>Feature sequence01 >Feature sequence02 1088 306 gene locus_tag LOCUS_00010 gene hyi 1088 306 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531398.1 protein_id gnl|my_center|LOCUS_00010 3058 1292 gene locus_tag LOCUS_00020 gene gcl 3058 1292 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969935.1 protein_id gnl|my_center|LOCUS_00020 3420 4229 gene locus_tag LOCUS_00030 3420 4229 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531396.1 protein_id gnl|my_center|LOCUS_00030 4513 4241 gene locus_tag LOCUS_00040 4513 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5927 4677 gene locus_tag LOCUS_00050 gene frc 5927 4677 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726706.1 protein_id gnl|my_center|LOCUS_00050 7572 6295 gene locus_tag LOCUS_00060 gene frc 7572 6295 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085940.1 protein_id gnl|my_center|LOCUS_00060 9417 7678 gene locus_tag LOCUS_00070 gene oxc 9417 7678 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085941.1 protein_id gnl|my_center|LOCUS_00070 10217 9492 gene locus_tag LOCUS_00080 10217 9492 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063699495.1 protein_id gnl|my_center|LOCUS_00080 11670 10969 gene locus_tag LOCUS_00090 11670 10969 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063699495.1 protein_id gnl|my_center|LOCUS_00090 12295 13530 gene locus_tag LOCUS_00100 gene oxlT 12295 13530 CDS product oxalate/formate MFS antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085934.1 protein_id gnl|my_center|LOCUS_00100 14173 15507 gene locus_tag LOCUS_00110 gene oxlT 14173 15507 CDS product oxalate/formate MFS antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085934.1 protein_id gnl|my_center|LOCUS_00110 16000 15563 gene locus_tag LOCUS_00120 16000 15563 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921211.1 protein_id gnl|my_center|LOCUS_00120 16748 16062 gene locus_tag LOCUS_00130 16748 16062 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540175.1 protein_id gnl|my_center|LOCUS_00130 18717 16837 gene locus_tag LOCUS_00140 gene thiC 18717 16837 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976311.1 protein_id gnl|my_center|LOCUS_00140 19054 20334 gene locus_tag LOCUS_00150 19054 20334 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085234.1 protein_id gnl|my_center|LOCUS_00150 21311 20448 gene locus_tag LOCUS_00160 21311 20448 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350720.1 protein_id gnl|my_center|LOCUS_00160 22398 21475 gene locus_tag LOCUS_00170 22398 21475 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267733.1 protein_id gnl|my_center|LOCUS_00170 23269 22508 gene locus_tag LOCUS_00180 23269 22508 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895777.1 protein_id gnl|my_center|LOCUS_00180 24023 23415 gene locus_tag LOCUS_00190 24023 23415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 25225 24020 gene locus_tag LOCUS_00200 25225 24020 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529745.1 protein_id gnl|my_center|LOCUS_00200 25504 25325 gene locus_tag LOCUS_00210 25504 25325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25415 26542 gene locus_tag LOCUS_00220 25415 26542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26657 27484 gene locus_tag LOCUS_00230 gene map 26657 27484 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532002.1 protein_id gnl|my_center|LOCUS_00230 27502 28371 gene locus_tag LOCUS_00240 gene radC 27502 28371 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133415038.1 protein_id gnl|my_center|LOCUS_00240 29600 28386 gene locus_tag LOCUS_00250 gene zigA 29600 28386 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972825.1 protein_id gnl|my_center|LOCUS_00250 31177 29747 gene locus_tag LOCUS_00260 31177 29747 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061798.1 protein_id gnl|my_center|LOCUS_00260 31466 32683 gene locus_tag LOCUS_00270 31466 32683 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064397.1 protein_id gnl|my_center|LOCUS_00270 >Feature sequence03 212 1693 gene locus_tag LOCUS_r00010 212 1693 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1894 1970 gene locus_tag LOCUS_t00010 1894 1970 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2012 2087 gene locus_tag LOCUS_t00020 2012 2087 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2430 5243 gene locus_tag LOCUS_r00020 2430 5243 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5340 5449 gene locus_tag LOCUS_r00030 5340 5449 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence04 850 647 gene locus_tag LOCUS_00280 850 647 CDS product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721263.1 protein_id gnl|my_center|LOCUS_00280 1821 922 gene locus_tag LOCUS_00290 1821 922 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083330.1 protein_id gnl|my_center|LOCUS_00290 1946 3112 gene locus_tag LOCUS_00300 1946 3112 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528785.1 protein_id gnl|my_center|LOCUS_00300 3124 3891 gene locus_tag LOCUS_00310 3124 3891 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528989.1 protein_id gnl|my_center|LOCUS_00310 6425 4470 gene locus_tag LOCUS_00320 gene cysC 6425 4470 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084291.1 protein_id gnl|my_center|LOCUS_00320 7242 6436 gene locus_tag LOCUS_00330 7242 6436 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084292.1 protein_id gnl|my_center|LOCUS_00330 7378 7686 gene locus_tag LOCUS_00340 7378 7686 CDS product DUF2849 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084294.1 protein_id gnl|my_center|LOCUS_00340 7720 9375 gene locus_tag LOCUS_00350 7720 9375 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084295.1 protein_id gnl|my_center|LOCUS_00350 9362 9889 gene locus_tag LOCUS_00360 9362 9889 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084296.1 protein_id gnl|my_center|LOCUS_00360 9886 10644 gene locus_tag LOCUS_00370 9886 10644 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084297.1 protein_id gnl|my_center|LOCUS_00370 11671 12690 gene locus_tag LOCUS_00380 11671 12690 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965384.1 protein_id gnl|my_center|LOCUS_00380 13353 12772 gene locus_tag LOCUS_00390 13353 12772 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533195.1 protein_id gnl|my_center|LOCUS_00390 13811 13389 gene locus_tag LOCUS_00400 gene hisE 13811 13389 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084141.1 protein_id gnl|my_center|LOCUS_00400 14051 15418 gene locus_tag LOCUS_00410 14051 15418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 15473 16600 gene locus_tag LOCUS_00420 15473 16600 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529351.1 protein_id gnl|my_center|LOCUS_00420 17237 16608 gene locus_tag LOCUS_00430 17237 16608 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965381.1 protein_id gnl|my_center|LOCUS_00430 19714 17309 gene locus_tag LOCUS_00440 19714 17309 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968934.1 protein_id gnl|my_center|LOCUS_00440 20625 19954 gene locus_tag LOCUS_00450 20625 19954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 21643 20798 gene locus_tag LOCUS_00460 21643 20798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 21826 23040 gene locus_tag LOCUS_00470 gene zapE 21826 23040 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083288.1 protein_id gnl|my_center|LOCUS_00470 23110 23829 gene locus_tag LOCUS_00480 23110 23829 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528385.1 protein_id gnl|my_center|LOCUS_00480 23986 24951 gene locus_tag LOCUS_00490 gene mdh 23986 24951 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008145224.1 protein_id gnl|my_center|LOCUS_00490 25282 28260 gene locus_tag LOCUS_00500 25282 28260 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083284.1 protein_id gnl|my_center|LOCUS_00500 28323 29558 gene locus_tag LOCUS_00510 gene odhB 28323 29558 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528851.1 protein_id gnl|my_center|LOCUS_00510 29587 30228 gene locus_tag LOCUS_00520 29587 30228 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067150.1 protein_id gnl|my_center|LOCUS_00520 30258 31658 gene locus_tag LOCUS_00530 gene lpdA 30258 31658 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083281.1 protein_id gnl|my_center|LOCUS_00530 31871 31743 gene locus_tag LOCUS_00540 31871 31743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 33015 32029 gene locus_tag LOCUS_00550 33015 32029 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083278.1 protein_id gnl|my_center|LOCUS_00550 33190 33384 gene locus_tag LOCUS_00560 33190 33384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 33465 35672 gene locus_tag LOCUS_00570 33465 35672 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083277.1 protein_id gnl|my_center|LOCUS_00570 35855 36010 gene locus_tag LOCUS_00580 35855 36010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 36024 36665 gene locus_tag LOCUS_00590 36024 36665 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946157.1 protein_id gnl|my_center|LOCUS_00590 36822 37115 gene locus_tag LOCUS_00600 36822 37115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 37122 38066 gene locus_tag LOCUS_00610 37122 38066 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400555.1 protein_id gnl|my_center|LOCUS_00610 39360 38080 gene locus_tag LOCUS_00620 39360 38080 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 protein_id gnl|my_center|LOCUS_00620 40288 39422 gene locus_tag LOCUS_00630 gene gluQRS 40288 39422 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084190.1 protein_id gnl|my_center|LOCUS_00630 41090 40308 gene locus_tag LOCUS_00640 41090 40308 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709621.1 protein_id gnl|my_center|LOCUS_00640 42958 41111 gene locus_tag LOCUS_00650 gene sdhA 42958 41111 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083345.1 protein_id gnl|my_center|LOCUS_00650 43361 42963 gene locus_tag LOCUS_00660 gene sdhD 43361 42963 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_00660 43817 43365 gene locus_tag LOCUS_00670 gene sdhC 43817 43365 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528874.1 protein_id gnl|my_center|LOCUS_00670 44111 45352 gene locus_tag LOCUS_00680 44111 45352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 45658 47610 gene locus_tag LOCUS_00690 45658 47610 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965357.1 protein_id gnl|my_center|LOCUS_00690 47614 48288 gene locus_tag LOCUS_00700 47614 48288 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390534.1 protein_id gnl|my_center|LOCUS_00700 48445 49002 gene locus_tag LOCUS_00710 48445 49002 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315684.1 protein_id gnl|my_center|LOCUS_00710 49567 49049 gene locus_tag LOCUS_00720 49567 49049 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084158.1 protein_id gnl|my_center|LOCUS_00720 50686 49853 gene locus_tag LOCUS_00730 gene besA 50686 49853 CDS product ferri-bacillibactin esterase BesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228740.1 protein_id gnl|my_center|LOCUS_00730 50934 51989 gene locus_tag LOCUS_00740 50934 51989 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171333.1 protein_id gnl|my_center|LOCUS_00740 51989 52762 gene locus_tag LOCUS_00750 51989 52762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208783.1 protein_id gnl|my_center|LOCUS_00750 53555 52779 gene locus_tag LOCUS_00760 gene dhbA 53555 52779 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048437.1 protein_id gnl|my_center|LOCUS_00760 57445 53537 gene locus_tag LOCUS_00770 gene entF 57445 53537 CDS product enterobactin non-ribosomal peptide synthetase EntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704706.1 protein_id gnl|my_center|LOCUS_00770 57734 57450 gene locus_tag LOCUS_00780 57734 57450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00780 58378 57734 gene locus_tag LOCUS_00790 58378 57734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00790 60003 58375 gene locus_tag LOCUS_00800 60003 58375 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 protein_id gnl|my_center|LOCUS_00800 61238 60000 gene locus_tag LOCUS_00810 61238 60000 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416879.1 protein_id gnl|my_center|LOCUS_00810 62575 61331 gene locus_tag LOCUS_00820 62575 61331 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550638.1 protein_id gnl|my_center|LOCUS_00820 63803 62634 gene locus_tag LOCUS_00830 gene yiuA 63803 62634 CDS product iron-siderophore ABC transporter substrate-binding protein YiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 protein_id gnl|my_center|LOCUS_00830 64176 65504 gene locus_tag LOCUS_00840 64176 65504 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313911.1 protein_id gnl|my_center|LOCUS_00840 65779 65704 gene locus_tag LOCUS_t00030 65779 65704 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 66028 66306 gene locus_tag LOCUS_00850 66028 66306 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 protein_id gnl|my_center|LOCUS_00850 66323 66649 gene locus_tag LOCUS_00860 66323 66649 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174939.1 protein_id gnl|my_center|LOCUS_00860 67432 66923 gene locus_tag LOCUS_00870 67432 66923 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136728.1 protein_id gnl|my_center|LOCUS_00870 69472 67643 gene locus_tag LOCUS_00880 gene typA 69472 67643 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330113.1 protein_id gnl|my_center|LOCUS_00880 69839 69606 gene locus_tag LOCUS_00890 69839 69606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 69999 70361 gene locus_tag LOCUS_00900 69999 70361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 71489 70374 gene locus_tag LOCUS_00910 71489 70374 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975888.1 protein_id gnl|my_center|LOCUS_00910 71635 72138 gene locus_tag LOCUS_00920 71635 72138 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_00920 72588 73034 gene locus_tag LOCUS_00930 72588 73034 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876608.1 protein_id gnl|my_center|LOCUS_00930 73031 74359 gene locus_tag LOCUS_00940 73031 74359 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393947.1 protein_id gnl|my_center|LOCUS_00940 75784 74558 gene locus_tag LOCUS_00950 75784 74558 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918018.1 protein_id gnl|my_center|LOCUS_00950 76405 75890 gene locus_tag LOCUS_00960 76405 75890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 77646 76414 gene locus_tag LOCUS_00970 gene rlmN 77646 76414 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083356.1 protein_id gnl|my_center|LOCUS_00970 78594 77818 gene locus_tag LOCUS_00980 78594 77818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 78806 79675 gene locus_tag LOCUS_00990 gene dapF 78806 79675 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083308.1 protein_id gnl|my_center|LOCUS_00990 79692 80966 gene locus_tag LOCUS_01000 gene mtaB 79692 80966 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083307.1 protein_id gnl|my_center|LOCUS_01000 80963 81913 gene locus_tag LOCUS_01010 gene ftsY 80963 81913 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083304.1 protein_id gnl|my_center|LOCUS_01010 81959 82945 gene locus_tag LOCUS_01020 81959 82945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 83636 82965 gene locus_tag LOCUS_01030 gene rpe 83636 82965 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975097.1 protein_id gnl|my_center|LOCUS_01030 84735 83788 gene locus_tag LOCUS_01040 gene cbbX 84735 83788 CDS product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140002.1 protein_id gnl|my_center|LOCUS_01040 85383 84964 gene locus_tag LOCUS_01050 85383 84964 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085372.1 protein_id gnl|my_center|LOCUS_01050 87075 85606 gene locus_tag LOCUS_01060 87075 85606 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085371.1 protein_id gnl|my_center|LOCUS_01060 88264 87179 gene locus_tag LOCUS_01070 gene fba 88264 87179 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085370.1 protein_id gnl|my_center|LOCUS_01070 90318 88279 gene locus_tag LOCUS_01080 gene tkt 90318 88279 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532054.1 protein_id gnl|my_center|LOCUS_01080 91190 90315 gene locus_tag LOCUS_01090 91190 90315 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085368.1 protein_id gnl|my_center|LOCUS_01090 92229 91204 gene locus_tag LOCUS_01100 92229 91204 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532052.1 protein_id gnl|my_center|LOCUS_01100 92413 93327 gene locus_tag LOCUS_01110 92413 93327 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085366.1 protein_id gnl|my_center|LOCUS_01110 94302 93283 gene locus_tag LOCUS_01120 94302 93283 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972130.1 protein_id gnl|my_center|LOCUS_01120 94393 95283 gene locus_tag LOCUS_01130 94393 95283 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529142.1 protein_id gnl|my_center|LOCUS_01130 97582 95363 gene locus_tag LOCUS_01140 97582 95363 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 protein_id gnl|my_center|LOCUS_01140 98040 97588 gene locus_tag LOCUS_01150 98040 97588 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398951.1 protein_id gnl|my_center|LOCUS_01150 98839 98162 gene locus_tag LOCUS_01160 98839 98162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 98979 100064 gene locus_tag LOCUS_01170 98979 100064 CDS product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613280.1 protein_id gnl|my_center|LOCUS_01170 100242 101060 gene locus_tag LOCUS_01180 100242 101060 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614998.1 protein_id gnl|my_center|LOCUS_01180 101061 101915 gene locus_tag LOCUS_01190 101061 101915 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090873437.1 protein_id gnl|my_center|LOCUS_01190 101919 103262 gene locus_tag LOCUS_01200 101919 103262 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731498.1 protein_id gnl|my_center|LOCUS_01200 103342 103914 gene locus_tag LOCUS_01210 gene rutF 103342 103914 CDS product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266758.1 protein_id gnl|my_center|LOCUS_01210 104295 105278 gene locus_tag LOCUS_01220 104295 105278 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530444.1 protein_id gnl|my_center|LOCUS_01220 105344 106147 gene locus_tag LOCUS_01230 105344 106147 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530445.1 protein_id gnl|my_center|LOCUS_01230 106183 107022 gene locus_tag LOCUS_01240 106183 107022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530446.1 protein_id gnl|my_center|LOCUS_01240 107368 108138 gene locus_tag LOCUS_01250 107368 108138 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530480.1 protein_id gnl|my_center|LOCUS_01250 108247 109575 gene locus_tag LOCUS_01260 gene hisD 108247 109575 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530482.1 protein_id gnl|my_center|LOCUS_01260 109584 109898 gene locus_tag LOCUS_01270 109584 109898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 109895 110914 gene locus_tag LOCUS_01280 109895 110914 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530483.1 protein_id gnl|my_center|LOCUS_01280 110911 112221 gene locus_tag LOCUS_01290 110911 112221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193377946.1 protein_id gnl|my_center|LOCUS_01290 112250 113392 gene locus_tag LOCUS_01300 112250 113392 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967214.1 protein_id gnl|my_center|LOCUS_01300 114276 113389 gene locus_tag LOCUS_01310 gene uraD 114276 113389 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966721.1 protein_id gnl|my_center|LOCUS_01310 117051 114286 gene locus_tag LOCUS_01320 117051 114286 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088902.1 protein_id gnl|my_center|LOCUS_01320 117908 117048 gene locus_tag LOCUS_01330 117908 117048 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088901.1 protein_id gnl|my_center|LOCUS_01330 118762 117923 gene locus_tag LOCUS_01340 gene pucL 118762 117923 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223818.1 protein_id gnl|my_center|LOCUS_01340 118968 119753 gene locus_tag LOCUS_01350 118968 119753 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314989.1 protein_id gnl|my_center|LOCUS_01350 119822 120466 gene locus_tag LOCUS_01360 119822 120466 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993682.1 protein_id gnl|my_center|LOCUS_01360 120820 121278 gene locus_tag LOCUS_01370 120820 121278 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640101.1 protein_id gnl|my_center|LOCUS_01370 121530 122723 gene locus_tag LOCUS_01380 121530 122723 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973130.1 protein_id gnl|my_center|LOCUS_01380 122794 123504 gene locus_tag LOCUS_01390 122794 123504 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 protein_id gnl|my_center|LOCUS_01390 123428 124966 gene locus_tag LOCUS_01400 123428 124966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 124982 125704 gene locus_tag LOCUS_01410 124982 125704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 125802 126749 gene locus_tag LOCUS_01420 125802 126749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 126946 129564 gene locus_tag LOCUS_01430 126946 129564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 129571 131412 gene locus_tag LOCUS_01440 129571 131412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_01440 131468 132550 gene locus_tag LOCUS_01450 131468 132550 CDS product GDP-mannose--glycolipid 4-beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037588.1 protein_id gnl|my_center|LOCUS_01450 133349 132624 gene locus_tag LOCUS_01460 133349 132624 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083382.1 protein_id gnl|my_center|LOCUS_01460 133941 133477 gene locus_tag LOCUS_01470 133941 133477 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083384.1 protein_id gnl|my_center|LOCUS_01470 134985 134263 gene locus_tag LOCUS_01480 134985 134263 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063699495.1 protein_id gnl|my_center|LOCUS_01480 136835 135327 gene locus_tag LOCUS_01490 136835 135327 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113695.1 protein_id gnl|my_center|LOCUS_01490 137392 136889 gene locus_tag LOCUS_01500 137392 136889 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033042400.1 protein_id gnl|my_center|LOCUS_01500 138626 137616 gene locus_tag LOCUS_01510 138626 137616 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966990.1 protein_id gnl|my_center|LOCUS_01510 139380 140855 gene locus_tag LOCUS_01520 gene zwf 139380 140855 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327380.1 protein_id gnl|my_center|LOCUS_01520 141062 141754 gene locus_tag LOCUS_01530 gene pgl 141062 141754 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327379.1 protein_id gnl|my_center|LOCUS_01530 141932 143770 gene locus_tag LOCUS_01540 gene edd 141932 143770 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530234.1 protein_id gnl|my_center|LOCUS_01540 144856 143798 gene locus_tag LOCUS_01550 144856 143798 CDS product DUF2125 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084212.1 protein_id gnl|my_center|LOCUS_01550 145046 145582 gene locus_tag LOCUS_01560 145046 145582 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173537.1 protein_id gnl|my_center|LOCUS_01560 145938 145612 gene locus_tag LOCUS_01570 145938 145612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 146660 146031 gene locus_tag LOCUS_01580 146660 146031 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084209.1 protein_id gnl|my_center|LOCUS_01580 147717 146725 gene locus_tag LOCUS_01590 147717 146725 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970105.1 protein_id gnl|my_center|LOCUS_01590 148369 147710 gene locus_tag LOCUS_01600 gene ftsE 148369 147710 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027544305.1 protein_id gnl|my_center|LOCUS_01600 148573 149172 gene locus_tag LOCUS_01610 gene hpt 148573 149172 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709205.1 protein_id gnl|my_center|LOCUS_01610 152592 149821 gene locus_tag LOCUS_01620 152592 149821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 154021 152753 gene locus_tag LOCUS_01630 gene lysA 154021 152753 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084201.1 protein_id gnl|my_center|LOCUS_01630 154327 154073 gene locus_tag LOCUS_01640 154327 154073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 155204 154386 gene locus_tag LOCUS_01650 gene xth 155204 154386 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083446.1 protein_id gnl|my_center|LOCUS_01650 156005 155286 gene locus_tag LOCUS_01660 156005 155286 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083445.1 protein_id gnl|my_center|LOCUS_01660 158788 156155 gene locus_tag LOCUS_01670 158788 156155 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083444.1 protein_id gnl|my_center|LOCUS_01670 159966 158815 gene locus_tag LOCUS_01680 159966 158815 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921599.1 protein_id gnl|my_center|LOCUS_01680 159865 160131 gene locus_tag LOCUS_01690 159865 160131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 161909 160443 gene locus_tag LOCUS_01700 161909 160443 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965116.1 protein_id gnl|my_center|LOCUS_01700 162304 161966 gene locus_tag LOCUS_01710 162304 161966 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008142813.1 protein_id gnl|my_center|LOCUS_01710 163509 162619 gene locus_tag LOCUS_01720 gene tesB 163509 162619 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970482.1 protein_id gnl|my_center|LOCUS_01720 163673 164905 gene locus_tag LOCUS_01730 163673 164905 CDS product ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083432.1 protein_id gnl|my_center|LOCUS_01730 165134 164910 gene locus_tag LOCUS_01740 165134 164910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 165256 165930 gene locus_tag LOCUS_01750 165256 165930 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389010.1 protein_id gnl|my_center|LOCUS_01750 166860 166057 gene locus_tag LOCUS_01760 166860 166057 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525498.1 protein_id gnl|my_center|LOCUS_01760 167054 167617 gene locus_tag LOCUS_01770 167054 167617 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067251.1 protein_id gnl|my_center|LOCUS_01770 167719 168651 gene locus_tag LOCUS_01780 gene trxA 167719 168651 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083423.1 protein_id gnl|my_center|LOCUS_01780 168681 169361 gene locus_tag LOCUS_01790 168681 169361 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 protein_id gnl|my_center|LOCUS_01790 172588 169367 gene locus_tag LOCUS_01800 172588 169367 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083188.1 protein_id gnl|my_center|LOCUS_01800 173847 172588 gene locus_tag LOCUS_01810 173847 172588 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972288.1 protein_id gnl|my_center|LOCUS_01810 174533 173844 gene locus_tag LOCUS_01820 174533 173844 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 protein_id gnl|my_center|LOCUS_01820 175162 174653 gene locus_tag LOCUS_01830 175162 174653 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083268.1 protein_id gnl|my_center|LOCUS_01830 175709 175269 gene locus_tag LOCUS_01840 175709 175269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 177229 175883 gene locus_tag LOCUS_01850 177229 175883 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083266.1 protein_id gnl|my_center|LOCUS_01850 178569 177229 gene locus_tag LOCUS_01860 178569 177229 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083265.1 protein_id gnl|my_center|LOCUS_01860 179108 178626 gene locus_tag LOCUS_01870 gene rlmH 179108 178626 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242497.1 protein_id gnl|my_center|LOCUS_01870 179532 179119 gene locus_tag LOCUS_01880 gene rsfS 179532 179119 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265955.1 protein_id gnl|my_center|LOCUS_01880 180179 179670 gene locus_tag LOCUS_01890 180179 179670 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965055.1 protein_id gnl|my_center|LOCUS_01890 183753 180358 gene locus_tag LOCUS_01900 183753 180358 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082991.1 protein_id gnl|my_center|LOCUS_01900 184760 183918 gene locus_tag LOCUS_01910 184760 183918 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966645.1 protein_id gnl|my_center|LOCUS_01910 185025 185327 gene locus_tag LOCUS_01920 gene rpmB 185025 185327 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082994.1 protein_id gnl|my_center|LOCUS_01920 185333 185962 gene locus_tag LOCUS_01930 185333 185962 CDS product VUT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066778.1 protein_id gnl|my_center|LOCUS_01930 187000 185987 gene locus_tag LOCUS_01940 187000 185987 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083009.1 protein_id gnl|my_center|LOCUS_01940 187482 186997 gene locus_tag LOCUS_01950 187482 186997 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088447.1 protein_id gnl|my_center|LOCUS_01950 187615 188382 gene locus_tag LOCUS_01960 gene rutR 187615 188382 CDS product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367241.1 protein_id gnl|my_center|LOCUS_01960 188408 189058 gene locus_tag LOCUS_01970 188408 189058 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965344.1 protein_id gnl|my_center|LOCUS_01970 189461 190459 gene locus_tag LOCUS_01980 gene yiaO 189461 190459 CDS product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776892.1 protein_id gnl|my_center|LOCUS_01980 190456 191250 gene locus_tag LOCUS_01990 190456 191250 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809724.1 protein_id gnl|my_center|LOCUS_01990 191247 191786 gene locus_tag LOCUS_02000 191247 191786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 191786 193069 gene locus_tag LOCUS_02010 191786 193069 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_02010 194570 193128 gene locus_tag LOCUS_02020 194570 193128 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531228.1 protein_id gnl|my_center|LOCUS_02020 194804 195070 gene locus_tag LOCUS_02030 194804 195070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 195940 195155 gene locus_tag LOCUS_02040 195940 195155 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310857.1 protein_id gnl|my_center|LOCUS_02040 198675 196075 gene locus_tag LOCUS_02050 198675 196075 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083292.1 protein_id gnl|my_center|LOCUS_02050 199400 198672 gene locus_tag LOCUS_02060 199400 198672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083291.1 protein_id gnl|my_center|LOCUS_02060 199558 200148 gene locus_tag LOCUS_02070 199558 200148 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965065.1 protein_id gnl|my_center|LOCUS_02070 200145 200594 gene locus_tag LOCUS_02080 200145 200594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 200678 201721 gene locus_tag LOCUS_02090 200678 201721 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532104.1 protein_id gnl|my_center|LOCUS_02090 202369 201767 gene locus_tag LOCUS_02100 202369 201767 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310869.1 protein_id gnl|my_center|LOCUS_02100 203763 202375 gene locus_tag LOCUS_02110 gene argH 203763 202375 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965353.1 protein_id gnl|my_center|LOCUS_02110 203827 204624 gene locus_tag LOCUS_02120 203827 204624 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084198.1 protein_id gnl|my_center|LOCUS_02120 204744 205718 gene locus_tag LOCUS_02130 204744 205718 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 protein_id gnl|my_center|LOCUS_02130 207075 206194 gene locus_tag LOCUS_02140 207075 206194 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084197.1 protein_id gnl|my_center|LOCUS_02140 208069 207122 gene locus_tag LOCUS_02150 208069 207122 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084196.1 protein_id gnl|my_center|LOCUS_02150 208821 208072 gene locus_tag LOCUS_02160 208821 208072 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982194.1 protein_id gnl|my_center|LOCUS_02160 209731 209012 gene locus_tag LOCUS_02170 209731 209012 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240065.1 protein_id gnl|my_center|LOCUS_02170 210505 209846 gene locus_tag LOCUS_02180 210505 209846 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969298.1 protein_id gnl|my_center|LOCUS_02180 211106 210513 gene locus_tag LOCUS_02190 211106 210513 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 protein_id gnl|my_center|LOCUS_02190 211324 211121 gene locus_tag LOCUS_02200 211324 211121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 211869 211393 gene locus_tag LOCUS_02210 211869 211393 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403782.1 protein_id gnl|my_center|LOCUS_02210 212530 212072 gene locus_tag LOCUS_02220 212530 212072 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171431.1 protein_id gnl|my_center|LOCUS_02220 213493 212660 gene locus_tag LOCUS_02230 213493 212660 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084192.1 protein_id gnl|my_center|LOCUS_02230 214524 213616 gene locus_tag LOCUS_02240 214524 213616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 215021 214752 gene locus_tag LOCUS_02250 215021 214752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 214948 216198 gene locus_tag LOCUS_02260 214948 216198 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083261.1 protein_id gnl|my_center|LOCUS_02260 216361 216696 gene locus_tag LOCUS_02270 216361 216696 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972540.1 protein_id gnl|my_center|LOCUS_02270 217103 217714 gene locus_tag LOCUS_02280 217103 217714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 218033 218314 gene locus_tag LOCUS_02290 218033 218314 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970346.1 protein_id gnl|my_center|LOCUS_02290 218339 218644 gene locus_tag LOCUS_02300 218339 218644 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531910.1 protein_id gnl|my_center|LOCUS_02300 218762 219631 gene locus_tag LOCUS_02310 218762 219631 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970526.1 protein_id gnl|my_center|LOCUS_02310 221169 219652 gene locus_tag LOCUS_02320 221169 219652 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000324.1 protein_id gnl|my_center|LOCUS_02320 222113 221163 gene locus_tag LOCUS_02330 222113 221163 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494181.1 protein_id gnl|my_center|LOCUS_02330 222246 222322 gene locus_tag LOCUS_t00040 222246 222322 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 223438 222332 gene locus_tag LOCUS_02340 223438 222332 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069333558.1 protein_id gnl|my_center|LOCUS_02340 223629 223435 gene locus_tag LOCUS_02350 223629 223435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 223827 223633 gene locus_tag LOCUS_02360 223827 223633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 224312 223836 gene locus_tag LOCUS_02370 224312 223836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 224619 224425 gene locus_tag LOCUS_02380 224619 224425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 225035 224616 gene locus_tag LOCUS_02390 225035 224616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 225445 225032 gene locus_tag LOCUS_02400 225445 225032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 225530 225811 gene locus_tag LOCUS_02410 225530 225811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 225822 226112 gene locus_tag LOCUS_02420 225822 226112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 226679 226158 gene locus_tag LOCUS_02430 226679 226158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 227805 226681 gene locus_tag LOCUS_02440 227805 226681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973367.1 protein_id gnl|my_center|LOCUS_02440 228243 227965 gene locus_tag LOCUS_02450 228243 227965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 <228875 228322 gene locus_tag LOCUS_02460 <228875 228322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072857.1:phage tail tape measure protein >Feature sequence05 51 389 gene locus_tag LOCUS_02470 51 389 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_02470 416 1321 gene locus_tag LOCUS_02480 416 1321 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349104.