689 4078 gene locus_tag LOCUS_42570 3689 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42570 >Feature sequence145 476 1234 gene locus_tag LOCUS_42580 476 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 1177 1503 gene locus_tag LOCUS_42590 1177 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 1485 1643 gene locus_tag LOCUS_42600 1485 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 1751 1969 gene locus_tag LOCUS_42610 1751 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 1945 2352 gene locus_tag LOCUS_42620 1945 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42620 2352 3962 gene locus_tag LOCUS_42630 2352 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 4833 3856 gene locus_tag LOCUS_42640 4833 3856 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246384.1 protein_id gnl|my_center|LOCUS_42640 4892 5032 gene locus_tag LOCUS_42650 4892 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 6168 5215 gene locus_tag LOCUS_42660 6168 5215 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642534.1 protein_id gnl|my_center|LOCUS_42660 6490 6329 gene locus_tag LOCUS_42670 6490 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42670 6687 6487 gene locus_tag LOCUS_42680 6687 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42680 >Feature sequence146 310 1143 gene locus_tag LOCUS_42690 gene kduI 310 1143 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423611.1 protein_id gnl|my_center|LOCUS_42690 1215 1970 gene locus_tag LOCUS_42700 1215 1970 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286332.1 protein_id gnl|my_center|LOCUS_42700 2015 2770 gene locus_tag LOCUS_42710 gene kduD 2015 2770 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161658.1 protein_id gnl|my_center|LOCUS_42710 3148 3921 gene locus_tag LOCUS_42720 3148 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 4001 4651 gene locus_tag LOCUS_42730 4001 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 5726 4749 gene locus_tag LOCUS_42740 5726 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 5877 6842 gene locus_tag LOCUS_42750 5877 6842 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109290171.1 protein_id gnl|my_center|LOCUS_42750 7048 7695 gene locus_tag LOCUS_42760 7048 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 7688 8770 gene locus_tag LOCUS_42770 7688 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 8763 10172 gene locus_tag LOCUS_42780 8763 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 10200 11840 gene locus_tag LOCUS_42790 10200 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 12195 13433 gene locus_tag LOCUS_42800 12195 13433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42800 13406 13852 gene locus_tag LOCUS_42810 13406 13852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42810 14265 15590 gene locus_tag LOCUS_42820 14265 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 15787 16371 gene locus_tag LOCUS_42830 15787 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 16368 18758 gene locus_tag LOCUS_42840 16368 18758 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259688.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42840 18748 19443 gene locus_tag LOCUS_42850 18748 19443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42850 19452 19691 gene locus_tag LOCUS_42860 19452 19691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42860 19725 20585 gene locus_tag LOCUS_42870 19725 20585 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259690.1 protein_id gnl|my_center|LOCUS_42870 20628 22613 gene locus_tag LOCUS_42880 20628 22613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259691.1 protein_id gnl|my_center|LOCUS_42880 22607 23689 gene locus_tag LOCUS_42890 22607 23689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42890 23686 24873 gene locus_tag LOCUS_42900 23686 24873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 24870 25787 gene locus_tag LOCUS_42910 24870 25787 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259693.1 protein_id gnl|my_center|LOCUS_42910 25975 26766 gene locus_tag LOCUS_42920 25975 26766 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909515.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42920 26980 27309 gene locus_tag LOCUS_42930 26980 27309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 >Feature sequence147 838 203 gene locus_tag LOCUS_42940 838 203 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244782.1 protein_id gnl|my_center|LOCUS_42940 1509 835 gene locus_tag LOCUS_42950 gene mtnX 1509 835 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245748.1 protein_id gnl|my_center|LOCUS_42950 2738 1506 gene locus_tag LOCUS_42960 gene mtnW 2738 1506 CDS product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245108.1 protein_id gnl|my_center|LOCUS_42960 3610 2735 gene locus_tag LOCUS_42970 gene proI 3610 2735 CDS product pyrroline-5-carboxylate reductase ProI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027249.1 protein_id gnl|my_center|LOCUS_42970 4898 3651 gene locus_tag LOCUS_42980 4898 3651 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_42980 6063 4966 gene locus_tag LOCUS_42990 gene proB 6063 4966 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744710.1 protein_id gnl|my_center|LOCUS_42990 7707 6508 gene locus_tag LOCUS_43000 gene mtnE 7707 6508 CDS product methionine-glutamine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244774.1 protein_id gnl|my_center|LOCUS_43000 8292 7810 gene locus_tag LOCUS_43010 8292 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 8432 9244 gene locus_tag LOCUS_43020 8432 9244 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 protein_id gnl|my_center|LOCUS_43020 9529 9251 gene locus_tag LOCUS_43030 9529 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43030 9909 9418 gene locus_tag LOCUS_43040 9909 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43040 10341 11792 gene locus_tag LOCUS_43050 gene leuC 10341 11792 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229604.1 protein_id gnl|my_center|LOCUS_43050 11825 12412 gene locus_tag LOCUS_43060 gene leuD 11825 12412 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330456.1 protein_id gnl|my_center|LOCUS_43060 12703 14127 gene locus_tag LOCUS_43070 12703 14127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 14175 14717 gene locus_tag LOCUS_43080 14175 14717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 14867 15544 gene locus_tag LOCUS_43090 gene nth 14867 15544 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933025.1 protein_id gnl|my_center|LOCUS_43090 15551 15823 gene locus_tag LOCUS_43100 15551 15823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 >Feature sequence148 306 566 gene locus_tag LOCUS_43110 306 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 563 1588 gene locus_tag LOCUS_43120 563 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43120 2281 1616 gene locus_tag LOCUS_43130 2281 1616 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393188.1 protein_id gnl|my_center|LOCUS_43130 3542 3201 gene locus_tag LOCUS_43140 3542 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43140 3859 3473 gene locus_tag LOCUS_43150 3859 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43150 5007 3862 gene locus_tag LOCUS_43160 5007 3862 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393190.1 protein_id gnl|my_center|LOCUS_43160 5275 5970 gene locus_tag LOCUS_43170 5275 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 6044 7120 gene locus_tag LOCUS_43180 6044 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 7142 7786 gene locus_tag LOCUS_43190 7142 7786 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136889.1 protein_id gnl|my_center|LOCUS_43190 8069 7878 gene locus_tag LOCUS_43200 8069 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 8377 8526 gene locus_tag LOCUS_43210 8377 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 9344 8523 gene locus_tag LOCUS_43220 9344 8523 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260128.1 protein_id gnl|my_center|LOCUS_43220 9596 11644 gene locus_tag LOCUS_43230 9596 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43230 11542 12648 gene locus_tag LOCUS_43240 11542 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43240 14804 12684 gene locus_tag LOCUS_43250 14804 12684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 14998 14771 gene locus_tag LOCUS_43260 14998 14771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 16724 15183 gene locus_tag LOCUS_43270 16724 15183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43270 <17282 16758 gene locus_tag LOCUS_43280 <17282 16758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775817.1:carbohydrate ABC transporter permease >Feature sequence149 762 463 gene locus_tag LOCUS_43290 762 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 1316 825 gene locus_tag LOCUS_43300 gene ectA 1316 825 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449632.1 protein_id gnl|my_center|LOCUS_43300 2209 1331 gene locus_tag LOCUS_43310 gene ehuA 2209 1331 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272242.1 protein_id gnl|my_center|LOCUS_43310 2959 2285 gene locus_tag LOCUS_43320 gene ehuD 2959 2285 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459282.1 protein_id gnl|my_center|LOCUS_43320 3616 2963 gene locus_tag LOCUS_43330 gene ehuC 3616 2963 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459281.1 protein_id gnl|my_center|LOCUS_43330 4469 3618 gene locus_tag LOCUS_43340 gene ehuB 4469 3618 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459280.1 protein_id gnl|my_center|LOCUS_43340 5217 5981 gene locus_tag LOCUS_43350 gene queC 5217 5981 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711596.1 protein_id gnl|my_center|LOCUS_43350 6151 6486 gene locus_tag LOCUS_43360 6151 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43360 6479 6688 gene locus_tag LOCUS_43370 6479 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 6688 7242 gene locus_tag LOCUS_43380 gene queE 6688 7242 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090918384.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43380 7573 7346 gene locus_tag LOCUS_43390 7573 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 7511 8008 gene locus_tag LOCUS_43400 gene queF 7511 8008 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986050.1 protein_id gnl|my_center|LOCUS_43400 9283 9756 gene locus_tag LOCUS_43410 9283 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 9792 10703 gene locus_tag LOCUS_43420 9792 10703 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549222.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43420 11168 10857 gene locus_tag LOCUS_43430 11168 10857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 11730 11212 gene locus_tag LOCUS_43440 11730 11212 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43440 11891 11694 gene locus_tag LOCUS_43450 11891 11694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 12629 11922 gene locus_tag LOCUS_43460 12629 11922 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_43460 12962 12633 gene locus_tag LOCUS_43470 12962 12633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 14062 12902 gene locus_tag LOCUS_43480 14062 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 15111 14260 gene locus_tag LOCUS_43490 15111 14260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43490 15788 15108 gene locus_tag LOCUS_43500 15788 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43500 17203 15788 gene locus_tag LOCUS_43510 gene pelF 17203 15788 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964052.1 protein_id gnl|my_center|LOCUS_43510 18744 17209 gene locus_tag LOCUS_43520 18744 17209 CDS product DUF2194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964051.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43520 19923 19018 gene locus_tag LOCUS_43530 19923 19018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964050.1 protein_id gnl|my_center|LOCUS_43530 20761 19916 gene locus_tag LOCUS_43540 20761 19916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 22101 20758 gene locus_tag LOCUS_43550 22101 20758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43550 >Feature sequence150 1104 160 gene locus_tag LOCUS_43560 1104 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 >Feature sequence151 85 399 gene locus_tag LOCUS_43570 85 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392166.1 protein_id gnl|my_center|LOCUS_43570 399 755 gene locus_tag LOCUS_43580 gene tnpB 399 755 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_43580 836 2269 gene locus_tag LOCUS_43590 836 2269 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461096.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43590 2227 2397 gene locus_tag LOCUS_43600 2227 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 >Feature sequence152 799 83 gene locus_tag LOCUS_43610 799 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43610 1308 796 gene locus_tag LOCUS_43620 1308 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43620 >Feature sequence153 36 269 gene locus_tag LOCUS_43630 36 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 371 940 gene locus_tag LOCUS_43640 371 940 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228501.1 protein_id gnl|my_center|LOCUS_43640 937 1671 gene locus_tag LOCUS_43650 937 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43650 1617 1952 gene locus_tag LOCUS_43660 1617 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43660 1977 2336 gene locus_tag LOCUS_43670 1977 2336 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222779.1 protein_id gnl|my_center|LOCUS_43670 2386 3588 gene locus_tag LOCUS_43680 2386 3588 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272338.1 protein_id gnl|my_center|LOCUS_43680 3619 4509 gene locus_tag LOCUS_43690 gene exnP 3619 4509 CDS product 5'-3' exonuclease ExnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230763.1 protein_id gnl|my_center|LOCUS_43690 4851 4585 gene locus_tag LOCUS_43700 4851 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 5209 4913 gene locus_tag LOCUS_43710 5209 4913 CDS product DUF3055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439025.1 protein_id gnl|my_center|LOCUS_43710 5399 6394 gene locus_tag LOCUS_43720 5399 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 6592 7053 gene locus_tag LOCUS_43730 6592 7053 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082082.1 protein_id gnl|my_center|LOCUS_43730 7120 7911 gene locus_tag LOCUS_43740 7120 7911 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_43740 8008 9357 gene locus_tag LOCUS_43750 8008 9357 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588613.1 protein_id gnl|my_center|LOCUS_43750 9412 10170 gene locus_tag LOCUS_43760 gene ecsA 9412 10170 CDS product ABC transporter ATP-binding protein EcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292603.1 protein_id gnl|my_center|LOCUS_43760 10167 11417 gene locus_tag LOCUS_43770 gene ecsB 10167 11417 CDS product ABC transporter permease EcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089155.1 protein_id gnl|my_center|LOCUS_43770 11595 12692 gene locus_tag LOCUS_43780 11595 12692 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161413.1 protein_id gnl|my_center|LOCUS_43780 12689 14080 gene locus_tag LOCUS_43790 gene murF 12689 14080 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595957.1 protein_id gnl|my_center|LOCUS_43790 14077 15246 gene locus_tag LOCUS_43800 gene alr 14077 15246 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390615.1 protein_id gnl|my_center|LOCUS_43800 16582 15257 gene locus_tag LOCUS_43810 16582 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 >Feature sequence154 266 448 gene locus_tag LOCUS_43820 266 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 1332 1883 gene locus_tag LOCUS_43830 1332 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43830 2041 3189 gene locus_tag LOCUS_43840 2041 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43840 3225 3944 gene locus_tag LOCUS_43850 gene cas5c 3225 3944 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009051.1 protein_id gnl|my_center|LOCUS_43850 4085 5848 gene locus_tag LOCUS_43860 gene cas8c 4085 5848 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922511.1 protein_id gnl|my_center|LOCUS_43860 5849 6715 gene locus_tag LOCUS_43870 gene cas7c 5849 6715 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_43870 7300 8334 gene locus_tag LOCUS_43880 gene cas1c 7300 8334 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_43880 8339 8629 gene locus_tag LOCUS_43890 gene cas2 8339 8629 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_43890 8822 8975 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgctccccatgcgggagcgtg 10151 9189 gene locus_tag LOCUS_43900 10151 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 10317 10126 gene locus_tag LOCUS_43910 10317 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 10883 10389 gene locus_tag LOCUS_43920 10883 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 12106 10898 gene locus_tag LOCUS_43930 12106 10898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43930 12399 12641 gene locus_tag LOCUS_43940 12399 12641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 13051 12863 gene locus_tag LOCUS_43950 13051 12863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 >Feature sequence155 390 1997 gene locus_tag LOCUS_43960 390 1997 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_43960 1994 3928 gene locus_tag LOCUS_43970 1994 3928 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_43970 3925 4926 gene locus_tag LOCUS_43980 3925 4926 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311043.1 protein_id gnl|my_center|LOCUS_43980 5088 6587 gene locus_tag LOCUS_43990 gene gguA 5088 6587 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_43990 6617 7603 gene locus_tag LOCUS_44000 6617 7603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_44000 7720 8724 gene locus_tag LOCUS_44010 7720 8724 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_44010 8784 9428 gene locus_tag LOCUS_44020 gene fsa 8784 9428 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964656.1 protein_id gnl|my_center|LOCUS_44020 9555 11081 gene locus_tag LOCUS_44030 gene xylB 9555 11081 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764573.1 protein_id gnl|my_center|LOCUS_44030 11543 12187 gene locus_tag LOCUS_44040 11543 12187 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082842.1 protein_id gnl|my_center|LOCUS_44040 12184 12981 gene locus_tag LOCUS_44050 gene fetB 12184 12981 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679254.1 protein_id gnl|my_center|LOCUS_44050 13002 13751 gene locus_tag LOCUS_44060 13002 13751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 13771 14292 gene locus_tag LOCUS_44070 13771 14292 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011542.1 protein_id gnl|my_center|LOCUS_44070 14507 15193 gene locus_tag LOCUS_44080 14507 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44080 15112 15444 gene locus_tag LOCUS_44090 15112 15444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44090 15441 15569 gene locus_tag LOCUS_44100 15441 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 15640 16944 gene locus_tag LOCUS_44110 15640 16944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 16838 17344 gene locus_tag LOCUS_44120 16838 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 17952 18965 gene locus_tag LOCUS_44130 17952 18965 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_44130 18971 19843 gene locus_tag LOCUS_44140 18971 19843 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083605764.1 protein_id gnl|my_center|LOCUS_44140 19858 20694 gene locus_tag LOCUS_44150 19858 20694 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_44150 20840 22186 gene locus_tag LOCUS_44160 20840 22186 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031641.1 protein_id gnl|my_center|LOCUS_44160 22277 23548 gene locus_tag LOCUS_44170 22277 23548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 23574 25622 gene locus_tag LOCUS_44180 23574 25622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 25694 27148 gene locus_tag LOCUS_44190 25694 27148 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838522.1 protein_id gnl|my_center|LOCUS_44190 27163 27257 gene locus_tag LOCUS_t00510 27163 27257 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27886 28812 gene locus_tag LOCUS_44200 27886 28812 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_44200 28834 29442 gene locus_tag LOCUS_44210 28834 29442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44210 29346 31274 gene locus_tag LOCUS_44220 29346 31274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44220 31271 31903 gene locus_tag LOCUS_44230 gene gmhA 31271 31903 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_44230 31900 32907 gene locus_tag LOCUS_44240 31900 32907 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_44240 >Feature sequence156 1254 370 gene locus_tag LOCUS_44250 1254 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145860136.1 protein_id gnl|my_center|LOCUS_44250 2236 1241 gene locus_tag LOCUS_44260 2236 1241 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434114.1 protein_id gnl|my_center|LOCUS_44260 4192 2348 gene locus_tag LOCUS_44270 4192 2348 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_44270 5047 4205 gene locus_tag LOCUS_44280 5047 4205 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_44280 5916 5044 gene locus_tag LOCUS_44290 5916 5044 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_44290 7347 5977 gene locus_tag LOCUS_44300 7347 5977 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122964585.1 protein_id gnl|my_center|LOCUS_44300 8796 7474 gene locus_tag LOCUS_44310 8796 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44310 9110 8856 gene locus_tag LOCUS_44320 9110 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44320 9666 9079 gene locus_tag LOCUS_44330 9666 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44330 10922 9672 gene locus_tag LOCUS_44340 10922 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 >Feature sequence157 296 3 gene locus_tag LOCUS_44350 296 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44350 796 344 gene locus_tag LOCUS_44360 796 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44360 1986 826 gene locus_tag LOCUS_44370 1986 826 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 protein_id gnl|my_center|LOCUS_44370 2315 1983 gene locus_tag LOCUS_44380 2315 1983 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812779.1 protein_id gnl|my_center|LOCUS_44380 2543 3511 gene locus_tag LOCUS_44390 2543 3511 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_44390 4629 3556 gene locus_tag LOCUS_44400 gene fni 4629 3556 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259707.1 protein_id gnl|my_center|LOCUS_44400 4829 5551 gene locus_tag LOCUS_44410 gene nagB 4829 5551 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_44410 5548 6732 gene locus_tag LOCUS_44420 gene nagA 5548 6732 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902854.1 protein_id gnl|my_center|LOCUS_44420 7654 6857 gene locus_tag LOCUS_44430 7654 6857 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_44430 8616 7657 gene locus_tag LOCUS_44440 8616 7657 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191748.1 protein_id gnl|my_center|LOCUS_44440 8921 8664 gene locus_tag LOCUS_44450 8921 8664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 11401 9086 gene locus_tag LOCUS_44460 gene recQ 11401 9086 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272332.1 protein_id gnl|my_center|LOCUS_44460 12486 11509 gene locus_tag LOCUS_44470 gene mdh 12486 11509 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153230.1 protein_id gnl|my_center|LOCUS_44470 13627 12524 gene locus_tag LOCUS_44480 gene icd 13627 12524 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_44480 13815 13546 gene locus_tag LOCUS_44490 13815 13546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44490 15032 13920 gene locus_tag LOCUS_44500 gene citZ 15032 13920 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_44500 15399 15899 gene locus_tag LOCUS_44510 15399 15899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 15899 16513 gene locus_tag LOCUS_44520 15899 16513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 16948 16526 gene locus_tag LOCUS_44530 16948 16526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 17451 16948 gene locus_tag LOCUS_44540 17451 16948 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_44540 18483 17614 gene locus_tag LOCUS_44550 18483 17614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44550 19367 18396 gene locus_tag LOCUS_44560 19367 18396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44560 20458 19469 gene locus_tag LOCUS_44570 20458 19469 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931204.