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence06 619 2142 gene locus_tag LOCUS_02490 619 2142 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980514.1 protein_id gnl|my_center|LOCUS_02490 3953 2313 gene locus_tag LOCUS_02500 gene groL 3953 2313 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088372.1 protein_id gnl|my_center|LOCUS_02500 4317 4003 gene locus_tag LOCUS_02510 4317 4003 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088371.1 protein_id gnl|my_center|LOCUS_02510 4618 4923 gene locus_tag LOCUS_02520 4618 4923 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088370.1 protein_id gnl|my_center|LOCUS_02520 5250 5879 gene locus_tag LOCUS_02530 5250 5879 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921425.1 protein_id gnl|my_center|LOCUS_02530 6418 5936 gene locus_tag LOCUS_02540 6418 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 7375 6629 gene locus_tag LOCUS_02550 7375 6629 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 protein_id gnl|my_center|LOCUS_02550 8593 7847 gene locus_tag LOCUS_02560 8593 7847 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088363.1 protein_id gnl|my_center|LOCUS_02560 9565 8681 gene locus_tag LOCUS_02570 9565 8681 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967763.1 protein_id gnl|my_center|LOCUS_02570 10548 9604 gene locus_tag LOCUS_02580 10548 9604 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088359.1 protein_id gnl|my_center|LOCUS_02580 11185 10562 gene locus_tag LOCUS_02590 11185 10562 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528284.1 protein_id gnl|my_center|LOCUS_02590 12736 11315 gene locus_tag LOCUS_02600 12736 11315 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175426.1 protein_id gnl|my_center|LOCUS_02600 12939 13700 gene locus_tag LOCUS_02610 12939 13700 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088357.1 protein_id gnl|my_center|LOCUS_02610 13792 14298 gene locus_tag LOCUS_02620 gene gpt 13792 14298 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175425.1 protein_id gnl|my_center|LOCUS_02620 14317 14706 gene locus_tag LOCUS_02630 14317 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 14788 15198 gene locus_tag LOCUS_02640 gene mexG 14788 15198 CDS product multidrug efflux RND transporter inhibitory subunit MexG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093607.1 protein_id gnl|my_center|LOCUS_02640 15224 16918 gene locus_tag LOCUS_02650 15224 16918 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720843.1 protein_id gnl|my_center|LOCUS_02650 16991 17075 gene locus_tag LOCUS_t00050 16991 17075 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17328 18575 gene locus_tag LOCUS_02660 17328 18575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 18729 19865 gene locus_tag LOCUS_02670 18729 19865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 20063 21151 gene locus_tag LOCUS_02680 20063 21151 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975531.1 protein_id gnl|my_center|LOCUS_02680 21144 22319 gene locus_tag LOCUS_02690 21144 22319 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097532308.1 protein_id gnl|my_center|LOCUS_02690 22422 23483 gene locus_tag LOCUS_02700 22422 23483 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393296.1 protein_id gnl|my_center|LOCUS_02700 23590 24870 gene locus_tag LOCUS_02710 23590 24870 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185616.1 protein_id gnl|my_center|LOCUS_02710 25885 24887 gene locus_tag LOCUS_02720 gene galE 25885 24887 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338390.1 protein_id gnl|my_center|LOCUS_02720 27372 26050 gene locus_tag LOCUS_02730 27372 26050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 27625 31458 gene locus_tag LOCUS_02740 gene putA 27625 31458 CDS product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524499.1 protein_id gnl|my_center|LOCUS_02740 31529 32557 gene locus_tag LOCUS_02750 31529 32557 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084237.1 protein_id gnl|my_center|LOCUS_02750 33498 32554 gene locus_tag LOCUS_02760 33498 32554 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927239.1 protein_id gnl|my_center|LOCUS_02760 34780 33602 gene locus_tag LOCUS_02770 34780 33602 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088337.1 protein_id gnl|my_center|LOCUS_02770 35054 34806 gene locus_tag LOCUS_02780 35054 34806 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602543.1 protein_id gnl|my_center|LOCUS_02780 35169 36230 gene locus_tag LOCUS_02790 35169 36230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088336.1 protein_id gnl|my_center|LOCUS_02790 36353 37105 gene locus_tag LOCUS_02800 36353 37105 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967757.1 protein_id gnl|my_center|LOCUS_02800 37221 38066 gene locus_tag LOCUS_02810 gene cysE 37221 38066 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175407.1 protein_id gnl|my_center|LOCUS_02810 38245 38457 gene locus_tag LOCUS_02820 38245 38457 CDS product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602550.1 protein_id gnl|my_center|LOCUS_02820 38476 39006 gene locus_tag LOCUS_02830 38476 39006 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240524.1 protein_id gnl|my_center|LOCUS_02830 39089 39634 gene locus_tag LOCUS_02840 39089 39634 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389882.1 protein_id gnl|my_center|LOCUS_02840 40321 39653 gene locus_tag LOCUS_02850 40321 39653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 40637 41470 gene locus_tag LOCUS_02860 40637 41470 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921493.1 protein_id gnl|my_center|LOCUS_02860 41610 42041 gene locus_tag LOCUS_02870 41610 42041 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531344.1 protein_id gnl|my_center|LOCUS_02870 42590 42096 gene locus_tag LOCUS_02880 gene hisI 42590 42096 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534698.1 protein_id gnl|my_center|LOCUS_02880 43221 42583 gene locus_tag LOCUS_02890 gene folE 43221 42583 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088270.1 protein_id gnl|my_center|LOCUS_02890 43472 43915 gene locus_tag LOCUS_02900 43472 43915 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088271.1 protein_id gnl|my_center|LOCUS_02900 44520 44062 gene locus_tag LOCUS_02910 44520 44062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 44597 44926 gene locus_tag LOCUS_02920 gene yidD 44597 44926 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088273.1 protein_id gnl|my_center|LOCUS_02920 44976 46976 gene locus_tag LOCUS_02930 gene thrS 44976 46976 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049832605.1 protein_id gnl|my_center|LOCUS_02930 47262 48161 gene locus_tag LOCUS_02940 47262 48161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 48496 48191 gene locus_tag LOCUS_02950 48496 48191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 48679 49863 gene locus_tag LOCUS_02960 48679 49863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 49889 52219 gene locus_tag LOCUS_02970 49889 52219 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161536185.1 protein_id gnl|my_center|LOCUS_02970 52229 52600 gene locus_tag LOCUS_02980 52229 52600 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_02980 52648 54243 gene locus_tag LOCUS_02990 52648 54243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 54723 54277 gene locus_tag LOCUS_03000 54723 54277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 55094 54762 gene locus_tag LOCUS_03010 55094 54762 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820087.1 protein_id gnl|my_center|LOCUS_03010 56920 55214 gene locus_tag LOCUS_03020 56920 55214 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815268.1 protein_id gnl|my_center|LOCUS_03020 57333 57258 gene locus_tag LOCUS_t00060 57333 57258 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 59223 57424 gene locus_tag LOCUS_03030 59223 57424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088673.1 protein_id gnl|my_center|LOCUS_03030 59510 59437 gene locus_tag LOCUS_t00070 59510 59437 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 59787 60449 gene locus_tag LOCUS_03040 59787 60449 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971822.1 protein_id gnl|my_center|LOCUS_03040 60632 62041 gene locus_tag LOCUS_03050 60632 62041 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087245.1 protein_id gnl|my_center|LOCUS_03050 62299 63519 gene locus_tag LOCUS_03060 62299 63519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 63651 66488 gene locus_tag LOCUS_03070 63651 66488 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087247.1 protein_id gnl|my_center|LOCUS_03070 66554 67270 gene locus_tag LOCUS_03080 66554 67270 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090491.1 protein_id gnl|my_center|LOCUS_03080 67693 67283 gene locus_tag LOCUS_03090 67693 67283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 67939 69666 gene locus_tag LOCUS_03100 gene ilvD 67939 69666 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531283.1 protein_id gnl|my_center|LOCUS_03100 69698 70516 gene locus_tag LOCUS_03110 69698 70516 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967247.1 protein_id gnl|my_center|LOCUS_03110 71383 70595 gene locus_tag LOCUS_03120 gene xth 71383 70595 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967248.1 protein_id gnl|my_center|LOCUS_03120 72171 71422 gene locus_tag LOCUS_03130 72171 71422 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400678.1 protein_id gnl|my_center|LOCUS_03130 72551 72171 gene locus_tag LOCUS_03140 gene erpA 72551 72171 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 protein_id gnl|my_center|LOCUS_03140 72643 73815 gene locus_tag LOCUS_03150 72643 73815 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087526.1 protein_id gnl|my_center|LOCUS_03150 73876 75642 gene locus_tag LOCUS_03160 gene argS 73876 75642 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967253.1 protein_id gnl|my_center|LOCUS_03160 75763 77445 gene locus_tag LOCUS_03170 75763 77445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 77471 78499 gene locus_tag LOCUS_03180 gene nagZ 77471 78499 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087522.1 protein_id gnl|my_center|LOCUS_03180 78518 79321 gene locus_tag LOCUS_03190 78518 79321 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087521.1 protein_id gnl|my_center|LOCUS_03190 79318 80025 gene locus_tag LOCUS_03200 gene scpB 79318 80025 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171841.1 protein_id gnl|my_center|LOCUS_03200 80057 81136 gene locus_tag LOCUS_03210 80057 81136 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020487294.1 protein_id gnl|my_center|LOCUS_03210 81203 81427 gene locus_tag LOCUS_03220 81203 81427 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087519.1 protein_id gnl|my_center|LOCUS_03220 81487 82314 gene locus_tag LOCUS_03230 81487 82314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 82311 83105 gene locus_tag LOCUS_03240 gene tatC 82311 83105 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087517.1 protein_id gnl|my_center|LOCUS_03240 83248 83021 gene locus_tag LOCUS_03250 83248 83021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 83247 84620 gene locus_tag LOCUS_03260 gene serS 83247 84620 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087516.1 protein_id gnl|my_center|LOCUS_03260 84753 85517 gene locus_tag LOCUS_03270 gene surE 84753 85517 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171844.1 protein_id gnl|my_center|LOCUS_03270 85551 86201 gene locus_tag LOCUS_03280 85551 86201 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087512.1 protein_id gnl|my_center|LOCUS_03280 86353 87573 gene locus_tag LOCUS_03290 86353 87573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 88539 87649 gene locus_tag LOCUS_03300 88539 87649 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087505.1 protein_id gnl|my_center|LOCUS_03300 88777 89118 gene locus_tag LOCUS_03310 gene yajC 88777 89118 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087504.1 protein_id gnl|my_center|LOCUS_03310 89165 90763 gene locus_tag LOCUS_03320 gene secD 89165 90763 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087503.1 protein_id gnl|my_center|LOCUS_03320 90778 91746 gene locus_tag LOCUS_03330 gene secF 90778 91746 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087502.1 protein_id gnl|my_center|LOCUS_03330 91798 92175 gene locus_tag LOCUS_03340 91798 92175 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531307.1 protein_id gnl|my_center|LOCUS_03340 92193 93044 gene locus_tag LOCUS_03350 92193 93044 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971712.1 protein_id gnl|my_center|LOCUS_03350 93136 94635 gene locus_tag LOCUS_03360 93136 94635 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090848.1 protein_id gnl|my_center|LOCUS_03360 95113 94718 gene locus_tag LOCUS_03370 95113 94718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 95961 95113 gene locus_tag LOCUS_03380 gene kdsA 95961 95113 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087568.1 protein_id gnl|my_center|LOCUS_03380 97007 95991 gene locus_tag LOCUS_03390 97007 95991 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974403.1 protein_id gnl|my_center|LOCUS_03390 98571 97147 gene locus_tag LOCUS_03400 98571 97147 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173221.1 protein_id gnl|my_center|LOCUS_03400 98840 99952 gene locus_tag LOCUS_03410 98840 99952 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084283.1 protein_id gnl|my_center|LOCUS_03410 100090 100166 gene locus_tag LOCUS_t00080 100090 100166 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 101422 100109 gene locus_tag LOCUS_03420 101422 100109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 101699 101430 gene locus_tag LOCUS_03430 101699 101430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 102160 101696 gene locus_tag LOCUS_03440 102160 101696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 102666 102163 gene locus_tag LOCUS_03450 102666 102163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 103694 102663 gene locus_tag LOCUS_03460 103694 102663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 104377 103691 gene locus_tag LOCUS_03470 104377 103691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268017.1 protein_id gnl|my_center|LOCUS_03470 104609 104370 gene locus_tag LOCUS_03480 104609 104370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 104752 104606 gene locus_tag LOCUS_03490 104752 104606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 105030 104749 gene locus_tag LOCUS_03500 105030 104749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 106171 105104 gene locus_tag LOCUS_03510 106171 105104 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339629.1 protein_id gnl|my_center|LOCUS_03510 106787 106164 gene locus_tag LOCUS_03520 106787 106164 CDS product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140266.1 protein_id gnl|my_center|LOCUS_03520 107025 106780 gene locus_tag LOCUS_03530 107025 106780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 107587 107018 gene locus_tag LOCUS_03540 107587 107018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 107942 107580 gene locus_tag LOCUS_03550 107942 107580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 108825 107935 gene locus_tag LOCUS_03560 108825 107935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 109367 108825 gene locus_tag LOCUS_03570 109367 108825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 110183 109971 gene locus_tag LOCUS_03580 110183 109971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 110383 110183 gene locus_tag LOCUS_03590 110383 110183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 110695 110387 gene locus_tag LOCUS_03600 110695 110387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 110993 110697 gene locus_tag LOCUS_03610 110993 110697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176949753.1 protein_id gnl|my_center|LOCUS_03610 111153 110986 gene locus_tag LOCUS_03620 111153 110986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 111597 111235 gene locus_tag LOCUS_03630 111597 111235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 111847 111614 gene locus_tag LOCUS_03640 111847 111614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 112101 111844 gene locus_tag LOCUS_03650 112101 111844 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089261.1 protein_id gnl|my_center|LOCUS_03650 112467 112111 gene locus_tag LOCUS_03660 112467 112111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 113146 112559 gene locus_tag LOCUS_03670 113146 112559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 113316 113564 gene locus_tag LOCUS_03680 113316 113564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 113593 113841 gene locus_tag LOCUS_03690 113593 113841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 114076 114717 gene locus_tag LOCUS_03700 114076 114717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 114714 115568 gene locus_tag LOCUS_03710 114714 115568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 116293 115604 gene locus_tag LOCUS_03720 116293 115604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 116386 116664 gene locus_tag LOCUS_03730 116386 116664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 116661 116924 gene locus_tag LOCUS_03740 116661 116924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 117314 117030 gene locus_tag LOCUS_03750 117314 117030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 117489 117971 gene locus_tag LOCUS_03760 117489 117971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970897.1 protein_id gnl|my_center|LOCUS_03760 117978 118226 gene locus_tag LOCUS_03770 117978 118226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 118249 118536 gene locus_tag LOCUS_03780 118249 118536 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329758.1 protein_id gnl|my_center|LOCUS_03780 118543 118848 gene locus_tag LOCUS_03790 118543 118848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 118845 119807 gene locus_tag LOCUS_03800 118845 119807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 119819 121213 gene locus_tag LOCUS_03810 gene dnaA 119819 121213 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083652.1 protein_id gnl|my_center|LOCUS_03810 121210 121809 gene locus_tag LOCUS_03820 121210 121809 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_03820 121806 122723 gene locus_tag LOCUS_03830 121806 122723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974889.1 protein_id gnl|my_center|LOCUS_03830 122720 123034 gene locus_tag LOCUS_03840 122720 123034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 123031 123393 gene locus_tag LOCUS_03850 123031 123393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 123396 125039 gene locus_tag LOCUS_03860 123396 125039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 125036 125368 gene locus_tag LOCUS_03870 125036 125368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 125365 126399 gene locus_tag LOCUS_03880 125365 126399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 126392 127060 gene locus_tag LOCUS_03890 126392 127060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 127308 127538 gene locus_tag LOCUS_03900 127308 127538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 127770 127558 gene locus_tag LOCUS_03910 127770 127558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 128032 128394 gene locus_tag LOCUS_03920 128032 128394 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072872.1 protein_id gnl|my_center|LOCUS_03920 128602 129033 gene locus_tag LOCUS_03930 128602 129033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 129308 130825 gene locus_tag LOCUS_03940 129308 130825 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384775.1 protein_id gnl|my_center|LOCUS_03940 130977 132704 gene locus_tag LOCUS_03950 130977 132704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 132715 133437 gene locus_tag LOCUS_03960 132715 133437 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138387483.1 protein_id gnl|my_center|LOCUS_03960 133463 134908 gene locus_tag LOCUS_03970 133463 134908 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975494.1 protein_id gnl|my_center|LOCUS_03970 134992 135420 gene locus_tag LOCUS_03980 134992 135420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975493.1 protein_id gnl|my_center|LOCUS_03980 135483 135920 gene locus_tag LOCUS_03990 135483 135920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 135926 136492 gene locus_tag LOCUS_04000 135926 136492 CDS product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 protein_id gnl|my_center|LOCUS_04000 136519 136929 gene locus_tag LOCUS_04010 136519 136929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975488.1 protein_id gnl|my_center|LOCUS_04010 136926 137279 gene locus_tag LOCUS_04020 136926 137279 CDS product head-tail adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975487.1 protein_id gnl|my_center|LOCUS_04020 137279 137458 gene locus_tag LOCUS_04030 137279 137458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 137459 137932 gene locus_tag LOCUS_04040 137459 137932 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975486.1 protein_id gnl|my_center|LOCUS_04040 137932 138333 gene locus_tag LOCUS_04050 137932 138333 CDS product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975485.1 protein_id gnl|my_center|LOCUS_04050 138395 138838 gene locus_tag LOCUS_04060 138395 138838 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975484.1 protein_id gnl|my_center|LOCUS_04060 138838 139254 gene locus_tag LOCUS_04070 138838 139254 CDS product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975483.1 protein_id gnl|my_center|LOCUS_04070 139281 139424 gene locus_tag LOCUS_04080 139281 139424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 139676 139401 gene locus_tag LOCUS_04090 139676 139401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 139760 142498 gene locus_tag LOCUS_04100 139760 142498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 142500 143066 gene locus_tag LOCUS_04110 142500 143066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 143054 143515 gene locus_tag LOCUS_04120 143054 143515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 143515 145299 gene locus_tag LOCUS_04130 143515 145299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 145296 145964 gene locus_tag LOCUS_04140 145296 145964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 145999 148398 gene locus_tag LOCUS_04150 145999 148398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 148446 149477 gene locus_tag LOCUS_04160 148446 149477 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742200.1 protein_id gnl|my_center|LOCUS_04160 149543 150394 gene locus_tag LOCUS_04170 149543 150394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 150391 152712 gene locus_tag LOCUS_04180 150391 152712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 152749 152982 gene locus_tag LOCUS_04190 152749 152982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 152969 153553 gene locus_tag LOCUS_04200 152969 153553 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384045.1 protein_id gnl|my_center|LOCUS_04200 153553 153978 gene locus_tag LOCUS_04210 153553 153978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 153929 154171 gene locus_tag LOCUS_04220 153929 154171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 154171 154527 gene locus_tag LOCUS_04230 154171 154527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 154524 154718 gene locus_tag LOCUS_04240 154524 154718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 155301 154912 gene locus_tag LOCUS_04250 155301 154912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 155612 155298 gene locus_tag LOCUS_04260 155612 155298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 155940 155620 gene locus_tag LOCUS_04270 155940 155620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 156432 156172 gene locus_tag LOCUS_04280 156432 156172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 156665 156450 gene locus_tag LOCUS_04290 156665 156450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 156923 156669 gene locus_tag LOCUS_04300 156923 156669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 157445 157260 gene locus_tag LOCUS_04310 157445 157260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 157737 158066 gene locus_tag LOCUS_04320 157737 158066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 158472 158837 gene locus_tag LOCUS_04330 158472 158837 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136158.1 protein_id gnl|my_center|LOCUS_04330 158828 159406 gene locus_tag LOCUS_04340 158828 159406 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211411592.1 protein_id gnl|my_center|LOCUS_04340 159497 160111 gene locus_tag LOCUS_04350 159497 160111 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327986.1 protein_id gnl|my_center|LOCUS_04350 160127 161326 gene locus_tag LOCUS_04360 160127 161326 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975084.1 protein_id gnl|my_center|LOCUS_04360 161365 162231 gene locus_tag LOCUS_04370 161365 162231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 162242 163549 gene locus_tag LOCUS_04380 gene nuoF 162242 163549 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312708.1 protein_id gnl|my_center|LOCUS_04380 163558 165636 gene locus_tag LOCUS_04390 gene nuoG 163558 165636 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975089.1 protein_id gnl|my_center|LOCUS_04390 165647 166681 gene locus_tag LOCUS_04400 gene nuoH 165647 166681 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087676.1 protein_id gnl|my_center|LOCUS_04400 166683 166946 gene locus_tag LOCUS_04410 166683 166946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 166957 167445 gene locus_tag LOCUS_04420 gene nuoI 166957 167445 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707628.1 protein_id gnl|my_center|LOCUS_04420 167549 168154 gene locus_tag LOCUS_04430 167549 168154 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087674.1 protein_id gnl|my_center|LOCUS_04430 168158 168466 gene locus_tag LOCUS_04440 gene nuoK 168158 168466 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531854.1 protein_id gnl|my_center|LOCUS_04440 168477 170405 gene locus_tag LOCUS_04450 gene nuoL 168477 170405 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087673.1 protein_id gnl|my_center|LOCUS_04450 170405 171919 gene locus_tag LOCUS_04460 170405 171919 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 protein_id gnl|my_center|LOCUS_04460 171951 173378 gene locus_tag LOCUS_04470 gene nuoN 171951 173378 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087671.1 protein_id gnl|my_center|LOCUS_04470 173381 174151 gene locus_tag LOCUS_04480 173381 174151 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975096.1 protein_id gnl|my_center|LOCUS_04480 174163 175851 gene locus_tag LOCUS_04490 174163 175851 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171719.1 protein_id gnl|my_center|LOCUS_04490 175941 176345 gene locus_tag LOCUS_04500 gene mce 175941 176345 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531105.1 protein_id gnl|my_center|LOCUS_04500 176355 176630 gene locus_tag LOCUS_04510 176355 176630 CDS product DUF1467 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087667.1 protein_id gnl|my_center|LOCUS_04510 177065 178387 gene locus_tag LOCUS_04520 177065 178387 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971520.1 protein_id gnl|my_center|LOCUS_04520 178384 179727 gene locus_tag LOCUS_04530 178384 179727 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087643.1 protein_id gnl|my_center|LOCUS_04530 179739 180431 gene locus_tag LOCUS_04540 179739 180431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087642.1 protein_id gnl|my_center|LOCUS_04540 180599 181054 gene locus_tag LOCUS_04550 180599 181054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 181389 184898 gene locus_tag LOCUS_04560 gene dnaE 181389 184898 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087634.1 protein_id gnl|my_center|LOCUS_04560 184911 185297 gene locus_tag LOCUS_04570 184911 185297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 185478 186476 gene locus_tag LOCUS_04580 185478 186476 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087629.1 protein_id gnl|my_center|LOCUS_04580 186594 187517 gene locus_tag LOCUS_04590 gene tsf 186594 187517 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087628.1 protein_id gnl|my_center|LOCUS_04590 187619 188353 gene locus_tag LOCUS_04600 gene pyrH 187619 188353 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027545778.1 protein_id gnl|my_center|LOCUS_04600 188649 188386 gene locus_tag LOCUS_04610 188649 188386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 188542 189063 gene locus_tag LOCUS_04620 gene frr 188542 189063 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171750.1 protein_id gnl|my_center|LOCUS_04620 189100 189888 gene locus_tag LOCUS_04630 189100 189888 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328197.1 protein_id gnl|my_center|LOCUS_04630 189893 190714 gene locus_tag LOCUS_04640 189893 190714 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027545781.1 protein_id gnl|my_center|LOCUS_04640 190839 191984 gene locus_tag LOCUS_04650 gene rseP 190839 191984 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087622.1 protein_id gnl|my_center|LOCUS_04650 192163 194595 gene locus_tag LOCUS_04660 gene bamA 192163 194595 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640362.1 protein_id gnl|my_center|LOCUS_04660 194918 194547 gene locus_tag LOCUS_04670 194918 194547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 194838 195746 gene locus_tag LOCUS_04680 gene lpxD 194838 195746 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087620.1 protein_id gnl|my_center|LOCUS_04680 195751 196233 gene locus_tag LOCUS_04690 gene fabZ 195751 196233 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975310.1 protein_id gnl|my_center|LOCUS_04690 196233 197066 gene locus_tag LOCUS_04700 gene lpxA 196233 197066 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087617.1 protein_id gnl|my_center|LOCUS_04700 197041 197925 gene locus_tag LOCUS_04710 gene lpxI 197041 197925 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967850.1 protein_id gnl|my_center|LOCUS_04710 197922 199124 gene locus_tag LOCUS_04720 gene lpxB 197922 199124 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087615.1 protein_id gnl|my_center|LOCUS_04720 200533 199223 gene locus_tag LOCUS_04730 gene gltA 200533 199223 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969265.1 protein_id gnl|my_center|LOCUS_04730 202271 200835 gene locus_tag LOCUS_04740 gene gltX 202271 200835 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087606.1 protein_id gnl|my_center|LOCUS_04740 202460 202834 gene locus_tag LOCUS_04750 202460 202834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 202850 205120 gene locus_tag LOCUS_04760 202850 205120 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921625.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04760 205815 205114 gene locus_tag LOCUS_04770 gene lexA 205815 205114 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087594.1 protein_id gnl|my_center|LOCUS_04770 206038 207864 gene locus_tag LOCUS_04780 gene atzF 206038 207864 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083864.1 protein_id gnl|my_center|LOCUS_04780 208593 207901 gene locus_tag LOCUS_04790 208593 207901 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965238.1 protein_id gnl|my_center|LOCUS_04790 209083 208694 gene locus_tag LOCUS_04800 gene hpxZ 209083 208694 CDS product oxalurate catabolism protein HpxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083862.1 protein_id gnl|my_center|LOCUS_04800 210357 209131 gene locus_tag LOCUS_04810 210357 209131 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_04810 210869 210384 gene locus_tag LOCUS_04820 gene moaC 210869 210384 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087579.1 protein_id gnl|my_center|LOCUS_04820 211678 210869 gene locus_tag LOCUS_04830 gene trpC 211678 210869 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087578.1 protein_id gnl|my_center|LOCUS_04830 212706 211684 gene locus_tag LOCUS_04840 gene trpD 212706 211684 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087577.1 protein_id gnl|my_center|LOCUS_04840 213328 212726 gene locus_tag LOCUS_04850 213328 212726 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_04850 214983 213469 gene locus_tag LOCUS_04860 gene trpE 214983 213469 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_04860 216886 214997 gene locus_tag LOCUS_04870 216886 214997 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087576.1 protein_id gnl|my_center|LOCUS_04870 217097 217813 gene locus_tag LOCUS_04880 gene tpiA 217097 217813 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087575.1 protein_id gnl|my_center|LOCUS_04880 217944 218327 gene locus_tag LOCUS_04890 217944 218327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 218453 220081 gene locus_tag LOCUS_04900 218453 220081 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087573.1 protein_id gnl|my_center|LOCUS_04900 220269 221138 gene locus_tag LOCUS_04910 220269 221138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 223834 221261 gene locus_tag LOCUS_04920 223834 221261 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087385.1 protein_id gnl|my_center|LOCUS_04920 224583 224104 gene locus_tag LOCUS_04930 224583 224104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 224800 226422 gene locus_tag LOCUS_04940 224800 226422 CDS product beta-1,6-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087383.1 protein_id gnl|my_center|LOCUS_04940 226762 226382 gene locus_tag LOCUS_04950 226762 226382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 226897 228246 gene locus_tag LOCUS_04960 gene glmU 226897 228246 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087379.1 protein_id gnl|my_center|LOCUS_04960 228365 230191 gene locus_tag LOCUS_04970 gene glmS 228365 230191 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087378.1 protein_id gnl|my_center|LOCUS_04970 230324 231607 gene locus_tag LOCUS_04980 gene eno 230324 231607 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087562.1 protein_id gnl|my_center|LOCUS_04980 231992 232348 gene locus_tag LOCUS_04990 231992 232348 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087554.1 protein_id gnl|my_center|LOCUS_04990 232704 233669 gene locus_tag LOCUS_05000 gene pdhA 232704 233669 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975252.1 protein_id gnl|my_center|LOCUS_05000 233684 233983 gene locus_tag LOCUS_05010 233684 233983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 234024 235439 gene locus_tag LOCUS_05020 234024 235439 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087550.1 protein_id gnl|my_center|LOCUS_05020 235454 236818 gene locus_tag LOCUS_05030 235454 236818 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087547.1 protein_id gnl|my_center|LOCUS_05030 236828 238246 gene locus_tag LOCUS_05040 gene lpdA 236828 238246 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087546.1 protein_id gnl|my_center|LOCUS_05040 238357 238605 gene locus_tag LOCUS_05050 238357 238605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 238707 239717 gene locus_tag LOCUS_05060 gene lipA 238707 239717 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087249.1 protein_id gnl|my_center|LOCUS_05060 239721 240191 gene locus_tag LOCUS_05070 239721 240191 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087250.1 protein_id gnl|my_center|LOCUS_05070 240691 240170 gene locus_tag LOCUS_05080 240691 240170 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087256.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05080 241941 240739 gene locus_tag LOCUS_05090 241941 240739 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 protein_id gnl|my_center|LOCUS_05090 242101 243132 gene locus_tag LOCUS_05100 gene dusB 242101 243132 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161537076.1 protein_id gnl|my_center|LOCUS_05100 243129 244259 gene locus_tag LOCUS_05110 243129 244259 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_05110 244268 245713 gene locus_tag LOCUS_05120 gene ntrC 244268 245713 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087260.1 protein_id gnl|my_center|LOCUS_05120 245833 248118 gene locus_tag LOCUS_05130 245833 248118 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967572.1 protein_id gnl|my_center|LOCUS_05130 248133 249500 gene locus_tag LOCUS_05140 248133 249500 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087262.1 protein_id gnl|my_center|LOCUS_05140 249617 250993 gene locus_tag LOCUS_05150 gene trkA 249617 250993 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975268.1 protein_id gnl|my_center|LOCUS_05150 251003 252451 gene locus_tag LOCUS_05160 251003 252451 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_05160 252478 253338 gene locus_tag LOCUS_05170 252478 253338 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531497.1 protein_id gnl|my_center|LOCUS_05170 253506 253757 gene locus_tag LOCUS_05180 gene hfq 253506 253757 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007591126.1 protein_id gnl|my_center|LOCUS_05180 253759 255153 gene locus_tag LOCUS_05190 gene hflX 253759 255153 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967571.1 protein_id gnl|my_center|LOCUS_05190 256026 255160 gene locus_tag LOCUS_05200 gene mazG 256026 255160 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531500.1 protein_id gnl|my_center|LOCUS_05200 256915 256115 gene locus_tag LOCUS_05210 256915 256115 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087285.1 protein_id gnl|my_center|LOCUS_05210 257707 256934 gene locus_tag LOCUS_05220 257707 256934 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_05220 259260 257704 gene locus_tag LOCUS_05230 gene metG 259260 257704 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097532087.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05230 260329 259298 gene locus_tag LOCUS_05240 260329 259298 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087288.1 protein_id gnl|my_center|LOCUS_05240 261042 260326 gene locus_tag LOCUS_05250 gene tmk 261042 260326 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087289.1 protein_id gnl|my_center|LOCUS_05250 262279 261044 gene locus_tag LOCUS_05260 262279 261044 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967564.1 protein_id gnl|my_center|LOCUS_05260 263412 262357 gene locus_tag LOCUS_05270 263412 262357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 263315 263635 gene locus_tag LOCUS_05280 263315 263635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 265042 263687 gene locus_tag LOCUS_05290 265042 263687 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389047.1 protein_id gnl|my_center|LOCUS_05290 265727 265047 gene locus_tag LOCUS_05300 265727 265047 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389046.1 protein_id gnl|my_center|LOCUS_05300 266175 265717 gene locus_tag LOCUS_05310 266175 265717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389045.1 protein_id gnl|my_center|LOCUS_05310 267988 266246 gene locus_tag LOCUS_05320 267988 266246 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389044.1 protein_id gnl|my_center|LOCUS_05320 269023 268058 gene locus_tag LOCUS_05330 269023 268058 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087474.1 protein_id gnl|my_center|LOCUS_05330 269598 269020 gene locus_tag LOCUS_05340 269598 269020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 270575 269613 gene locus_tag LOCUS_05350 270575 269613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 271132 270572 gene locus_tag LOCUS_05360 271132 270572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 272196 271129 gene locus_tag LOCUS_05370 272196 271129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 273224 272223 gene locus_tag LOCUS_05380 273224 272223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 274085 273225 gene locus_tag LOCUS_05390 274085 273225 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_05390 275113 274082 gene locus_tag LOCUS_05400 275113 274082 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038330.1 protein_id gnl|my_center|LOCUS_05400 275633 275316 gene locus_tag LOCUS_05410 275633 275316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 276251 275673 gene locus_tag LOCUS_05420 276251 275673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 277193 276324 gene locus_tag LOCUS_05430 277193 276324 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966732.1 protein_id gnl|my_center|LOCUS_05430 279267 277363 gene locus_tag LOCUS_05440 279267 277363 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719727.1 protein_id gnl|my_center|LOCUS_05440 279713 280294 gene locus_tag LOCUS_05450 279713 280294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 280291 281751 gene locus_tag LOCUS_05460 280291 281751 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966731.1 protein_id gnl|my_center|LOCUS_05460 281748 282407 gene locus_tag LOCUS_05470 281748 282407 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083999.1 protein_id gnl|my_center|LOCUS_05470 284891 282429 gene locus_tag LOCUS_05480 284891 282429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 285270 285554 gene locus_tag LOCUS_05490 285270 285554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 285796 285996 gene locus_tag LOCUS_05500 285796 285996 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_05500 286008 286904 gene locus_tag LOCUS_05510 286008 286904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 286910 287260 gene locus_tag LOCUS_05520 286910 287260 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975757.1 protein_id gnl|my_center|LOCUS_05520 287257 287685 gene locus_tag LOCUS_05530 287257 287685 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038731.1 protein_id gnl|my_center|LOCUS_05530 287687 288112 gene locus_tag LOCUS_05540 287687 288112 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 protein_id gnl|my_center|LOCUS_05540 289675 288296 gene locus_tag LOCUS_05550 289675 288296 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532939.1 protein_id gnl|my_center|LOCUS_05550 289973 291727 gene locus_tag LOCUS_05560 289973 291727 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398965.1 protein_id gnl|my_center|LOCUS_05560 291727 293088 gene locus_tag LOCUS_05570 291727 293088 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532937.1 protein_id gnl|my_center|LOCUS_05570 295206 293134 gene locus_tag LOCUS_05580 295206 293134 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530644.1 protein_id gnl|my_center|LOCUS_05580 296229 295228 gene locus_tag LOCUS_05590 296229 295228 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_05590 300313 296333 gene locus_tag LOCUS_05600 300313 296333 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257407.1 protein_id gnl|my_center|LOCUS_05600 301435 300449 gene locus_tag LOCUS_05610 301435 300449 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816010.1 protein_id gnl|my_center|LOCUS_05610 302012 301644 gene locus_tag LOCUS_05620 302012 301644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 303424 302036 gene locus_tag LOCUS_05630 303424 302036 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_05630 304161 303424 gene locus_tag LOCUS_05640 304161 303424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 305645 304158 gene locus_tag LOCUS_05650 305645 304158 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401360.1 protein_id gnl|my_center|LOCUS_05650 307219 305675 gene locus_tag LOCUS_05660 307219 305675 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528938.1 protein_id gnl|my_center|LOCUS_05660 308298 307231 gene locus_tag LOCUS_05670 308298 307231 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_05670 308642 308295 gene locus_tag LOCUS_05680 308642 308295 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528939.1 protein_id gnl|my_center|LOCUS_05680 309011 308652 gene locus_tag LOCUS_05690 309011 308652 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528941.1 protein_id gnl|my_center|LOCUS_05690 310291 309017 gene locus_tag LOCUS_05700 310291 309017 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528942.1 protein_id gnl|my_center|LOCUS_05700 311409 310354 gene locus_tag LOCUS_05710 311409 310354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528943.1 protein_id gnl|my_center|LOCUS_05710 312197 311406 gene locus_tag LOCUS_05720 312197 311406 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528944.1 protein_id gnl|my_center|LOCUS_05720 313056 312190 gene locus_tag LOCUS_05730 313056 312190 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528945.1 protein_id gnl|my_center|LOCUS_05730 314204 313158 gene locus_tag LOCUS_05740 314204 313158 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528946.1 protein_id gnl|my_center|LOCUS_05740 314369 315328 gene locus_tag LOCUS_05750 314369 315328 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528947.1 protein_id gnl|my_center|LOCUS_05750 315325 316608 gene locus_tag LOCUS_05760 315325 316608 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528948.1 protein_id gnl|my_center|LOCUS_05760 317325 316618 gene locus_tag LOCUS_05770 317325 316618 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216352.1 protein_id gnl|my_center|LOCUS_05770 317446 318147 gene locus_tag LOCUS_05780 gene deoC 317446 318147 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436656.1 protein_id gnl|my_center|LOCUS_05780 318209 319255 gene locus_tag LOCUS_05790 318209 319255 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389957.1 protein_id gnl|my_center|LOCUS_05790 319398 320894 gene locus_tag LOCUS_05800 319398 320894 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339570.1 protein_id gnl|my_center|LOCUS_05800 320894 321865 gene locus_tag LOCUS_05810 320894 321865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974215.1 protein_id gnl|my_center|LOCUS_05810 321880 322875 gene locus_tag LOCUS_05820 321880 322875 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974216.1 protein_id gnl|my_center|LOCUS_05820 322872 323948 gene locus_tag LOCUS_05830 322872 323948 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389953.1 protein_id gnl|my_center|LOCUS_05830 323993 324910 gene locus_tag LOCUS_05840 gene rbsK 323993 324910 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389952.1 protein_id gnl|my_center|LOCUS_05840 325024 324935 gene locus_tag LOCUS_t00090 325024 324935 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 325918 325181 gene locus_tag LOCUS_05850 325918 325181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 326394 326125 gene locus_tag LOCUS_05860 326394 326125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 326958 327524 gene locus_tag LOCUS_05870 326958 327524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549603.1 protein_id gnl|my_center|LOCUS_05870 327653 327982 gene locus_tag LOCUS_05880 327653 327982 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721013.1 protein_id gnl|my_center|LOCUS_05880 328092 329447 gene locus_tag LOCUS_05890 gene rimO 328092 329447 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087346.1 protein_id gnl|my_center|LOCUS_05890 330249 329485 gene locus_tag LOCUS_05900 330249 329485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 331492 330269 gene locus_tag LOCUS_05910 331492 330269 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_05910 332769 331489 gene locus_tag LOCUS_05920 332769 331489 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966724.1 protein_id gnl|my_center|LOCUS_05920 334002 332920 gene locus_tag LOCUS_05930 334002 332920 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966719.1 protein_id gnl|my_center|LOCUS_05930 335027 334104 gene locus_tag LOCUS_05940 335027 334104 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088898.1 protein_id gnl|my_center|LOCUS_05940 336096 335020 gene locus_tag LOCUS_05950 336096 335020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088897.1 protein_id gnl|my_center|LOCUS_05950 337648 336086 gene locus_tag LOCUS_05960 337648 336086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088896.1 protein_id gnl|my_center|LOCUS_05960 338808 337831 gene locus_tag LOCUS_05970 338808 337831 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015931585.1 protein_id gnl|my_center|LOCUS_05970 339598 338837 gene locus_tag LOCUS_05980 gene pcs 339598 338837 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533217.1 protein_id gnl|my_center|LOCUS_05980 339765 340976 gene locus_tag LOCUS_05990 339765 340976 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087357.1 protein_id gnl|my_center|LOCUS_05990 341940 340981 gene locus_tag LOCUS_06000 341940 340981 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087358.1 protein_id gnl|my_center|LOCUS_06000 342107 342442 gene locus_tag LOCUS_06010 gene hspQ 342107 342442 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087359.1 protein_id gnl|my_center|LOCUS_06010 343274 342522 gene locus_tag LOCUS_06020 343274 342522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 343463 345292 gene locus_tag LOCUS_06030 343463 345292 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967416.1 protein_id gnl|my_center|LOCUS_06030 345461 345787 gene locus_tag LOCUS_06040 345461 345787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 349338 345814 gene locus_tag LOCUS_06050 gene mfd 349338 345814 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087372.1 protein_id gnl|my_center|LOCUS_06050 349631 349335 gene locus_tag LOCUS_06060 349631 349335 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087373.1 protein_id gnl|my_center|LOCUS_06060 349753 351888 gene locus_tag LOCUS_06070 gene recG 349753 351888 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087374.1 protein_id gnl|my_center|LOCUS_06070 351983 352336 gene locus_tag LOCUS_06080 351983 352336 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327944.1 protein_id gnl|my_center|LOCUS_06080 352336 352935 gene locus_tag LOCUS_06090 gene mobA 352336 352935 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921607.1 protein_id gnl|my_center|LOCUS_06090 353468 352932 gene locus_tag LOCUS_06100 gene mobB 353468 352932 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_06100 353616 353888 gene locus_tag LOCUS_06110 353616 353888 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970127.1 protein_id gnl|my_center|LOCUS_06110 354449 353958 gene locus_tag LOCUS_06120 354449 353958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 354823 354527 gene locus_tag LOCUS_06130 354823 354527 CDS product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531327.1 protein_id gnl|my_center|LOCUS_06130 355098 354823 gene locus_tag LOCUS_06140 355098 354823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 355055 355591 gene locus_tag LOCUS_06150 355055 355591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 355661 356089 gene locus_tag LOCUS_06160 355661 356089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 356082 356396 gene locus_tag LOCUS_06170 356082 356396 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918542.1 protein_id gnl|my_center|LOCUS_06170 356475 358175 gene locus_tag LOCUS_06180 356475 358175 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063682649.1 protein_id gnl|my_center|LOCUS_06180 358347 359603 gene locus_tag LOCUS_06190 358347 359603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 359734 359659 gene locus_tag LOCUS_t00100 359734 359659 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 359978 360577 gene locus_tag LOCUS_06200 gene wrbA 359978 360577 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975540.1 protein_id gnl|my_center|LOCUS_06200 361859 360720 gene locus_tag LOCUS_06210 gene tgt 361859 360720 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529609.1 protein_id gnl|my_center|LOCUS_06210 362989 361856 gene locus_tag LOCUS_06220 gene queA 362989 361856 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397677.1 protein_id gnl|my_center|LOCUS_06220 363488 363024 gene locus_tag LOCUS_06230 363488 363024 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087459.1 protein_id gnl|my_center|LOCUS_06230 364084 363530 gene locus_tag LOCUS_06240 364084 363530 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531825.1 protein_id gnl|my_center|LOCUS_06240 364631 364125 gene locus_tag LOCUS_06250 gene coaD 364631 364125 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087462.1 protein_id gnl|my_center|LOCUS_06250 365296 364715 gene locus_tag LOCUS_06260 365296 364715 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929870.1 protein_id gnl|my_center|LOCUS_06260 368209 365441 gene locus_tag LOCUS_06270 gene gyrA 368209 365441 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087464.1 protein_id gnl|my_center|LOCUS_06270 368706 369332 gene locus_tag LOCUS_06280 368706 369332 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531832.1 protein_id gnl|my_center|LOCUS_06280 370139 369579 gene locus_tag LOCUS_06290 370139 369579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 370415 370579 gene locus_tag LOCUS_06300 370415 370579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 370648 373551 gene locus_tag LOCUS_06310 gene uvrA 370648 373551 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087470.1 protein_id gnl|my_center|LOCUS_06310 374898 373825 gene locus_tag LOCUS_06320 374898 373825 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087731.1 protein_id gnl|my_center|LOCUS_06320 375012 375341 gene locus_tag LOCUS_06330 375012 375341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 376869 375367 gene locus_tag LOCUS_06340 376869 375367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 378419 376938 gene locus_tag LOCUS_06350 378419 376938 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183635.1 protein_id gnl|my_center|LOCUS_06350 378731 378654 gene locus_tag LOCUS_t00110 378731 378654 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 379284 378754 gene locus_tag LOCUS_06360 379284 378754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 379438 380124 gene locus_tag LOCUS_06370 379438 380124 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534715.1 protein_id gnl|my_center|LOCUS_06370 381644 380097 gene locus_tag LOCUS_06380 381644 380097 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973601.1 protein_id gnl|my_center|LOCUS_06380 382161 382427 gene locus_tag LOCUS_06390 382161 382427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 383654 382536 gene locus_tag LOCUS_06400 383654 382536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 384004 383699 gene locus_tag LOCUS_06410 384004 383699 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171641.1 protein_id gnl|my_center|LOCUS_06410 385082 384111 gene locus_tag LOCUS_06420 385082 384111 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087781.1 protein_id gnl|my_center|LOCUS_06420 386155 385079 gene locus_tag LOCUS_06430 gene plsX 386155 385079 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391069.1 protein_id gnl|my_center|LOCUS_06430 386810 386280 gene locus_tag LOCUS_06440 386810 386280 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087783.1 protein_id gnl|my_center|LOCUS_06440 387370 386807 gene locus_tag LOCUS_06450 387370 386807 CDS product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532235.1 protein_id gnl|my_center|LOCUS_06450 387555 388082 gene locus_tag LOCUS_06460 387555 388082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 389362 388124 gene locus_tag LOCUS_06470 389362 388124 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974548.1 protein_id gnl|my_center|LOCUS_06470 390207 389443 gene locus_tag LOCUS_06480 390207 389443 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535100.1 protein_id gnl|my_center|LOCUS_06480 391305 390310 gene locus_tag LOCUS_06490 gene thiL 391305 390310 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087788.1 protein_id gnl|my_center|LOCUS_06490 391842 391342 gene locus_tag LOCUS_06500 gene nusB 391842 391342 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087789.1 protein_id gnl|my_center|LOCUS_06500 392346 391849 gene locus_tag LOCUS_06510 gene ribH 392346 391849 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087790.1 protein_id gnl|my_center|LOCUS_06510 392982 392392 gene locus_tag LOCUS_06520 392982 392392 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532248.1 protein_id gnl|my_center|LOCUS_06520 394141 392984 gene locus_tag LOCUS_06530 gene ribD 394141 392984 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087792.1 protein_id gnl|my_center|LOCUS_06530 394671 394147 gene locus_tag LOCUS_06540 gene nrdR 394671 394147 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532250.1 protein_id gnl|my_center|LOCUS_06540 395988 394681 gene locus_tag LOCUS_06550 395988 394681 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087794.1 protein_id gnl|my_center|LOCUS_06550 396208 397272 gene locus_tag LOCUS_06560 396208 397272 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529811.1 protein_id gnl|my_center|LOCUS_06560 397860 397291 gene locus_tag LOCUS_06570 397860 397291 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087797.1 protein_id gnl|my_center|LOCUS_06570 398438 398007 gene locus_tag LOCUS_06580 398438 398007 CDS product DUF6163 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312832.1 protein_id gnl|my_center|LOCUS_06580 399540 398464 gene locus_tag LOCUS_06590 399540 398464 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 protein_id gnl|my_center|LOCUS_06590 399820 400881 gene locus_tag LOCUS_06600 gene hemB 399820 400881 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966342.1 protein_id gnl|my_center|LOCUS_06600 400890 402323 gene locus_tag LOCUS_06610 400890 402323 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391276.1 protein_id gnl|my_center|LOCUS_06610 402332 403558 gene locus_tag LOCUS_06620 402332 403558 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_06620 403626 404159 gene locus_tag LOCUS_06630 403626 404159 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171628.1 protein_id gnl|my_center|LOCUS_06630 404245 404994 gene locus_tag LOCUS_06640 404245 404994 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087800.1 protein_id gnl|my_center|LOCUS_06640 407253 405022 gene locus_tag LOCUS_06650 gene parC 407253 405022 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087818.1 protein_id gnl|my_center|LOCUS_06650 407670 407873 gene locus_tag LOCUS_06660 407670 407873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 408595 407867 gene locus_tag LOCUS_06670 gene recO 408595 407867 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087819.1 protein_id gnl|my_center|LOCUS_06670 409556 408612 gene locus_tag LOCUS_06680 gene era 409556 408612 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844236.1 protein_id gnl|my_center|LOCUS_06680 410284 409553 gene locus_tag LOCUS_06690 gene rnc 410284 409553 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087822.1 protein_id gnl|my_center|LOCUS_06690 411036 410281 gene locus_tag LOCUS_06700 gene lepB 411036 410281 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087823.1 protein_id gnl|my_center|LOCUS_06700 411560 411150 gene locus_tag LOCUS_06710 gene acpS 411560 411150 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532586.1 protein_id gnl|my_center|LOCUS_06710 412341 411568 gene locus_tag LOCUS_06720 412341 411568 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087825.1 protein_id gnl|my_center|LOCUS_06720 412939 412346 gene locus_tag LOCUS_06730 gene pyrE 412939 412346 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919429.1 protein_id gnl|my_center|LOCUS_06730 413854 413018 gene locus_tag LOCUS_06740 413854 413018 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529017.1 protein_id gnl|my_center|LOCUS_06740 416350 414146 gene locus_tag LOCUS_06750 416350 414146 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087826.1 protein_id gnl|my_center|LOCUS_06750 416895 416506 gene locus_tag LOCUS_06760 gene rpoZ 416895 416506 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008133017.1 protein_id gnl|my_center|LOCUS_06760 417167 417772 gene locus_tag LOCUS_06770 417167 417772 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087827.1 protein_id gnl|my_center|LOCUS_06770 417778 418437 gene locus_tag LOCUS_06780 417778 418437 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_06780 419496 418453 gene locus_tag LOCUS_06790 gene epmA 419496 418453 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330707.1 protein_id gnl|my_center|LOCUS_06790 419621 420190 gene locus_tag LOCUS_06800 gene efp 419621 420190 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067676.1 protein_id gnl|my_center|LOCUS_06800 420734 420258 gene locus_tag LOCUS_06810 gene smpB 420734 420258 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087830.1 protein_id gnl|my_center|LOCUS_06810 421664 420774 gene locus_tag LOCUS_06820 gene dapA 421664 420774 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171604.1 protein_id gnl|my_center|LOCUS_06820 422295 422089 gene locus_tag LOCUS_06830 422295 422089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 422312 424273 gene locus_tag LOCUS_06840 422312 424273 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966353.