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44570 21088 20624 gene locus_tag LOCUS_44580 21088 20624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44580 21489 20971 gene locus_tag LOCUS_44590 21489 20971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44590 21720 21532 gene locus_tag LOCUS_44600 21720 21532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459626.1 protein_id gnl|my_center|LOCUS_44600 22441 21947 gene locus_tag LOCUS_44610 22441 21947 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665103.1 protein_id gnl|my_center|LOCUS_44610 23186 22968 gene locus_tag LOCUS_44620 23186 22968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 >Feature sequence158 407 84 gene locus_tag LOCUS_44630 407 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 747 463 gene locus_tag LOCUS_44640 747 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 1429 794 gene locus_tag LOCUS_44650 1429 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 1711 1508 gene locus_tag LOCUS_44660 1711 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 2700 1726 gene locus_tag LOCUS_44670 2700 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 3679 2864 gene locus_tag LOCUS_44680 gene spo0A 3679 2864 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 protein_id gnl|my_center|LOCUS_44680 5218 3899 gene locus_tag LOCUS_44690 gene spoIVB 5218 3899 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398697.1 protein_id gnl|my_center|LOCUS_44690 5857 5342 gene locus_tag LOCUS_44700 5857 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44700 7038 5743 gene locus_tag LOCUS_44710 7038 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44710 7530 7078 gene locus_tag LOCUS_44720 gene argR 7530 7078 CDS product arginine repressor ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230265.1 protein_id gnl|my_center|LOCUS_44720 8009 7551 gene locus_tag LOCUS_44730 8009 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 8221 7982 gene locus_tag LOCUS_44740 8221 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 9129 8293 gene locus_tag LOCUS_44750 9129 8293 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274739.1 protein_id gnl|my_center|LOCUS_44750 11024 9126 gene locus_tag LOCUS_44760 gene dxs 11024 9126 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366452.1 protein_id gnl|my_center|LOCUS_44760 12065 11148 gene locus_tag LOCUS_44770 12065 11148 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125281.1 protein_id gnl|my_center|LOCUS_44770 12330 12070 gene locus_tag LOCUS_44780 12330 12070 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 protein_id gnl|my_center|LOCUS_44780 13684 12311 gene locus_tag LOCUS_44790 gene xseA 13684 12311 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415249.1 protein_id gnl|my_center|LOCUS_44790 14566 13715 gene locus_tag LOCUS_44800 gene folD 14566 13715 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226732.1 protein_id gnl|my_center|LOCUS_44800 15073 14624 gene locus_tag LOCUS_44810 gene nusB 15073 14624 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 protein_id gnl|my_center|LOCUS_44810 15463 15233 gene locus_tag LOCUS_44820 15463 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 16034 15477 gene locus_tag LOCUS_44830 16034 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 16534 16124 gene locus_tag LOCUS_44840 16534 16124 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_44840 18008 16644 gene locus_tag LOCUS_44850 gene accC 18008 16644 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592876.1 protein_id gnl|my_center|LOCUS_44850 18567 18073 gene locus_tag LOCUS_44860 gene accB 18567 18073 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472859.1 protein_id gnl|my_center|LOCUS_44860 19426 18806 gene locus_tag LOCUS_44870 19426 18806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 20122 19484 gene locus_tag LOCUS_44880 gene spoIIIAG 20122 19484 CDS product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230248.1 protein_id gnl|my_center|LOCUS_44880 20949 20209 gene locus_tag LOCUS_44890 20949 20209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 22204 20975 gene locus_tag LOCUS_44900 gene spoIIIAE 22204 20975 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230230.1 protein_id gnl|my_center|LOCUS_44900 22605 22210 gene locus_tag LOCUS_44910 gene spoIIIAD 22605 22210 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 protein_id gnl|my_center|LOCUS_44910 22828 22625 gene locus_tag LOCUS_44920 gene spoIIIAC 22828 22625 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020914.1 protein_id gnl|my_center|LOCUS_44920 23362 22844 gene locus_tag LOCUS_44930 23362 22844 CDS product stage III sporulation protein AB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460278.1 protein_id gnl|my_center|LOCUS_44930 24357 23356 gene locus_tag LOCUS_44940 gene spoIIIAA 24357 23356 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393045.1 protein_id gnl|my_center|LOCUS_44940 24719 24453 gene locus_tag LOCUS_44950 24719 24453 CDS product YqhV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398639.1 protein_id gnl|my_center|LOCUS_44950 24880 25293 gene locus_tag LOCUS_44960 24880 25293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44960 25451 25741 gene locus_tag LOCUS_44970 25451 25741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44970 25752 26504 gene locus_tag LOCUS_44980 25752 26504 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_44980 26606 27067 gene locus_tag LOCUS_44990 26606 27067 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391668.1 protein_id gnl|my_center|LOCUS_44990 28443 27190 gene locus_tag LOCUS_45000 28443 27190 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_45000 29134 28526 gene locus_tag LOCUS_45010 29134 28526 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962669.1 protein_id gnl|my_center|LOCUS_45010 29608 29201 gene locus_tag LOCUS_45020 29608 29201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45020 30192 29611 gene locus_tag LOCUS_45030 30192 29611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 30073 30306 gene locus_tag LOCUS_45040 30073 30306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 30837 30496 gene locus_tag LOCUS_45050 30837 30496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45050 32143 31076 gene locus_tag LOCUS_45060 gene pepQ 32143 31076 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 protein_id gnl|my_center|LOCUS_45060 32593 32156 gene locus_tag LOCUS_45070 gene aroQ 32593 32156 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_45070 33321 32755 gene locus_tag LOCUS_45080 33321 32755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 33544 33879 gene locus_tag LOCUS_45090 33544 33879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45090 33995 34504 gene locus_tag LOCUS_45100 33995 34504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45100 34568 34813 gene locus_tag LOCUS_45110 34568 34813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 >Feature sequence159 193 462 gene locus_tag LOCUS_45120 193 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 1440 619 gene locus_tag LOCUS_45130 1440 619 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_45130 1682 1437 gene locus_tag LOCUS_45140 1682 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 2042 1683 gene locus_tag LOCUS_45150 2042 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45150 2709 3875 gene locus_tag LOCUS_45160 2709 3875 CDS product IS1380-like element ISEcp1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608644.1 protein_id gnl|my_center|LOCUS_45160 4076 4297 gene locus_tag LOCUS_45170 4076 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 4492 4668 gene locus_tag LOCUS_45180 4492 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45180 4638 5153 gene locus_tag LOCUS_45190 4638 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45190 5156 5899 gene locus_tag LOCUS_45200 5156 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45200 5890 6903 gene locus_tag LOCUS_45210 gene cydB 5890 6903 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244559.1 protein_id gnl|my_center|LOCUS_45210 6903 8642 gene locus_tag LOCUS_45220 gene cydD 6903 8642 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244017.1 protein_id gnl|my_center|LOCUS_45220 8639 9904 gene locus_tag LOCUS_45230 8639 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45230 9883 10380 gene locus_tag LOCUS_45240 9883 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45240 10403 10555 gene locus_tag LOCUS_45250 10403 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 10698 11006 gene locus_tag LOCUS_45260 10698 11006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 11081 11389 gene locus_tag LOCUS_45270 11081 11389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 12046 11411 gene locus_tag LOCUS_45280 12046 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 12262 12603 gene locus_tag LOCUS_45290 12262 12603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 12662 13957 gene locus_tag LOCUS_45300 12662 13957 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_45300 13954 14556 gene locus_tag LOCUS_45310 13954 14556 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259401.1 protein_id gnl|my_center|LOCUS_45310 14553 15374 gene locus_tag LOCUS_45320 14553 15374 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192012.1 protein_id gnl|my_center|LOCUS_45320 15367 16101 gene locus_tag LOCUS_45330 15367 16101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 16654 16154 gene locus_tag LOCUS_45340 16654 16154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 18080 16671 gene locus_tag LOCUS_45350 18080 16671 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704508.1 protein_id gnl|my_center|LOCUS_45350 18219 18734 gene locus_tag LOCUS_45360 gene resA 18219 18734 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742200.1 protein_id gnl|my_center|LOCUS_45360 18829 19050 gene locus_tag LOCUS_45370 18829 19050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 19414 19166 gene locus_tag LOCUS_45380 19414 19166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 19534 20358 gene locus_tag LOCUS_45390 19534 20358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 20360 21007 gene locus_tag LOCUS_45400 gene degU 20360 21007 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_45400 21032 21301 gene locus_tag LOCUS_45410 21032 21301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 21400 21831 gene locus_tag LOCUS_45420 21400 21831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 22073 23677 gene locus_tag LOCUS_45430 22073 23677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45430 23695 24222 gene locus_tag LOCUS_45440 23695 24222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45440 24272 24958 gene locus_tag LOCUS_45450 24272 24958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 25359 24964 gene locus_tag LOCUS_45460 25359 24964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 25880 25518 gene locus_tag LOCUS_45470 25880 25518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 26742 26044 gene locus_tag LOCUS_45480 26742 26044 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831066.1 protein_id gnl|my_center|LOCUS_45480 >Feature sequence160 907 476 gene locus_tag LOCUS_45490 907 476 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226527.1 protein_id gnl|my_center|LOCUS_45490 1409 900 gene locus_tag LOCUS_45500 1409 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 2067 1621 gene locus_tag LOCUS_45510 2067 1621 CDS product DUF6376 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695200.1 protein_id gnl|my_center|LOCUS_45510 2256 2810 gene locus_tag LOCUS_45520 gene raiA 2256 2810 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671185.1 protein_id gnl|my_center|LOCUS_45520 3013 5517 gene locus_tag LOCUS_45530 gene secA 3013 5517 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228033.1 protein_id gnl|my_center|LOCUS_45530 5659 6672 gene locus_tag LOCUS_45540 gene prfB 5659 6672 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_45540 6901 7950 gene locus_tag LOCUS_45550 gene argC 6901 7950 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245768.1 protein_id gnl|my_center|LOCUS_45550 8041 9273 gene locus_tag LOCUS_45560 gene argJ 8041 9273 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163580248.1 protein_id gnl|my_center|LOCUS_45560 9307 10101 gene locus_tag LOCUS_45570 gene argB 9307 10101 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_45570 10110 11300 gene locus_tag LOCUS_45580 10110 11300 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_45580 11361 12317 gene locus_tag LOCUS_45590 gene argF 11361 12317 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_45590 12337 13575 gene locus_tag LOCUS_45600 12337 13575 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_45600 13727 15142 gene locus_tag LOCUS_45610 gene argH 13727 15142 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041296.1 protein_id gnl|my_center|LOCUS_45610 15895 15380 gene locus_tag LOCUS_45620 15895 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 16215 16901 gene locus_tag LOCUS_45630 gene ftsE 16215 16901 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_45630 16891 17151 gene locus_tag LOCUS_45640 16891 17151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45640 17082 17807 gene locus_tag LOCUS_45650 gene ftsX 17082 17807 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45650 17819 18157 gene locus_tag LOCUS_45660 17819 18157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 18154 19074 gene locus_tag LOCUS_45670 18154 19074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45670 19192 20655 gene locus_tag LOCUS_45680 19192 20655 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037436.1 protein_id gnl|my_center|LOCUS_45680 20961 22118 gene locus_tag LOCUS_45690 20961 22118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 22395 24569 gene locus_tag LOCUS_45700 22395 24569 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_45700 25019 26626 gene locus_tag LOCUS_45710 gene uvrB 25019 26626 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441046.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45710 26572 26781 gene locus_tag LOCUS_45720 26572 26781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45720 26975 27688 gene locus_tag LOCUS_45730 26975 27688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45730 27688 28317 gene locus_tag LOCUS_45740 27688 28317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45740 28431 29858 gene locus_tag LOCUS_45750 28431 29858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45750 31437 29929 gene locus_tag LOCUS_45760 31437 29929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 32756 31524 gene locus_tag LOCUS_45770 32756 31524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45770 33304 32792 gene locus_tag LOCUS_45780 33304 32792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45780 33587 33802 gene locus_tag LOCUS_45790 33587 33802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 34889 33921 gene locus_tag LOCUS_45800 34889 33921 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989909.1 protein_id gnl|my_center|LOCUS_45800 35080 36312 gene locus_tag LOCUS_45810 35080 36312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45810 >Feature sequence161 526 909 gene locus_tag LOCUS_45820 526 909 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776472.1 protein_id gnl|my_center|LOCUS_45820 1000 1902 gene locus_tag LOCUS_45830 gene thpD 1000 1902 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 protein_id gnl|my_center|LOCUS_45830 3094 1961 gene locus_tag LOCUS_45840 3094 1961 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793731.1 protein_id gnl|my_center|LOCUS_45840 3455 4060 gene locus_tag LOCUS_45850 3455 4060 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254439.1 protein_id gnl|my_center|LOCUS_45850 4307 5203 gene locus_tag LOCUS_45860 4307 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45860 5197 5478 gene locus_tag LOCUS_45870 5197 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 6708 5737 gene locus_tag LOCUS_45880 6708 5737 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200923.1 protein_id gnl|my_center|LOCUS_45880 7052 8101 gene locus_tag LOCUS_45890 7052 8101 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257043.1 protein_id gnl|my_center|LOCUS_45890 >Feature sequence162 2435 405 gene locus_tag LOCUS_45900 gene atzF 2435 405 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 protein_id gnl|my_center|LOCUS_45900 3034 2453 gene locus_tag LOCUS_45910 3034 2453 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081171.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45910 4137 3472 gene locus_tag LOCUS_45920 4137 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45920 5180 4389 gene locus_tag LOCUS_45930 5180 4389 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967495.1 protein_id gnl|my_center|LOCUS_45930 5997 5173 gene locus_tag LOCUS_45940 5997 5173 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160916.1 protein_id gnl|my_center|LOCUS_45940 6723 6010 gene locus_tag LOCUS_45950 6723 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45950 7094 6720 gene locus_tag LOCUS_45960 7094 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45960 8152 7070 gene locus_tag LOCUS_45970 gene potD 8152 7070 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759316.1 protein_id gnl|my_center|LOCUS_45970 8771 9133 gene locus_tag LOCUS_45980 8771 9133 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228564.1 protein_id gnl|my_center|LOCUS_45980 11477 9243 gene locus_tag LOCUS_45990 11477 9243 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676339.1 protein_id gnl|my_center|LOCUS_45990 12148 11573 gene locus_tag LOCUS_46000 12148 11573 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963375.1 protein_id gnl|my_center|LOCUS_46000 <13186 12453 gene locus_tag LOCUS_46010 <13186 12453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_100934837.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence163 <1 941 gene locus_tag LOCUS_46020 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000345218.1:tRNA epoxyqueuosine(34) reductase QueG 1161 1304 gene locus_tag LOCUS_46030 1161 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 1350 1943 gene locus_tag LOCUS_46040 gene folE 1350 1943 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225516.1 protein_id gnl|my_center|LOCUS_46040 3309 2065 gene locus_tag LOCUS_46050 3309 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 4470 3415 gene locus_tag LOCUS_46060 4470 3415 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867387.1 protein_id gnl|my_center|LOCUS_46060 4740 5483 gene locus_tag LOCUS_46070 4740 5483 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_46070 5851 7089 gene locus_tag LOCUS_46080 5851 7089 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073391.1 protein_id gnl|my_center|LOCUS_46080 9599 7278 gene locus_tag LOCUS_46090 gene acnA 9599 7278 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118669.1 protein_id gnl|my_center|LOCUS_46090 9991 9554 gene locus_tag LOCUS_46100 9991 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46100 10286 11398 gene locus_tag LOCUS_46110 10286 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 >Feature sequence164 3559 3882 gene locus_tag LOCUS_46120 3559 3882 CDS product YtrH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383157.1 protein_id gnl|my_center|LOCUS_46120 3887 4396 gene locus_tag LOCUS_46130 3887 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 4494 4787 gene locus_tag LOCUS_46140 4494 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 6178 4829 gene locus_tag LOCUS_46150 6178 4829 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398641.1 protein_id gnl|my_center|LOCUS_46150 6305 6781 gene locus_tag LOCUS_46160 6305 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 6778 7638 gene locus_tag LOCUS_46170 6778 7638 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541430.1 protein_id gnl|my_center|LOCUS_46170 8098 7808 gene locus_tag LOCUS_46180 8098 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 8516 8181 gene locus_tag LOCUS_46190 8516 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 8820 9479 gene locus_tag LOCUS_46200 8820 9479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 9446 10192 gene locus_tag LOCUS_46210 9446 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46210 10208 11368 gene locus_tag LOCUS_46220 gene spaC 10208 11368 CDS product spore coat associated protein SpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245845.1 protein_id gnl|my_center|LOCUS_46220 11438 11863 gene locus_tag LOCUS_46230 11438 11863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 11907 12161 gene locus_tag LOCUS_46240 11907 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 12131 12814 gene locus_tag LOCUS_46250 12131 12814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46250 12804 13136 gene locus_tag LOCUS_46260 12804 13136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 13289 13585 gene locus_tag LOCUS_46270 13289 13585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 13633 13956 gene locus_tag LOCUS_46280 13633 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 13953 14432 gene locus_tag LOCUS_46290 13953 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 14564 15682 gene locus_tag LOCUS_46300 gene spaC 14564 15682 CDS product spore coat associated protein SpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245845.1 protein_id gnl|my_center|LOCUS_46300 16427 15738 gene locus_tag LOCUS_46310 16427 15738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 17086 16517 gene locus_tag LOCUS_46320 gene cotJC 17086 16517 CDS product spore coat protein CotJC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233850.1 protein_id gnl|my_center|LOCUS_46320 17419 17156 gene locus_tag LOCUS_46330 gene cotJB 17419 17156 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 protein_id gnl|my_center|LOCUS_46330 17724 17425 gene locus_tag LOCUS_46340 17724 17425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 18710 17973 gene locus_tag LOCUS_46350 18710 17973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46350 20272 19133 gene locus_tag LOCUS_46360 gene yfkAB 20272 19133 CDS product radical SAM/CxCxxxxC motif protein YfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156016.1 protein_id gnl|my_center|LOCUS_46360 21515 20430 gene locus_tag LOCUS_46370 21515 20430 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_46370 22937 21657 gene locus_tag LOCUS_46380 22937 21657 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073806426.1 protein_id gnl|my_center|LOCUS_46380 23104 22886 gene locus_tag LOCUS_46390 23104 22886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 23623 23147 gene locus_tag LOCUS_46400 23623 23147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 24626 23631 gene locus_tag LOCUS_46410 gene moaA 24626 23631 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722673.1 protein_id gnl|my_center|LOCUS_46410 25174 25482 gene locus_tag LOCUS_46420 25174 25482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 25479 26531 gene locus_tag LOCUS_46430 25479 26531 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158098.1 protein_id gnl|my_center|LOCUS_46430 26708 27724 gene locus_tag LOCUS_46440 26708 27724 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_46440 27999 27829 gene locus_tag LOCUS_46450 27999 27829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 28751 27993 gene locus_tag LOCUS_46460 28751 27993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 29594 28755 gene locus_tag LOCUS_46470 29594 28755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 30391 29654 gene locus_tag LOCUS_46480 30391 29654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46480 30714 30340 gene locus_tag LOCUS_46490 30714 30340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46490 >Feature sequence165 363 1061 gene locus_tag LOCUS_46500 363 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 1058 1972 gene locus_tag LOCUS_46510 1058 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 2080 2277 gene locus_tag LOCUS_46520 2080 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 2342 2956 gene locus_tag LOCUS_46530 2342 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 3076 5274 gene locus_tag LOCUS_46540 3076 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 5306 6118 gene locus_tag LOCUS_46550 5306 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 6213 6716 gene locus_tag LOCUS_46560 6213 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 6742 7740 gene locus_tag LOCUS_46570 6742 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 7737 8639 gene locus_tag LOCUS_46580 7737 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 9543 8641 gene locus_tag LOCUS_46590 9543 8641 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019638483.1 protein_id gnl|my_center|LOCUS_46590 10272 9691 gene locus_tag LOCUS_46600 10272 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 10832 10383 gene locus_tag LOCUS_46610 gene yneK 10832 10383 CDS product DynA interaction protein YneK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231580.1 protein_id gnl|my_center|LOCUS_46610 10923 12056 gene locus_tag LOCUS_46620 10923 12056 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912466.1 protein_id gnl|my_center|LOCUS_46620 12168 13004 gene locus_tag LOCUS_46630 gene purU 12168 13004 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245802.1 protein_id gnl|my_center|LOCUS_46630 13251 15272 gene locus_tag LOCUS_46640 gene tkt 13251 15272 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019766.1 protein_id gnl|my_center|LOCUS_46640 15385 15543 gene locus_tag LOCUS_46650 15385 15543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46650 15498 15701 gene locus_tag LOCUS_46660 15498 15701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46660 16720 15818 gene locus_tag LOCUS_46670 16720 15818 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_46670 16881 18254 gene locus_tag LOCUS_46680 16881 18254 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103654.1 protein_id gnl|my_center|LOCUS_46680 18254 18889 gene locus_tag LOCUS_46690 18254 18889 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_46690 19151 19966 gene locus_tag LOCUS_46700 gene cysT 19151 19966 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_46700 19963 20112 gene locus_tag LOCUS_46710 19963 20112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 20109 20759 gene locus_tag LOCUS_46720 20109 20759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46720 20763 21827 gene locus_tag LOCUS_46730 20763 21827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 21859 22980 gene locus_tag LOCUS_46740 21859 22980 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_46740 23847 23047 gene locus_tag LOCUS_46750 23847 23047 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_46750 24300 25634 gene locus_tag LOCUS_46760 24300 25634 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733072.1 protein_id gnl|my_center|LOCUS_46760 26616 25867 gene locus_tag LOCUS_46770 26616 25867 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628423.1 protein_id gnl|my_center|LOCUS_46770 28330 27590 gene locus_tag LOCUS_46780 28330 27590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 29002 29934 gene locus_tag LOCUS_46790 29002 29934 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_46790 29966 30799 gene locus_tag LOCUS_46800 gene cysT 29966 30799 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_46800 30812 31141 gene locus_tag LOCUS_46810 30812 31141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46810 31156 31695 gene locus_tag LOCUS_46820 31156 31695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46820 31755 31958 gene locus_tag LOCUS_46830 31755 31958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 32015 32260 gene locus_tag LOCUS_46840 32015 32260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 32261 32593 gene locus_tag LOCUS_46850 32261 32593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 32625 33008 gene locus_tag LOCUS_46860 32625 33008 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036534.1 protein_id gnl|my_center|LOCUS_46860 33359 33072 gene locus_tag LOCUS_46870 33359 33072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 34356 33427 gene locus_tag LOCUS_46880 34356 33427 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973903.1 protein_id gnl|my_center|LOCUS_46880 34975 34421 gene locus_tag LOCUS_46890 34975 34421 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056276.1 protein_id gnl|my_center|LOCUS_46890 36327 34972 gene locus_tag LOCUS_46900 36327 34972 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227543.1 protein_id gnl|my_center|LOCUS_46900 36476 37411 gene locus_tag LOCUS_46910 36476 37411 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421907.1 protein_id gnl|my_center|LOCUS_46910 37392 38078 gene locus_tag LOCUS_46920 37392 38078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 38072 38347 gene locus_tag LOCUS_46930 38072 38347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 38465 39271 gene locus_tag LOCUS_46940 38465 39271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46940 39268 39519 gene locus_tag LOCUS_46950 39268 39519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46950 39737 40144 gene locus_tag LOCUS_46960 39737 40144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46960 40132 42501 gene locus_tag LOCUS_46970 40132 42501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 >Feature sequence166 936 208 gene locus_tag LOCUS_46980 936 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 3047 2214 gene locus_tag LOCUS_46990 3047 2214 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803894.1 protein_id gnl|my_center|LOCUS_46990 4015 3014 gene locus_tag LOCUS_47000 4015 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 5715 4045 gene locus_tag LOCUS_47010 gene ycnJ 5715 4045 CDS product copper transporter YcnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246637.1 protein_id gnl|my_center|LOCUS_47010 6073 6249 gene locus_tag LOCUS_47020 6073 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 7297 6476 gene locus_tag LOCUS_47030 gene pxpA 7297 6476 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207350.1 protein_id gnl|my_center|LOCUS_47030 <7963 7385 gene locus_tag LOCUS_47040 <7963 7385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003234419.1:5-oxoprolinase subunit PxpC >Feature sequence167 165 1322 gene locus_tag LOCUS_47050 165 1322 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584031.1 protein_id gnl|my_center|LOCUS_47050 1379 2383 gene locus_tag LOCUS_47060 1379 2383 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 protein_id gnl|my_center|LOCUS_47060 2485 3996 gene locus_tag LOCUS_47070 2485 3996 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_47070 4038 4730 gene locus_tag LOCUS_47080 4038 4730 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522961.1 protein_id gnl|my_center|LOCUS_47080 4847 5359 gene locus_tag LOCUS_47090 4847 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47090 5344 6141 gene locus_tag LOCUS_47100 5344 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47100 6638 6360 gene locus_tag LOCUS_47110 6638 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 7033 6707 gene locus_tag LOCUS_47120 7033 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 7241 7543 gene locus_tag LOCUS_47130 7241 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47130 7540 7914 gene locus_tag LOCUS_47140 7540 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47140 8047 8451 gene locus_tag LOCUS_47150 8047 8451 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220090.1 protein_id gnl|my_center|LOCUS_47150 8481 8987 gene locus_tag LOCUS_47160 8481 8987 CDS product DUF4178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051758.1 protein_id gnl|my_center|LOCUS_47160 8999 9748 gene locus_tag LOCUS_47170 8999 9748 CDS product DUF4247 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054401985.1 protein_id gnl|my_center|LOCUS_47170 9980 10315 gene locus_tag LOCUS_47180 9980 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47180 10315 10518 gene locus_tag LOCUS_47190 10315 10518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 11042 12025 gene locus_tag LOCUS_47200 gene mntA 11042 12025 CDS product manganese ABC transporter substrate-binding protein/adhesin MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229060.1 protein_id gnl|my_center|LOCUS_47200 12027 12761 gene locus_tag LOCUS_47210 gene mntB 12027 12761 CDS product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 protein_id gnl|my_center|LOCUS_47210 12758 13681 gene locus_tag LOCUS_47220 12758 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 13678 14568 gene locus_tag LOCUS_47230 gene mntD 13678 14568 CDS product manganese ABC transporter permease MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229067.1 protein_id gnl|my_center|LOCUS_47230 >Feature sequence168 1270 32 gene locus_tag LOCUS_47240 1270 32 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380210.1 protein_id gnl|my_center|LOCUS_47240 1768 1274 gene locus_tag LOCUS_47250 1768 1274 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393559.1 protein_id gnl|my_center|LOCUS_47250 2204 1827 gene locus_tag LOCUS_47260 2204 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 2438 2947 gene locus_tag LOCUS_47270 2438 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 3187 4692 gene locus_tag LOCUS_47280 3187 4692 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272490.1 protein_id gnl|my_center|LOCUS_47280 4707 5711 gene locus_tag LOCUS_47290 4707 5711 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810429.1 protein_id gnl|my_center|LOCUS_47290 5737 6360 gene locus_tag LOCUS_47300 5737 6360 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813074.1 protein_id gnl|my_center|LOCUS_47300 6801 6427 gene locus_tag LOCUS_47310 6801 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272592.1 protein_id gnl|my_center|LOCUS_47310 6956 7297 gene locus_tag LOCUS_47320 6956 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 7622 8344 gene locus_tag LOCUS_47330 7622 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 8361 8942 gene locus_tag LOCUS_47340 gene clpP 8361 8942 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228214.1 protein_id gnl|my_center|LOCUS_47340 9117 10514 gene locus_tag LOCUS_47350 9117 10514 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121215506.1 protein_id gnl|my_center|LOCUS_47350 10902 10537 gene locus_tag LOCUS_47360 10902 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 11309 10803 gene locus_tag LOCUS_47370 11309 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 11552 12427 gene locus_tag LOCUS_47380 gene catE 11552 12427 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 protein_id gnl|my_center|LOCUS_47380 13867 12560 gene locus_tag LOCUS_47390 gene uraA 13867 12560 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198341.1 protein_id gnl|my_center|LOCUS_47390 14512 14171 gene locus_tag LOCUS_47400 14512 14171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 15004 17718 gene locus_tag LOCUS_47410 gene sucA 15004 17718 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399330.1 protein_id gnl|my_center|LOCUS_47410 17685 17870 gene locus_tag LOCUS_47420 17685 17870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 17886 19058 gene locus_tag LOCUS_47430 gene odhB 17886 19058 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569898.1 protein_id gnl|my_center|LOCUS_47430 19055 19174 gene locus_tag LOCUS_47440 19055 19174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 19533 21227 gene locus_tag LOCUS_47450 gene argS 19533 21227 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475862.1 protein_id gnl|my_center|LOCUS_47450 21458 21637 gene locus_tag LOCUS_47460 21458 21637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 21634 22632 gene locus_tag LOCUS_47470 21634 22632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47470 22723 22944 gene locus_tag LOCUS_47480 22723 22944 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138162.1 protein_id gnl|my_center|LOCUS_47480 22997 23389 gene locus_tag LOCUS_47490 22997 23389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 23495 24442 gene locus_tag LOCUS_47500 23495 24442 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212337777.1 protein_id gnl|my_center|LOCUS_47500 24739 25272 gene locus_tag LOCUS_47510 24739 25272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 25157 25732 gene locus_tag LOCUS_47520 25157 25732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 25749 26576 gene locus_tag LOCUS_47530 25749 26576 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_47530 26616 28043 gene locus_tag LOCUS_47540 26616 28043 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_47540 28040 29575 gene locus_tag LOCUS_47550 28040 29575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 30163 31017 gene locus_tag LOCUS_47560 30163 31017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 31014 31889 gene locus_tag LOCUS_47570 31014 31889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47570 31787 32395 gene locus_tag LOCUS_47580 31787 32395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 32611 32793 gene locus_tag LOCUS_47590 32611 32793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 32822 34771 gene locus_tag LOCUS_47600 32822 34771 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 protein_id gnl|my_center|LOCUS_47600 35914 35465 gene locus_tag LOCUS_47610 35914 35465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 35983 37146 gene locus_tag LOCUS_47620 35983 37146 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584053.1 protein_id gnl|my_center|LOCUS_47620 37159 38226 gene locus_tag LOCUS_47630 37159 38226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584052.1 protein_id gnl|my_center|LOCUS_47630 38240 39256 gene locus_tag LOCUS_47640 38240 39256 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_47640 39253 39561 gene locus_tag LOCUS_47650 39253 39561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 39570 40055 gene locus_tag LOCUS_47660 39570 40055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 40060 40881 gene locus_tag LOCUS_47670 40060 40881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 40959 41447 gene locus_tag LOCUS_47680 40959 41447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 41405 41851 gene locus_tag LOCUS_47690 41405 41851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 42654 41956 gene locus_tag LOCUS_47700 42654 41956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 42791 42648 gene locus_tag LOCUS_47710 42791 42648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 42934 43968 gene locus_tag LOCUS_47720 42934 43968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 44116 44799 gene locus_tag LOCUS_47730 44116 44799 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998273.1 protein_id gnl|my_center|LOCUS_47730 45184 49773 gene locus_tag LOCUS_47740 45184 49773 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742098.1 protein_id gnl|my_center|LOCUS_47740 49826 50791 gene locus_tag LOCUS_47750 49826 50791 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_47750 50797 51945 gene locus_tag LOCUS_47760 50797 51945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 52132 52932 gene locus_tag LOCUS_47770 52132 52932 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_47770 52932 53102 gene locus_tag LOCUS_47780 52932 53102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 53299 55110 gene locus_tag LOCUS_47790 53299 55110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 55085 56755 gene locus_tag LOCUS_47800 55085 56755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 56832 58556 gene locus_tag LOCUS_47810 56832 58556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 58556 59542 gene locus_tag LOCUS_47820 58556 59542 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_47820 59672 60223 gene locus_tag LOCUS_47830 59672 60223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47830 >Feature sequence169 539 318 gene locus_tag LOCUS_47840 539 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 1019 1846 gene locus_tag LOCUS_47850 1019 1846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404266.1 protein_id gnl|my_center|LOCUS_47850 1843 3642 gene locus_tag LOCUS_47860 1843 3642 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025992.1 protein_id gnl|my_center|LOCUS_47860 4710 3736 gene locus_tag LOCUS_47870 4710 3736 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707197.1 protein_id gnl|my_center|LOCUS_47870 5884 4691 gene locus_tag LOCUS_47880 5884 4691 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584014.