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06840 426585 424531 gene locus_tag LOCUS_06850 426585 424531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 427989 426730 gene locus_tag LOCUS_06860 427989 426730 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968487.1 protein_id gnl|my_center|LOCUS_06860 428433 428158 gene locus_tag LOCUS_06870 428433 428158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 429159 428581 gene locus_tag LOCUS_06880 429159 428581 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112638.1 protein_id gnl|my_center|LOCUS_06880 429949 429260 gene locus_tag LOCUS_06890 429949 429260 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174443.1 protein_id gnl|my_center|LOCUS_06890 430526 430450 gene locus_tag LOCUS_t00120 430526 430450 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 430848 430543 gene locus_tag LOCUS_06900 430848 430543 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171332.1 protein_id gnl|my_center|LOCUS_06900 430972 430896 gene locus_tag LOCUS_t00130 430972 430896 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 431541 431059 gene locus_tag LOCUS_06910 431541 431059 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087183.1 protein_id gnl|my_center|LOCUS_06910 432182 431583 gene locus_tag LOCUS_06920 432182 431583 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531329.1 protein_id gnl|my_center|LOCUS_06920 433050 432334 gene locus_tag LOCUS_06930 433050 432334 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_06930 433156 433578 gene locus_tag LOCUS_06940 gene gloA 433156 433578 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531328.1 protein_id gnl|my_center|LOCUS_06940 433735 433809 gene locus_tag LOCUS_t00140 433735 433809 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 434094 434714 gene locus_tag LOCUS_06950 434094 434714 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067512.1 protein_id gnl|my_center|LOCUS_06950 434808 435677 gene locus_tag LOCUS_06960 434808 435677 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090839.1 protein_id gnl|my_center|LOCUS_06960 435768 436439 gene locus_tag LOCUS_06970 435768 436439 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 protein_id gnl|my_center|LOCUS_06970 436445 437113 gene locus_tag LOCUS_06980 436445 437113 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 protein_id gnl|my_center|LOCUS_06980 437119 437928 gene locus_tag LOCUS_06990 437119 437928 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412889.1 protein_id gnl|my_center|LOCUS_06990 437941 438849 gene locus_tag LOCUS_07000 437941 438849 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_07000 438827 440254 gene locus_tag LOCUS_07010 438827 440254 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_07010 440438 441868 gene locus_tag LOCUS_07020 440438 441868 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530546.1 protein_id gnl|my_center|LOCUS_07020 442687 441977 gene locus_tag LOCUS_07030 442687 441977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 444654 442684 gene locus_tag LOCUS_07040 gene fhuB 444654 442684 CDS product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313727.1 protein_id gnl|my_center|LOCUS_07040 445526 444654 gene locus_tag LOCUS_07050 445526 444654 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992428.1 protein_id gnl|my_center|LOCUS_07050 447604 445589 gene locus_tag LOCUS_07060 447604 445589 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813609.1 protein_id gnl|my_center|LOCUS_07060 447883 448818 gene locus_tag LOCUS_07070 447883 448818 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313724.1 protein_id gnl|my_center|LOCUS_07070 451812 448912 gene locus_tag LOCUS_07080 451812 448912 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172153.1 protein_id gnl|my_center|LOCUS_07080 452665 453945 gene locus_tag LOCUS_07090 452665 453945 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328867.1 protein_id gnl|my_center|LOCUS_07090 454623 453958 gene locus_tag LOCUS_07100 454623 453958 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243931.1 protein_id gnl|my_center|LOCUS_07100 454830 456179 gene locus_tag LOCUS_07110 454830 456179 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089468.1 protein_id gnl|my_center|LOCUS_07110 456189 457712 gene locus_tag LOCUS_07120 456189 457712 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528581.1 protein_id gnl|my_center|LOCUS_07120 457808 458824 gene locus_tag LOCUS_07130 gene dctP 457808 458824 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967084.1 protein_id gnl|my_center|LOCUS_07130 458953 459459 gene locus_tag LOCUS_07140 458953 459459 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967083.1 protein_id gnl|my_center|LOCUS_07140 459459 460778 gene locus_tag LOCUS_07150 459459 460778 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970023.1 protein_id gnl|my_center|LOCUS_07150 460958 462277 gene locus_tag LOCUS_07160 460958 462277 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731498.1 protein_id gnl|my_center|LOCUS_07160 462952 462395 gene locus_tag LOCUS_07170 462952 462395 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966016.1 protein_id gnl|my_center|LOCUS_07170 464297 462984 gene locus_tag LOCUS_07180 464297 462984 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731498.1 protein_id gnl|my_center|LOCUS_07180 464615 465748 gene locus_tag LOCUS_07190 464615 465748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 466948 465788 gene locus_tag LOCUS_07200 466948 465788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 467437 467057 gene locus_tag LOCUS_07210 467437 467057 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528522.1 protein_id gnl|my_center|LOCUS_07210 467566 467952 gene locus_tag LOCUS_07220 467566 467952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 468273 467956 gene locus_tag LOCUS_07230 468273 467956 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103070.1 protein_id gnl|my_center|LOCUS_07230 468430 469320 gene locus_tag LOCUS_07240 468430 469320 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445527.1 protein_id gnl|my_center|LOCUS_07240 470154 469324 gene locus_tag LOCUS_07250 gene eutC 470154 469324 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037405.1 protein_id gnl|my_center|LOCUS_07250 471539 470151 gene locus_tag LOCUS_07260 471539 470151 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103255.1 protein_id gnl|my_center|LOCUS_07260 471709 472455 gene locus_tag LOCUS_07270 471709 472455 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190398.1 protein_id gnl|my_center|LOCUS_07270 472574 473629 gene locus_tag LOCUS_07280 gene speB 472574 473629 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329331.1 protein_id gnl|my_center|LOCUS_07280 473626 474435 gene locus_tag LOCUS_07290 473626 474435 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763805.1 protein_id gnl|my_center|LOCUS_07290 475827 474508 gene locus_tag LOCUS_07300 gene oxlT 475827 474508 CDS product oxalate/formate MFS antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085933.1 protein_id gnl|my_center|LOCUS_07300 476455 476598 gene locus_tag LOCUS_07310 476455 476598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 476730 478079 gene locus_tag LOCUS_07320 476730 478079 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626527.1 protein_id gnl|my_center|LOCUS_07320 479582 478095 gene locus_tag LOCUS_07330 479582 478095 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070148.1 protein_id gnl|my_center|LOCUS_07330 481083 479752 gene locus_tag LOCUS_07340 481083 479752 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_07340 481601 481083 gene locus_tag LOCUS_07350 481601 481083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 482783 481773 gene locus_tag LOCUS_07360 482783 481773 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809579.1 protein_id gnl|my_center|LOCUS_07360 483624 482830 gene locus_tag LOCUS_07370 483624 482830 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089227.1 protein_id gnl|my_center|LOCUS_07370 484493 483621 gene locus_tag LOCUS_07380 484493 483621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089228.1 protein_id gnl|my_center|LOCUS_07380 485657 484713 gene locus_tag LOCUS_07390 485657 484713 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807822.1 protein_id gnl|my_center|LOCUS_07390 486886 485654 gene locus_tag LOCUS_07400 486886 485654 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129868.1 protein_id gnl|my_center|LOCUS_07400 488301 487045 gene locus_tag LOCUS_07410 488301 487045 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968534.1 protein_id gnl|my_center|LOCUS_07410 488672 488301 gene locus_tag LOCUS_07420 488672 488301 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089906.1 protein_id gnl|my_center|LOCUS_07420 489008 488700 gene locus_tag LOCUS_07430 489008 488700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 490096 489014 gene locus_tag LOCUS_07440 490096 489014 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_07440 490522 490109 gene locus_tag LOCUS_07450 490522 490109 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921478.1 protein_id gnl|my_center|LOCUS_07450 490735 491184 gene locus_tag LOCUS_07460 490735 491184 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970037.1 protein_id gnl|my_center|LOCUS_07460 491384 492331 gene locus_tag LOCUS_07470 491384 492331 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086660.1 protein_id gnl|my_center|LOCUS_07470 492386 492868 gene locus_tag LOCUS_07480 492386 492868 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_07480 493362 493108 gene locus_tag LOCUS_07490 493362 493108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 494285 493497 gene locus_tag LOCUS_07500 494285 493497 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 protein_id gnl|my_center|LOCUS_07500 495428 494346 gene locus_tag LOCUS_07510 495428 494346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_07510 496234 495434 gene locus_tag LOCUS_07520 496234 495434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531381.1 protein_id gnl|my_center|LOCUS_07520 497148 496237 gene locus_tag LOCUS_07530 497148 496237 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975256.1 protein_id gnl|my_center|LOCUS_07530 498383 497220 gene locus_tag LOCUS_07540 498383 497220 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388773.1 protein_id gnl|my_center|LOCUS_07540 498947 498471 gene locus_tag LOCUS_07550 498947 498471 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_07550 500845 499058 gene locus_tag LOCUS_07560 500845 499058 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720819.1 protein_id gnl|my_center|LOCUS_07560 502929 500857 gene locus_tag LOCUS_07570 502929 500857 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258127.1 protein_id gnl|my_center|LOCUS_07570 503714 503001 gene locus_tag LOCUS_07580 503714 503001 CDS product N-carbamoylsarcosine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 protein_id gnl|my_center|LOCUS_07580 503936 504847 gene locus_tag LOCUS_07590 503936 504847 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064418.1 protein_id gnl|my_center|LOCUS_07590 505027 504936 gene locus_tag LOCUS_t00150 505027 504936 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 506131 505418 gene locus_tag LOCUS_07600 506131 505418 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974864.1 protein_id gnl|my_center|LOCUS_07600 506445 506678 gene locus_tag LOCUS_07610 506445 506678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 506866 507483 gene locus_tag LOCUS_07620 506866 507483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 508054 507515 gene locus_tag LOCUS_07630 508054 507515 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312626.1 protein_id gnl|my_center|LOCUS_07630 509705 508212 gene locus_tag LOCUS_07640 gene gatB 509705 508212 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975137.1 protein_id gnl|my_center|LOCUS_07640 510001 511698 gene locus_tag LOCUS_07650 510001 511698 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706381.1 protein_id gnl|my_center|LOCUS_07650 511800 512099 gene locus_tag LOCUS_07660 511800 512099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 512250 513398 gene locus_tag LOCUS_07670 512250 513398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 513773 513477 gene locus_tag LOCUS_07680 513773 513477 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561857.1 protein_id gnl|my_center|LOCUS_07680 515254 513773 gene locus_tag LOCUS_07690 gene gatA 515254 513773 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087849.1 protein_id gnl|my_center|LOCUS_07690 515547 515260 gene locus_tag LOCUS_07700 gene gatC 515547 515260 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531787.1 protein_id gnl|my_center|LOCUS_07700 516008 515712 gene locus_tag LOCUS_07710 516008 515712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 516373 516035 gene locus_tag LOCUS_07720 516373 516035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 516510 517442 gene locus_tag LOCUS_07730 516510 517442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 518179 517475 gene locus_tag LOCUS_07740 518179 517475 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401541.1 protein_id gnl|my_center|LOCUS_07740 519528 518263 gene locus_tag LOCUS_07750 519528 518263 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388134.1 protein_id gnl|my_center|LOCUS_07750 519598 520041 gene locus_tag LOCUS_07760 519598 520041 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388135.1 protein_id gnl|my_center|LOCUS_07760 520241 520723 gene locus_tag LOCUS_07770 gene ruvX 520241 520723 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171591.1 protein_id gnl|my_center|LOCUS_07770 520741 521673 gene locus_tag LOCUS_07780 520741 521673 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087855.1 protein_id gnl|my_center|LOCUS_07780 522140 521739 gene locus_tag LOCUS_07790 522140 521739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 522319 523272 gene locus_tag LOCUS_07800 522319 523272 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087859.1 protein_id gnl|my_center|LOCUS_07800 523265 524563 gene locus_tag LOCUS_07810 523265 524563 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171586.1 protein_id gnl|my_center|LOCUS_07810 524615 525220 gene locus_tag LOCUS_07820 gene plsY 524615 525220 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256563.1 protein_id gnl|my_center|LOCUS_07820 525224 526342 gene locus_tag LOCUS_07830 gene dprA 525224 526342 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971531.1 protein_id gnl|my_center|LOCUS_07830 526545 526339 gene locus_tag LOCUS_07840 526545 526339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 526828 529521 gene locus_tag LOCUS_07850 gene topA 526828 529521 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966363.1 protein_id gnl|my_center|LOCUS_07850 531060 529582 gene locus_tag LOCUS_07860 531060 529582 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921435.1 protein_id gnl|my_center|LOCUS_07860 531228 533549 gene locus_tag LOCUS_07870 gene rnr 531228 533549 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087872.1 protein_id gnl|my_center|LOCUS_07870 533568 534035 gene locus_tag LOCUS_07880 533568 534035 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533690.1 protein_id gnl|my_center|LOCUS_07880 534079 534819 gene locus_tag LOCUS_07890 534079 534819 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087874.1 protein_id gnl|my_center|LOCUS_07890 534954 536111 gene locus_tag LOCUS_07900 534954 536111 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537639.1 protein_id gnl|my_center|LOCUS_07900 536232 536399 gene locus_tag LOCUS_07910 gene rpmG 536232 536399 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603295.1 protein_id gnl|my_center|LOCUS_07910 537061 536690 gene locus_tag LOCUS_07920 537061 536690 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603272.1 protein_id gnl|my_center|LOCUS_07920 537180 537482 gene locus_tag LOCUS_07930 537180 537482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 537499 538851 gene locus_tag LOCUS_07940 537499 538851 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087884.1 protein_id gnl|my_center|LOCUS_07940 539635 538808 gene locus_tag LOCUS_07950 539635 538808 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531768.1 protein_id gnl|my_center|LOCUS_07950 539783 540244 gene locus_tag LOCUS_07960 539783 540244 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467599.1 protein_id gnl|my_center|LOCUS_07960 540250 541014 gene locus_tag LOCUS_07970 540250 541014 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087891.1 protein_id gnl|my_center|LOCUS_07970 541411 542430 gene locus_tag LOCUS_07980 541411 542430 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087892.1 protein_id gnl|my_center|LOCUS_07980 542479 542901 gene locus_tag LOCUS_07990 542479 542901 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087893.1 protein_id gnl|my_center|LOCUS_07990 543224 542907 gene locus_tag LOCUS_08000 543224 542907 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087895.1 protein_id gnl|my_center|LOCUS_08000 543997 543254 gene locus_tag LOCUS_08010 543997 543254 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087896.1 protein_id gnl|my_center|LOCUS_08010 546628 544169 gene locus_tag LOCUS_08020 gene clpA 546628 544169 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087911.1 protein_id gnl|my_center|LOCUS_08020 547031 546660 gene locus_tag LOCUS_08030 gene clpS 547031 546660 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535011.1 protein_id gnl|my_center|LOCUS_08030 547681 547346 gene locus_tag LOCUS_08040 547681 547346 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531776.1 protein_id gnl|my_center|LOCUS_08040 548037 549704 gene locus_tag LOCUS_08050 548037 549704 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087914.1 protein_id gnl|my_center|LOCUS_08050 550412 549714 gene locus_tag LOCUS_08060 550412 549714 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087915.1 protein_id gnl|my_center|LOCUS_08060 551137 550409 gene locus_tag LOCUS_08070 551137 550409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_08070 551267 552124 gene locus_tag LOCUS_08080 gene panC 551267 552124 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087920.1 protein_id gnl|my_center|LOCUS_08080 552298 552128 gene locus_tag LOCUS_08090 552298 552128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 552792 552358 gene locus_tag LOCUS_08100 552792 552358 CDS product DUF1489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531780.1 protein_id gnl|my_center|LOCUS_08100 553497 552823 gene locus_tag LOCUS_08110 553497 552823 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970529.1 protein_id gnl|my_center|LOCUS_08110 553843 553715 gene locus_tag LOCUS_08120 553843 553715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 554120 554818 gene locus_tag LOCUS_08130 554120 554818 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087926.1 protein_id gnl|my_center|LOCUS_08130 554815 555126 gene locus_tag LOCUS_08140 554815 555126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 555933 555142 gene locus_tag LOCUS_08150 555933 555142 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535747.1 protein_id gnl|my_center|LOCUS_08150 558203 555948 gene locus_tag LOCUS_08160 558203 555948 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918742.1 protein_id gnl|my_center|LOCUS_08160 559753 558347 gene locus_tag LOCUS_08170 gene mgtE 559753 558347 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088007.1 protein_id gnl|my_center|LOCUS_08170 559890 560177 gene locus_tag LOCUS_08180 559890 560177 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088021.1 protein_id gnl|my_center|LOCUS_08180 560899 560174 gene locus_tag LOCUS_08190 gene lipB 560899 560174 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531111.1 protein_id gnl|my_center|LOCUS_08190 561070 561154 gene locus_tag LOCUS_t00160 561070 561154 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 561964 561290 gene locus_tag LOCUS_08200 561964 561290 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967985.1 protein_id gnl|my_center|LOCUS_08200 561860 562105 gene locus_tag LOCUS_08210 561860 562105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 563477 562149 gene locus_tag LOCUS_08220 563477 562149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 564957 563878 gene locus_tag LOCUS_08230 564957 563878 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088122.1 protein_id gnl|my_center|LOCUS_08230 565389 565006 gene locus_tag LOCUS_08240 gene crcB 565389 565006 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253076.1 protein_id gnl|my_center|LOCUS_08240 566725 565409 gene locus_tag LOCUS_08250 566725 565409 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088123.1 protein_id gnl|my_center|LOCUS_08250 568301 566733 gene locus_tag LOCUS_08260 568301 566733 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967063.1 protein_id gnl|my_center|LOCUS_08260 568749 568321 gene locus_tag LOCUS_08270 gene rplQ 568749 568321 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707774.1 protein_id gnl|my_center|LOCUS_08270 569839 568823 gene locus_tag LOCUS_08280 569839 568823 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088132.1 protein_id gnl|my_center|LOCUS_08280 570359 569970 gene locus_tag LOCUS_08290 gene rpsK 570359 569970 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536496.1 protein_id gnl|my_center|LOCUS_08290 570843 570475 gene locus_tag LOCUS_08300 gene rpsM 570843 570475 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531437.1 protein_id gnl|my_center|LOCUS_08300 571612 571028 gene locus_tag LOCUS_08310 571612 571028 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328075.1 protein_id gnl|my_center|LOCUS_08310 572940 571609 gene locus_tag LOCUS_08320 gene secY 572940 571609 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088135.1 protein_id gnl|my_center|LOCUS_08320 573487 572996 gene locus_tag LOCUS_08330 gene rplO 573487 572996 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313981.1 protein_id gnl|my_center|LOCUS_08330 573701 573510 gene locus_tag LOCUS_08340 gene rpmD 573701 573510 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495212.1 protein_id gnl|my_center|LOCUS_08340 574278 573727 gene locus_tag LOCUS_08350 gene rpsE 574278 573727 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136332.1 protein_id gnl|my_center|LOCUS_08350 574682 574320 gene locus_tag LOCUS_08360 gene rplR 574682 574320 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313980.1 protein_id gnl|my_center|LOCUS_08360 575228 574695 gene locus_tag LOCUS_08370 gene rplF 575228 574695 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088138.1 protein_id gnl|my_center|LOCUS_08370 575648 575250 gene locus_tag LOCUS_08380 gene rpsH 575648 575250 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088139.1 protein_id gnl|my_center|LOCUS_08380 575967 575662 gene locus_tag LOCUS_08390 gene rpsN 575967 575662 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919140.1 protein_id gnl|my_center|LOCUS_08390 576582 576025 gene locus_tag LOCUS_08400 gene rplE 576582 576025 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975179.1 protein_id gnl|my_center|LOCUS_08400 576892 576575 gene locus_tag LOCUS_08410 gene rplX 576892 576575 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531428.1 protein_id gnl|my_center|LOCUS_08410 577260 576892 gene locus_tag LOCUS_08420 gene rplN 577260 576892 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495199.1 protein_id gnl|my_center|LOCUS_08420 577583 577335 gene locus_tag LOCUS_08430 gene rpsQ 577583 577335 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088143.1 protein_id gnl|my_center|LOCUS_08430 577803 577594 gene locus_tag LOCUS_08440 gene rpmC 577803 577594 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205459.1 protein_id gnl|my_center|LOCUS_08440 578228 577815 gene locus_tag LOCUS_08450 gene rplP 578228 577815 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390431.1 protein_id gnl|my_center|LOCUS_08450 578965 578258 gene locus_tag LOCUS_08460 gene rpsC 578965 578258 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088146.1 protein_id gnl|my_center|LOCUS_08460 579345 578965 gene locus_tag LOCUS_08470 gene rplV 579345 578965 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205462.1 protein_id gnl|my_center|LOCUS_08470 579634 579356 gene locus_tag LOCUS_08480 gene rpsS 579634 579356 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002964358.1 protein_id gnl|my_center|LOCUS_08480 580485 579652 gene locus_tag LOCUS_08490 gene rplB 580485 579652 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088148.1 protein_id gnl|my_center|LOCUS_08490 580804 580508 gene locus_tag LOCUS_08500 580804 580508 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088149.1 protein_id gnl|my_center|LOCUS_08500 581421 580801 gene locus_tag LOCUS_08510 gene rplD 581421 580801 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088150.1 protein_id gnl|my_center|LOCUS_08510 582152 581421 gene locus_tag LOCUS_08520 gene rplC 582152 581421 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088151.1 protein_id gnl|my_center|LOCUS_08520 582483 582175 gene locus_tag LOCUS_08530 gene rpsJ 582483 582175 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507767.