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47880 6189 5881 gene locus_tag LOCUS_47890 6189 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47890 6839 6255 gene locus_tag LOCUS_47900 6839 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47900 7417 6836 gene locus_tag LOCUS_47910 7417 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47910 8679 7471 gene locus_tag LOCUS_47920 8679 7471 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243020.1 protein_id gnl|my_center|LOCUS_47920 9521 8715 gene locus_tag LOCUS_47930 9521 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 >Feature sequence170 >Feature sequence171 737 474 gene locus_tag LOCUS_47940 737 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 1421 2122 gene locus_tag LOCUS_47950 1421 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 3439 2225 gene locus_tag LOCUS_47960 3439 2225 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_47960 3943 3464 gene locus_tag LOCUS_47970 3943 3464 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_47970 4814 3984 gene locus_tag LOCUS_47980 4814 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 5012 5449 gene locus_tag LOCUS_47990 5012 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 5733 6107 gene locus_tag LOCUS_48000 5733 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48000 6041 6613 gene locus_tag LOCUS_48010 6041 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48010 7598 6672 gene locus_tag LOCUS_48020 gene cysK 7598 6672 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762273.1 protein_id gnl|my_center|LOCUS_48020 8926 7622 gene locus_tag LOCUS_48030 8926 7622 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230095.1 protein_id gnl|my_center|LOCUS_48030 9543 9013 gene locus_tag LOCUS_48040 9543 9013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 10085 9666 gene locus_tag LOCUS_48050 10085 9666 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237674.1 protein_id gnl|my_center|LOCUS_48050 11420 10101 gene locus_tag LOCUS_48060 11420 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48060 12463 11438 gene locus_tag LOCUS_48070 12463 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48070 12639 12998 gene locus_tag LOCUS_48080 12639 12998 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392117.1 protein_id gnl|my_center|LOCUS_48080 13222 13608 gene locus_tag LOCUS_48090 13222 13608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 15781 13688 gene locus_tag LOCUS_48100 15781 13688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 18329 15888 gene locus_tag LOCUS_48110 gene pheT 18329 15888 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498186.1 protein_id gnl|my_center|LOCUS_48110 19266 18367 gene locus_tag LOCUS_48120 gene pheS 19266 18367 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_48120 20550 20134 gene locus_tag LOCUS_48130 20550 20134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48130 21485 20547 gene locus_tag LOCUS_48140 21485 20547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48140 22381 21689 gene locus_tag LOCUS_48150 22381 21689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48150 23184 22375 gene locus_tag LOCUS_48160 23184 22375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48160 23807 23259 gene locus_tag LOCUS_48170 gene glpP 23807 23259 CDS product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394287.1 protein_id gnl|my_center|LOCUS_48170 24867 23824 gene locus_tag LOCUS_48180 24867 23824 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836854.1 protein_id gnl|my_center|LOCUS_48180 26867 24921 gene locus_tag LOCUS_48190 26867 24921 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575935.1 protein_id gnl|my_center|LOCUS_48190 27729 26902 gene locus_tag LOCUS_48200 27729 26902 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974928.1 protein_id gnl|my_center|LOCUS_48200 28574 27726 gene locus_tag LOCUS_48210 28574 27726 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400851.1 protein_id gnl|my_center|LOCUS_48210 29973 28660 gene locus_tag LOCUS_48220 29973 28660 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972798.1 protein_id gnl|my_center|LOCUS_48220 >Feature sequence172 2441 666 gene locus_tag LOCUS_48230 gene rlmD 2441 666 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615206.1 protein_id gnl|my_center|LOCUS_48230 3215 4564 gene locus_tag LOCUS_48240 3215 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 4802 6169 gene locus_tag LOCUS_48250 4802 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 6174 6683 gene locus_tag LOCUS_48260 6174 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 7681 7881 gene locus_tag LOCUS_48270 7681 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48270 7929 8432 gene locus_tag LOCUS_48280 7929 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48280 8882 8610 gene locus_tag LOCUS_48290 8882 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 9580 8879 gene locus_tag LOCUS_48300 9580 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 10030 9632 gene locus_tag LOCUS_48310 gene glxA 10030 9632 CDS product glyoxalase GlxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243380.1 protein_id gnl|my_center|LOCUS_48310 10694 10068 gene locus_tag LOCUS_48320 10694 10068 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941350.1 protein_id gnl|my_center|LOCUS_48320 11782 10694 gene locus_tag LOCUS_48330 11782 10694 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968016.1 protein_id gnl|my_center|LOCUS_48330 12014 12220 gene locus_tag LOCUS_48340 12014 12220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 12452 13231 gene locus_tag LOCUS_48350 gene trmB 12452 13231 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983387.1 protein_id gnl|my_center|LOCUS_48350 13713 13150 gene locus_tag LOCUS_48360 13713 13150 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944684.1 protein_id gnl|my_center|LOCUS_48360 14490 15617 gene locus_tag LOCUS_48370 14490 15617 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808136.1 protein_id gnl|my_center|LOCUS_48370 15964 16476 gene locus_tag LOCUS_48380 15964 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 16509 17792 gene locus_tag LOCUS_48390 16509 17792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 17848 19326 gene locus_tag LOCUS_48400 17848 19326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48400 19341 19481 gene locus_tag LOCUS_48410 19341 19481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 19482 21125 gene locus_tag LOCUS_48420 gene nagZ 19482 21125 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_48420 21363 21088 gene locus_tag LOCUS_48430 21363 21088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 21586 22986 gene locus_tag LOCUS_48440 21586 22986 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026992.1 protein_id gnl|my_center|LOCUS_48440 23065 23946 gene locus_tag LOCUS_48450 23065 23946 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118115.1 protein_id gnl|my_center|LOCUS_48450 23946 24740 gene locus_tag LOCUS_48460 23946 24740 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 protein_id gnl|my_center|LOCUS_48460 25002 25646 gene locus_tag LOCUS_48470 gene infC 25002 25646 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973214.1 protein_id gnl|my_center|LOCUS_48470 25676 25876 gene locus_tag LOCUS_48480 gene rpmI 25676 25876 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222418.1 protein_id gnl|my_center|LOCUS_48480 25950 26309 gene locus_tag LOCUS_48490 gene rplT 25950 26309 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263326.1 protein_id gnl|my_center|LOCUS_48490 26943 27455 gene locus_tag LOCUS_48500 26943 27455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 27894 27382 gene locus_tag LOCUS_48510 27894 27382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 28446 30191 gene locus_tag LOCUS_48520 gene ilvB 28446 30191 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 protein_id gnl|my_center|LOCUS_48520 30188 30673 gene locus_tag LOCUS_48530 gene ilvN 30188 30673 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_48530 30831 31823 gene locus_tag LOCUS_48540 gene ilvC 30831 31823 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861143.1 protein_id gnl|my_center|LOCUS_48540 31980 33509 gene locus_tag LOCUS_48550 31980 33509 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_48550 33579 34658 gene locus_tag LOCUS_48560 gene leuB 33579 34658 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_48560 34820 35368 gene locus_tag LOCUS_48570 gene ahpA 34820 35368 CDS product biofilm-specific peroxidase AhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245371.1 protein_id gnl|my_center|LOCUS_48570 35548 35973 gene locus_tag LOCUS_48580 35548 35973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 36119 36931 gene locus_tag LOCUS_48590 gene sigI 36119 36931 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245855.1 protein_id gnl|my_center|LOCUS_48590 36928 38619 gene locus_tag LOCUS_48600 36928 38619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 38746 39150 gene locus_tag LOCUS_48610 38746 39150 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258524.1 protein_id gnl|my_center|LOCUS_48610 39154 40425 gene locus_tag LOCUS_48620 39154 40425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48620 40579 42096 gene locus_tag LOCUS_48630 40579 42096 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_48630 43002 42316 gene locus_tag LOCUS_48640 43002 42316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48640 43307 42936 gene locus_tag LOCUS_48650 43307 42936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48650 43520 43843 gene locus_tag LOCUS_48660 43520 43843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48660 43840 44334 gene locus_tag LOCUS_48670 43840 44334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48670 44526 45488 gene locus_tag LOCUS_48680 44526 45488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 45559 46410 gene locus_tag LOCUS_48690 45559 46410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 46492 47277 gene locus_tag LOCUS_48700 gene lutA 46492 47277 CDS product lactate utilization iron-sulfur protein LutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244353.1 protein_id gnl|my_center|LOCUS_48700 47274 47585 gene locus_tag LOCUS_48710 47274 47585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48710 47582 48781 gene locus_tag LOCUS_48720 47582 48781 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460058.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48720 48778 49572 gene locus_tag LOCUS_48730 48778 49572 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315273.1 protein_id gnl|my_center|LOCUS_48730 49736 49891 gene locus_tag LOCUS_48740 49736 49891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 49965 50423 gene locus_tag LOCUS_48750 49965 50423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 50420 53170 gene locus_tag LOCUS_48760 50420 53170 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185141306.1 protein_id gnl|my_center|LOCUS_48760 53161 53610 gene locus_tag LOCUS_48770 53161 53610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48770 54207 53761 gene locus_tag LOCUS_48780 54207 53761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 54859 54227 gene locus_tag LOCUS_48790 54859 54227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 >Feature sequence173 1490 423 gene locus_tag LOCUS_48800 1490 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48800 1782 1516 gene locus_tag LOCUS_48810 1782 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 2227 1892 gene locus_tag LOCUS_48820 2227 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48820 2231 2485 gene locus_tag LOCUS_48830 2231 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 2849 2562 gene locus_tag LOCUS_48840 2849 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48840 3810 2872 gene locus_tag LOCUS_48850 3810 2872 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_48850 3852 4064 gene locus_tag LOCUS_48860 3852 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 4048 5295 gene locus_tag LOCUS_48870 4048 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48870 5292 5816 gene locus_tag LOCUS_48880 5292 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48880 5809 7410 gene locus_tag LOCUS_48890 5809 7410 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723174.1 protein_id gnl|my_center|LOCUS_48890 7717 7490 gene locus_tag LOCUS_48900 7717 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 8487 7681 gene locus_tag LOCUS_48910 8487 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48910 9164 8418 gene locus_tag LOCUS_48920 9164 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 10218 9205 gene locus_tag LOCUS_48930 10218 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 11312 10215 gene locus_tag LOCUS_48940 11312 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 12024 11410 gene locus_tag LOCUS_48950 12024 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48950 12293 12021 gene locus_tag LOCUS_48960 12293 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 12865 12293 gene locus_tag LOCUS_48970 12865 12293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48970 13221 12841 gene locus_tag LOCUS_48980 13221 12841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48980 14630 13284 gene locus_tag LOCUS_48990 14630 13284 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286788.1 protein_id gnl|my_center|LOCUS_48990 15998 14880 gene locus_tag LOCUS_49000 15998 14880 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226897.1 protein_id gnl|my_center|LOCUS_49000 16294 17454 gene locus_tag LOCUS_49010 16294 17454 CDS product oxalate decarboxylase family bicupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747527.1 protein_id gnl|my_center|LOCUS_49010 >Feature sequence174 2617 2426 gene locus_tag LOCUS_49020 2617 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 4597 2705 gene locus_tag LOCUS_49030 4597 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 6625 4703 gene locus_tag LOCUS_49040 6625 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 7144 6827 gene locus_tag LOCUS_49050 7144 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 7947 7162 gene locus_tag LOCUS_49060 7947 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 9267 7978 gene locus_tag LOCUS_49070 gene cap8O 9267 7978 CDS product type 8 capsular polysaccharide synthesis protein Cap8O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779504.1 protein_id gnl|my_center|LOCUS_49070 10004 9264 gene locus_tag LOCUS_49080 10004 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49080 10279 10001 gene locus_tag LOCUS_49090 10279 10001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49090 10991 10413 gene locus_tag LOCUS_49100 10991 10413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49100 11507 11767 gene locus_tag LOCUS_49110 11507 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 11933 11652 gene locus_tag LOCUS_49120 11933 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49120 12505 12296 gene locus_tag LOCUS_49130 12505 12296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 12907 12752 gene locus_tag LOCUS_49140 12907 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 13959 14600 gene locus_tag LOCUS_49150 13959 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 14736 16292 gene locus_tag LOCUS_49160 14736 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 16416 17540 gene locus_tag LOCUS_49170 16416 17540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 19482 17794 gene locus_tag LOCUS_49180 19482 17794 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_49180 20004 19537 gene locus_tag LOCUS_49190 20004 19537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49190 20687 19923 gene locus_tag LOCUS_49200 20687 19923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49200 20902 20687 gene locus_tag LOCUS_49210 20902 20687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49210 21055 21513 gene locus_tag LOCUS_49220 21055 21513 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861494.1 protein_id gnl|my_center|LOCUS_49220 21566 23302 gene locus_tag LOCUS_49230 21566 23302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_49230 23292 24878 gene locus_tag LOCUS_49240 23292 24878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49240 24919 25188 gene locus_tag LOCUS_49250 24919 25188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49250 26468 25251 gene locus_tag LOCUS_49260 26468 25251 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503266.1 protein_id gnl|my_center|LOCUS_49260 26991 26485 gene locus_tag LOCUS_49270 26991 26485 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461316.1 protein_id gnl|my_center|LOCUS_49270 27951 27085 gene locus_tag LOCUS_49280 27951 27085 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 protein_id gnl|my_center|LOCUS_49280 >Feature sequence175 825 70 gene locus_tag LOCUS_49290 825 70 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388698.1 protein_id gnl|my_center|LOCUS_49290 1002 1382 gene locus_tag LOCUS_49300 1002 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 1313 1894 gene locus_tag LOCUS_49310 1313 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 2061 1900 gene locus_tag LOCUS_49320 2061 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 2255 2650 gene locus_tag LOCUS_49330 2255 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 >Feature sequence176 300 431 gene locus_tag LOCUS_49340 300 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 514 1335 gene locus_tag LOCUS_49350 514 1335 CDS product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399435.1 protein_id gnl|my_center|LOCUS_49350 1604 3361 gene locus_tag LOCUS_49360 1604 3361 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453879.1 protein_id gnl|my_center|LOCUS_49360 3476 4069 gene locus_tag LOCUS_49370 gene hitR 3476 4069 CDS product envelope stress response regulator transcription factor HitR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009878919.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49370 4066 4641 gene locus_tag LOCUS_49380 4066 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49380 4599 5201 gene locus_tag LOCUS_49390 4599 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49390 6277 5564 gene locus_tag LOCUS_49400 6277 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 6821 6255 gene locus_tag LOCUS_49410 6821 6255 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_49410 7047 8078 gene locus_tag LOCUS_49420 7047 8078 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975879.1 protein_id gnl|my_center|LOCUS_49420 8192 8383 gene locus_tag LOCUS_49430 8192 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49430 8341 8943 gene locus_tag LOCUS_49440 8341 8943 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234424.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49440 8950 9429 gene locus_tag LOCUS_49450 8950 9429 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398518.1 protein_id gnl|my_center|LOCUS_49450 9480 9806 gene locus_tag LOCUS_49460 9480 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 >Feature sequence177 420 950 gene locus_tag LOCUS_49470 420 950 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889318.1 protein_id gnl|my_center|LOCUS_49470 974 3235 gene locus_tag LOCUS_49480 974 3235 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989998.1 protein_id gnl|my_center|LOCUS_49480 3635 3787 gene locus_tag LOCUS_49490 3635 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 3784 4071 gene locus_tag LOCUS_49500 3784 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49500 4072 4230 gene locus_tag LOCUS_49510 4072 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49510 4641 4288 gene locus_tag LOCUS_49520 4641 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 5066 4638 gene locus_tag LOCUS_49530 5066 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 5189 5788 gene locus_tag LOCUS_49540 5189 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 5822 6040 gene locus_tag LOCUS_49550 5822 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 6273 8522 gene locus_tag LOCUS_49560 6273 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 8539 10077 gene locus_tag LOCUS_49570 8539 10077 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906003.1 protein_id gnl|my_center|LOCUS_49570 10428 10168 gene locus_tag LOCUS_49580 10428 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 10498 12357 gene locus_tag LOCUS_49590 10498 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 12252 12761 gene locus_tag LOCUS_49600 12252 12761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 12854 14215 gene locus_tag LOCUS_49610 12854 14215 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028490.1 protein_id gnl|my_center|LOCUS_49610 >Feature sequence178 165 377 gene locus_tag LOCUS_49620 165 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 1927 1013 gene locus_tag LOCUS_49630 1927 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 3318 2425 gene locus_tag LOCUS_49640 3318 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 5811 3385 gene locus_tag LOCUS_49650 5811 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49650 6203 5820 gene locus_tag LOCUS_49660 6203 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49660 6454 6266 gene locus_tag LOCUS_49670 6454 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 6704 6387 gene locus_tag LOCUS_49680 6704 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 7817 7041 gene locus_tag LOCUS_49690 7817 7041 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989362.1 protein_id gnl|my_center|LOCUS_49690 8185 7763 gene locus_tag LOCUS_49700 8185 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 >Feature sequence179 865 137 gene locus_tag LOCUS_49710 865 137 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_49710 1161 904 gene locus_tag LOCUS_49720 1161 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 >Feature sequence180 78 305 gene locus_tag LOCUS_49730 78 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 481 2292 gene locus_tag LOCUS_49740 481 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 3012 2392 gene locus_tag LOCUS_49750 3012 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 3788 2937 gene locus_tag LOCUS_49760 3788 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 5626 4028 gene locus_tag LOCUS_49770 5626 4028 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_49770 6582 5704 gene locus_tag LOCUS_49780 6582 5704 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_49780 7562 6600 gene locus_tag LOCUS_49790 7562 6600 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_49790 7869 7606 gene locus_tag LOCUS_49800 7869 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 8150 8335 gene locus_tag LOCUS_49810 8150 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 8694 8494 gene locus_tag LOCUS_49820 8694 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 9811 9305 gene locus_tag LOCUS_49830 9811 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 10902 9979 gene locus_tag LOCUS_49840 10902 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49840 11429 10839 gene locus_tag LOCUS_49850 11429 10839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 >Feature sequence181 1128 277 gene locus_tag LOCUS_49860 1128 277 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891843.1 protein_id gnl|my_center|LOCUS_49860 1272 1976 gene locus_tag LOCUS_49870 1272 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49870 2341 3267 gene locus_tag LOCUS_49880 2341 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49880 4083 3268 gene locus_tag LOCUS_49890 4083 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 4389 5657 gene locus_tag LOCUS_49900 gene ilvA 4389 5657 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250353.1 protein_id gnl|my_center|LOCUS_49900 >Feature sequence182 >Feature sequence183 175 1137 gene locus_tag LOCUS_49910 175 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 3051 1276 gene locus_tag LOCUS_49920 3051 1276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_49920 3488 3048 gene locus_tag LOCUS_49930 3488 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 4041 3511 gene locus_tag LOCUS_49940 4041 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 5846 4038 gene locus_tag LOCUS_49950 5846 4038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49950 6394 5843 gene locus_tag LOCUS_49960 6394 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 7160 6450 gene locus_tag LOCUS_49970 7160 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 9350 8139 gene locus_tag LOCUS_49980 9350 8139 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_49980 9502 10068 gene locus_tag LOCUS_49990 9502 10068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 10065 11879 gene locus_tag LOCUS_50000 10065 11879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 12039 12980 gene locus_tag LOCUS_50010 12039 12980 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_50010 12997 13335 gene locus_tag LOCUS_50020 12997 13335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 13326 13856 gene locus_tag LOCUS_50030 13326 13856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50030 13919 15490 gene locus_tag LOCUS_50040 13919 15490 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972693.1 protein_id gnl|my_center|LOCUS_50040 15520 16572 gene locus_tag LOCUS_50050 15520 16572 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967916.1 protein_id gnl|my_center|LOCUS_50050 16594 16950 gene locus_tag LOCUS_50060 16594 16950 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967915.1 protein_id gnl|my_center|LOCUS_50060 17615 17052 gene locus_tag LOCUS_50070 17615 17052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 17815 17612 gene locus_tag LOCUS_50080 17815 17612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 18366 17809 gene locus_tag LOCUS_50090 18366 17809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50090 >Feature sequence184 1276 269 gene locus_tag LOCUS_50100 1276 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 2170 1496 gene locus_tag LOCUS_50110 2170 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 3015 2146 gene locus_tag LOCUS_50120 3015 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 3415 3026 gene locus_tag LOCUS_50130 3415 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 3976 3497 gene locus_tag LOCUS_50140 3976 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 6129 4060 gene locus_tag LOCUS_50150 6129 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 6622 6119 gene locus_tag LOCUS_50160 6622 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 7989 6532 gene locus_tag LOCUS_50170 7989 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 8831 7986 gene locus_tag LOCUS_50180 8831 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 9560 8865 gene locus_tag LOCUS_50190 9560 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 10680 9583 gene locus_tag LOCUS_50200 10680 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 11334 10726 gene locus_tag LOCUS_50210 11334 10726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 11534 11322 gene locus_tag LOCUS_50220 11534 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 11791 11609 gene locus_tag LOCUS_50230 11791 11609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 12036 11812 gene locus_tag LOCUS_50240 12036 11812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 12242 11973 gene locus_tag LOCUS_50250 12242 11973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 12550 12128 gene locus_tag LOCUS_50260 12550 12128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50260 13325 12498 gene locus_tag LOCUS_50270 13325 12498 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_50270 15863 14298 gene locus_tag LOCUS_50280 15863 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50280 16923 15997 gene locus_tag LOCUS_50290 16923 15997 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_50290 17872 16892 gene locus_tag LOCUS_50300 17872 16892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 18089 17877 gene locus_tag LOCUS_50310 18089 17877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50310 18376 18951 gene locus_tag LOCUS_50320 18376 18951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 18846 19133 gene locus_tag LOCUS_50330 18846 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 20150 19155 gene locus_tag LOCUS_50340 20150 19155 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232642.1 protein_id gnl|my_center|LOCUS_50340 20763 20170 gene locus_tag LOCUS_50350 20763 20170 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231449.1 protein_id gnl|my_center|LOCUS_50350 22134 20971 gene locus_tag LOCUS_50360 22134 20971 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_50360 23249 22428 gene locus_tag LOCUS_50370 23249 22428 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_50370 23666 23785 gene locus_tag LOCUS_50380 23666 23785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 25185 23773 gene locus_tag LOCUS_50390 25185 23773 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_50390 26057 25182 gene locus_tag LOCUS_50400 26057 25182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 27452 26073 gene locus_tag LOCUS_50410 27452 26073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 27684 27397 gene locus_tag LOCUS_50420 27684 27397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 28641 27685 gene locus_tag LOCUS_50430 28641 27685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 29787 28915 gene locus_tag LOCUS_50440 29787 28915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50440 30182 29760 gene locus_tag LOCUS_50450 30182 29760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50450 32012 30465 gene locus_tag LOCUS_50460 gene purH 32012 30465 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745444.1 protein_id gnl|my_center|LOCUS_50460 32544 32065 gene locus_tag LOCUS_50470 gene purN 32544 32065 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393541.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50470 32675 32541 gene locus_tag LOCUS_50480 32675 32541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 33718 32675 gene locus_tag LOCUS_50490 gene purM 33718 32675 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_50490 34196 33795 gene locus_tag LOCUS_50500 34196 33795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50500 35275 34193 gene locus_tag LOCUS_50510 35275 34193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50510 37503 35260 gene locus_tag LOCUS_50520 gene purL 37503 35260 CDS product phosphoribosylformylglycinamidine synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055546.1 protein_id gnl|my_center|LOCUS_50520 38176 37481 gene locus_tag LOCUS_50530 gene purQ 38176 37481 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666779.1 protein_id gnl|my_center|LOCUS_50530 38422 38180 gene locus_tag LOCUS_50540 gene purS 38422 38180 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219409.1 protein_id gnl|my_center|LOCUS_50540 39436 38543 gene locus_tag LOCUS_50550 39436 38543 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922494.1 protein_id gnl|my_center|LOCUS_50550 40753 39452 gene locus_tag LOCUS_50560 gene purB 40753 39452 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625683.1 protein_id gnl|my_center|LOCUS_50560 41962 40763 gene locus_tag LOCUS_50570 gene purK 41962 40763 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196812.1 protein_id gnl|my_center|LOCUS_50570 42444 41959 gene locus_tag LOCUS_50580 gene purE 42444 41959 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839367.1 protein_id gnl|my_center|LOCUS_50580 >Feature sequence185 1018 134 gene locus_tag LOCUS_50590 1018 134 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 protein_id gnl|my_center|LOCUS_50590 1284 1439 gene locus_tag LOCUS_50600 1284 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 1436 2599 gene locus_tag LOCUS_50610 1436 2599 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975877.1 protein_id gnl|my_center|LOCUS_50610 2711 3682 gene locus_tag LOCUS_50620 2711 3682 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994448.1 protein_id gnl|my_center|LOCUS_50620 3682 4515 gene locus_tag LOCUS_50630 3682 4515 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 protein_id gnl|my_center|LOCUS_50630 4543 5214 gene locus_tag LOCUS_50640 4543 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50640 5220 6344 gene locus_tag LOCUS_50650 5220 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50650 6499 8337 gene locus_tag LOCUS_50660 gene yesM 6499 8337 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_50660 8485 9912 gene locus_tag LOCUS_50670 8485 9912 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_50670 9909 11270 gene locus_tag LOCUS_50680 9909 11270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 11302 12381 gene locus_tag LOCUS_50690 11302 12381 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050459751.1 protein_id gnl|my_center|LOCUS_50690 12400 13248 gene locus_tag LOCUS_50700 12400 13248 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_50700 13292 13519 gene locus_tag LOCUS_50710 13292 13519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 13516 14508 gene locus_tag LOCUS_50720 13516 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 14486 15124 gene locus_tag LOCUS_50730 14486 15124 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257281.1 protein_id gnl|my_center|LOCUS_50730 15244 16176 gene locus_tag LOCUS_50740 15244 16176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948979.1 protein_id gnl|my_center|LOCUS_50740 16195 17448 gene locus_tag LOCUS_50750 16195 17448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 17445 18548 gene locus_tag LOCUS_50760 17445 18548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 18592 18783 gene locus_tag LOCUS_50770 18592 18783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 >Feature sequence186 913 260 gene locus_tag LOCUS_50780 913 260 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229784.1 protein_id gnl|my_center|LOCUS_50780 1580 927 gene locus_tag LOCUS_50790 1580 927 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112672.1 protein_id gnl|my_center|LOCUS_50790 2489 1608 gene locus_tag LOCUS_50800 gene glnH 2489 1608 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916480.1 protein_id gnl|my_center|LOCUS_50800 3019 2552 gene locus_tag LOCUS_50810 3019 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50810 3258 3100 gene locus_tag LOCUS_50820 3258 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50820 4242 3433 gene locus_tag LOCUS_50830 4242 3433 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 protein_id gnl|my_center|LOCUS_50830 6674 4284 gene locus_tag LOCUS_50840 6674 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 7246 6773 gene locus_tag LOCUS_50850 7246 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 >Feature sequence187 719 228 gene locus_tag LOCUS_50860 719 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 1333 776 gene locus_tag LOCUS_50870 1333 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50870 1656 1330 gene locus_tag LOCUS_50880 1656 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50880 2628 1669 gene locus_tag LOCUS_50890 2628 1669 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_50890 2835 2665 gene locus_tag LOCUS_50900 2835 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 3842 2784 gene locus_tag LOCUS_50910 3842 2784 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026981.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50910 >Feature sequence188 3 365 gene locus_tag LOCUS_50920 3 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 378 716 gene locus_tag LOCUS_50930 378 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50930 710 1216 gene locus_tag LOCUS_50940 710 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50940 1348 1581 gene locus_tag LOCUS_50950 1348 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 1578 2048 gene locus_tag LOCUS_50960 1578 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 2117 2983 gene locus_tag LOCUS_50970 gene mmsB 2117 2983 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114168.1 protein_id gnl|my_center|LOCUS_50970 2988 3665 gene locus_tag LOCUS_50980 2988 3665 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175134.1 protein_id gnl|my_center|LOCUS_50980 3662 4735 gene locus_tag LOCUS_50990 3662 4735 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137395785.1 protein_id gnl|my_center|LOCUS_50990 4752 5915 gene locus_tag LOCUS_51000 4752 5915 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459150.1 protein_id gnl|my_center|LOCUS_51000 5938 7410 gene locus_tag LOCUS_51010 5938 7410 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 protein_id gnl|my_center|LOCUS_51010 7659 7982 gene locus_tag LOCUS_51020 7659 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51020 7979 8560 gene locus_tag LOCUS_51030 7979 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51030 8580 9134 gene locus_tag LOCUS_51040 8580 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 9259 9807 gene locus_tag LOCUS_51050 9259 9807 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931266.1 protein_id gnl|my_center|LOCUS_51050 9807 10571 gene locus_tag LOCUS_51060 9807 10571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 11070 10576 gene locus_tag LOCUS_51070 11070 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 >Feature sequence189 1089 142 gene locus_tag LOCUS_51080 1089 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 1475 1140 gene locus_tag LOCUS_51090 1475 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51090 1726 1367 gene locus_tag LOCUS_51100 1726 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51100 3573 1681 gene locus_tag LOCUS_51110 3573 1681 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005309.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51110 3803 3603 gene locus_tag LOCUS_51120 gene copZ 3803 3603 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076661.1 protein_id gnl|my_center|LOCUS_51120 4434 4075 gene locus_tag LOCUS_51130 4434 4075 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_51130 5365 4622 gene locus_tag LOCUS_51140 5365 4622 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905831.1 protein_id gnl|my_center|LOCUS_51140 6261 5392 gene locus_tag LOCUS_51150 6261 5392 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_51150 6392 7297 gene locus_tag LOCUS_51160 6392 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 7357 8082 gene locus_tag LOCUS_51170 7357 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51170 8336 8163 gene locus_tag LOCUS_51180 8336 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 8417 8731 gene locus_tag LOCUS_51190 8417 8731 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813646.1 protein_id gnl|my_center|LOCUS_51190 8924 9541 gene locus_tag LOCUS_51200 8924 9541 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905527.1 protein_id gnl|my_center|LOCUS_51200 9940 9632 gene locus_tag LOCUS_51210 9940 9632 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017800955.1 protein_id gnl|my_center|LOCUS_51210 10183 11106 gene locus_tag LOCUS_51220 10183 11106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 >Feature sequence190 1549 284 gene locus_tag LOCUS_51230 1549 284 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_51230 1770 1504 gene locus_tag LOCUS_51240 1770 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 3646 1859 gene locus_tag LOCUS_51250 3646 1859 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_51250 >Feature sequence191 2527 1610 gene locus_tag LOCUS_51260 2527 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 3372 2524 gene locus_tag LOCUS_51270 3372 2524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256857.1 protein_id gnl|my_center|LOCUS_51270 4500 3574 gene locus_tag LOCUS_51280 4500 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 4838 4404 gene locus_tag LOCUS_51290 4838 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 5875 4778 gene locus_tag LOCUS_51300 5875 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 6475 6164 gene locus_tag LOCUS_51310 6475 6164 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637502.1 protein_id gnl|my_center|LOCUS_51310 8076 6646 gene locus_tag LOCUS_51320 8076 6646 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218124.1 protein_id gnl|my_center|LOCUS_51320 9170 8175 gene locus_tag LOCUS_51330 gene iolC 9170 8175 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068622.1 protein_id gnl|my_center|LOCUS_51330 10027 9167 gene locus_tag LOCUS_51340 gene iolB 10027 9167 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528375.1 protein_id gnl|my_center|LOCUS_51340 11075 10062 gene locus_tag LOCUS_51350 gene iolG 11075 10062 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398990.1 protein_id gnl|my_center|LOCUS_51350 11601 11128 gene locus_tag LOCUS_51360 11601 11128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51360 12011 11598 gene locus_tag LOCUS_51370 12011 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51370 13897 12035 gene locus_tag LOCUS_51380 gene iolD 13897 12035 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268320.1 protein_id gnl|my_center|LOCUS_51380 15270 14257 gene locus_tag LOCUS_51390 gene degA 15270 14257 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_51390 16747 15449 gene locus_tag LOCUS_51400 16747 15449 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226019.1 protein_id gnl|my_center|LOCUS_51400 17661 16792 gene locus_tag LOCUS_51410 17661 16792 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_51410 18545 17670 gene locus_tag LOCUS_51420 18545 17670 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_51420 19996 18590 gene locus_tag LOCUS_51430 19996 18590 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_51430 21127 20165 gene locus_tag LOCUS_51440 gene malR 21127 20165 CDS product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219042.1 protein_id gnl|my_center|LOCUS_51440 >Feature sequence192 515 775 gene locus_tag LOCUS_51450 515 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 817 990 gene locus_tag LOCUS_51460 817 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 1197 1883 gene locus_tag LOCUS_51470 1197 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51470 4267 2630 gene locus_tag LOCUS_51480 4267 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 6065 4260 gene locus_tag LOCUS_51490 6065 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 7474 6158 gene locus_tag LOCUS_51500 7474 6158 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359868.1 protein_id gnl|my_center|LOCUS_51500 7899 7639 gene locus_tag LOCUS_51510 7899 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51510 9452 8487 gene locus_tag LOCUS_51520 9452 8487 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_51520 10574 9543 gene locus_tag LOCUS_51530 10574 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 11137 11046 gene locus_tag LOCUS_t00520 11137 11046 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12752 11508 gene locus_tag LOCUS_51540 12752 11508 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_51540 14452 12746 gene locus_tag LOCUS_51550 14452 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127588486.1 protein_id gnl|my_center|LOCUS_51550 14748 14663 gene locus_tag LOCUS_t00530 14748 14663 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14884 14809 gene locus_tag LOCUS_t00540 14884 14809 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 15004 14930 gene locus_tag LOCUS_t00550 15004 14930 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence193 817 1143 gene locus_tag LOCUS_51560 817 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 2009 1140 gene locus_tag LOCUS_51570 2009 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 2459 2938 gene locus_tag LOCUS_51580 2459 2938 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989488.1 protein_id gnl|my_center|LOCUS_51580 4382 2955 gene locus_tag LOCUS_51590 4382 2955 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229519.1 protein_id gnl|my_center|LOCUS_51590 5787 4375 gene locus_tag LOCUS_51600 gene glcD 5787 4375 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398865.1 protein_id gnl|my_center|LOCUS_51600 5917 6648 gene locus_tag LOCUS_51610 gene lutR 5917 6648 CDS product L-lactate utilization/bacilysin biosynthesis transcriptional regulator LutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968191.1 protein_id gnl|my_center|LOCUS_51610 7353 6703 gene locus_tag LOCUS_51620 7353 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 7569 7378 gene locus_tag LOCUS_51630 7569 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 8264 7542 gene locus_tag LOCUS_51640 8264 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51640 >Feature sequence194 353 177 gene locus_tag LOCUS_51650 353 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 2022 607 gene locus_tag LOCUS_51660 2022 607 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886639.1 protein_id gnl|my_center|LOCUS_51660 2336 2001 gene locus_tag LOCUS_51670 2336 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 3420 2341 gene locus_tag LOCUS_51680 3420 2341 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755970.1 protein_id gnl|my_center|LOCUS_51680 4921 3449 gene locus_tag LOCUS_51690 4921 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 5619 4918 gene locus_tag LOCUS_51700 5619 4918 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195828.1 protein_id gnl|my_center|LOCUS_51700 7731 5944 gene locus_tag LOCUS_51710 7731 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51710 >Feature sequence195 595 104 gene locus_tag LOCUS_51720 595 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51720 825 592 gene locus_tag LOCUS_51730 825 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51730 1091 714 gene locus_tag LOCUS_51740 1091 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51740 1838 1512 gene locus_tag LOCUS_51750 1838 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 2326 1832 gene locus_tag LOCUS_51760 2326 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 4254 3178 gene locus_tag LOCUS_51770 4254 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 5379 4276 gene locus_tag LOCUS_51780 5379 4276 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_51780 6049 5621 gene locus_tag LOCUS_51790 6049 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 7292 6375 gene locus_tag LOCUS_51800 7292 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 7488 7264 gene locus_tag LOCUS_51810 7488 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 9725 8673 gene locus_tag LOCUS_51820 9725 8673 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210043.1 protein_id gnl|my_center|LOCUS_51820 10766 9786 gene locus_tag LOCUS_51830 10766 9786 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969272.1 protein_id gnl|my_center|LOCUS_51830 11772 10780 gene locus_tag LOCUS_51840 11772 10780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210045.1 protein_id gnl|my_center|LOCUS_51840 12401 11769 gene locus_tag LOCUS_51850 12401 11769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51850 13300 12449 gene locus_tag LOCUS_51860 13300 12449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51860 13860 13339 gene locus_tag LOCUS_51870 13860 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51870 14186 13857 gene locus_tag LOCUS_51880 14186 13857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 >Feature sequence196 990 127 gene locus_tag LOCUS_51890 990 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 2138 1083 gene locus_tag LOCUS_51900 2138 1083 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_51900 3198 2215 gene locus_tag LOCUS_51910 3198 2215 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51910 3380 3165 gene locus_tag LOCUS_51920 3380 