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence07 1702 647 gene locus_tag LOCUS_08540 1702 647 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965507.1 protein_id gnl|my_center|LOCUS_08540 2169 1813 gene locus_tag LOCUS_08550 2169 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 3556 2189 gene locus_tag LOCUS_08560 3556 2189 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921144.1 protein_id gnl|my_center|LOCUS_08560 4140 3643 gene locus_tag LOCUS_08570 4140 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 5189 4233 gene locus_tag LOCUS_08580 5189 4233 CDS product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173040.1 protein_id gnl|my_center|LOCUS_08580 5942 5514 gene locus_tag LOCUS_08590 gene mscL 5942 5514 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970958.1 protein_id gnl|my_center|LOCUS_08590 6981 6610 gene locus_tag LOCUS_08600 6981 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 7370 7155 gene locus_tag LOCUS_08610 7370 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 7569 11120 gene locus_tag LOCUS_08620 7569 11120 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084017.1 protein_id gnl|my_center|LOCUS_08620 11495 11136 gene locus_tag LOCUS_08630 11495 11136 CDS product DUF3088 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084105.1 protein_id gnl|my_center|LOCUS_08630 12196 11528 gene locus_tag LOCUS_08640 12196 11528 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084012.1 protein_id gnl|my_center|LOCUS_08640 12783 12319 gene locus_tag LOCUS_08650 12783 12319 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173696.1 protein_id gnl|my_center|LOCUS_08650 13008 12802 gene locus_tag LOCUS_08660 13008 12802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 12902 13894 gene locus_tag LOCUS_08670 12902 13894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 14474 13920 gene locus_tag LOCUS_08680 14474 13920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 15133 14519 gene locus_tag LOCUS_08690 15133 14519 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 protein_id gnl|my_center|LOCUS_08690 15753 15319 gene locus_tag LOCUS_08700 15753 15319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 16265 19576 gene locus_tag LOCUS_08710 16265 19576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 20326 19610 gene locus_tag LOCUS_08720 gene pdeM 20326 19610 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000237.1 protein_id gnl|my_center|LOCUS_08720 22829 20301 gene locus_tag LOCUS_08730 22829 20301 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171190.1 protein_id gnl|my_center|LOCUS_08730 23513 23046 gene locus_tag LOCUS_08740 23513 23046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 24157 23510 gene locus_tag LOCUS_08750 24157 23510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 25235 24279 gene locus_tag LOCUS_08760 25235 24279 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083965.1 protein_id gnl|my_center|LOCUS_08760 25295 26359 gene locus_tag LOCUS_08770 25295 26359 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527947.1 protein_id gnl|my_center|LOCUS_08770 26539 28128 gene locus_tag LOCUS_08780 26539 28128 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083963.1 protein_id gnl|my_center|LOCUS_08780 29659 28106 gene locus_tag LOCUS_08790 29659 28106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 29838 30107 gene locus_tag LOCUS_08800 29838 30107 CDS product DUF6460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172810.1 protein_id gnl|my_center|LOCUS_08800 30189 30710 gene locus_tag LOCUS_08810 30189 30710 CDS product c-type cytochrome, methanol metabolism-related inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088954.1 protein_id gnl|my_center|LOCUS_08810 31807 30731 gene locus_tag LOCUS_08820 31807 30731 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083959.1 protein_id gnl|my_center|LOCUS_08820 32170 31811 gene locus_tag LOCUS_08830 32170 31811 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173552.1 protein_id gnl|my_center|LOCUS_08830 32315 32941 gene locus_tag LOCUS_08840 32315 32941 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327211.1 protein_id gnl|my_center|LOCUS_08840 33268 33008 gene locus_tag LOCUS_08850 33268 33008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 33484 34119 gene locus_tag LOCUS_08860 33484 34119 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_08860 34620 34165 gene locus_tag LOCUS_08870 34620 34165 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064706.1 protein_id gnl|my_center|LOCUS_08870 35534 34617 gene locus_tag LOCUS_08880 gene fmt 35534 34617 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090830.1 protein_id gnl|my_center|LOCUS_08880 36123 35581 gene locus_tag LOCUS_08890 gene def 36123 35581 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090831.1 protein_id gnl|my_center|LOCUS_08890 36232 37425 gene locus_tag LOCUS_08900 gene rmuC 36232 37425 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175976.1 protein_id gnl|my_center|LOCUS_08900 37817 38716 gene locus_tag LOCUS_08910 37817 38716 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085923.1 protein_id gnl|my_center|LOCUS_08910 38827 39003 gene locus_tag LOCUS_08920 38827 39003 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089300.1 protein_id gnl|my_center|LOCUS_08920 39720 39166 gene locus_tag LOCUS_08930 39720 39166 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090521.1 protein_id gnl|my_center|LOCUS_08930 39959 39717 gene locus_tag LOCUS_08940 39959 39717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 40130 40966 gene locus_tag LOCUS_08950 40130 40966 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966151.1 protein_id gnl|my_center|LOCUS_08950 40979 42298 gene locus_tag LOCUS_08960 40979 42298 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388499.1 protein_id gnl|my_center|LOCUS_08960 42551 43012 gene locus_tag LOCUS_08970 42551 43012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 43164 43736 gene locus_tag LOCUS_08980 43164 43736 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973607.1 protein_id gnl|my_center|LOCUS_08980 43954 46749 gene locus_tag LOCUS_08990 43954 46749 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965190.1 protein_id gnl|my_center|LOCUS_08990 46815 47720 gene locus_tag LOCUS_09000 46815 47720 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940938.1 protein_id gnl|my_center|LOCUS_09000 49170 47740 gene locus_tag LOCUS_09010 49170 47740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 49444 51612 gene locus_tag LOCUS_09020 49444 51612 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083732.1 protein_id gnl|my_center|LOCUS_09020 52390 51632 gene locus_tag LOCUS_09030 52390 51632 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083731.1 protein_id gnl|my_center|LOCUS_09030 53019 52516 gene locus_tag LOCUS_09040 53019 52516 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083916.1 protein_id gnl|my_center|LOCUS_09040 53474 53704 gene locus_tag LOCUS_09050 53474 53704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 53676 54884 gene locus_tag LOCUS_09060 53676 54884 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970888.1 protein_id gnl|my_center|LOCUS_09060 54881 55828 gene locus_tag LOCUS_09070 gene argF 54881 55828 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083918.1 protein_id gnl|my_center|LOCUS_09070 56001 57026 gene locus_tag LOCUS_09080 56001 57026 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083919.1 protein_id gnl|my_center|LOCUS_09080 58648 57485 gene locus_tag LOCUS_09090 gene argE 58648 57485 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064838.1 protein_id gnl|my_center|LOCUS_09090 60158 58707 gene locus_tag LOCUS_09100 60158 58707 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388889.1 protein_id gnl|my_center|LOCUS_09100 60658 60266 gene locus_tag LOCUS_09110 gene apaG 60658 60266 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172741.1 protein_id gnl|my_center|LOCUS_09110 61997 60789 gene locus_tag LOCUS_09120 61997 60789 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965254.1 protein_id gnl|my_center|LOCUS_09120 62188 63351 gene locus_tag LOCUS_09130 62188 63351 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530160.1 protein_id gnl|my_center|LOCUS_09130 64332 63373 gene locus_tag LOCUS_09140 gene nudC 64332 63373 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090845.1 protein_id gnl|my_center|LOCUS_09140 64754 64332 gene locus_tag LOCUS_09150 64754 64332 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966071.1 protein_id gnl|my_center|LOCUS_09150 64957 65910 gene locus_tag LOCUS_09160 gene pip 64957 65910 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532557.1 protein_id gnl|my_center|LOCUS_09160 66430 65930 gene locus_tag LOCUS_09170 66430 65930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 66716 66931 gene locus_tag LOCUS_09180 66716 66931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 67039 69006 gene locus_tag LOCUS_09190 67039 69006 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090838.1 protein_id gnl|my_center|LOCUS_09190 69019 69339 gene locus_tag LOCUS_09200 69019 69339 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067631.1 protein_id gnl|my_center|LOCUS_09200 71237 69501 gene locus_tag LOCUS_09210 71237 69501 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992488.1 protein_id gnl|my_center|LOCUS_09210 72410 71421 gene locus_tag LOCUS_09220 72410 71421 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_09220 73164 72451 gene locus_tag LOCUS_09230 73164 72451 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532996.1 protein_id gnl|my_center|LOCUS_09230 73903 73157 gene locus_tag LOCUS_09240 gene urtD 73903 73157 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084268.1 protein_id gnl|my_center|LOCUS_09240 74961 73903 gene locus_tag LOCUS_09250 74961 73903 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532994.1 protein_id gnl|my_center|LOCUS_09250 75851 74979 gene locus_tag LOCUS_09260 75851 74979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 77221 75983 gene locus_tag LOCUS_09270 gene urtA 77221 75983 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728738.1 protein_id gnl|my_center|LOCUS_09270 77905 77243 gene locus_tag LOCUS_09280 77905 77243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 79029 77902 gene locus_tag LOCUS_09290 79029 77902 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975893.1 protein_id gnl|my_center|LOCUS_09290 79917 79327 gene locus_tag LOCUS_09300 79917 79327 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919721.1 protein_id gnl|my_center|LOCUS_09300 83378 79950 gene locus_tag LOCUS_09310 83378 79950 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085112.1 protein_id gnl|my_center|LOCUS_09310 84776 83601 gene locus_tag LOCUS_09320 84776 83601 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921602.1 protein_id gnl|my_center|LOCUS_09320 84955 84773 gene locus_tag LOCUS_09330 84955 84773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 87258 84952 gene locus_tag LOCUS_09340 87258 84952 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085554.1 protein_id gnl|my_center|LOCUS_09340 87782 87282 gene locus_tag LOCUS_09350 87782 87282 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085553.1 protein_id gnl|my_center|LOCUS_09350 89254 87794 gene locus_tag LOCUS_09360 gene ccoG 89254 87794 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088522.1 protein_id gnl|my_center|LOCUS_09360 90383 89499 gene locus_tag LOCUS_09370 gene ccoP 90383 89499 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085551.1 protein_id gnl|my_center|LOCUS_09370 90543 90388 gene locus_tag LOCUS_09380 90543 90388 CDS product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919279.1 protein_id gnl|my_center|LOCUS_09380 91315 90554 gene locus_tag LOCUS_09390 gene ccoO 91315 90554 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971696.1 protein_id gnl|my_center|LOCUS_09390 93002 91326 gene locus_tag LOCUS_09400 gene ccoN 93002 91326 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085548.1 protein_id gnl|my_center|LOCUS_09400 93391 93699 gene locus_tag LOCUS_09410 93391 93699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083655.1 protein_id gnl|my_center|LOCUS_09410 93783 94436 gene locus_tag LOCUS_09420 gene msrA 93783 94436 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_09420 94579 95295 gene locus_tag LOCUS_09430 94579 95295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411033.1 protein_id gnl|my_center|LOCUS_09430 95431 95928 gene locus_tag LOCUS_09440 95431 95928 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383720.1 protein_id gnl|my_center|LOCUS_09440 96021 97520 gene locus_tag LOCUS_09450 gene cysG 96021 97520 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256894.1 protein_id gnl|my_center|LOCUS_09450 98921 97935 gene locus_tag LOCUS_09460 gene hisG 98921 97935 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090257.1 protein_id gnl|my_center|LOCUS_09460 100036 98918 gene locus_tag LOCUS_09470 100036 98918 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090256.1 protein_id gnl|my_center|LOCUS_09470 101067 100159 gene locus_tag LOCUS_09480 101067 100159 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974036.1 protein_id gnl|my_center|LOCUS_09480 101201 103375 gene locus_tag LOCUS_09490 gene katG 101201 103375 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444101.1 protein_id gnl|my_center|LOCUS_09490 104211 103558 gene locus_tag LOCUS_09500 104211 103558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 107260 105761 gene locus_tag LOCUS_09510 gene hisS 107260 105761 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090191.1 protein_id gnl|my_center|LOCUS_09510 108139 107342 gene locus_tag LOCUS_09520 108139 107342 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703877.1 protein_id gnl|my_center|LOCUS_09520 109286 108171 gene locus_tag LOCUS_09530 109286 108171 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813122.1 protein_id gnl|my_center|LOCUS_09530 111290 109377 gene locus_tag LOCUS_09540 111290 109377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 111555 112925 gene locus_tag LOCUS_09550 111555 112925 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530907.1 protein_id gnl|my_center|LOCUS_09550 113124 115598 gene locus_tag LOCUS_09560 gene hrpB 113124 115598 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968081.1 protein_id gnl|my_center|LOCUS_09560 115800 116024 gene locus_tag LOCUS_09570 115800 116024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 117349 116030 gene locus_tag LOCUS_09580 117349 116030 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530058.1 protein_id gnl|my_center|LOCUS_09580 117514 118626 gene locus_tag LOCUS_09590 gene aroC 117514 118626 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532800.1 protein_id gnl|my_center|LOCUS_09590 118717 120024 gene locus_tag LOCUS_09600 gene ribB 118717 120024 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974718.1 protein_id gnl|my_center|LOCUS_09600 120160 120963 gene locus_tag LOCUS_09610 120160 120963 CDS product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085427.1 protein_id gnl|my_center|LOCUS_09610 122282 120960 gene locus_tag LOCUS_09620 122282 120960 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085434.1 protein_id gnl|my_center|LOCUS_09620 123040 122279 gene locus_tag LOCUS_09630 123040 122279 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965884.1 protein_id gnl|my_center|LOCUS_09630 124987 123047 gene locus_tag LOCUS_09640 gene dxs 124987 123047 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175335.1 protein_id gnl|my_center|LOCUS_09640 125200 126462 gene locus_tag LOCUS_09650 125200 126462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384424.1 protein_id gnl|my_center|LOCUS_09650 126477 127064 gene locus_tag LOCUS_09660 126477 127064 CDS product protein-S-isoprenylcysteine O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328453.1 protein_id gnl|my_center|LOCUS_09660 127078 127329 gene locus_tag LOCUS_09670 127078 127329 CDS product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538075.1 protein_id gnl|my_center|LOCUS_09670 127766 127326 gene locus_tag LOCUS_09680 127766 127326 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532827.1 protein_id gnl|my_center|LOCUS_09680 128051 127791 gene locus_tag LOCUS_09690 128051 127791 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008132970.1 protein_id gnl|my_center|LOCUS_09690 129079 128150 gene locus_tag LOCUS_09700 129079 128150 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085438.1 protein_id gnl|my_center|LOCUS_09700 129358 130359 gene locus_tag LOCUS_09710 129358 130359 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085356.1 protein_id gnl|my_center|LOCUS_09710 130523 131818 gene locus_tag LOCUS_09720 130523 131818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 132647 132165 gene locus_tag LOCUS_09730 132647 132165 CDS product ATP synthase subunit b 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084004.1 protein_id gnl|my_center|LOCUS_09730 133275 132658 gene locus_tag LOCUS_09740 133275 132658 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532842.1 protein_id gnl|my_center|LOCUS_09740 133569 133342 gene locus_tag LOCUS_09750 133569 133342 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006206606.1 protein_id gnl|my_center|LOCUS_09750 134421 133636 gene locus_tag LOCUS_09760 134421 133636 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532843.1 protein_id gnl|my_center|LOCUS_09760 134909 134526 gene locus_tag LOCUS_09770 134909 134526 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532844.1 protein_id gnl|my_center|LOCUS_09770 138637 135185 gene locus_tag LOCUS_09780 gene smc 138637 135185 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085283.1 protein_id gnl|my_center|LOCUS_09780 138937 139488 gene locus_tag LOCUS_09790 138937 139488 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 protein_id gnl|my_center|LOCUS_09790 139620 140615 gene locus_tag LOCUS_09800 139620 140615 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938246.1 protein_id gnl|my_center|LOCUS_09800 140709 141353 gene locus_tag LOCUS_09810 140709 141353 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528311.1 protein_id gnl|my_center|LOCUS_09810 142353 141373 gene locus_tag LOCUS_09820 142353 141373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 142577 143764 gene locus_tag LOCUS_09830 142577 143764 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971153.1 protein_id gnl|my_center|LOCUS_09830 143761 144375 gene locus_tag LOCUS_09840 143761 144375 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530087.1 protein_id gnl|my_center|LOCUS_09840 144616 144428 gene locus_tag LOCUS_09850 144616 144428 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767547.1 protein_id gnl|my_center|LOCUS_09850 145787 144699 gene locus_tag LOCUS_09860 gene mutY 145787 144699 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971157.1 protein_id gnl|my_center|LOCUS_09860 145814 146449 gene locus_tag LOCUS_09870 145814 146449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 146552 147235 gene locus_tag LOCUS_09880 146552 147235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 147750 147319 gene locus_tag LOCUS_09890 147750 147319 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094613.1 protein_id gnl|my_center|LOCUS_09890 149084 147801 gene locus_tag LOCUS_09900 149084 147801 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 protein_id gnl|my_center|LOCUS_09900 149377 149961 gene locus_tag LOCUS_09910 149377 149961 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085300.1 protein_id gnl|my_center|LOCUS_09910 150540 149965 gene locus_tag LOCUS_09920 gene moaB 150540 149965 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965931.1 protein_id gnl|my_center|LOCUS_09920 151442 150549 gene locus_tag LOCUS_09930 151442 150549 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_09930 152214 151552 gene locus_tag LOCUS_09940 152214 151552 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086030.1 protein_id gnl|my_center|LOCUS_09940 153210 152278 gene locus_tag LOCUS_09950 153210 152278 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_09950 153396 154346 gene locus_tag LOCUS_09960 153396 154346 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_09960 154782 154336 gene locus_tag LOCUS_09970 154782 154336 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844779.1 protein_id gnl|my_center|LOCUS_09970 154997 155983 gene locus_tag LOCUS_09980 154997 155983 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105742760.1 protein_id gnl|my_center|LOCUS_09980 156093 157427 gene locus_tag LOCUS_09990 156093 157427 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530222.1 protein_id gnl|my_center|LOCUS_09990 157745 157464 gene locus_tag LOCUS_10000 157745 157464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 158314 157886 gene locus_tag LOCUS_10010 158314 157886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 160098 158311 gene locus_tag LOCUS_10020 160098 158311 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085850.1 protein_id gnl|my_center|LOCUS_10020 161141 160095 gene locus_tag LOCUS_10030 161141 160095 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205740.1 protein_id gnl|my_center|LOCUS_10030 161332 162147 gene locus_tag LOCUS_10040 161332 162147 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529675.1 protein_id gnl|my_center|LOCUS_10040 162543 162151 gene locus_tag LOCUS_10050 162543 162151 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844628.1 protein_id gnl|my_center|LOCUS_10050 162830 163042 gene locus_tag LOCUS_10060 162830 163042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 163708 163046 gene locus_tag LOCUS_10070 163708 163046 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390496.1 protein_id gnl|my_center|LOCUS_10070 164033 165319 gene locus_tag LOCUS_10080 164033 165319 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533665.1 protein_id gnl|my_center|LOCUS_10080 165502 166980 gene locus_tag LOCUS_10090 165502 166980 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257454.1 protein_id gnl|my_center|LOCUS_10090 166671 166601 gene locus_tag LOCUS_t00170 166671 166601 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 167415 166990 gene locus_tag LOCUS_10100 167415 166990 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063783.1 protein_id gnl|my_center|LOCUS_10100 167607 168380 gene locus_tag LOCUS_10110 gene fpr 167607 168380 CDS product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_10110 168708 168400 gene locus_tag LOCUS_10120 168708 168400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 168873 169361 gene locus_tag LOCUS_10130 168873 169361 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105221.1 protein_id gnl|my_center|LOCUS_10130 170822 169416 gene locus_tag LOCUS_10140 gene ahcY 170822 169416 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088685.1 protein_id gnl|my_center|LOCUS_10140 171347 171060 gene locus_tag LOCUS_10150 171347 171060 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090869.1 protein_id gnl|my_center|LOCUS_10150 171676 171344 gene locus_tag LOCUS_10160 171676 171344 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067454.1 protein_id gnl|my_center|LOCUS_10160 172363 171911 gene locus_tag LOCUS_10170 172363 171911 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090867.1 protein_id gnl|my_center|LOCUS_10170 174237 172363 gene locus_tag LOCUS_10180 174237 172363 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175918.1 protein_id gnl|my_center|LOCUS_10180 174943 174245 gene locus_tag LOCUS_10190 174943 174245 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008542552.1 protein_id gnl|my_center|LOCUS_10190 175089 175871 gene locus_tag LOCUS_10200 175089 175871 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090865.1 protein_id gnl|my_center|LOCUS_10200 176013 177611 gene locus_tag LOCUS_10210 176013 177611 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330413.1 protein_id gnl|my_center|LOCUS_10210 177649 178161 gene locus_tag LOCUS_10220 177649 178161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 179620 178178 gene locus_tag LOCUS_10230 179620 178178 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939629.1 protein_id gnl|my_center|LOCUS_10230 179862 180467 gene locus_tag LOCUS_10240 gene recR 179862 180467 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090836.1 protein_id gnl|my_center|LOCUS_10240 181840 180464 gene locus_tag LOCUS_10250 181840 180464 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090834.1 protein_id gnl|my_center|LOCUS_10250 182898 181978 gene locus_tag LOCUS_10260 182898 181978 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085763.1 protein_id gnl|my_center|LOCUS_10260 185416 182909 gene locus_tag LOCUS_10270 185416 182909 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085762.1 protein_id gnl|my_center|LOCUS_10270 188839 185528 gene locus_tag LOCUS_10280 188839 185528 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973386.1 protein_id gnl|my_center|LOCUS_10280 192292 189104 gene locus_tag LOCUS_10290 192292 189104 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089465.1 protein_id gnl|my_center|LOCUS_10290 193555 192344 gene locus_tag LOCUS_10300 193555 192344 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967657.1 protein_id gnl|my_center|LOCUS_10300 194271 193771 gene locus_tag LOCUS_10310 194271 193771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 194176 194523 gene locus_tag LOCUS_10320 194176 194523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 194916 195005 gene locus_tag LOCUS_t00180 194916 195005 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 196877 195183 gene locus_tag LOCUS_10330 196877 195183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 197284 196874 gene locus_tag LOCUS_10340 197284 196874 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_10340 197790 197326 gene locus_tag LOCUS_10350 197790 197326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 198053 198277 gene locus_tag LOCUS_10360 198053 198277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 199170 198283 gene locus_tag LOCUS_10370 199170 198283 CDS product IS1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081285673.1 protein_id gnl|my_center|LOCUS_10370 199285 200319 gene locus_tag LOCUS_10380 199285 200319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 200564 200316 gene locus_tag LOCUS_10390 200564 200316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 200760 200554 gene locus_tag LOCUS_10400 200760 200554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 201264 200851 gene locus_tag LOCUS_10410 201264 200851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 202654 201680 gene locus_tag LOCUS_10420 202654 201680 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992236.1 protein_id gnl|my_center|LOCUS_10420 203211 202663 gene locus_tag LOCUS_10430 203211 202663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970379.1 protein_id gnl|my_center|LOCUS_10430 203446 204429 gene locus_tag LOCUS_10440 203446 204429 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 protein_id gnl|my_center|LOCUS_10440 204531 205142 gene locus_tag LOCUS_10450 204531 205142 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391821.1 protein_id gnl|my_center|LOCUS_10450 208828 205505 gene locus_tag LOCUS_10460 208828 205505 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921044.1 protein_id gnl|my_center|LOCUS_10460 210264 208825 gene locus_tag LOCUS_10470 210264 208825 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921433.1 protein_id gnl|my_center|LOCUS_10470 211123 210269 gene locus_tag LOCUS_10480 211123 210269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085808.1 protein_id gnl|my_center|LOCUS_10480 212239 211940 gene locus_tag LOCUS_10490 212239 211940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 212327 212941 gene locus_tag LOCUS_10500 212327 212941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 212938 215697 gene locus_tag LOCUS_10510 212938 215697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 216000 215818 gene locus_tag LOCUS_10520 216000 215818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 216161 220192 gene locus_tag LOCUS_10530 216161 220192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 221202 220324 gene locus_tag LOCUS_10540 221202 220324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 221215 221511 gene locus_tag LOCUS_10550 221215 221511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 222925 223182 gene locus_tag LOCUS_10560 222925 223182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 223771 223472 gene locus_tag LOCUS_10570 223771 223472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 225054 224041 gene locus_tag LOCUS_10580 225054 224041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 226426 225047 gene locus_tag LOCUS_10590 226426 225047 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922072.1 protein_id gnl|my_center|LOCUS_10590 226855 227442 gene locus_tag LOCUS_10600 226855 227442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 229755 228556 gene locus_tag LOCUS_10610 229755 228556 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339179.1 protein_id gnl|my_center|LOCUS_10610 230381 229749 gene locus_tag LOCUS_10620 230381 229749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339178.1 protein_id gnl|my_center|LOCUS_10620 231262 230378 gene locus_tag LOCUS_10630 231262 230378 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339177.1 protein_id gnl|my_center|LOCUS_10630 232212 231259 gene locus_tag LOCUS_10640 232212 231259 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339176.1 protein_id gnl|my_center|LOCUS_10640 232550 232209 gene locus_tag LOCUS_10650 232550 232209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 233376 232537 gene locus_tag LOCUS_10660 233376 232537 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339174.1 protein_id gnl|my_center|LOCUS_10660 234320 233370 gene locus_tag LOCUS_10670 234320 233370 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339173.1 protein_id gnl|my_center|LOCUS_10670 235745 234423 gene locus_tag LOCUS_10680 235745 234423 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088433.1 protein_id gnl|my_center|LOCUS_10680 236380 235745 gene locus_tag LOCUS_10690 236380 235745 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_10690 237199 236564 gene locus_tag LOCUS_10700 237199 236564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 237226 238092 gene locus_tag LOCUS_10710 237226 238092 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112398.1 protein_id gnl|my_center|LOCUS_10710 238354 238184 gene locus_tag LOCUS_10720 238354 238184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 239010 238390 gene locus_tag LOCUS_10730 239010 238390 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967995.1 protein_id gnl|my_center|LOCUS_10730 239096 240214 gene locus_tag LOCUS_10740 239096 240214 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169995.1 protein_id gnl|my_center|LOCUS_10740 240211 243321 gene locus_tag LOCUS_10750 240211 243321 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967993.1 protein_id gnl|my_center|LOCUS_10750 243368 244174 gene locus_tag LOCUS_10760 243368 244174 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035676.1 protein_id gnl|my_center|LOCUS_10760 244651 244313 gene locus_tag LOCUS_10770 244651 244313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10770 244938 244648 gene locus_tag LOCUS_10780 244938 244648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10780 245389 244901 gene locus_tag LOCUS_10790 245389 244901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10790 246005 245496 gene locus_tag LOCUS_10800 246005 245496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10800 247013 246153 gene locus_tag LOCUS_10810 247013 246153 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815921.1 protein_id gnl|my_center|LOCUS_10810 248091 247015 gene locus_tag LOCUS_10820 248091 247015 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191832.1 protein_id gnl|my_center|LOCUS_10820 248882 248088 gene locus_tag LOCUS_10830 248882 248088 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815918.1 protein_id gnl|my_center|LOCUS_10830 249693 248884 gene locus_tag LOCUS_10840 249693 248884 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191802.1 protein_id gnl|my_center|LOCUS_10840 250779 249766 gene locus_tag LOCUS_10850 250779 249766 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402156.1 protein_id gnl|my_center|LOCUS_10850 251826 250816 gene locus_tag LOCUS_10860 251826 250816 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763739.1 protein_id gnl|my_center|LOCUS_10860 251711 252094 gene locus_tag LOCUS_10870 251711 252094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 252568 252170 gene locus_tag LOCUS_10880 252568 252170 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315324.1 protein_id gnl|my_center|LOCUS_10880 252713 253309 gene locus_tag LOCUS_10890 252713 253309 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402250.1 protein_id gnl|my_center|LOCUS_10890 256564 253526 gene locus_tag LOCUS_10900 256564 253526 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090047.1 protein_id gnl|my_center|LOCUS_10900 257652 256564 gene locus_tag LOCUS_10910 257652 256564 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965440.1 protein_id gnl|my_center|LOCUS_10910 257982 258485 gene locus_tag LOCUS_10920 257982 258485 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090050.1 protein_id gnl|my_center|LOCUS_10920 258478 258759 gene locus_tag LOCUS_10930 258478 258759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 258756 259055 gene locus_tag LOCUS_10940 258756 259055 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_10940 259067 259969 gene locus_tag LOCUS_10950 259067 259969 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090053.1 protein_id gnl|my_center|LOCUS_10950 259966 260295 gene locus_tag LOCUS_10960 259966 260295 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090054.1 protein_id gnl|my_center|LOCUS_10960 260297 261793 gene locus_tag LOCUS_10970 260297 261793 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090055.1 protein_id gnl|my_center|LOCUS_10970 261804 263435 gene locus_tag LOCUS_10980 261804 263435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 264905 263454 gene locus_tag LOCUS_10990 264905 263454 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090686.1 protein_id gnl|my_center|LOCUS_10990 265946 264909 gene locus_tag LOCUS_11000 265946 264909 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966094.1 protein_id gnl|my_center|LOCUS_11000 266204 267484 gene locus_tag LOCUS_11010 266204 267484 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267750.1 protein_id gnl|my_center|LOCUS_11010 268423 267500 gene locus_tag LOCUS_11020 268423 267500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 268349 268657 gene locus_tag LOCUS_11030 268349 268657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 268688 269698 gene locus_tag LOCUS_11040 268688 269698 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970123.1 protein_id gnl|my_center|LOCUS_11040 269989 271491 gene locus_tag LOCUS_11050 269989 271491 CDS product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090046.1 protein_id gnl|my_center|LOCUS_11050 271516 272757 gene locus_tag LOCUS_11060 271516 272757 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393556.1 protein_id gnl|my_center|LOCUS_11060 272943 274373 gene locus_tag LOCUS_11070 272943 274373 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159143.1 protein_id gnl|my_center|LOCUS_11070 274960 274418 gene locus_tag LOCUS_11080 274960 274418 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992389.1 protein_id gnl|my_center|LOCUS_11080 274883 275101 gene locus_tag LOCUS_11090 274883 275101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 275192 275476 gene locus_tag LOCUS_11100 275192 275476 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054775.1 protein_id gnl|my_center|LOCUS_11100 275476 276066 gene locus_tag LOCUS_11110 275476 276066 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704514.1 protein_id gnl|my_center|LOCUS_11110 276116 276763 gene locus_tag LOCUS_11120 276116 276763 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330590.1 protein_id gnl|my_center|LOCUS_11120 276817 278133 gene locus_tag LOCUS_11130 276817 278133 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456672.1 protein_id gnl|my_center|LOCUS_11130 279715 278138 gene locus_tag