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51920 4296 3373 gene locus_tag LOCUS_51930 4296 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 4839 5600 gene locus_tag LOCUS_51940 4839 5600 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976366.1 protein_id gnl|my_center|LOCUS_51940 5658 6452 gene locus_tag LOCUS_51950 5658 6452 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_51950 6495 7388 gene locus_tag LOCUS_51960 6495 7388 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223727.1 protein_id gnl|my_center|LOCUS_51960 7404 8108 gene locus_tag LOCUS_51970 7404 8108 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_51970 9438 8173 gene locus_tag LOCUS_51980 9438 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 9663 10805 gene locus_tag LOCUS_51990 9663 10805 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039287.1 protein_id gnl|my_center|LOCUS_51990 >Feature sequence197 1174 365 gene locus_tag LOCUS_52000 1174 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52000 1662 1204 gene locus_tag LOCUS_52010 1662 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52010 1853 2644 gene locus_tag LOCUS_52020 1853 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 3107 2658 gene locus_tag LOCUS_52030 3107 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 3422 4891 gene locus_tag LOCUS_52040 3422 4891 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226022.1 protein_id gnl|my_center|LOCUS_52040 5528 4962 gene locus_tag LOCUS_52050 5528 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52050 5803 5537 gene locus_tag LOCUS_52060 5803 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 6011 6304 gene locus_tag LOCUS_52070 6011 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 6439 7383 gene locus_tag LOCUS_52080 6439 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52080 7380 7595 gene locus_tag LOCUS_52090 7380 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 8279 9049 gene locus_tag LOCUS_52100 8279 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52100 9019 10038 gene locus_tag LOCUS_52110 9019 10038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52110 10031 11290 gene locus_tag LOCUS_52120 10031 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 11471 12220 gene locus_tag LOCUS_52130 11471 12220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 12228 13082 gene locus_tag LOCUS_52140 gene thiG 12228 13082 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931981.1 protein_id gnl|my_center|LOCUS_52140 13079 14215 gene locus_tag LOCUS_52150 gene thiO 13079 14215 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_52150 14229 15056 gene locus_tag LOCUS_52160 gene thiD 14229 15056 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228119.1 protein_id gnl|my_center|LOCUS_52160 15628 17286 gene locus_tag LOCUS_52170 15628 17286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 17171 19528 gene locus_tag LOCUS_52180 17171 19528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 20789 21250 gene locus_tag LOCUS_52190 20789 21250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 21583 22245 gene locus_tag LOCUS_52200 21583 22245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 >Feature sequence198 420 1496 gene locus_tag LOCUS_52210 420 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52210 1481 2038 gene locus_tag LOCUS_52220 1481 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52220 2264 3661 gene locus_tag LOCUS_52230 2264 3661 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392746.1 protein_id gnl|my_center|LOCUS_52230 >Feature sequence199 1358 123 gene locus_tag LOCUS_52240 1358 123 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615621.1 protein_id gnl|my_center|LOCUS_52240 1805 1515 gene locus_tag LOCUS_52250 1805 1515 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942661.1 protein_id gnl|my_center|LOCUS_52250 2381 3250 gene locus_tag LOCUS_52260 2381 3250 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868944.1 protein_id gnl|my_center|LOCUS_52260 3523 4512 gene locus_tag LOCUS_52270 3523 4512 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_52270 4747 6903 gene locus_tag LOCUS_52280 4747 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 6885 7829 gene locus_tag LOCUS_52290 6885 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 8030 8803 gene locus_tag LOCUS_52300 8030 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52300 8854 9444 gene locus_tag LOCUS_52310 8854 9444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52310 9614 11047 gene locus_tag LOCUS_52320 9614 11047 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244488.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52320 11062 11364 gene locus_tag LOCUS_52330 11062 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 11677 11417 gene locus_tag LOCUS_52340 11677 11417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 12144 11740 gene locus_tag LOCUS_52350 12144 11740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 12830 12144 gene locus_tag LOCUS_52360 12830 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 >Feature sequence200 99 1115 gene locus_tag LOCUS_52370 gene uxuA 99 1115 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082566.1 protein_id gnl|my_center|LOCUS_52370 2608 1220 gene locus_tag LOCUS_52380 2608 1220 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902283.1 protein_id gnl|my_center|LOCUS_52380 3429 2647 gene locus_tag LOCUS_52390 gene fabG 3429 2647 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_52390 4232 3426 gene locus_tag LOCUS_52400 4232 3426 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_52400 4678 4454 gene locus_tag LOCUS_52410 4678 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 5661 5218 gene locus_tag LOCUS_52420 5661 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 6410 5658 gene locus_tag LOCUS_52430 6410 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 6587 7030 gene locus_tag LOCUS_52440 6587 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 7058 8206 gene locus_tag LOCUS_52450 7058 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 8265 9209 gene locus_tag LOCUS_52460 8265 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 9179 10312 gene locus_tag LOCUS_52470 9179 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52470 >Feature sequence201 388 1242 gene locus_tag LOCUS_52480 388 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 2579 1275 gene locus_tag LOCUS_52490 2579 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 2859 4091 gene locus_tag LOCUS_52500 2859 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 4504 4178 gene locus_tag LOCUS_52510 4504 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 4820 5764 gene locus_tag LOCUS_52520 4820 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 5905 7005 gene locus_tag LOCUS_52530 gene ychF 5905 7005 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 protein_id gnl|my_center|LOCUS_52530 7135 8202 gene locus_tag LOCUS_52540 gene prfA 7135 8202 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227645.1 protein_id gnl|my_center|LOCUS_52540 8350 9261 gene locus_tag LOCUS_52550 gene prmC 8350 9261 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393873.1 protein_id gnl|my_center|LOCUS_52550 9518 10180 gene locus_tag LOCUS_52560 gene spoIIR 9518 10180 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227654.1 protein_id gnl|my_center|LOCUS_52560 >Feature sequence202 1189 314 gene locus_tag LOCUS_52570 1189 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 1178 1594 gene locus_tag LOCUS_52580 1178 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 2717 2265 gene locus_tag LOCUS_52590 2717 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 3255 2836 gene locus_tag LOCUS_52600 3255 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 4419 3880 gene locus_tag LOCUS_52610 4419 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 5356 4643 gene locus_tag LOCUS_52620 5356 4643 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222118.1 protein_id gnl|my_center|LOCUS_52620 6538 5666 gene locus_tag LOCUS_52630 6538 5666 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728964.1 protein_id gnl|my_center|LOCUS_52630 6648 7235 gene locus_tag LOCUS_52640 6648 7235 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080680.1 protein_id gnl|my_center|LOCUS_52640 9709 7574 gene locus_tag LOCUS_52650 9709 7574 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_52650 9900 9733 gene locus_tag LOCUS_52660 9900 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 10258 9893 gene locus_tag LOCUS_52670 10258 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 10649 10293 gene locus_tag LOCUS_52680 10649 10293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 10865 10680 gene locus_tag LOCUS_52690 10865 10680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 11035 11286 gene locus_tag LOCUS_52700 11035 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 12127 11480 gene locus_tag LOCUS_52710 12127 11480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 12500 12195 gene locus_tag LOCUS_52720 12500 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 14152 12500 gene locus_tag LOCUS_52730 14152 12500 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_52730 14446 14255 gene locus_tag LOCUS_52740 14446 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 15399 14494 gene locus_tag LOCUS_52750 15399 14494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 15749 15396 gene locus_tag LOCUS_52760 15749 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 15985 15737 gene locus_tag LOCUS_52770 15985 15737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 16335 15985 gene locus_tag LOCUS_52780 16335 15985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 17514 16429 gene locus_tag LOCUS_52790 17514 16429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52790 17618 17454 gene locus_tag LOCUS_52800 17618 17454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 18020 17634 gene locus_tag LOCUS_52810 18020 17634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 18501 18304 gene locus_tag LOCUS_52820 18501 18304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52820 18738 18598 gene locus_tag LOCUS_52830 18738 18598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 >Feature sequence203 172 600 gene locus_tag LOCUS_52840 172 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 657 1001 gene locus_tag LOCUS_52850 657 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 1013 1522 gene locus_tag LOCUS_52860 1013 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 1516 2148 gene locus_tag LOCUS_52870 1516 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 2810 2418 gene locus_tag LOCUS_52880 2810 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 3045 3551 gene locus_tag LOCUS_52890 3045 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52890 3443 4468 gene locus_tag LOCUS_52900 3443 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52900 4567 4839 gene locus_tag LOCUS_52910 4567 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52910 4794 5597 gene locus_tag LOCUS_52920 gene bfmBAA 4794 5597 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852555.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52920 5598 6581 gene locus_tag LOCUS_52930 gene bfmBAB 5598 6581 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290076.1 protein_id gnl|my_center|LOCUS_52930 6667 8025 gene locus_tag LOCUS_52940 gene bfmBB 6667 8025 CDS product branched-chain alpha-keto dehydrogenase complex dihydrolipoyllysine-residue (2-methylpropanoyl)transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230323.1 protein_id gnl|my_center|LOCUS_52940 8043 8714 gene locus_tag LOCUS_52950 gene lipB 8043 8714 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_52950 9526 10014 gene locus_tag LOCUS_52960 9526 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52960 10459 11025 gene locus_tag LOCUS_52970 10459 11025 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067038.1 protein_id gnl|my_center|LOCUS_52970 11022 12227 gene locus_tag LOCUS_52980 11022 12227 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246128.1 protein_id gnl|my_center|LOCUS_52980 12260 12898 gene locus_tag LOCUS_52990 gene spoIIM 12260 12898 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269093.1 protein_id gnl|my_center|LOCUS_52990 13007 13480 gene locus_tag LOCUS_53000 gene fur 13007 13480 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223972.1 protein_id gnl|my_center|LOCUS_53000 13659 14765 gene locus_tag LOCUS_53010 gene ald 13659 14765 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243280.1 protein_id gnl|my_center|LOCUS_53010 14880 15113 gene locus_tag LOCUS_53020 14880 15113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 15143 16135 gene locus_tag LOCUS_53030 gene xerD 15143 16135 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_53030 16182 16571 gene locus_tag LOCUS_53040 16182 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53040 16571 17011 gene locus_tag LOCUS_53050 16571 17011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53050 17122 17316 gene locus_tag LOCUS_53060 17122 17316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 >Feature sequence204 663 1226 gene locus_tag LOCUS_53070 663 1226 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880222.1 protein_id gnl|my_center|LOCUS_53070 2067 1525 gene locus_tag LOCUS_53080 gene chrA 2067 1525 CDS product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 protein_id gnl|my_center|LOCUS_53080 2687 2055 gene locus_tag LOCUS_53090 gene chrB 2687 2055 CDS product chromate efflux transporter subunit ChrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227843.1 protein_id gnl|my_center|LOCUS_53090 3172 2690 gene locus_tag LOCUS_53100 gene chrS 3172 2690 CDS product chromate efflux transcriptional regulator ChrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242900.1 protein_id gnl|my_center|LOCUS_53100 >Feature sequence205 1135 398 gene locus_tag LOCUS_53110 1135 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53110 1841 1473 gene locus_tag LOCUS_53120 1841 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 2251 2571 gene locus_tag LOCUS_53130 2251 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 3547 2645 gene locus_tag LOCUS_53140 gene sdaAA 3547 2645 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003739226.1 protein_id gnl|my_center|LOCUS_53140 4221 3544 gene locus_tag LOCUS_53150 gene sdaAB 4221 3544 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294585.1 protein_id gnl|my_center|LOCUS_53150 5343 4270 gene locus_tag LOCUS_53160 5343 4270 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213126768.1 protein_id gnl|my_center|LOCUS_53160 6361 5345 gene locus_tag LOCUS_53170 6361 5345 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_53170 7837 6488 gene locus_tag LOCUS_53180 7837 6488 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439084.1 protein_id gnl|my_center|LOCUS_53180 8099 8668 gene locus_tag LOCUS_53190 8099 8668 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181842.1 protein_id gnl|my_center|LOCUS_53190 8736 9533 gene locus_tag LOCUS_53200 8736 9533 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_53200 10240 9614 gene locus_tag LOCUS_53210 10240 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 11450 10443 gene locus_tag LOCUS_53220 11450 10443 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983751.1 protein_id gnl|my_center|LOCUS_53220 12454 11447 gene locus_tag LOCUS_53230 12454 11447 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823047.1 protein_id gnl|my_center|LOCUS_53230 13555 12569 gene locus_tag LOCUS_53240 13555 12569 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732576.1 protein_id gnl|my_center|LOCUS_53240 >Feature sequence206 604 1989 gene locus_tag LOCUS_53250 604 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53250 1932 2384 gene locus_tag LOCUS_53260 1932 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53260 2377 2712 gene locus_tag LOCUS_53270 2377 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 2670 4016 gene locus_tag LOCUS_53280 2670 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53280 >Feature sequence207 619 1152 gene locus_tag LOCUS_53290 619 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53290 3159 1261 gene locus_tag LOCUS_53300 3159 1261 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460118.1 protein_id gnl|my_center|LOCUS_53300 4028 3582 gene locus_tag LOCUS_53310 4028 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 4284 4604 gene locus_tag LOCUS_53320 4284 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 5242 5018 gene locus_tag LOCUS_53330 5242 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 5840 5235 gene locus_tag LOCUS_53340 5840 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 6948 5887 gene locus_tag LOCUS_53350 6948 5887 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727368.1 protein_id gnl|my_center|LOCUS_53350 8283 7141 gene locus_tag LOCUS_53360 8283 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 9549 8320 gene locus_tag LOCUS_53370 9549 8320 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392450.1 protein_id gnl|my_center|LOCUS_53370 9662 9531 gene locus_tag LOCUS_53380 9662 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 10008 10409 gene locus_tag LOCUS_53390 10008 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 10310 10510 gene locus_tag LOCUS_53400 10310 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 10516 11475 gene locus_tag LOCUS_53410 10516 11475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 11481 11762 gene locus_tag LOCUS_53420 11481 11762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 11936 12718 gene locus_tag LOCUS_53430 11936 12718 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085668.1 protein_id gnl|my_center|LOCUS_53430 14060 12855 gene locus_tag LOCUS_53440 gene mtnK 14060 12855 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948891.1 protein_id gnl|my_center|LOCUS_53440 14398 14685 gene locus_tag LOCUS_53450 14398 14685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53450 15864 15019 gene locus_tag LOCUS_53460 gene gerHC 15864 15019 CDS product spore germination protein GerHC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411389.1 protein_id gnl|my_center|LOCUS_53460 16882 16088 gene locus_tag LOCUS_53470 16882 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53470 17181 16882 gene locus_tag LOCUS_53480 17181 16882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53480 18703 17216 gene locus_tag LOCUS_53490 18703 17216 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802302.1 protein_id gnl|my_center|LOCUS_53490 20187 18907 gene locus_tag LOCUS_53500 20187 18907 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021210.1 protein_id gnl|my_center|LOCUS_53500 >Feature sequence208 54 449 gene locus_tag LOCUS_53510 54 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 478 1428 gene locus_tag LOCUS_53520 478 1428 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_53520 2425 1589 gene locus_tag LOCUS_53530 2425 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 3319 2465 gene locus_tag LOCUS_53540 3319 2465 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_53540 3449 4309 gene locus_tag LOCUS_53550 3449 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 5219 4440 gene locus_tag LOCUS_53560 5219 4440 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723203.1 protein_id gnl|my_center|LOCUS_53560 5493 6983 gene locus_tag LOCUS_53570 5493 6983 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104585.1 protein_id gnl|my_center|LOCUS_53570 6996 7988 gene locus_tag LOCUS_53580 6996 7988 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530262.1 protein_id gnl|my_center|LOCUS_53580 8014 8787 gene locus_tag LOCUS_53590 8014 8787 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437663.1 protein_id gnl|my_center|LOCUS_53590 8810 9484 gene locus_tag LOCUS_53600 8810 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53600 9484 9816 gene locus_tag LOCUS_53610 9484 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53610 9979 11430 gene locus_tag LOCUS_53620 9979 11430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 11446 12084 gene locus_tag LOCUS_53630 gene dhaL 11446 12084 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008607.1 protein_id gnl|my_center|LOCUS_53630 12091 13041 gene locus_tag LOCUS_53640 gene glpX 12091 13041 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439090.1 protein_id gnl|my_center|LOCUS_53640 13069 13740 gene locus_tag LOCUS_53650 gene fsa 13069 13740 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723193.1 protein_id gnl|my_center|LOCUS_53650 13740 15734 gene locus_tag LOCUS_53660 gene tkt 13740 15734 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 protein_id gnl|my_center|LOCUS_53660 >Feature sequence209 1492 368 gene locus_tag LOCUS_53670 1492 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 2537 1707 gene locus_tag LOCUS_53680 gene besA 2537 1707 CDS product ferri-bacillibactin esterase BesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228740.1 protein_id gnl|my_center|LOCUS_53680 2872 2582 gene locus_tag LOCUS_53690 2872 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53690 3318 2869 gene locus_tag LOCUS_53700 3318 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53700 4440 3412 gene locus_tag LOCUS_53710 4440 3412 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920450.1 protein_id gnl|my_center|LOCUS_53710 5443 4433 gene locus_tag LOCUS_53720 5443 4433 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173074.1 protein_id gnl|my_center|LOCUS_53720 6508 5453 gene locus_tag LOCUS_53730 gene feuA 6508 5453 CDS product iron ABC transporter substrate-binding protein FeuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234978.1 protein_id gnl|my_center|LOCUS_53730 8014 6611 gene locus_tag LOCUS_53740 gene btr 8014 6611 CDS product bacillibactin transport transcriptional regulator Btr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234977.1 protein_id gnl|my_center|LOCUS_53740 8992 8450 gene locus_tag LOCUS_53750 8992 8450 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030768.1 protein_id gnl|my_center|LOCUS_53750 >Feature sequence210 197 631 gene locus_tag LOCUS_53760 197 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53760 944 1924 gene locus_tag LOCUS_53770 944 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 1921 2724 gene locus_tag LOCUS_53780 1921 2724 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956754.1 protein_id gnl|my_center|LOCUS_53780 2729 2983 gene locus_tag LOCUS_53790 2729 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53790 2884 3510 gene locus_tag LOCUS_53800 2884 3510 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681582.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53800 >Feature sequence211 42 386 gene locus_tag LOCUS_53810 42 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 424 1389 gene locus_tag LOCUS_53820 424 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 1407 2345 gene locus_tag LOCUS_53830 1407 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 2509 3159 gene locus_tag LOCUS_53840 2509 3159 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53840 >Feature sequence212 2102 198 gene locus_tag LOCUS_53850 2102 198 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272544.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53850 2611 2099 gene locus_tag LOCUS_53860 2611 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53860 3222 2704 gene locus_tag LOCUS_53870 3222 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53870 5117 3219 gene locus_tag LOCUS_53880 5117 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53880 >Feature sequence213 265 65 gene locus_tag LOCUS_53890 265 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 638 357 gene locus_tag LOCUS_53900 638 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 975 661 gene locus_tag LOCUS_53910 975 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 2619 1342 gene locus_tag LOCUS_53920 2619 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 3983 2625 gene locus_tag LOCUS_53930 3983 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 4639 4253 gene locus_tag LOCUS_53940 4639 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 4972 4640 gene locus_tag LOCUS_53950 4972 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 5942 5115 gene locus_tag LOCUS_53960 5942 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 6580 5942 gene locus_tag LOCUS_53970 6580 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 >Feature sequence214 <1 949 gene locus_tag LOCUS_53980 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000593465.1:chitin disaccharide deacetylase 1210 2214 gene locus_tag LOCUS_53990 1210 2214 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762079.1 protein_id gnl|my_center|LOCUS_53990 2245 4551 gene locus_tag LOCUS_54000 2245 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 4641 4934 gene locus_tag LOCUS_54010 4641 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 5018 5524 gene locus_tag LOCUS_54020 5018 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 >Feature sequence215 716 1972 gene locus_tag LOCUS_54030 gene ltrA 716 1972 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_54030 >Feature sequence216 642 100 gene locus_tag LOCUS_54040 642 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 1298 978 gene locus_tag LOCUS_54050 1298 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54050 1645 1352 gene locus_tag LOCUS_54060 1645 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 >Feature sequence217 49 600 gene locus_tag LOCUS_54070 49 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 612 1769 gene locus_tag LOCUS_54080 612 1769 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025547.1 protein_id gnl|my_center|LOCUS_54080 2721 1948 gene locus_tag LOCUS_54090 gene sigB 2721 1948 CDS product RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002164611.1 protein_id gnl|my_center|LOCUS_54090 3194 2718 gene locus_tag LOCUS_54100 gene rsbW 3194 2718 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234299.1 protein_id gnl|my_center|LOCUS_54100 3547 3218 gene locus_tag LOCUS_54110 3547 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 3825 4355 gene locus_tag LOCUS_54120 3825 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 4721 4503 gene locus_tag LOCUS_54130 4721 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 5305 4832 gene locus_tag LOCUS_54140 5305 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 6350 5490 gene locus_tag LOCUS_54150 6350 5490 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901419.1 protein_id gnl|my_center|LOCUS_54150 6568 7740 gene locus_tag LOCUS_54160 6568 7740 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016043.1 protein_id gnl|my_center|LOCUS_54160 7796 8785 gene locus_tag LOCUS_54170 gene galE 7796 8785 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964738.1 protein_id gnl|my_center|LOCUS_54170 >Feature sequence218 655 2772 gene locus_tag LOCUS_54180 655 2772 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084425723.1 protein_id gnl|my_center|LOCUS_54180 4223 2760 gene locus_tag LOCUS_54190 4223 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54190 4705 4220 gene locus_tag LOCUS_54200 4705 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54200 6429 4702 gene locus_tag LOCUS_54210 6429 4702 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 protein_id gnl|my_center|LOCUS_54210 6952 6464 gene locus_tag LOCUS_54220 6952 6464 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724169.1 protein_id gnl|my_center|LOCUS_54220 7209 8504 gene locus_tag LOCUS_54230 7209 8504 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229240.1 protein_id gnl|my_center|LOCUS_54230 9065 10087 gene locus_tag LOCUS_54240 9065 10087 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259167.1 protein_id gnl|my_center|LOCUS_54240 11074 10124 gene locus_tag LOCUS_54250 11074 10124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 11329 12531 gene locus_tag LOCUS_54260 11329 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 12930 13883 gene locus_tag LOCUS_54270 gene yclN 12930 13883 CDS product petrobactin ABC transporter permease YclN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234491.1 protein_id gnl|my_center|LOCUS_54270 13873 14817 gene locus_tag LOCUS_54280 gene yclO 13873 14817 CDS product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 protein_id gnl|my_center|LOCUS_54280 14814 15572 gene locus_tag LOCUS_54290 gene yclP 14814 15572 CDS product petrobactin ABC transporter ATP-binding protein YclP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234487.1 protein_id gnl|my_center|LOCUS_54290 15658 16677 gene locus_tag LOCUS_54300 gene yclQ 15658 16677 CDS product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 protein_id gnl|my_center|LOCUS_54300 17936 17256 gene locus_tag LOCUS_54310 17936 17256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 18267 20102 gene locus_tag LOCUS_54320 18267 20102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_54320 20080 20829 gene locus_tag LOCUS_54330 20080 20829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54330 21443 21934 gene locus_tag LOCUS_54340 21443 21934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54340 >Feature sequence219 179 1051 gene locus_tag LOCUS_54350 179 1051 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_54350 1048 2295 gene locus_tag LOCUS_54360 1048 2295 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438096.1 protein_id gnl|my_center|LOCUS_54360 2292 3605 gene locus_tag LOCUS_54370 gene asnS 2292 3605 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 protein_id gnl|my_center|LOCUS_54370 3691 4368 gene locus_tag LOCUS_54380 gene dnaD 3691 4368 CDS product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398499.1 protein_id gnl|my_center|LOCUS_54380 5884 4919 gene locus_tag LOCUS_54390 5884 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 >Feature sequence220 1076 138 gene locus_tag LOCUS_54400 gene cysK 1076 138 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244491.1 protein_id gnl|my_center|LOCUS_54400 2156 1182 gene locus_tag LOCUS_54410 2156 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 3033 2173 gene locus_tag LOCUS_54420 gene hslO 3033 2173 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 protein_id gnl|my_center|LOCUS_54420 3921 3154 gene locus_tag LOCUS_54430 3921 3154 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_54430 4814 3918 gene locus_tag LOCUS_54440 gene nadC 4814 3918 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_54440 6426 4807 gene locus_tag LOCUS_54450 gene nadB 6426 4807 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_54450 7408 6470 gene locus_tag LOCUS_54460 gene nadA 7408 6470 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020997.1 protein_id gnl|my_center|LOCUS_54460 >Feature sequence221 569 751 gene locus_tag LOCUS_54470 569 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 2228 819 gene locus_tag LOCUS_54480 gene ltrA 2228 819 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_54480 >Feature sequence222 248 21 gene locus_tag LOCUS_54490 248 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 1206 289 gene locus_tag LOCUS_54500 1206 289 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_54500 1592 1861 gene locus_tag LOCUS_54510 1592 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 2387 1983 gene locus_tag LOCUS_54520 2387 1983 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 protein_id gnl|my_center|LOCUS_54520 2682 2389 gene locus_tag LOCUS_54530 2682 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54530 3748 2903 gene locus_tag LOCUS_54540 3748 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 4592 3807 gene locus_tag LOCUS_54550 4592 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54550 5032 4550 gene locus_tag LOCUS_54560 5032 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54560 5845 5060 gene locus_tag LOCUS_54570 5845 5060 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970645.1 protein_id gnl|my_center|LOCUS_54570 6530 5871 gene locus_tag LOCUS_54580 gene rspR 6530 5871 CDS product DNA-binding transcriptional regulator rspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215553.1 protein_id gnl|my_center|LOCUS_54580 7631 6573 gene locus_tag LOCUS_54590 7631 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 8466 7636 gene locus_tag LOCUS_54600 8466 7636 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189285321.1 protein_id gnl|my_center|LOCUS_54600 9329 8466 gene locus_tag LOCUS_54610 9329 8466 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189285322.1 protein_id gnl|my_center|LOCUS_54610 10059 9409 gene locus_tag LOCUS_54620 10059 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54620 10529 10056 gene locus_tag LOCUS_54630 10529 10056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54630 11941 11381 gene locus_tag LOCUS_54640 11941 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 12301 12726 gene locus_tag LOCUS_54650 12301 12726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 >Feature sequence223 1688 489 gene locus_tag LOCUS_54660 1688 489 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730052.1 protein_id gnl|my_center|LOCUS_54660 2666 1761 gene locus_tag LOCUS_54670 gene hprK 2666 1761 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_54670 3225 4334 gene locus_tag LOCUS_54680 3225 4334 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273580.1 protein_id gnl|my_center|LOCUS_54680 4900 4424 gene locus_tag LOCUS_54690 4900 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 5313 5134 gene locus_tag LOCUS_54700 5313 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 6503 5412 gene locus_tag LOCUS_54710 6503 5412 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_54710 >Feature sequence224 103 1290 gene locus_tag LOCUS_54720 103 1290 CDS product IS256-like element ISEfm2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081133701.1 protein_id gnl|my_center|LOCUS_54720 >Feature sequence225 1110 58 gene locus_tag LOCUS_54730 1110 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54730 1750 1118 gene locus_tag LOCUS_54740 gene hxlA 1750 1118 CDS product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246452.1 protein_id gnl|my_center|LOCUS_54740 2959 2048 gene locus_tag LOCUS_54750 2959 2048 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328848.1 protein_id gnl|my_center|LOCUS_54750 3172 4395 gene locus_tag LOCUS_54760 gene istA 3172 4395 CDS product IS21-like element ISMac3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023425.1 protein_id gnl|my_center|LOCUS_54760 4392 5144 gene locus_tag LOCUS_54770 gene istB 4392 5144 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 protein_id gnl|my_center|LOCUS_54770 5578 5348 gene locus_tag LOCUS_54780 5578 5348 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 protein_id gnl|my_center|LOCUS_54780 >Feature sequence226 466 1386 gene locus_tag LOCUS_54790 466 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54790 1467 2375 gene locus_tag LOCUS_54800 1467 2375 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_54800 2414 3406 gene locus_tag LOCUS_54810 2414 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54810 3403 4026 gene locus_tag LOCUS_54820 3403 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54820 4327 4100 gene locus_tag LOCUS_54830 4327 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 6399 4243 gene locus_tag LOCUS_54840 6399 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 6494 7879 gene locus_tag LOCUS_54850 6494 7879 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_54850 7916 8938 gene locus_tag LOCUS_54860 7916 8938 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_54860 8946 11558 gene locus_tag LOCUS_54870 8946 11558 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109251.1 protein_id gnl|my_center|LOCUS_54870 11579 12616 gene locus_tag LOCUS_54880 11579 12616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 12742 12984 gene locus_tag LOCUS_54890 12742 12984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 12989 13411 gene locus_tag LOCUS_54900 12989 13411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54900 >Feature sequence227 159 980 gene locus_tag LOCUS_54910 159 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54910 985 1365 gene locus_tag LOCUS_54920 985 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 1362 2177 gene locus_tag LOCUS_54930 gene istB 1362 2177 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 protein_id gnl|my_center|LOCUS_54930 3812 3519 gene locus_tag LOCUS_54940 3812 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54940 >Feature sequence228 2224 998 gene locus_tag LOCUS_54950 2224 998 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233099.1 protein_id gnl|my_center|LOCUS_54950 5010 2446 gene locus_tag LOCUS_54960 5010 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54960 5852 5007 gene locus_tag LOCUS_54970 5852 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54970 6499 5957 gene locus_tag LOCUS_54980 6499 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54980 8638 6572 gene locus_tag LOCUS_54990 8638 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54990 10281 8527 gene locus_tag LOCUS_55000 10281 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55000 10711 11568 gene locus_tag LOCUS_55010 10711 11568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 12584 11796 gene locus_tag LOCUS_55020 12584 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55020 13249 12581 gene locus_tag LOCUS_55030 13249 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 13489 14472 gene locus_tag LOCUS_55040 13489 14472 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945015.1 protein_id gnl|my_center|LOCUS_55040 14995 14399 gene locus_tag LOCUS_55050 gene deoC 14995 14399 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356166.1 protein_id gnl|my_center|LOCUS_55050 15577 15137 gene locus_tag LOCUS_55060 15577 15137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55060 16909 15683 gene locus_tag LOCUS_55070 gene mtaB 16909 15683 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108686.1 protein_id gnl|my_center|LOCUS_55070 17819 17043 gene locus_tag LOCUS_55080 17819 17043 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190154.1 protein_id gnl|my_center|LOCUS_55080 18055 17885 gene locus_tag LOCUS_55090 18055 17885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 18590 18177 gene locus_tag LOCUS_55100 18590 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55100 19620 18595 gene locus_tag LOCUS_55110 gene prmA 19620 18595 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872101.1 protein_id gnl|my_center|LOCUS_55110 >Feature sequence229 309 1331 gene locus_tag LOCUS_55120 gene macA 309 1331 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216705.1 protein_id gnl|my_center|LOCUS_55120 1360 1875 gene locus_tag LOCUS_55130 1360 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 1875 4247 gene locus_tag LOCUS_55140 1875 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 >Feature sequence230 2308 80 gene locus_tag LOCUS_55150 2308 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 3269 2346 gene locus_tag LOCUS_55160 3269 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 3583 3404 gene locus_tag LOCUS_55170 3583 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55170 3894 3580 gene locus_tag LOCUS_55180 3894 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55180 4220 3894 gene locus_tag LOCUS_55190 4220 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55190 4662 4258 gene locus_tag LOCUS_55200 4662 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55200 5195 4665 gene locus_tag LOCUS_55210 5195 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55210 6614 5286 gene locus_tag LOCUS_55220 6614 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 8921 7713 gene locus_tag LOCUS_55230 8921 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 9094 8900 gene locus_tag LOCUS_55240 9094 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 9353 9565 gene locus_tag LOCUS_55250 9353 9565 CDS product YrzA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010984.1 protein_id gnl|my_center|LOCUS_55250 >Feature sequence231 1128 265 gene locus_tag LOCUS_55260 1128 265 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932077.1 protein_id gnl|my_center|LOCUS_55260 1501 1223 gene locus_tag LOCUS_55270 1501 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 2041 2361 gene locus_tag LOCUS_55280 2041 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55280 2352 2786 gene locus_tag LOCUS_55290 2352 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55290 2759 2941 gene locus_tag LOCUS_55300 2759 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 2958 3863 gene locus_tag LOCUS_55310 gene rbsK 2958 3863 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113483.1 protein_id gnl|my_center|LOCUS_55310 4082 4933 gene locus_tag LOCUS_55320 4082 4933 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55320 5044 5505 gene locus_tag LOCUS_55330 gene rpiB 5044 5505 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969382.1 protein_id gnl|my_center|LOCUS_55330 5646 6311 gene locus_tag LOCUS_55340 5646 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55340 6389 6988 gene locus_tag LOCUS_55350 6389 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 7057 7953 gene locus_tag LOCUS_55360 7057 7953 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037380364.1 protein_id gnl|my_center|LOCUS_55360 >Feature sequence232 1592 39 gene locus_tag LOCUS_55370 1592 39 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083788.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55370 1990 1559 gene locus_tag LOCUS_55380 1990 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55380 2333 2626 gene locus_tag LOCUS_55390 2333 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55390 2662 3486 gene locus_tag LOCUS_55400 2662 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55400 3898 4971 gene locus_tag LOCUS_55410 3898 4971 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031503.1 protein_id gnl|my_center|LOCUS_55410 >Feature sequence233 1376 168 gene locus_tag LOCUS_55420 1376 168 CDS product IS4-like element ISDha3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458871.1 protein_id gnl|my_center|LOCUS_55420 >Feature sequence234 718 1701 gene locus_tag LOCUS_55430 gene msrB 718 1701 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290155.1 protein_id gnl|my_center|LOCUS_55430 1850 3094 gene locus_tag LOCUS_55440 1850 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55440 3297 10169 gene locus_tag LOCUS_55450 3297 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55450 10344 11321 gene locus_tag LOCUS_55460 10344 11321 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_55460 11343 12230 gene locus_tag LOCUS_55470 11343 12230 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_55470 12280 13617 gene locus_tag LOCUS_55480 12280 13617 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 protein_id gnl|my_center|LOCUS_55480 >Feature sequence235 115 990 gene locus_tag LOCUS_55490 115 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55490 990 1448 gene locus_tag LOCUS_55500 990 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 >Feature sequence236 236 102 gene locus_tag LOCUS_55510 gene rpmH 236 102 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356012.1 protein_id gnl|my_center|LOCUS_55510 893 2176 gene locus_tag LOCUS_55520 gene dnaA 893 2176 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_55520 2740 3591 gene locus_tag LOCUS_55530 2740 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55530 3630 3845 gene locus_tag LOCUS_55540 gene rlbA 3630 3845 CDS product ribosome maturation protein RlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226810.1 protein_id gnl|my_center|LOCUS_55540 3902 4480 gene locus_tag LOCUS_55550 3902 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55550 4566 5012 gene locus_tag LOCUS_55560 4566 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55560 5367 7277 gene locus_tag LOCUS_55570 gene gyrB 5367 7277 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_55570 7700 7332 gene locus_tag LOCUS_55580 7700 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 8083 7697 gene locus_tag LOCUS_55590 8083 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 8411 9319 gene locus_tag LOCUS_55600 8411 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55600 9280 9579 gene locus_tag LOCUS_55610 9280 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55610 9551 10930 gene locus_tag LOCUS_55620 9551 10930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55620 10942 12021 gene locus_tag LOCUS_55630 10942 12021 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_55630 >Feature sequence237 918 556 gene locus_tag LOCUS_55640 918 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55640 1040 915 gene locus_tag LOCUS_55650 1040 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 2996 1542 gene locus_tag LOCUS_55660 2996 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55660 3375 3007 gene locus_tag LOCUS_55670 3375 3007 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723032.1 protein_id gnl|my_center|LOCUS_55670 >Feature sequence238 495 1235 gene locus_tag LOCUS_55680 495 1235 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932718.1 