LOCUS_11140 279715 278138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 279989 279699 gene locus_tag LOCUS_11150 279989 279699 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 protein_id gnl|my_center|LOCUS_11150 280888 279986 gene locus_tag LOCUS_11160 280888 279986 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074278.1 protein_id gnl|my_center|LOCUS_11160 282200 281265 gene locus_tag LOCUS_11170 282200 281265 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504141.1 protein_id gnl|my_center|LOCUS_11170 282289 282969 gene locus_tag LOCUS_11180 282289 282969 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529481.1 protein_id gnl|my_center|LOCUS_11180 283048 283923 gene locus_tag LOCUS_11190 283048 283923 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172900.1 protein_id gnl|my_center|LOCUS_11190 284257 284114 gene locus_tag LOCUS_11200 284257 284114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 285064 284363 gene locus_tag LOCUS_11210 285064 284363 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141426.1 protein_id gnl|my_center|LOCUS_11210 286224 285061 gene locus_tag LOCUS_11220 286224 285061 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_11220 287456 286221 gene locus_tag LOCUS_11230 287456 286221 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383345.1 protein_id gnl|my_center|LOCUS_11230 287725 287453 gene locus_tag LOCUS_11240 287725 287453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 288001 288705 gene locus_tag LOCUS_11250 288001 288705 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966216.1 protein_id gnl|my_center|LOCUS_11250 288711 290042 gene locus_tag LOCUS_11260 288711 290042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 290127 290687 gene locus_tag LOCUS_11270 290127 290687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 291431 290757 gene locus_tag LOCUS_11280 291431 290757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 292214 292035 gene locus_tag LOCUS_11290 292214 292035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 292360 293433 gene locus_tag LOCUS_11300 292360 293433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 294263 293487 gene locus_tag LOCUS_11310 294263 293487 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254139.1 protein_id gnl|my_center|LOCUS_11310 295494 294268 gene locus_tag LOCUS_11320 295494 294268 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090672.1 protein_id gnl|my_center|LOCUS_11320 295563 296420 gene locus_tag LOCUS_11330 295563 296420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 296499 297335 gene locus_tag LOCUS_11340 gene phnC 296499 297335 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113118.1 protein_id gnl|my_center|LOCUS_11340 297328 298122 gene locus_tag LOCUS_11350 gene phnE 297328 298122 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808584.1 protein_id gnl|my_center|LOCUS_11350 298276 299274 gene locus_tag LOCUS_11360 298276 299274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 300542 299331 gene locus_tag LOCUS_11370 300542 299331 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827650.1 protein_id gnl|my_center|LOCUS_11370 301228 300731 gene locus_tag LOCUS_11380 301228 300731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 302510 301317 gene locus_tag LOCUS_11390 302510 301317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 305307 302644 gene locus_tag LOCUS_11400 305307 302644 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088995.1 protein_id gnl|my_center|LOCUS_11400 307199 305550 gene locus_tag LOCUS_11410 307199 305550 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391292.1 protein_id gnl|my_center|LOCUS_11410 310833 307381 gene locus_tag LOCUS_11420 310833 307381 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389025.1 protein_id gnl|my_center|LOCUS_11420 312093 310837 gene locus_tag LOCUS_11430 312093 310837 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_11430 312404 313402 gene locus_tag LOCUS_11440 312404 313402 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529395.1 protein_id gnl|my_center|LOCUS_11440 313841 314305 gene locus_tag LOCUS_11450 313841 314305 CDS product DUF1348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974639.1 protein_id gnl|my_center|LOCUS_11450 314308 314931 gene locus_tag LOCUS_11460 314308 314931 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974638.1 protein_id gnl|my_center|LOCUS_11460 315242 315883 gene locus_tag LOCUS_11470 315242 315883 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703862.1 protein_id gnl|my_center|LOCUS_11470 317610 315988 gene locus_tag LOCUS_11480 317610 315988 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530640.1 protein_id gnl|my_center|LOCUS_11480 317697 318179 gene locus_tag LOCUS_11490 317697 318179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 318403 319149 gene locus_tag LOCUS_11500 318403 319149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 319258 321330 gene locus_tag LOCUS_11510 319258 321330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 322509 321346 gene locus_tag LOCUS_11520 322509 321346 CDS product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028053720.1 protein_id gnl|my_center|LOCUS_11520 324239 322521 gene locus_tag LOCUS_11530 gene ngg 324239 322521 CDS product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389741.1 protein_id gnl|my_center|LOCUS_11530 325956 324259 gene locus_tag LOCUS_11540 325956 324259 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969278.1 protein_id gnl|my_center|LOCUS_11540 326480 328696 gene locus_tag LOCUS_11550 326480 328696 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268364.1 protein_id gnl|my_center|LOCUS_11550 331047 328693 gene locus_tag LOCUS_11560 331047 328693 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967157.1 protein_id gnl|my_center|LOCUS_11560 331339 332427 gene locus_tag LOCUS_11570 gene dctP 331339 332427 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_11570 332430 332975 gene locus_tag LOCUS_11580 332430 332975 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227767.1 protein_id gnl|my_center|LOCUS_11580 332965 334290 gene locus_tag LOCUS_11590 332965 334290 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_11590 334307 335908 gene locus_tag LOCUS_11600 334307 335908 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035546.1 protein_id gnl|my_center|LOCUS_11600 337540 335957 gene locus_tag LOCUS_11610 337540 335957 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_11610 340760 337587 gene locus_tag LOCUS_11620 340760 337587 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530683.1 protein_id gnl|my_center|LOCUS_11620 342063 340771 gene locus_tag LOCUS_11630 342063 340771 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530682.1 protein_id gnl|my_center|LOCUS_11630 342187 342837 gene locus_tag LOCUS_11640 342187 342837 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090680.1 protein_id gnl|my_center|LOCUS_11640 343864 342842 gene locus_tag LOCUS_11650 gene lhpD 343864 342842 CDS product bifunctional delta(1)-pyrroline-2-carboxylate/delta(1)-piperideine-2-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082545.1 protein_id gnl|my_center|LOCUS_11650 344589 343861 gene locus_tag LOCUS_11660 344589 343861 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967141.1 protein_id gnl|my_center|LOCUS_11660 344680 345300 gene locus_tag LOCUS_11670 344680 345300 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969450.1 protein_id gnl|my_center|LOCUS_11670 345297 346562 gene locus_tag LOCUS_11680 345297 346562 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969451.1 protein_id gnl|my_center|LOCUS_11680 346590 347582 gene locus_tag LOCUS_11690 346590 347582 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969452.1 protein_id gnl|my_center|LOCUS_11690 348785 347748 gene locus_tag LOCUS_11700 348785 347748 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114965.1 protein_id gnl|my_center|LOCUS_11700 350090 348987 gene locus_tag LOCUS_11710 350090 348987 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_11710 351262 350261 gene locus_tag LOCUS_11720 351262 350261 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969498.1 protein_id gnl|my_center|LOCUS_11720 352528 351275 gene locus_tag LOCUS_11730 352528 351275 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975157.1 protein_id gnl|my_center|LOCUS_11730 353583 352687 gene locus_tag LOCUS_11740 353583 352687 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529089.1 protein_id gnl|my_center|LOCUS_11740 354350 353625 gene locus_tag LOCUS_11750 354350 353625 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114964.1 protein_id gnl|my_center|LOCUS_11750 355046 354360 gene locus_tag LOCUS_11760 355046 354360 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312400.1 protein_id gnl|my_center|LOCUS_11760 355721 355059 gene locus_tag LOCUS_11770 355721 355059 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082559.1 protein_id gnl|my_center|LOCUS_11770 356628 355813 gene locus_tag LOCUS_11780 356628 355813 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974068.1 protein_id gnl|my_center|LOCUS_11780 356943 357635 gene locus_tag LOCUS_11790 356943 357635 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206385.1 protein_id gnl|my_center|LOCUS_11790 357734 359797 gene locus_tag LOCUS_11800 gene glgX 357734 359797 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113651.1 protein_id gnl|my_center|LOCUS_11800 359794 361554 gene locus_tag LOCUS_11810 gene treZ 359794 361554 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388264.1 protein_id gnl|my_center|LOCUS_11810 361554 364133 gene locus_tag LOCUS_11820 gene treY 361554 364133 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089510.1 protein_id gnl|my_center|LOCUS_11820 364339 365781 gene locus_tag LOCUS_11830 364339 365781 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921572.1 protein_id gnl|my_center|LOCUS_11830 365769 367922 gene locus_tag LOCUS_11840 gene mdoH 365769 367922 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090776.1 protein_id gnl|my_center|LOCUS_11840 368566 368003 gene locus_tag LOCUS_11850 368566 368003 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313905.1 protein_id gnl|my_center|LOCUS_11850 368949 368668 gene locus_tag LOCUS_11860 368949 368668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 370753 369020 gene locus_tag LOCUS_11870 gene poxB 370753 369020 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090021.1 protein_id gnl|my_center|LOCUS_11870 371034 372473 gene locus_tag LOCUS_11880 371034 372473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 372470 373126 gene locus_tag LOCUS_11890 372470 373126 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087542.1 protein_id gnl|my_center|LOCUS_11890 373238 373609 gene locus_tag LOCUS_11900 373238 373609 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497989.1 protein_id gnl|my_center|LOCUS_11900 373838 374356 gene locus_tag LOCUS_11910 373838 374356 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974150.1 protein_id gnl|my_center|LOCUS_11910 374421 374930 gene locus_tag LOCUS_11920 374421 374930 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833877.1 protein_id gnl|my_center|LOCUS_11920 374927 375454 gene locus_tag LOCUS_11930 374927 375454 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833874.1 protein_id gnl|my_center|LOCUS_11930 375593 377500 gene locus_tag LOCUS_11940 375593 377500 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083089.1 protein_id gnl|my_center|LOCUS_11940 378388 377504 gene locus_tag LOCUS_11950 378388 377504 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391223.1 protein_id gnl|my_center|LOCUS_11950 378508 379710 gene locus_tag LOCUS_11960 378508 379710 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391224.1 protein_id gnl|my_center|LOCUS_11960 379847 380980 gene locus_tag LOCUS_11970 379847 380980 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965135.1 protein_id gnl|my_center|LOCUS_11970 380977 382590 gene locus_tag LOCUS_11980 380977 382590 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083517.1 protein_id gnl|my_center|LOCUS_11980 382721 383551 gene locus_tag LOCUS_11990 382721 383551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 383861 384697 gene locus_tag LOCUS_12000 383861 384697 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704638.1 protein_id gnl|my_center|LOCUS_12000 385390 384755 gene locus_tag LOCUS_12010 385390 384755 CDS product NrsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529421.1 protein_id gnl|my_center|LOCUS_12010 385944 385387 gene locus_tag LOCUS_12020 385944 385387 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085822.1 protein_id gnl|my_center|LOCUS_12020 386164 386448 gene locus_tag LOCUS_12030 386164 386448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 386513 387370 gene locus_tag LOCUS_12040 386513 387370 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534478.1 protein_id gnl|my_center|LOCUS_12040 387375 388160 gene locus_tag LOCUS_12050 387375 388160 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521491.1 protein_id gnl|my_center|LOCUS_12050 388153 388605 gene locus_tag LOCUS_12060 388153 388605 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921090.1 protein_id gnl|my_center|LOCUS_12060 389844 388657 gene locus_tag LOCUS_12070 gene rhmD 389844 388657 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 protein_id gnl|my_center|LOCUS_12070 391229 389907 gene locus_tag LOCUS_12080 391229 389907 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113702.1 protein_id gnl|my_center|LOCUS_12080 392068 391343 gene locus_tag LOCUS_12090 392068 391343 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086690.1 protein_id gnl|my_center|LOCUS_12090 392958 392113 gene locus_tag LOCUS_12100 392958 392113 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703672.1 protein_id gnl|my_center|LOCUS_12100 393110 394054 gene locus_tag LOCUS_12110 393110 394054 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089050.1 protein_id gnl|my_center|LOCUS_12110 394228 395502 gene locus_tag LOCUS_12120 394228 395502 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061529.1 protein_id gnl|my_center|LOCUS_12120 395504 396838 gene locus_tag LOCUS_12130 395504 396838 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083269077.1 protein_id gnl|my_center|LOCUS_12130 396843 397961 gene locus_tag LOCUS_12140 396843 397961 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391456.1 protein_id gnl|my_center|LOCUS_12140 397988 399904 gene locus_tag LOCUS_12150 397988 399904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 400386 399886 gene locus_tag LOCUS_12160 400386 399886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 401600 400404 gene locus_tag LOCUS_12170 401600 400404 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850755.1 protein_id gnl|my_center|LOCUS_12170 402598 401597 gene locus_tag LOCUS_12180 402598 401597 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531312.1 protein_id gnl|my_center|LOCUS_12180 404532 402601 gene locus_tag LOCUS_12190 404532 402601 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975625.1 protein_id gnl|my_center|LOCUS_12190 406475 404544 gene locus_tag LOCUS_12200 406475 404544 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391463.1 protein_id gnl|my_center|LOCUS_12200 408250 406511 gene locus_tag LOCUS_12210 408250 406511 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066587.1 protein_id gnl|my_center|LOCUS_12210 408784 408260 gene locus_tag LOCUS_12220 408784 408260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 411513 408781 gene locus_tag LOCUS_12230 411513 408781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061533.1 protein_id gnl|my_center|LOCUS_12230 411617 412639 gene locus_tag LOCUS_12240 411617 412639 CDS product polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850756.1 protein_id gnl|my_center|LOCUS_12240 413048 412671 gene locus_tag LOCUS_12250 413048 412671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 414488 413136 gene locus_tag LOCUS_12260 414488 413136 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152045320.1 protein_id gnl|my_center|LOCUS_12260 415831 414578 gene locus_tag LOCUS_12270 415831 414578 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530678.1 protein_id gnl|my_center|LOCUS_12270 416592 415828 gene locus_tag LOCUS_12280 416592 415828 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530679.1 protein_id gnl|my_center|LOCUS_12280 416790 418016 gene locus_tag LOCUS_12290 416790 418016 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086489.1 protein_id gnl|my_center|LOCUS_12290 418024 420042 gene locus_tag LOCUS_12300 418024 420042 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086488.1 protein_id gnl|my_center|LOCUS_12300 421305 420046 gene locus_tag LOCUS_12310 421305 420046 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389580.1 protein_id gnl|my_center|LOCUS_12310 422281 421340 gene locus_tag LOCUS_12320 422281 421340 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 protein_id gnl|my_center|LOCUS_12320 423428 422397 gene locus_tag LOCUS_12330 423428 422397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 423872 424291 gene locus_tag LOCUS_12340 423872 424291 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088914.1 protein_id gnl|my_center|LOCUS_12340 424305 426764 gene locus_tag LOCUS_12350 gene lon 424305 426764 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088915.1 protein_id gnl|my_center|LOCUS_12350 426856 428289 gene locus_tag LOCUS_12360 426856 428289 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930806.1 protein_id gnl|my_center|LOCUS_12360 429617 428583 gene locus_tag LOCUS_12370 429617 428583 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969878.1 protein_id gnl|my_center|LOCUS_12370 429644 429895 gene locus_tag LOCUS_12380 429644 429895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 430067 430255 gene locus_tag LOCUS_12390 430067 430255 CDS product DUF2735 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314993.1 protein_id gnl|my_center|LOCUS_12390 431317 430391 gene locus_tag LOCUS_12400 431317 430391 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531363.1 protein_id gnl|my_center|LOCUS_12400 433061 431556 gene locus_tag LOCUS_12410 gene glpK 433061 431556 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084227.1 protein_id gnl|my_center|LOCUS_12410 434908 433199 gene locus_tag LOCUS_12420 434908 433199 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148771775.1 protein_id gnl|my_center|LOCUS_12420 435312 435007 gene locus_tag LOCUS_12430 435312 435007 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719814.1 protein_id gnl|my_center|LOCUS_12430 436133 435324 gene locus_tag LOCUS_12440 436133 435324 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085227.1 protein_id gnl|my_center|LOCUS_12440 437032 436130 gene locus_tag LOCUS_12450 437032 436130 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085226.1 protein_id gnl|my_center|LOCUS_12450 438129 437032 gene locus_tag LOCUS_12460 438129 437032 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085225.1 protein_id gnl|my_center|LOCUS_12460 439251 438142 gene locus_tag LOCUS_12470 439251 438142 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531812.1 protein_id gnl|my_center|LOCUS_12470 440798 439248 gene locus_tag LOCUS_12480 gene glpD 440798 439248 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085223.1 protein_id gnl|my_center|LOCUS_12480 441998 441177 gene locus_tag LOCUS_12490 441998 441177 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973507.1 protein_id gnl|my_center|LOCUS_12490 442416 444716 gene locus_tag LOCUS_12500 442416 444716 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083112.1 protein_id gnl|my_center|LOCUS_12500 444718 446133 gene locus_tag LOCUS_12510 444718 446133 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188183.1 protein_id gnl|my_center|LOCUS_12510 446136 447173 gene locus_tag LOCUS_12520 gene cydB 446136 447173 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169023.1 protein_id gnl|my_center|LOCUS_12520 447226 448386 gene locus_tag LOCUS_12530 447226 448386 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230815.1 protein_id gnl|my_center|LOCUS_12530 449668 448409 gene locus_tag LOCUS_12540 gene arsJ 449668 448409 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798948.1 protein_id gnl|my_center|LOCUS_12540 450714 449671 gene locus_tag LOCUS_12550 450714 449671 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255924.1 protein_id gnl|my_center|LOCUS_12550 452323 451067 gene locus_tag LOCUS_12560 452323 451067 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337698.1 protein_id gnl|my_center|LOCUS_12560 452649 452320 gene locus_tag LOCUS_12570 452649 452320 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530552.1 protein_id gnl|my_center|LOCUS_12570 453836 452748 gene locus_tag LOCUS_12580 gene arsB 453836 452748 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969943.1 protein_id gnl|my_center|LOCUS_12580 454292 453855 gene locus_tag LOCUS_12590 gene arsC 454292 453855 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459395.1 protein_id gnl|my_center|LOCUS_12590 454846 454304 gene locus_tag LOCUS_12600 454846 454304 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 protein_id gnl|my_center|LOCUS_12600 455210 454839 gene locus_tag LOCUS_12610 455210 454839 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969026.1 protein_id gnl|my_center|LOCUS_12610 456195 455308 gene locus_tag LOCUS_12620 456195 455308 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331465.1 protein_id gnl|my_center|LOCUS_12620 456671 456595 gene locus_tag LOCUS_t00190 456671 456595 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 458123 456804 gene locus_tag LOCUS_12630 458123 456804 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_12630 459693 458137 gene locus_tag LOCUS_12640 459693 458137 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175987.1 protein_id gnl|my_center|LOCUS_12640 460480 460614 gene locus_tag LOCUS_12650 gene rpmH 460480 460614 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531576.1 protein_id gnl|my_center|LOCUS_12650 460678 461088 gene locus_tag LOCUS_12660 460678 461088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 461078 462895 gene locus_tag LOCUS_12670 gene yidC 461078 462895 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966085.1 protein_id gnl|my_center|LOCUS_12670 462896 463579 gene locus_tag LOCUS_12680 gene yihA 462896 463579 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090821.1 protein_id gnl|my_center|LOCUS_12680 463728 464801 gene locus_tag LOCUS_12690 463728 464801 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967605.1 protein_id gnl|my_center|LOCUS_12690 465152 465586 gene locus_tag LOCUS_12700 465152 465586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966402.1 protein_id gnl|my_center|LOCUS_12700 466524 466156 gene locus_tag LOCUS_12710 466524 466156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 467123 466659 gene locus_tag LOCUS_12720 gene ptsN 467123 466659 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083550.1 protein_id gnl|my_center|LOCUS_12720 467832 467200 gene locus_tag LOCUS_12730 gene raiA 467832 467200 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083549.1 protein_id gnl|my_center|LOCUS_12730 469662 468091 gene locus_tag LOCUS_12740 gene rpoN 469662 468091 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083548.1 protein_id gnl|my_center|LOCUS_12740 470697 469726 gene locus_tag LOCUS_12750 gene lptB 470697 469726 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083547.1 protein_id gnl|my_center|LOCUS_12750 471519 470821 gene locus_tag LOCUS_12760 471519 470821 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965157.1 protein_id gnl|my_center|LOCUS_12760 472439 471591 gene locus_tag LOCUS_12770 472439 471591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 473261 472629 gene locus_tag LOCUS_12780 473261 472629 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 protein_id gnl|my_center|LOCUS_12780 474300 473347 gene locus_tag LOCUS_12790 gene ubiA 474300 473347 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090253.1 protein_id gnl|my_center|LOCUS_12790 475112 474309 gene locus_tag LOCUS_12800 475112 474309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 475392 475177 gene locus_tag LOCUS_12810 475392 475177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 475273 476046 gene locus_tag LOCUS_12820 475273 476046 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967316.1 protein_id gnl|my_center|LOCUS_12820 476410 477531 gene locus_tag LOCUS_12830 476410 477531 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173971.1 protein_id gnl|my_center|LOCUS_12830 477752 479122 gene locus_tag LOCUS_12840 477752 479122 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083983.1 protein_id gnl|my_center|LOCUS_12840 480488 479604 gene locus_tag LOCUS_12850 480488 479604 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327465.1 protein_id gnl|my_center|LOCUS_12850 480685 481032 gene locus_tag LOCUS_12860 480685 481032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 481249 482310 gene locus_tag LOCUS_12870 481249 482310 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088246.1 protein_id gnl|my_center|LOCUS_12870 483891 482491 gene locus_tag LOCUS_12880 483891 482491 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920966.1 protein_id gnl|my_center|LOCUS_12880 484094 485269 gene locus_tag LOCUS_12890 484094 485269 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971011.1 protein_id gnl|my_center|LOCUS_12890 485281 486186 gene locus_tag LOCUS_12900 485281 486186 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395250.1 protein_id gnl|my_center|LOCUS_12900 486186 487004 gene locus_tag LOCUS_12910 486186 487004 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527099.1 protein_id gnl|my_center|LOCUS_12910 487012 487407 gene locus_tag LOCUS_12920 487012 487407 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530342.1 protein_id gnl|my_center|LOCUS_12920 487477 489333 gene locus_tag LOCUS_12930 gene mutL 487477 489333 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090225.1 protein_id gnl|my_center|LOCUS_12930 489357 490640 gene locus_tag LOCUS_12940 489357 490640 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338191.1 protein_id gnl|my_center|LOCUS_12940 490648 491172 gene locus_tag LOCUS_12950 490648 491172 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211531.1 protein_id gnl|my_center|LOCUS_12950 491288 491806 gene locus_tag LOCUS_12960 491288 491806 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087757.1 protein_id gnl|my_center|LOCUS_12960 492264 492040 gene locus_tag LOCUS_12970 492264 492040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 493720 492701 gene locus_tag LOCUS_12980 gene ilvC 493720 492701 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531065.1 protein_id gnl|my_center|LOCUS_12980 494394 493744 gene locus_tag LOCUS_12990 494394 493744 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173714.1 protein_id gnl|my_center|LOCUS_12990 495412 494489 gene locus_tag LOCUS_13000 495412 494489 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257820.1 protein_id gnl|my_center|LOCUS_13000 496094 495522 gene locus_tag LOCUS_13010 gene ilvN 496094 495522 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089241.1 protein_id gnl|my_center|LOCUS_13010 497974 496214 gene locus_tag LOCUS_13020 497974 496214 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640408.1 protein_id gnl|my_center|LOCUS_13020 498308 499114 gene locus_tag LOCUS_13030 gene dapB 498308 499114 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968395.1 protein_id gnl|my_center|LOCUS_13030 499172 499795 gene locus_tag LOCUS_13040 499172 499795 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083512.1 protein_id gnl|my_center|LOCUS_13040 499839 500180 gene locus_tag LOCUS_13050 499839 500180 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720718.1 protein_id gnl|my_center|LOCUS_13050 501094 500198 gene locus_tag LOCUS_13060 501094 500198 CDS product bifunctional helix-turn-helix domain-containing protein/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529602.1 protein_id gnl|my_center|LOCUS_13060 501691 501161 gene locus_tag LOCUS_13070 501691 501161 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_13070 501714 502610 gene locus_tag LOCUS_13080 501714 502610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 503412 502618 gene locus_tag LOCUS_13090 503412 502618 CDS product sulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528050.1 protein_id gnl|my_center|LOCUS_13090 503570 504913 gene locus_tag LOCUS_13100 503570 504913 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083529.1 protein_id gnl|my_center|LOCUS_13100 507439 505034 gene locus_tag LOCUS_13110 gene pheT 507439 505034 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083531.1 protein_id gnl|my_center|LOCUS_13110 508018 507455 gene locus_tag LOCUS_13120 508018 507455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 509115 508015 gene locus_tag LOCUS_13130 gene pheS 509115 508015 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528309.1 protein_id gnl|my_center|LOCUS_13130 509721 509353 gene locus_tag LOCUS_13140 gene rplT 509721 509353 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528310.1 protein_id gnl|my_center|LOCUS_13140 509955 509755 gene locus_tag LOCUS_13150 gene rpmI 509955 509755 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008539890.1 protein_id gnl|my_center|LOCUS_13150 510994 510167 gene locus_tag LOCUS_13160 510994 510167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 511192 512064 gene locus_tag LOCUS_13170 511192 512064 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528623.1 protein_id gnl|my_center|LOCUS_13170 513172 512141 gene locus_tag LOCUS_13180 513172 512141 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968509.1 protein_id gnl|my_center|LOCUS_13180 513485 513569 gene locus_tag LOCUS_t00200 513485 513569 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 514392 513688 gene locus_tag LOCUS_13190 514392 513688 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974207.1 protein_id gnl|my_center|LOCUS_13190 516905 514407 gene locus_tag LOCUS_13200 516905 514407 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_13200 517232 518236 gene locus_tag LOCUS_13210 517232 518236 CDS product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440462.1 protein_id gnl|my_center|LOCUS_13210 518310 518687 gene locus_tag LOCUS_13220 518310 518687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 527209 518741 gene locus_tag LOCUS_13230 527209 518741 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538238.1 protein_id gnl|my_center|LOCUS_13230 527937 527677 gene locus_tag LOCUS_13240 527937 527677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970917.1 protein_id gnl|my_center|LOCUS_13240 528078 527947 gene locus_tag LOCUS_13250 528078 527947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 528499 528287 gene locus_tag LOCUS_13260 528499 528287 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010915421.1 protein_id gnl|my_center|LOCUS_13260 531146 528855 gene locus_tag LOCUS_13270 531146 528855 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640248.1 protein_id gnl|my_center|LOCUS_13270 532769 531300 gene locus_tag LOCUS_13280 gene hydA 532769 531300 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255348.1 protein_id gnl|my_center|LOCUS_13280 534031 532784 gene locus_tag LOCUS_13290 534031 532784 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992339.1 protein_id gnl|my_center|LOCUS_13290 534262 535227 gene locus_tag LOCUS_13300 534262 535227 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085984.1 protein_id gnl|my_center|LOCUS_13300 535330 536916 gene locus_tag LOCUS_13310 535330 536916 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966054.1 protein_id gnl|my_center|LOCUS_13310 