protein_id gnl|my_center|LOCUS_55680 1232 2251 gene locus_tag LOCUS_55690 1232 2251 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258336.1 protein_id gnl|my_center|LOCUS_55690 2310 3002 gene locus_tag LOCUS_55700 2310 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 >Feature sequence239 51 677 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgctcccgcgt 1462 998 gene locus_tag LOCUS_55710 1462 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 2060 1602 gene locus_tag LOCUS_55720 2060 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 2840 2373 gene locus_tag LOCUS_55730 2840 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55730 3215 2844 gene locus_tag LOCUS_55740 3215 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 4001 3222 gene locus_tag LOCUS_55750 gene cmr4 4001 3222 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55750 5595 4255 gene locus_tag LOCUS_55760 5595 4255 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229143.1 protein_id gnl|my_center|LOCUS_55760 6772 5477 gene locus_tag LOCUS_55770 6772 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55770 7392 6751 gene locus_tag LOCUS_55780 7392 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 7724 7389 gene locus_tag LOCUS_55790 7724 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 8650 8060 gene locus_tag LOCUS_55800 8650 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 8992 >9285 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgctcccgc >Feature sequence240 600 31 gene locus_tag LOCUS_55810 600 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 1006 1944 gene locus_tag LOCUS_55820 1006 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55820 1856 2335 gene locus_tag LOCUS_55830 1856 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 >Feature sequence241 181 2121 gene locus_tag LOCUS_55840 181 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 2903 2115 gene locus_tag LOCUS_55850 2903 2115 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262990.1 protein_id gnl|my_center|LOCUS_55850 4180 3101 gene locus_tag LOCUS_55860 4180 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 4386 4177 gene locus_tag LOCUS_55870 4386 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 5102 4383 gene locus_tag LOCUS_55880 5102 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 6059 5208 gene locus_tag LOCUS_55890 6059 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 6864 6148 gene locus_tag LOCUS_55900 6864 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55900 7160 6861 gene locus_tag LOCUS_55910 7160 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55910 7643 7804 gene locus_tag LOCUS_55920 7643 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 8022 7825 gene locus_tag LOCUS_55930 8022 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55930 >Feature sequence242 460 125 gene locus_tag LOCUS_55940 gene hmoA 460 125 CDS product heme-degrading oxygenase HmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243958.1 protein_id gnl|my_center|LOCUS_55940 1318 539 gene locus_tag LOCUS_55950 1318 539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930637.1 protein_id gnl|my_center|LOCUS_55950 1983 1372 gene locus_tag LOCUS_55960 1983 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 2297 2527 gene locus_tag LOCUS_55970 2297 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 2551 3210 gene locus_tag LOCUS_55980 2551 3210 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_55980 3662 3294 gene locus_tag LOCUS_55990 3662 3294 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130472.1 protein_id gnl|my_center|LOCUS_55990 4925 3801 gene locus_tag LOCUS_56000 4925 3801 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703474.1 protein_id gnl|my_center|LOCUS_56000 5387 4971 gene locus_tag LOCUS_56010 5387 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56010 5818 5384 gene locus_tag LOCUS_56020 5818 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56020 6791 5832 gene locus_tag LOCUS_56030 6791 5832 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_56030 8509 6881 gene locus_tag LOCUS_56040 8509 6881 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972693.1 protein_id gnl|my_center|LOCUS_56040 8863 8681 gene locus_tag LOCUS_56050 8863 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 9224 8946 gene locus_tag LOCUS_56060 9224 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 10921 9221 gene locus_tag LOCUS_56070 10921 9221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 11598 11290 gene locus_tag LOCUS_56080 11598 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 11711 12262 gene locus_tag LOCUS_56090 11711 12262 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761174.1 protein_id gnl|my_center|LOCUS_56090 12266 13273 gene locus_tag LOCUS_56100 12266 13273 CDS product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761173.1 protein_id gnl|my_center|LOCUS_56100 >Feature sequence243 1261 71 gene locus_tag LOCUS_56110 1261 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 >Feature sequence244 1500 124 gene locus_tag LOCUS_56120 gene mgtE 1500 124 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232543.1 protein_id gnl|my_center|LOCUS_56120 >Feature sequence245 1995 721 gene locus_tag LOCUS_56130 1995 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56130 2261 1971 gene locus_tag LOCUS_56140 2261 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 3043 2303 gene locus_tag LOCUS_56150 3043 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56150 3240 3605 gene locus_tag LOCUS_56160 3240 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56160 3608 4132 gene locus_tag LOCUS_56170 3608 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56170 4157 5056 gene locus_tag LOCUS_56180 4157 5056 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_56180 5168 5962 gene locus_tag LOCUS_56190 5168 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 5860 6339 gene locus_tag LOCUS_56200 5860 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 6276 6785 gene locus_tag LOCUS_56210 6276 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 7035 8027 gene locus_tag LOCUS_56220 7035 8027 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_56220 8521 10314 gene locus_tag LOCUS_56230 8521 10314 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582799.1 protein_id gnl|my_center|LOCUS_56230 11330 10398 gene locus_tag LOCUS_56240 11330 10398 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112660.1 protein_id gnl|my_center|LOCUS_56240 11743 11889 gene locus_tag LOCUS_56250 11743 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56250 >Feature sequence246 1284 211 gene locus_tag LOCUS_56260 1284 211 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_56260 <2052 1298 gene locus_tag LOCUS_56270 <2052 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_125082658.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence247 387 166 gene locus_tag LOCUS_56280 387 166 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091640.1 protein_id gnl|my_center|LOCUS_56280 1098 529 gene locus_tag LOCUS_56290 1098 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 1468 1142 gene locus_tag LOCUS_56300 1468 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 2547 1504 gene locus_tag LOCUS_56310 2547 1504 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886400.1 protein_id gnl|my_center|LOCUS_56310 3017 4006 gene locus_tag LOCUS_56320 gene trpS 3017 4006 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110984.1 protein_id gnl|my_center|LOCUS_56320 4209 4018 gene locus_tag LOCUS_56330 4209 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56330 4338 4568 gene locus_tag LOCUS_56340 4338 4568 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416009.1 protein_id gnl|my_center|LOCUS_56340 5682 4690 gene locus_tag LOCUS_56350 5682 4690 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244136.1 protein_id gnl|my_center|LOCUS_56350 6652 5876 gene locus_tag LOCUS_56360 6652 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 7130 6636 gene locus_tag LOCUS_56370 7130 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56370 7406 7999 gene locus_tag LOCUS_56380 7406 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56380 7984 8265 gene locus_tag LOCUS_56390 7984 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56390 8721 8921 gene locus_tag LOCUS_56400 8721 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 8963 9895 gene locus_tag LOCUS_56410 8963 9895 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497489.1 protein_id gnl|my_center|LOCUS_56410 9957 10127 gene locus_tag LOCUS_56420 9957 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 >Feature sequence248 583 927 gene locus_tag LOCUS_56430 583 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56430 888 1109 gene locus_tag LOCUS_56440 888 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 1243 1728 gene locus_tag LOCUS_56450 1243 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 1752 1967 gene locus_tag LOCUS_56460 1752 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 2141 2791 gene locus_tag LOCUS_56470 2141 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56470 2680 3321 gene locus_tag LOCUS_56480 2680 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56480 3512 3973 gene locus_tag LOCUS_56490 3512 3973 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723894.1 protein_id gnl|my_center|LOCUS_56490 4009 4530 gene locus_tag LOCUS_56500 gene mcsA 4009 4530 CDS product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 protein_id gnl|my_center|LOCUS_56500 4550 5629 gene locus_tag LOCUS_56510 4550 5629 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_56510 5632 6351 gene locus_tag LOCUS_56520 5632 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56520 6422 8074 gene locus_tag LOCUS_56530 6422 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56530 8278 9642 gene locus_tag LOCUS_56540 gene radA 8278 9642 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_56540 9653 10729 gene locus_tag LOCUS_56550 gene disA 9653 10729 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392168.1 protein_id gnl|my_center|LOCUS_56550 10847 11593 gene locus_tag LOCUS_56560 gene pssA 10847 11593 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285417.1 protein_id gnl|my_center|LOCUS_56560 >Feature sequence249 732 1061 gene locus_tag LOCUS_56570 732 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56570 1058 2269 gene locus_tag LOCUS_56580 1058 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56580 >Feature sequence250 1164 28 gene locus_tag LOCUS_56590 1164 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 2200 1568 gene locus_tag LOCUS_56600 2200 1568 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144255.1 protein_id gnl|my_center|LOCUS_56600 3495 2197 gene locus_tag LOCUS_56610 gene mutY 3495 2197 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 protein_id gnl|my_center|LOCUS_56610 >Feature sequence251 533 186 gene locus_tag LOCUS_56620 533 186 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009915789.1 protein_id gnl|my_center|LOCUS_56620 846 553 gene locus_tag LOCUS_56630 846 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56630 2075 843 gene locus_tag LOCUS_56640 2075 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 3800 2154 gene locus_tag LOCUS_56650 3800 2154 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_56650 4313 3915 gene locus_tag LOCUS_56660 4313 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 >Feature sequence252 219 812 gene locus_tag LOCUS_56670 219 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 1129 824 gene locus_tag LOCUS_56680 1129 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 1337 2710 gene locus_tag LOCUS_56690 1337 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 3542 2673 gene locus_tag LOCUS_56700 3542 2673 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837952.1 protein_id gnl|my_center|LOCUS_56700 3827 3561 gene locus_tag LOCUS_56710 3827 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 4384 3770 gene locus_tag LOCUS_56720 4384 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 4805 4362 gene locus_tag LOCUS_56730 4805 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 4957 4796 gene locus_tag LOCUS_56740 4957 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 6433 4991 gene locus_tag LOCUS_56750 6433 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 7209 6430 gene locus_tag LOCUS_56760 7209 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 8081 7209 gene locus_tag LOCUS_56770 8081 7209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837952.1 protein_id gnl|my_center|LOCUS_56770 >Feature sequence253 >Feature sequence254 1172 249 gene locus_tag LOCUS_56780 gene xerD 1172 249 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547075.1 protein_id gnl|my_center|LOCUS_56780 >Feature sequence255 328 125 gene locus_tag LOCUS_56790 328 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 1448 795 gene locus_tag LOCUS_56800 1448 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 1884 1732 gene locus_tag LOCUS_56810 1884 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 3067 2408 gene locus_tag LOCUS_56820 gene lieB 3067 2408 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_56820 4112 3174 gene locus_tag LOCUS_56830 4112 3174 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221977.1 protein_id gnl|my_center|LOCUS_56830 4846 4247 gene locus_tag LOCUS_56840 4846 4247 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220164.1 protein_id gnl|my_center|LOCUS_56840 5740 4931 gene locus_tag LOCUS_56850 5740 4931 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054639.1 protein_id gnl|my_center|LOCUS_56850 >Feature sequence256 888 73 gene locus_tag LOCUS_56860 gene etfA 888 73 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101963.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56860 1731 1111 gene locus_tag LOCUS_56870 gene etfB 1731 1111 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029028.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56870 >Feature sequence257 913 386 gene locus_tag LOCUS_56880 913 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 <3652 1087 gene locus_tag LOCUS_56890 <3652 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245201.1:exonuclease subunit SbcC >Feature sequence258 1479 979 gene locus_tag LOCUS_56900 1479 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 1625 1458 gene locus_tag LOCUS_56910 1625 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 2299 1577 gene locus_tag LOCUS_56920 2299 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56920 3258 2575 gene locus_tag LOCUS_56930 3258 2575 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226274.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56930 4357 3401 gene locus_tag LOCUS_56940 4357 3401 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529984.1 protein_id gnl|my_center|LOCUS_56940 4581 5486 gene locus_tag LOCUS_56950 4581 5486 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083209.1 protein_id gnl|my_center|LOCUS_56950 >Feature sequence259 1415 171 gene locus_tag LOCUS_56960 1415 171 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297404.1 protein_id gnl|my_center|LOCUS_56960 >Feature sequence260 132 329 gene locus_tag LOCUS_56970 132 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 796 350 gene locus_tag LOCUS_56980 796 350 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243994.1 protein_id gnl|my_center|LOCUS_56980 1002 1457 gene locus_tag LOCUS_56990 1002 1457 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029332115.1 protein_id gnl|my_center|LOCUS_56990 >Feature sequence261 602 1465 gene locus_tag LOCUS_57000 602 1465 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732025.1 protein_id gnl|my_center|LOCUS_57000 1471 1986 gene locus_tag LOCUS_57010 1471 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57010 >Feature sequence262 1495 239 gene locus_tag LOCUS_57020 1495 239 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081862.1 protein_id gnl|my_center|LOCUS_57020 1612 2127 gene locus_tag LOCUS_57030 1612 2127 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_57030 2554 3168 gene locus_tag LOCUS_57040 gene fapR 2554 3168 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232044.1 protein_id gnl|my_center|LOCUS_57040 3152 3439 gene locus_tag LOCUS_57050 3152 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57050 3391 4140 gene locus_tag LOCUS_57060 3391 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57060 4207 5136 gene locus_tag LOCUS_57070 4207 5136 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_57070 5250 6176 gene locus_tag LOCUS_57080 gene fabD 5250 6176 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_57080 6226 6975 gene locus_tag LOCUS_57090 gene fabG 6226 6975 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_57090 7053 7286 gene locus_tag LOCUS_57100 gene acpP 7053 7286 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 protein_id gnl|my_center|LOCUS_57100 7496 8737 gene locus_tag LOCUS_57110 gene fabF 7496 8737 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_57110 8727 9428 gene locus_tag LOCUS_57120 gene rncS 8727 9428 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146873.1 protein_id gnl|my_center|LOCUS_57120 >Feature sequence263 518 1879 gene locus_tag LOCUS_57130 gene ltrA 518 1879 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_57130 >Feature sequence264 <1 906 gene locus_tag LOCUS_57140 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140940.1:DUF3656 domain-containing protein 922 1665 gene locus_tag LOCUS_57150 922 1665 CDS product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272088.1 protein_id gnl|my_center|LOCUS_57150 1934 4165 gene locus_tag LOCUS_57160 gene pcrA 1934 4165 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57160 4077 4301 gene locus_tag LOCUS_57170 4077 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57170 4318 5961 gene locus_tag LOCUS_57180 gene ligA 4318 5961 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048227.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57180 5877 6413 gene locus_tag LOCUS_57190 5877 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57190 >Feature sequence265 344 955 gene locus_tag LOCUS_57200 gene pdxT 344 955 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238799.1 protein_id gnl|my_center|LOCUS_57200 948 1490 gene locus_tag LOCUS_57210 948 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57210 1487 2233 gene locus_tag LOCUS_57220 1487 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57220 2321 2409 gene locus_tag LOCUS_t00560 2321 2409 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2559 2906 gene locus_tag LOCUS_57230 2559 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 2925 3101 gene locus_tag LOCUS_57240 2925 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 3467 3937 gene locus_tag LOCUS_57250 3467 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57250 3826 4533 gene locus_tag LOCUS_57260 3826 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 4710 4634 gene locus_tag LOCUS_t00570 4710 4634 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5766 4930 gene locus_tag LOCUS_57270 5766 4930 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_57270 6268 5900 gene locus_tag LOCUS_57280 6268 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 6588 6962 gene locus_tag LOCUS_57290 6588 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57290 >Feature sequence266 370 762 gene locus_tag LOCUS_57300 370 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57300 759 1244 gene locus_tag LOCUS_57310 759 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57310 >Feature sequence267 135 560 gene locus_tag LOCUS_57320 135 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57320 665 1453 gene locus_tag LOCUS_57330 665 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 1534 1722 gene locus_tag LOCUS_57340 1534 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57340 1719 1841 gene locus_tag LOCUS_57350 1719 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 >Feature sequence268 1179 31 gene locus_tag LOCUS_57360 1179 31 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730052.1 protein_id gnl|my_center|LOCUS_57360 1249 1638 gene locus_tag LOCUS_57370 1249 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210986.1 protein_id gnl|my_center|LOCUS_57370 >Feature sequence269 1275 49 gene locus_tag LOCUS_57380 1275 49 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198598615.1 protein_id gnl|my_center|LOCUS_57380 >Feature sequence270 23 571 gene locus_tag LOCUS_57390 23 571 CDS product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245125.1 protein_id gnl|my_center|LOCUS_57390 >Feature sequence271 208 366 gene locus_tag LOCUS_57400 208 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 1261 512 gene locus_tag LOCUS_57410 1261 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57410 1485 1222 gene locus_tag LOCUS_57420 1485 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 2774 1569 gene locus_tag LOCUS_57430 2774 1569 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 protein_id gnl|my_center|LOCUS_57430 2942 3529 gene locus_tag LOCUS_57440 2942 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57440 3490 4254 gene locus_tag LOCUS_57450 3490 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57450 4291 5787 gene locus_tag LOCUS_57460 gene xylB 4291 5787 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245233.1 protein_id gnl|my_center|LOCUS_57460 5852 5998 gene locus_tag LOCUS_57470 5852 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 >Feature sequence272 1248 487 gene locus_tag LOCUS_57480 1248 487 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399589.1 protein_id gnl|my_center|LOCUS_57480 1560 1399 gene locus_tag LOCUS_57490 1560 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57490 >Feature sequence273 1578 790 gene locus_tag LOCUS_57500 1578 790 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_57500 >Feature sequence274 683 246 gene locus_tag LOCUS_57510 683 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 >Feature sequence275 520 71 gene locus_tag LOCUS_57520 520 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 766 626 gene locus_tag LOCUS_57530 766 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 1202 777 gene locus_tag LOCUS_57540 1202 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 >Feature sequence276 1570 233 gene locus_tag LOCUS_57550 1570 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 >Feature sequence277 186 641 gene locus_tag LOCUS_57560 186 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 674 1255 gene locus_tag LOCUS_57570 674 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570