536928 537935 gene locus_tag LOCUS_13320 536928 537935 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085986.1 protein_id gnl|my_center|LOCUS_13320 537935 538924 gene locus_tag LOCUS_13330 gene yjfF 537935 538924 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085987.1 protein_id gnl|my_center|LOCUS_13330 538921 539655 gene locus_tag LOCUS_13340 538921 539655 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085988.1 protein_id gnl|my_center|LOCUS_13340 539668 541416 gene locus_tag LOCUS_13350 gene araD 539668 541416 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976013.1 protein_id gnl|my_center|LOCUS_13350 541426 542355 gene locus_tag LOCUS_13360 541426 542355 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966109.1 protein_id gnl|my_center|LOCUS_13360 542441 543367 gene locus_tag LOCUS_13370 542441 543367 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085989.1 protein_id gnl|my_center|LOCUS_13370 543380 545185 gene locus_tag LOCUS_13380 543380 545185 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314796.1 protein_id gnl|my_center|LOCUS_13380 545199 546095 gene locus_tag LOCUS_13390 545199 546095 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966051.1 protein_id gnl|my_center|LOCUS_13390 546095 547021 gene locus_tag LOCUS_13400 546095 547021 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241208.1 protein_id gnl|my_center|LOCUS_13400 547018 547692 gene locus_tag LOCUS_13410 547018 547692 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974640.1 protein_id gnl|my_center|LOCUS_13410 547774 548871 gene locus_tag LOCUS_13420 gene chvE 547774 548871 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085992.1 protein_id gnl|my_center|LOCUS_13420 548934 550550 gene locus_tag LOCUS_13430 gene gguA 548934 550550 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966050.1 protein_id gnl|my_center|LOCUS_13430 550547 551734 gene locus_tag LOCUS_13440 gene gguB 550547 551734 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085994.1 protein_id gnl|my_center|LOCUS_13440 553738 551783 gene locus_tag LOCUS_13450 553738 551783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 554294 553974 gene locus_tag LOCUS_13460 gene trxA 554294 553974 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598398.1 protein_id gnl|my_center|LOCUS_13460 557787 554371 gene locus_tag LOCUS_13470 gene addA 557787 554371 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921368.1 protein_id gnl|my_center|LOCUS_13470 560840 557784 gene locus_tag LOCUS_13480 gene addB 560840 557784 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528328.1 protein_id gnl|my_center|LOCUS_13480 561602 560868 gene locus_tag LOCUS_13490 561602 560868 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083577.1 protein_id gnl|my_center|LOCUS_13490 563410 561599 gene locus_tag LOCUS_13500 563410 561599 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083579.1 protein_id gnl|my_center|LOCUS_13500 566018 563415 gene locus_tag LOCUS_13510 566018 563415 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965154.1 protein_id gnl|my_center|LOCUS_13510 567188 566163 gene locus_tag LOCUS_13520 gene cysK 567188 566163 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067744.1 protein_id gnl|my_center|LOCUS_13520 567737 567294 gene locus_tag LOCUS_13530 567737 567294 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_13530 568290 567811 gene locus_tag LOCUS_13540 gene dut 568290 567811 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_13540 569519 568287 gene locus_tag LOCUS_13550 gene coaBC 569519 568287 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083582.1 protein_id gnl|my_center|LOCUS_13550 569975 569748 gene locus_tag LOCUS_13560 569975 569748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 571564 569996 gene locus_tag LOCUS_13570 gene ubiB 571564 569996 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083583.1 protein_id gnl|my_center|LOCUS_13570 572384 571569 gene locus_tag LOCUS_13580 gene ubiE 572384 571569 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083584.1 protein_id gnl|my_center|LOCUS_13580 573493 572519 gene locus_tag LOCUS_13590 573493 572519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 574161 573652 gene locus_tag LOCUS_13600 574161 573652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174612.1 protein_id gnl|my_center|LOCUS_13600 574361 574894 gene locus_tag LOCUS_13610 574361 574894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 574898 575815 gene locus_tag LOCUS_13620 574898 575815 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530053.1 protein_id gnl|my_center|LOCUS_13620 575893 577110 gene locus_tag LOCUS_13630 575893 577110 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930653.1 protein_id gnl|my_center|LOCUS_13630 577161 579074 gene locus_tag LOCUS_13640 577161 579074 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039367.1 protein_id gnl|my_center|LOCUS_13640 579071 579823 gene locus_tag LOCUS_13650 579071 579823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810082.1 protein_id gnl|my_center|LOCUS_13650 579820 580515 gene locus_tag LOCUS_13660 579820 580515 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810083.1 protein_id gnl|my_center|LOCUS_13660 580617 581075 gene locus_tag LOCUS_13670 580617 581075 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086610.1 protein_id gnl|my_center|LOCUS_13670 581850 581077 gene locus_tag LOCUS_13680 581850 581077 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088325.1 protein_id gnl|my_center|LOCUS_13680 581973 581899 gene locus_tag LOCUS_t00210 581973 581899 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 582130 582206 gene locus_tag LOCUS_t00220 582130 582206 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 582559 582281 gene locus_tag LOCUS_13690 582559 582281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 582440 583252 gene locus_tag LOCUS_13700 582440 583252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 583819 583325 gene locus_tag LOCUS_13710 583819 583325 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531567.1 protein_id gnl|my_center|LOCUS_13710 584546 583914 gene locus_tag LOCUS_13720 584546 583914 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242643.1 protein_id gnl|my_center|LOCUS_13720 584696 585607 gene locus_tag LOCUS_13730 584696 585607 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965893.1 protein_id gnl|my_center|LOCUS_13730 586429 585644 gene locus_tag LOCUS_13740 586429 585644 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085404.1 protein_id gnl|my_center|LOCUS_13740 587147 586440 gene locus_tag LOCUS_13750 587147 586440 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527996.1 protein_id gnl|my_center|LOCUS_13750 587194 588525 gene locus_tag LOCUS_13760 587194 588525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 588628 590010 gene locus_tag LOCUS_13770 588628 590010 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_13770 590648 590136 gene locus_tag LOCUS_13780 590648 590136 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086992.1 protein_id gnl|my_center|LOCUS_13780 591033 591263 gene locus_tag LOCUS_13790 591033 591263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 591459 592433 gene locus_tag LOCUS_13800 591459 592433 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085408.1 protein_id gnl|my_center|LOCUS_13800 593201 592452 gene locus_tag LOCUS_13810 593201 592452 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085409.1 protein_id gnl|my_center|LOCUS_13810 593892 593266 gene locus_tag LOCUS_13820 gene pdxH 593892 593266 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532806.1 protein_id gnl|my_center|LOCUS_13820 593966 594430 gene locus_tag LOCUS_13830 593966 594430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 594590 595540 gene locus_tag LOCUS_13840 594590 595540 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085412.1 protein_id gnl|my_center|LOCUS_13840 595737 596561 gene locus_tag LOCUS_13850 gene fabI 595737 596561 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085415.1 protein_id gnl|my_center|LOCUS_13850 596602 597234 gene locus_tag LOCUS_13860 596602 597234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 597231 597821 gene locus_tag LOCUS_13870 597231 597821 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707099.1 protein_id gnl|my_center|LOCUS_13870 597850 599229 gene locus_tag LOCUS_13880 597850 599229 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055726633.1 protein_id gnl|my_center|LOCUS_13880 599313 599660 gene locus_tag LOCUS_13890 599313 599660 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533675.1 protein_id gnl|my_center|LOCUS_13890 599678 600529 gene locus_tag LOCUS_13900 599678 600529 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 protein_id gnl|my_center|LOCUS_13900 603280 600548 gene locus_tag LOCUS_13910 603280 600548 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207762468.1 protein_id gnl|my_center|LOCUS_13910 604265 603498 gene locus_tag LOCUS_13920 604265 603498 CDS product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723572.1 protein_id gnl|my_center|LOCUS_13920 605013 604291 gene locus_tag LOCUS_13930 605013 604291 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531512.1 protein_id gnl|my_center|LOCUS_13930 605837 605049 gene locus_tag LOCUS_13940 605837 605049 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531511.1 protein_id gnl|my_center|LOCUS_13940 606378 605821 gene locus_tag LOCUS_13950 606378 605821 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827403.1 protein_id gnl|my_center|LOCUS_13950 606503 607630 gene locus_tag LOCUS_13960 606503 607630 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083251.1 protein_id gnl|my_center|LOCUS_13960 608065 607646 gene locus_tag LOCUS_13970 608065 607646 CDS product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113677.1 protein_id gnl|my_center|LOCUS_13970 609000 608140 gene locus_tag LOCUS_13980 609000 608140 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974995.1 protein_id gnl|my_center|LOCUS_13980 609350 609072 gene locus_tag LOCUS_13990 609350 609072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 609862 609356 gene locus_tag LOCUS_14000 609862 609356 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531567.1 protein_id gnl|my_center|LOCUS_14000 611126 610224 gene locus_tag LOCUS_14010 611126 610224 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205603.1 protein_id gnl|my_center|LOCUS_14010 613282 611123 gene locus_tag LOCUS_14020 613282 611123 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556205.1 protein_id gnl|my_center|LOCUS_14020 613500 614684 gene locus_tag LOCUS_14030 613500 614684 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_14030 615452 614694 gene locus_tag LOCUS_14040 615452 614694 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338633.1 protein_id gnl|my_center|LOCUS_14040 616530 615559 gene locus_tag LOCUS_14050 gene tal 616530 615559 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309875.1 protein_id gnl|my_center|LOCUS_14050 616836 617675 gene locus_tag LOCUS_14060 616836 617675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 617686 618297 gene locus_tag LOCUS_14070 617686 618297 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550965.1 protein_id gnl|my_center|LOCUS_14070 618294 618818 gene locus_tag LOCUS_14080 618294 618818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 619535 618834 gene locus_tag LOCUS_14090 619535 618834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 619719 620045 gene locus_tag LOCUS_14100 619719 620045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 620184 620858 gene locus_tag LOCUS_14110 620184 620858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 621211 620864 gene locus_tag LOCUS_14120 621211 620864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 621910 621317 gene locus_tag LOCUS_14130 621910 621317 CDS product DUF6101 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090252.1 protein_id gnl|my_center|LOCUS_14130 622131 622946 gene locus_tag LOCUS_14140 622131 622946 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174622.1 protein_id gnl|my_center|LOCUS_14140 623012 623248 gene locus_tag LOCUS_14150 623012 623248 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532345.1 protein_id gnl|my_center|LOCUS_14150 623266 624024 gene locus_tag LOCUS_14160 623266 624024 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532344.1 protein_id gnl|my_center|LOCUS_14160 624095 625312 gene locus_tag LOCUS_14170 624095 625312 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090247.1 protein_id gnl|my_center|LOCUS_14170 625316 626326 gene locus_tag LOCUS_14180 gene lpxK 625316 626326 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090246.1 protein_id gnl|my_center|LOCUS_14180 626555 626331 gene locus_tag LOCUS_14190 626555 626331 CDS product DUF2093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090242.1 protein_id gnl|my_center|LOCUS_14190 628359 626725 gene locus_tag LOCUS_14200 gene xseA 628359 626725 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090239.1 protein_id gnl|my_center|LOCUS_14200 628752 629696 gene locus_tag LOCUS_14210 628752 629696 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085322.1 protein_id gnl|my_center|LOCUS_14210 629727 631052 gene locus_tag LOCUS_14220 629727 631052 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730167.1 protein_id gnl|my_center|LOCUS_14220 631132 633390 gene locus_tag LOCUS_14230 gene glyS 631132 633390 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384808.1 protein_id gnl|my_center|LOCUS_14230 633906 634070 gene locus_tag LOCUS_14240 633906 634070 CDS product DUF3096 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528205.1 protein_id gnl|my_center|LOCUS_14240 634546 634154 gene locus_tag LOCUS_14250 634546 634154 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214914.1 protein_id gnl|my_center|LOCUS_14250 634840 637518 gene locus_tag LOCUS_14260 gene ppdK 634840 637518 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921419.1 protein_id gnl|my_center|LOCUS_14260 637651 638079 gene locus_tag LOCUS_14270 637651 638079 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087349.1 protein_id gnl|my_center|LOCUS_14270 638015 638428 gene locus_tag LOCUS_14280 638015 638428 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191582.1 protein_id gnl|my_center|LOCUS_14280 638594 639148 gene locus_tag LOCUS_14290 638594 639148 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084104.1 protein_id gnl|my_center|LOCUS_14290 640029 639256 gene locus_tag LOCUS_14300 640029 639256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 642865 640106 gene locus_tag LOCUS_14310 gene mutS 642865 640106 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083746.1 protein_id gnl|my_center|LOCUS_14310 643446 642955 gene locus_tag LOCUS_14320 643446 642955 CDS product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083725.1 protein_id gnl|my_center|LOCUS_14320 643571 644161 gene locus_tag LOCUS_14330 643571 644161 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809301.1 protein_id gnl|my_center|LOCUS_14330 644158 644688 gene locus_tag LOCUS_14340 644158 644688 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809303.1 protein_id gnl|my_center|LOCUS_14340 646163 644694 gene locus_tag LOCUS_14350 646163 644694 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072019.1 protein_id gnl|my_center|LOCUS_14350 646345 647235 gene locus_tag LOCUS_14360 gene argB 646345 647235 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090823.1 protein_id gnl|my_center|LOCUS_14360 647412 648131 gene locus_tag LOCUS_14370 647412 648131 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090825.1 protein_id gnl|my_center|LOCUS_14370 648218 649060 gene locus_tag LOCUS_14380 gene dapD 648218 649060 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493576.1 protein_id gnl|my_center|LOCUS_14380 649122 650321 gene locus_tag LOCUS_14390 gene dapE 649122 650321 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090828.1 protein_id gnl|my_center|LOCUS_14390 650648 650325 gene locus_tag LOCUS_14400 650648 650325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 650760 651218 gene locus_tag LOCUS_14410 650760 651218 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085348.1 protein_id gnl|my_center|LOCUS_14410 651272 651667 gene locus_tag LOCUS_14420 651272 651667 CDS product TIGR02301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085347.1 protein_id gnl|my_center|LOCUS_14420 651817 652089 gene locus_tag LOCUS_14430 651817 652089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008135624.1 protein_id gnl|my_center|LOCUS_14430 652568 652098 gene locus_tag LOCUS_14440 652568 652098 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537604.1 protein_id gnl|my_center|LOCUS_14440 652939 652700 gene locus_tag LOCUS_14450 gene rpsU 652939 652700 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089854.1 protein_id gnl|my_center|LOCUS_14450 653772 653146 gene locus_tag LOCUS_14460 653772 653146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 654513 653794 gene locus_tag LOCUS_14470 gene pyrF 654513 653794 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083509.1 protein_id gnl|my_center|LOCUS_14470 655114 654533 gene locus_tag LOCUS_14480 655114 654533 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083508.1 protein_id gnl|my_center|LOCUS_14480 655903 655205 gene locus_tag LOCUS_14490 655903 655205 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598495.1 protein_id gnl|my_center|LOCUS_14490 657169 656027 gene locus_tag LOCUS_14500 gene dnaJ 657169 656027 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083507.1 protein_id gnl|my_center|LOCUS_14500 659268 657373 gene locus_tag LOCUS_14510 gene dnaK 659268 657373 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083506.1 protein_id gnl|my_center|LOCUS_14510 660761 659529 gene locus_tag LOCUS_14520 660761 659529 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328756.1 protein_id gnl|my_center|LOCUS_14520 661155 660754 gene locus_tag LOCUS_14530 661155 660754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 662180 661251 gene locus_tag LOCUS_14540 662180 661251 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970319.1 protein_id gnl|my_center|LOCUS_14540 662751 662365 gene locus_tag LOCUS_14550 662751 662365 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706237.1 protein_id gnl|my_center|LOCUS_14550 662963 663652 gene locus_tag LOCUS_14560 662963 663652 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083540.1 protein_id gnl|my_center|LOCUS_14560 663628 664779 gene locus_tag LOCUS_14570 gene queG 663628 664779 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083539.1 protein_id gnl|my_center|LOCUS_14570 664779 665648 gene locus_tag LOCUS_14580 664779 665648 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089578.1 protein_id gnl|my_center|LOCUS_14580 666445 665657 gene locus_tag LOCUS_14590 666445 665657 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089363.1 protein_id gnl|my_center|LOCUS_14590 666838 668721 gene locus_tag LOCUS_14600 666838 668721 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087463.1 protein_id gnl|my_center|LOCUS_14600 668952 670058 gene locus_tag LOCUS_14610 668952 670058 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083909.1 protein_id gnl|my_center|LOCUS_14610 670805 670170 gene locus_tag LOCUS_14620 670805 670170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 671807 670821 gene locus_tag LOCUS_14630 gene ppk2 671807 670821 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974330.1 protein_id gnl|my_center|LOCUS_14630 671926 673299 gene locus_tag LOCUS_14640 671926 673299 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083910.1 protein_id gnl|my_center|LOCUS_14640 673528 673307 gene locus_tag LOCUS_14650 673528 673307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 673449 674489 gene locus_tag LOCUS_14660 gene pstS 673449 674489 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965256.1 protein_id gnl|my_center|LOCUS_14660 674729 675700 gene locus_tag LOCUS_14670 gene pstC 674729 675700 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193912.1 protein_id gnl|my_center|LOCUS_14670 675710 676543 gene locus_tag LOCUS_14680 gene pstA 675710 676543 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_14680 676552 677373 gene locus_tag LOCUS_14690 gene pstB 676552 677373 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448479.1 protein_id gnl|my_center|LOCUS_14690 677396 678109 gene locus_tag LOCUS_14700 gene phoU 677396 678109 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083915.1 protein_id gnl|my_center|LOCUS_14700 678145 678846 gene locus_tag LOCUS_14710 gene phoB 678145 678846 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530178.1 protein_id gnl|my_center|LOCUS_14710 679057 679746 gene locus_tag LOCUS_14720 gene nthA 679057 679746 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879389.1 protein_id gnl|my_center|LOCUS_14720 679790 680497 gene locus_tag LOCUS_14730 gene nthB 679790 680497 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976132.1 protein_id gnl|my_center|LOCUS_14730 680494 680841 gene locus_tag LOCUS_14740 680494 680841 CDS product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174057.1 protein_id gnl|my_center|LOCUS_14740 681932 680847 gene locus_tag LOCUS_14750 681932 680847 CDS product trifunctional transcriptional activator/DNA repair protein Ada/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008215.1 protein_id gnl|my_center|LOCUS_14750 682779 682015 gene locus_tag LOCUS_14760 682779 682015 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226013866.1 protein_id gnl|my_center|LOCUS_14760 682915 683835 gene locus_tag LOCUS_14770 682915 683835 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974644.1 protein_id gnl|my_center|LOCUS_14770 685227 683860 gene locus_tag LOCUS_14780 gene phaZ 685227 683860 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083730.1 protein_id gnl|my_center|LOCUS_14780 685387 686790 gene locus_tag LOCUS_14790 685387 686790 CDS product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083727.1 protein_id gnl|my_center|LOCUS_14790 686905 687453 gene locus_tag LOCUS_14800 686905 687453 CDS product ActR/PrrA/RegA family redox response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463732.1 protein_id gnl|my_center|LOCUS_14800 688377 687493 gene locus_tag LOCUS_14810 688377 687493 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226033.1 protein_id gnl|my_center|LOCUS_14810 689438 688440 gene locus_tag LOCUS_14820 689438 688440 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083626.1 protein_id gnl|my_center|LOCUS_14820 689573 691099 gene locus_tag LOCUS_14830 689573 691099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 691193 692224 gene locus_tag LOCUS_14840 gene trpS 691193 692224 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083624.1 protein_id gnl|my_center|LOCUS_14840 692381 692875 gene locus_tag LOCUS_14850 692381 692875 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310195.1 protein_id gnl|my_center|LOCUS_14850 692980 693261 gene locus_tag LOCUS_14860 692980 693261 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038488.1 protein_id gnl|my_center|LOCUS_14860 693307 694434 gene locus_tag LOCUS_14870 693307 694434 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034858990.1 protein_id gnl|my_center|LOCUS_14870 694434 695279 gene locus_tag LOCUS_14880 gene fghA 694434 695279 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529901.1 protein_id gnl|my_center|LOCUS_14880 696262 695345 gene locus_tag LOCUS_14890 696262 695345 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406412.1 protein_id gnl|my_center|LOCUS_14890 697001 696294 gene locus_tag LOCUS_14900 697001 696294 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230125.1 protein_id gnl|my_center|LOCUS_14900 697132 697902 gene locus_tag LOCUS_14910 697132 697902 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839946.1 protein_id gnl|my_center|LOCUS_14910 697915 698613 gene locus_tag LOCUS_14920 697915 698613 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399868.1 protein_id gnl|my_center|LOCUS_14920 698610 699008 gene locus_tag LOCUS_14930 698610 699008 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206417.1 protein_id gnl|my_center|LOCUS_14930 700211 699168 gene locus_tag LOCUS_14940 700211 699168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929892.1 protein_id gnl|my_center|LOCUS_14940 700780 700259 gene locus_tag LOCUS_14950 700780 700259 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089744.1 protein_id gnl|my_center|LOCUS_14950 702060 700780 gene locus_tag LOCUS_14960 702060 700780 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_14960 703523 702057 gene locus_tag LOCUS_14970 703523 702057 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105036.1 protein_id gnl|my_center|LOCUS_14970 703978 703520 gene locus_tag LOCUS_14980 703978 703520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 705574 704090 gene locus_tag LOCUS_14990 gene hpaB 705574 704090 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228328.1 protein_id gnl|my_center|LOCUS_14990 706559 706098 gene locus_tag LOCUS_15000 706559 706098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529866.1 protein_id gnl|my_center|LOCUS_15000 706672 707730 gene locus_tag LOCUS_15010 706672 707730 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529867.1 protein_id gnl|my_center|LOCUS_15010 707843 709420 gene locus_tag LOCUS_15020 707843 709420 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529868.1 protein_id gnl|my_center|LOCUS_15020 709417 710532 gene locus_tag LOCUS_15030 709417 710532 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529869.1 protein_id gnl|my_center|LOCUS_15030 710545 711480 gene locus_tag LOCUS_15040 710545 711480 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529870.1 protein_id gnl|my_center|LOCUS_15040 712691 711498 gene locus_tag LOCUS_15050 712691 711498 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529872.1 protein_id gnl|my_center|LOCUS_15050 713069 713782 gene locus_tag LOCUS_15060 713069 713782 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529856.1 protein_id gnl|my_center|LOCUS_15060 713874 715427 gene locus_tag LOCUS_15070 713874 715427 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529855.1 protein_id gnl|my_center|LOCUS_15070 715880 716935 gene locus_tag LOCUS_15080 715880 716935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 716935 717678 gene locus_tag LOCUS_15090 716935 717678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 717922 718476 gene locus_tag LOCUS_15100 717922 718476 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083622.1 protein_id gnl|my_center|LOCUS_15100 718655 719338 gene locus_tag LOCUS_15110 gene tsaB 718655 719338 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083621.1 protein_id gnl|my_center|LOCUS_15110 719335 719832 gene locus_tag LOCUS_15120 gene rimI 719335 719832 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083620.1 protein_id gnl|my_center|LOCUS_15120 719907 720332 gene locus_tag LOCUS_15130 719907 720332 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083619.1 protein_id gnl|my_center|LOCUS_15130 720342 721112 gene locus_tag LOCUS_15140 720342 721112 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527908.1 protein_id gnl|my_center|LOCUS_15140 721358 721191 gene locus_tag LOCUS_15150 721358 721191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 721361 722785 gene locus_tag LOCUS_15160 gene miaB 721361 722785 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992205.1 protein_id gnl|my_center|LOCUS_15160 722782 723951 gene locus_tag LOCUS_15170 722782 723951 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083616.1 protein_id gnl|my_center|LOCUS_15170 723948 724469 gene locus_tag LOCUS_15180 gene ybeY 723948 724469 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965162.1 protein_id gnl|my_center|LOCUS_15180 724478 725731 gene locus_tag LOCUS_15190 724478 725731 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083614.1 protein_id gnl|my_center|LOCUS_15190 725744 727336 gene locus_tag LOCUS_15200 gene lnt 725744 727336 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083613.1 protein_id gnl|my_center|LOCUS_15200 727446 727856 gene locus_tag LOCUS_15210 727446 727856 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083612.1 protein_id gnl|my_center|LOCUS_15210 727988 729181 gene locus_tag LOCUS_15220 gene metK 727988 729181 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088686.1 protein_id gnl|my_center|LOCUS_15220 729275 730045 gene locus_tag LOCUS_15230 729275 730045 CDS product tRNA (guanosine(46)-N(7))-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527899.1 protein_id gnl|my_center|LOCUS_15230 730125 730472 gene locus_tag LOCUS_15240 730125 730472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 730472 730894 gene locus_tag LOCUS_15250 730472 730894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 731041 732876 gene locus_tag LOCUS_15260 731041 732876 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085312.1 protein_id gnl|my_center|LOCUS_15260 733377 732952 gene locus_tag LOCUS_15270 733377 732952 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400759.1 protein_id gnl|my_center|LOCUS_15270 734153 733614 gene locus_tag LOCUS_15280 734153 733614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 735525 734365 gene locus_tag LOCUS_15290 735525 734365 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965920.1 protein_id gnl|my_center|LOCUS_15290 735416 735679 gene locus_tag LOCUS_15300 735416 735679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 736237 736569 gene locus_tag LOCUS_15310 736237 736569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 736576 737253 gene locus_tag LOCUS_15320 736576 737253 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526652.1 protein_id gnl|my_center|LOCUS_15320 737906 737400 gene locus_tag LOCUS_15330 737906 737400 CDS product tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531123.1 protein_id gnl|my_center|LOCUS_15330 738514 737903 gene locus_tag LOCUS_15340 738514 737903 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085339.1 protein_id gnl|my_center|LOCUS_15340 739157 738579 gene locus_tag LOCUS_15350 739157 738579 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085340.1 protein_id gnl|my_center|LOCUS_15350 740029 739160 gene locus_tag LOCUS_15360 740029 739160 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085341.1 protein_id gnl|my_center|LOCUS_15360 740265 740681 gene locus_tag LOCUS_15370 740265 740681 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975825.1 protein_id gnl|my_center|LOCUS_15370 743801 740823 gene locus_tag LOCUS_15380 gene polA 743801 740823 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090853.1 protein_id gnl|my_center|LOCUS_15380 744071 744823 gene locus_tag LOCUS_15390 gene truA 744071 744823 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338327.1 protein_id gnl|my_center|LOCUS_15390 745130 744831 gene locus_tag LOCUS_15400 745130 744831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 746583 745210 gene locus_tag LOCUS_15410 746583 745210 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085342.1 protein_id gnl|my_center|LOCUS_15410 747781 746726 gene locus_tag LOCUS_15420 747781 746726 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339562.1 protein_id gnl|my_center|LOCUS_15420 748032 748850 gene locus_tag LOCUS_15430 748032 748850 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000234.1 protein_id gnl|my_center|LOCUS_15430 749504 748872 gene locus_tag LOCUS_15440 749504 748872 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199909.1 protein_id gnl|my_center|LOCUS_15440 749662 750624 gene locus_tag LOCUS_15450 749662 750624 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174657.1 protein_id gnl|my_center|LOCUS_15450 750672 751634 gene locus_tag LOCUS_15460 750672 751634 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967295.1 protein_id gnl|my_center|LOCUS_15460 752542 751631 gene locus_tag LOCUS_15470 752542 751631 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969944.1 protein_id gnl|my_center|LOCUS_15470 752656 753717 gene locus_tag LOCUS_15480 752656 753717 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203330501.1 protein_id gnl|my_center|LOCUS_15480 753855 756929 gene locus_tag LOCUS_15490 gene ileS 753855 756929 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090213.1 protein_id gnl|my_center|LOCUS_15490 756940 757437 gene locus_tag LOCUS_15500 gene lspA 756940 757437 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174654.1 protein_id gnl|my_center|LOCUS_15500 757530 758195 gene locus_tag LOCUS_15510 757530 758195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 758487 759848 gene locus_tag LOCUS_15520 758487 759848 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463825.1 protein_id gnl|my_center|LOCUS_15520 759845 761281 gene locus_tag LOCUS_15530 759845 761281 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967298.1 protein_id gnl|my_center|LOCUS_15530 761467 762480 gene locus_tag LOCUS_15540 761467 762480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 763872 762565 gene locus_tag LOCUS_15550 763872 762565 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089683.1 protein_id gnl|my_center|LOCUS_15550 764191 764937 gene locus_tag LOCUS_15560 764191 764937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 765346 764954 gene locus_tag LOCUS_15570 765346 764954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 765649 767145 gene locus_tag LOCUS_15580 765649 767145 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530350.1 protein_id gnl|my_center|LOCUS_15580 767279 768712 gene locus_tag LOCUS_15590 767279 768712 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_15590 768716 770074 gene locus_tag LOCUS_15600 768716 770074 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530351.1 protein_id gnl|my_center|LOCUS_15600 770078 771403 gene locus_tag LOCUS_15610 gene glcF 770078 771403 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401223.1 protein_id gnl|my_center|LOCUS_15610 771408 771761 gene locus_tag LOCUS_15620 771408 771761 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312612.1 protein_id gnl|my_center|LOCUS_15620 771845 772846 gene locus_tag LOCUS_15630 771845 772846 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223629.1 protein_id gnl|my_center|LOCUS_15630 773845 772889 gene locus_tag LOCUS_15640 gene mbfA 773845 772889 CDS product iron exporter MbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090619.1 protein_id gnl|my_center|LOCUS_15640 774036 776060 gene locus_tag LOCUS_15650 774036 776060 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965108.1 protein_id gnl|my_center|LOCUS_15650 778326 776170 gene locus_tag LOCUS_15660 gene pnp 778326 776170 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970644.1 protein_id gnl|my_center|LOCUS_15660 778844 778575 gene locus_tag LOCUS_15670 gene rpsO 778844 778575 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309908.1 protein_id gnl|my_center|LOCUS_15670 780138 779089 gene locus_tag LOCUS_15680 gene truB 780138 779089 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172518.1 protein_id gnl|my_center|LOCUS_15680 780575 780135 gene locus_tag LOCUS_15690 gene rbfA 780575 780135 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083604.1 protein_id gnl|my_center|LOCUS_15690 783469 780728 gene locus_tag LOCUS_15700 gene infB 783469 780728 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083605.1 protein_id gnl|my_center|LOCUS_15700 784318 783536 gene locus_tag LOCUS_15710 784318 783536 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083606.1 protein_id gnl|my_center|LOCUS_15710 785942 784338 gene locus_tag LOCUS_15720 gene nusA 785942 784338 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083607.1 protein_id gnl|my_center|LOCUS_15720 786802 785942 gene locus_tag LOCUS_15730 786802 785942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 787018 787917 gene locus_tag LOCUS_15740 787018 787917 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965922.1 protein_id gnl|my_center|LOCUS_15740 787929 788252 gene locus_tag LOCUS_15750 787929 788252 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919842.1 protein_id gnl|my_center|LOCUS_15750 789216 788269 gene locus_tag LOCUS_15760 789216 788269 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974622.1 protein_id gnl|my_center|LOCUS_15760 790544 789273 gene locus_tag LOCUS_15770 gene purD 790544 789273 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327551.1 protein_id gnl|my_center|LOCUS_15770 792782 790770 gene locus_tag LOCUS_15780 792782 790770 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390984.1 protein_id gnl|my_center|LOCUS_15780 793922 792792 gene locus_tag LOCUS_15790 793922 792792 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390983.1 protein_id gnl|my_center|LOCUS_15790 794335 794144 gene locus_tag LOCUS_15800 794335 794144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 795291 794359 gene locus_tag LOCUS_15810 795291 794359 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085321.1 protein_id gnl|my_center|LOCUS_15810 796149 795358 gene locus_tag LOCUS_15820 796149 795358 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085320.1 protein_id gnl|my_center|LOCUS_15820 796406 796146 gene locus_tag LOCUS_15830 796406 796146 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085319.1 protein_id gnl|my_center|LOCUS_15830 796588 797610 gene locus_tag LOCUS_15840 796588 797610 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085318.1 protein_id gnl|my_center|LOCUS_15840 798062 797634 gene locus_tag LOCUS_15850 798062 797634 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537305.1 protein_id gnl|my_center|LOCUS_15850 798217 800412 gene locus_tag LOCUS_15860 798217 800412 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971071.1 protein_id gnl|my_center|LOCUS_15860 800432 800989 gene locus_tag LOCUS_15870 gene rsmD 800432 800989 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090226.1 protein_id gnl|my_center|LOCUS_15870 801852 801019 gene locus_tag LOCUS_15880 801852 801019 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083536.1 protein_id gnl|my_center|LOCUS_15880 802146 802703 gene locus_tag LOCUS_15890 gene infC 802146 802703 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528312.1 protein_id gnl|my_center|LOCUS_15890 804190 802850 gene locus_tag LOCUS_15900 804190 802850 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083572.1 protein_id gnl|my_center|LOCUS_15900 805136 804201 gene locus_tag LOCUS_15910 gene accD 805136 804201 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083571.1 protein_id gnl|my_center|LOCUS_15910 806100 805249 gene locus_tag LOCUS_15920 gene trpA 806100 805249 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083570.1 protein_id gnl|my_center|LOCUS_15920 807329 806097 gene locus_tag LOCUS_15930 gene trpB 807329 806097 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083569.1 protein_id gnl|my_center|LOCUS_15930 808066 807326 gene locus_tag LOCUS_15940 808066 807326 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083568.1 protein_id gnl|my_center|LOCUS_15940 808313 809338 gene locus_tag LOCUS_15950 gene cysP 808313 809338 CDS product thiosulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973096.1 protein_id gnl|my_center|LOCUS_15950 809559 810380 gene locus_tag LOCUS_15960 gene cysT 809559 810380 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384410.1 protein_id gnl|my_center|LOCUS_15960 810384 811283 gene locus_tag LOCUS_15970 gene cysW 810384 811283 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973094.1 protein_id gnl|my_center|LOCUS_15970 812393 811434 gene locus_tag LOCUS_15980 812393 811434 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529581.1 protein_id gnl|my_center|LOCUS_15980 812807 812415 gene locus_tag LOCUS_15990 812807 812415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 813134 812841 gene locus_tag LOCUS_16000 813134 812841 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008539997.1 protein_id gnl|my_center|LOCUS_16000 814191 813211 gene locus_tag LOCUS_16010 gene sppA 814191 813211 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083566.1 protein_id gnl|my_center|LOCUS_16010 814926 814312 gene locus_tag LOCUS_16020 814926 814312 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966112.1 protein_id gnl|my_center|LOCUS_16020 815642 814950 gene locus_tag LOCUS_16030 815642 814950 CDS product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090673.1 protein_id gnl|my_center|LOCUS_16030 816790 815651 gene locus_tag LOCUS_16040 816790 815651 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388792.1 protein_id gnl|my_center|LOCUS_16040 818490 816877 gene locus_tag LOCUS_16050 818490 816877 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035546.1 protein_id gnl|my_center|LOCUS_16050 818576 818818 gene locus_tag LOCUS_16060 818576 818818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 819489 820619 gene locus_tag LOCUS_16070 gene odc2 819489 820619 CDS product ornithine/lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529754.1 protein_id gnl|my_center|LOCUS_16070 820809 821438 gene locus_tag LOCUS_16080 820809 821438 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090485.1 protein_id gnl|my_center|LOCUS_16080 822440 821640 gene locus_tag LOCUS_16090 822440 821640 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967666.1 protein_id gnl|my_center|LOCUS_16090 822843 824066 gene locus_tag LOCUS_16100 gene phaZ 822843 824066 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089442.1 protein_id gnl|my_center|LOCUS_16100 824455 825882 gene locus_tag LOCUS_16110 824455 825882 CDS product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529731.1 protein_id gnl|my_center|LOCUS_16110 826739 825930 gene locus_tag LOCUS_16120 826739 825930 CDS product pyrroline-5-carboxylate reductase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384670.1 protein_id gnl|my_center|LOCUS_16120 827192 827896 gene locus_tag LOCUS_16130 827192 827896 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265698.1 protein_id gnl|my_center|LOCUS_16130 828019 829107 gene locus_tag LOCUS_16140 gene hemH 828019 829107 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393586.1 protein_id gnl|my_center|LOCUS_16140 829479 830072 gene locus_tag LOCUS_16150 829479 830072 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942408.1 protein_id gnl|my_center|LOCUS_16150 830137 830394 gene locus_tag LOCUS_16160 830137 830394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 830545 831027 gene locus_tag LOCUS_16170 830545 831027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 832904 831198 gene locus_tag LOCUS_16180 gene rpsA 832904 831198 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027546860.1 protein_id gnl|my_center|LOCUS_16180 833514 835187 gene locus_tag LOCUS_16190 833514 835187 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173615749.1 protein_id gnl|my_center|LOCUS_16190 835256 836302 gene locus_tag LOCUS_16200 835256 836302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 836304 837242 gene locus_tag LOCUS_16210 836304 837242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 837546 837220 gene locus_tag LOCUS_16220 837546 837220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 838453 837647 gene locus_tag LOCUS_16230 gene cobF 838453 837647 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228664.1 protein_id gnl|my_center|LOCUS_16230 838951 838457 gene locus_tag LOCUS_16240 838951 838457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 839578 838958 gene locus_tag LOCUS_16250 839578 838958 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339438.1 protein_id gnl|my_center|LOCUS_16250 840927 839575 gene locus_tag LOCUS_16260 gene aroA 840927 839575 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965151.1 protein_id gnl|my_center|LOCUS_16260 841048 841479 gene locus_tag LOCUS_16270 841048 841479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 841639 841714 gene locus_tag LOCUS_t00230 841639 841714 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 841865 842281 gene locus_tag LOCUS_16280 841865 842281 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316411.1 protein_id gnl|my_center|LOCUS_16280 843110 842286 gene locus_tag LOCUS_16290 843110 842286 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971976.1 protein_id gnl|my_center|LOCUS_16290 843771 843115 gene locus_tag LOCUS_16300 gene chrR 843771 843115 CDS product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338712.1 protein_id gnl|my_center|LOCUS_16300 844346 843768 gene locus_tag LOCUS_16310 844346 843768 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_16310 844531 845877 gene locus_tag LOCUS_16320 844531 845877 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_16320 845874 846692 gene locus_tag LOCUS_16330 845874 846692 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_16330 846682 847902 gene locus_tag LOCUS_16340 846682 847902 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971979.1 protein_id gnl|my_center|LOCUS_16340 848150 847932 gene locus_tag LOCUS_16350 848150 847932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 848347 849327 gene locus_tag LOCUS_16360 gene gnd 848347 849327 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766216.1 protein_id gnl|my_center|LOCUS_16360 849343 850884 gene locus_tag LOCUS_16370 gene zwf 849343 850884 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268136.1 protein_id gnl|my_center|LOCUS_16370 850881 851726 gene locus_tag LOCUS_16380 850881 851726 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766212.1 protein_id gnl|my_center|LOCUS_16380 853689 851851 gene locus_tag LOCUS_16390 853689 851851 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531870.1 protein_id gnl|my_center|LOCUS_16390 854261 853974 gene locus_tag LOCUS_16400 854261 853974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 855099 854251 gene locus_tag LOCUS_16410 gene fdhD 855099 854251 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085919.1 protein_id gnl|my_center|LOCUS_16410 857968 855113 gene locus_tag LOCUS_16420 gene fdhF 857968 855113 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398020.1 protein_id gnl|my_center|LOCUS_16420 859539 857983 gene locus_tag LOCUS_16430 859539 857983 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970350.1 protein_id gnl|my_center|LOCUS_16430 860009 859536 gene locus_tag LOCUS_16440 860009 859536 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085922.1 protein_id gnl|my_center|LOCUS_16440 860248 861780 gene locus_tag LOCUS_16450 860248 861780 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083488.1 protein_id gnl|my_center|LOCUS_16450 862546 863607 gene locus_tag LOCUS_16460 862546 863607 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968546.1 protein_id gnl|my_center|LOCUS_16460 863859 864281 gene locus_tag LOCUS_16470 863859 864281 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083554.1 protein_id gnl|my_center|LOCUS_16470 864328 864612 gene locus_tag LOCUS_16480 864328 864612 CDS product DUF1150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083553.1 protein_id gnl|my_center|LOCUS_16480 865655 864714 gene locus_tag LOCUS_16490 gene gshB 865655 864714 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083495.1 protein_id gnl|my_center|LOCUS_16490 866124 865750 gene locus_tag LOCUS_16500 866124 865750 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083496.1 protein_id gnl|my_center|LOCUS_16500 867034 866132 gene locus_tag LOCUS_16510 gene rsmI 867034 866132 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083497.1 protein_id gnl|my_center|LOCUS_16510 867228 868451 gene locus_tag LOCUS_16520 867228 868451 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000235.1 protein_id gnl|my_center|LOCUS_16520 869664 868468 gene locus_tag LOCUS_16530 gene hemW 869664 868468 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172453.1 protein_id gnl|my_center|LOCUS_16530 870307 869654 gene locus_tag LOCUS_16540 gene rdgB 870307 869654 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083500.1 protein_id gnl|my_center|LOCUS_16540 871023 870310 gene locus_tag LOCUS_16550 gene rph 871023 870310 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083501.1 protein_id gnl|my_center|LOCUS_16550 871187 872287 gene locus_tag LOCUS_16560 gene hrcA 871187 872287 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083502.1 protein_id gnl|my_center|LOCUS_16560 872253 872987 gene locus_tag LOCUS_16570 872253 872987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 873957 873013 gene locus_tag LOCUS_16580 873957 873013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965133.1 protein_id gnl|my_center|LOCUS_16580 874678 874034 gene locus_tag LOCUS_16590 874678 874034 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067461.1 protein_id gnl|my_center|LOCUS_16590 875639 874680 gene locus_tag LOCUS_16600 gene coaA 875639 874680 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027543772.1 protein_id gnl|my_center|LOCUS_16600 876110 875775 gene locus_tag LOCUS_16610 876110 875775 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876448.1 protein_id gnl|my_center|LOCUS_16610 876899 876120 gene locus_tag LOCUS_16620 gene hisF 876899 876120 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501998.1 protein_id gnl|my_center|LOCUS_16620 877651 876917 gene locus_tag LOCUS_16630 gene hisA 877651 876917 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965127.1 protein_id gnl|my_center|LOCUS_16630 878310 877648 gene locus_tag LOCUS_16640 gene hisH 878310 877648 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970621.1 protein_id gnl|my_center|LOCUS_16640 878789 878307 gene locus_tag LOCUS_16650 878789 878307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 879385 878792 gene locus_tag LOCUS_16660 gene hisB 879385 878792 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083477.1 protein_id gnl|my_center|LOCUS_16660 879527 880075 gene locus_tag LOCUS_16670 gene hslV 879527 880075 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083476.1 protein_id gnl|my_center|LOCUS_16670 880112 881422 gene locus_tag LOCUS_16680 gene hslU 880112 881422 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083473.1 protein_id gnl|my_center|LOCUS_16680 881866 881501 gene locus_tag LOCUS_16690 881866 881501 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311080.1 protein_id gnl|my_center|LOCUS_16690 882468 881863 gene locus_tag LOCUS_16700 882468 881863 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083471.1 protein_id gnl|my_center|LOCUS_16700 883751 882465 gene locus_tag LOCUS_16710 883751 882465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16710 884486 883764 gene locus_tag LOCUS_16720 884486 883764 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 protein_id gnl|my_center|LOCUS_16720 884853 884488 gene locus_tag LOCUS_16730 884853 884488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 884865 885332 gene locus_tag LOCUS_16740 gene secB 884865 885332 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083468.1 protein_id gnl|my_center|LOCUS_16740 886055 885339 gene locus_tag LOCUS_16750 gene dnaQ 886055 885339 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083467.1 protein_id gnl|my_center|LOCUS_16750 886659 886048 gene locus_tag LOCUS_16760 gene coaE 886659 886048 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528726.1 protein_id gnl|my_center|LOCUS_16760 887501 886656 gene locus_tag LOCUS_16770 887501 886656 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528727.1 protein_id gnl|my_center|LOCUS_16770 888118 887498 gene locus_tag LOCUS_16780 888118 887498 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083465.1 protein_id gnl|my_center|LOCUS_16780 888980 888123 gene locus_tag LOCUS_16790 888980 888123 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083464.1 protein_id gnl|my_center|LOCUS_16790 889314 890342 gene locus_tag LOCUS_16800 gene hemE 889314 890342 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085186.1 protein_id gnl|my_center|LOCUS_16800 890353 890778 gene locus_tag LOCUS_16810 gene hemJ 890353 890778 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_16810 891027 892292 gene locus_tag LOCUS_16820 gene rho 891027 892292 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083462.1 protein_id gnl|my_center|LOCUS_16820 892380 892820 gene locus_tag LOCUS_16830 892380 892820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 895122 893104 gene locus_tag LOCUS_16840 895122 893104 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_16840 895196 896566 gene locus_tag LOCUS_16850 gene mnmE 895196 896566 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391371.1 protein_id gnl|my_center|LOCUS_16850 896769 898625 gene locus_tag LOCUS_16860 gene mnmG 896769 898625 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083460.1 protein_id gnl|my_center|LOCUS_16860 898644 899300 gene locus_tag LOCUS_16870 gene rsmG 898644 899300 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178639.1 protein_id gnl|my_center|LOCUS_16870 899334 900191 gene locus_tag LOCUS_16880 899334 900191 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083458.1 protein_id gnl|my_center|LOCUS_16880 899712 899641 gene locus_tag LOCUS_t00240 899712 899641 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 900203 901126 gene locus_tag LOCUS_16890 900203 901126 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067406.1 protein_id gnl|my_center|LOCUS_16890 902159 901134 gene locus_tag LOCUS_16900 gene holA 902159 901134 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083456.1 protein_id gnl|my_center|LOCUS_16900 902745 902164 gene locus_tag LOCUS_16910 gene lptE 902745 902164 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083455.1 protein_id gnl|my_center|LOCUS_16910 905368 902732 gene locus_tag LOCUS_16920 gene leuS 905368 902732 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398680.1 protein_id gnl|my_center|LOCUS_16920 907245 905455 gene locus_tag LOCUS_16930 907245 905455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 907424 908107 gene locus_tag LOCUS_16940 907424 908107 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083450.1 protein_id gnl|my_center|LOCUS_16940 908722 908156 gene locus_tag LOCUS_16950 908722 908156 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171578751.1 protein_id gnl|my_center|LOCUS_16950 908903 909589 gene locus_tag LOCUS_16960 908903 909589 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008142830.1 protein_id gnl|my_center|LOCUS_16960 909658 910149 gene locus_tag LOCUS_16970 909658 910149 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970491.1 protein_id gnl|my_center|LOCUS_16970 910172 910603 gene locus_tag LOCUS_16980 gene arfB 910172 910603 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_16980 910945 910634 gene locus_tag LOCUS_16990 910945 910634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 911051 912007 gene locus_tag LOCUS_17000 gene htpX 911051 912007 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876568.1 protein_id gnl|my_center|LOCUS_17000 912117 912192 gene locus_tag LOCUS_t00250 912117 912192 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 912644 912318 gene locus_tag LOCUS_17010 912644 912318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 913698 912766 gene locus_tag LOCUS_17020 913698 912766 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038233.1 protein_id gnl|my_center|LOCUS_17020 913869 914171 gene locus_tag LOCUS_17030 913869 914171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 914272 914739 gene locus_tag LOCUS_17040 914272 914739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 914860 914946 gene locus_tag LOCUS_t00260 914860 914946 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 916032 915007 gene locus_tag LOCUS_17050 916032 915007 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527056.1 protein_id gnl|my_center|LOCUS_17050 916426 916112 gene locus_tag LOCUS_17060 916426 916112 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973675.1 protein_id gnl|my_center|LOCUS_17060 917915 916434 gene locus_tag LOCUS_17070 917915 916434 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525215.1 protein_id gnl|my_center|LOCUS_17070 919157 918099 gene locus_tag LOCUS_17080 919157 918099 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525214.1 protein_id gnl|my_center|LOCUS_17080 920999 919179 gene locus_tag LOCUS_17090 920999 919179 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183463334.1 protein_id gnl|my_center|LOCUS_17090 921606 920992 gene locus_tag LOCUS_17100 921606 920992 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531333.1 protein_id gnl|my_center|LOCUS_17100 921749 922441 gene locus_tag LOCUS_17110 921749 922441 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525211.1 protein_id gnl|my_center|LOCUS_17110 922587 923624 gene locus_tag LOCUS_17120 922587 923624 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_17120 924188 923631 gene locus_tag LOCUS_17130 924188 923631 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199185.1 protein_id gnl|my_center|LOCUS_17130 925314 924223 gene locus_tag LOCUS_17140 gene aguA 925314 924223 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104504.1 protein_id gnl|my_center|LOCUS_17140 926208 925318 gene locus_tag LOCUS_17150 gene aguB 926208 925318 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 protein_id gnl|my_center|LOCUS_17150 926592 926254 gene locus_tag LOCUS_17160 926592 926254 CDS product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083295.1 protein_id gnl|my_center|LOCUS_17160 927256 928059 gene locus_tag LOCUS_17170 927256 928059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 929064 928132 gene locus_tag LOCUS_17180 929064 928132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 931941 929257 gene locus_tag LOCUS_17190 gene acnA 931941 929257 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528828.1 protein_id gnl|my_center|LOCUS_17190 932156 932809 gene locus_tag LOCUS_17200 gene ccmA 932156 932809 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528829.1 protein_id gnl|my_center|LOCUS_17200 932806 933477 gene locus_tag LOCUS_17210 gene ccmB 932806 933477 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083299.1 protein_id gnl|my_center|LOCUS_17210 933844 934398 gene locus_tag LOCUS_17220 933844 934398 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083275.1 protein_id gnl|my_center|LOCUS_17220 934398 935930 gene locus_tag LOCUS_17230 gene atpA 934398 935930 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083274.1 protein_id gnl|my_center|LOCUS_17230 935957 936838 gene locus_tag LOCUS_17240 935957 936838 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083273.1 protein_id gnl|my_center|LOCUS_17240 936872 938305 gene locus_tag LOCUS_17250 gene atpD 936872 938305 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083272.1 protein_id gnl|my_center|LOCUS_17250 938383 938799 gene locus_tag LOCUS_17260 938383 938799 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083271.1 protein_id gnl|my_center|LOCUS_17260 938903 939583 gene locus_tag LOCUS_17270 gene tenA 938903 939583 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066884.1 protein_id gnl|my_center|LOCUS_17270 939698 940444 gene locus_tag LOCUS_17280 939698 940444 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088320.1 protein_id gnl|my_center|LOCUS_17280 940868 940587 gene locus_tag LOCUS_17290 gene infA 940868 940587 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388420.1 protein_id gnl|my_center|LOCUS_17290 942410 940944 gene locus_tag LOCUS_17300 942410 940944 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084264.1 protein_id gnl|my_center|LOCUS_17300 942668 943411 gene locus_tag LOCUS_17310 942668 943411 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083053.1 protein_id gnl|my_center|LOCUS_17310 943531 943803 gene locus_tag LOCUS_17320 943531 943803 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 protein_id gnl|my_center|LOCUS_17320 943818 944141 gene locus_tag LOCUS_17330 943818 944141 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_17330 944837 944154 gene locus_tag LOCUS_17340 gene metW 944837 944154 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173533.1 protein_id gnl|my_center|LOCUS_17340 946006 944837 gene locus_tag LOCUS_17350 946006 944837 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_17350 946314 946090 gene locus_tag LOCUS_17360 946314 946090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 946313 947110 gene locus_tag LOCUS_17370 946313 947110 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084215.1 protein_id gnl|my_center|LOCUS_17370 947154 948275 gene locus_tag LOCUS_17380 gene hisC 947154 948275 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973186.1 protein_id gnl|my_center|LOCUS_17380 948265 949200 gene locus_tag LOCUS_17390 948265 949200 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084213.1 protein_id gnl|my_center|LOCUS_17390 951731 950241 gene locus_tag LOCUS_17400 951731 950241 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200059.1 protein_id gnl|my_center|LOCUS_17400 951858 952769 gene locus_tag LOCUS_17410 951858 952769 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537711.1 protein_id gnl|my_center|LOCUS_17410 953731 952772 gene locus_tag LOCUS_17420 953731 952772 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970707.1 protein_id gnl|my_center|LOCUS_17420 954888 953854 gene locus_tag LOCUS_17430 954888 953854 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252333.1 protein_id gnl|my_center|LOCUS_17430 955405 954950 gene locus_tag LOCUS_17440 955405 954950 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 protein_id gnl|my_center|LOCUS_17440 955474 957729 gene locus_tag LOCUS_17450 955474 957729 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399174.1 protein_id gnl|my_center|LOCUS_17450 959260 957734 gene locus_tag LOCUS_17460 959260 957734 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390363.1 protein_id gnl|my_center|LOCUS_17460 959431 960489 gene locus_tag LOCUS_17470 959431 960489 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389904.1 protein_id gnl|my_center|LOCUS_17470 961891 960506 gene locus_tag LOCUS_17480 961891 960506 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400962.1 protein_id gnl|my_center|LOCUS_17480 962246 962728 gene locus_tag LOCUS_17490 962246 962728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 962862 963935 gene locus_tag LOCUS_17500 962862 963935 CDS product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877947.1 protein_id gnl|my_center|LOCUS_17500 963853 964992 gene locus_tag LOCUS_17510 963853 964992 CDS product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 protein_id gnl|my_center|LOCUS_17510 964989 965546 gene locus_tag LOCUS_17520 964989 965546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 965543 966556 gene locus_tag LOCUS_17530 965543 966556 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 protein_id gnl|my_center|LOCUS_17530 966553 967731 gene locus_tag LOCUS_17540 966553 967731 CDS product MSMEG_0565 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876802.1 protein_id gnl|my_center|LOCUS_17540 967740 968027 gene locus_tag LOCUS_17550 967740 968027 CDS product MSMEG_0570 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 protein_id gnl|my_center|LOCUS_17550 968053 969318 gene locus_tag LOCUS_17560 968053 969318 CDS product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 protein_id gnl|my_center|LOCUS_17560 969315 970187 gene locus_tag LOCUS_17570 969315 970187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 970354 970428 gene locus_tag LOCUS_t00270 970354 970428 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 971884 970919 gene locus_tag LOCUS_17580 971884 970919 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974766.1 protein_id gnl|my_center|LOCUS_17580 972436 972843 gene locus_tag LOCUS_17590 gene crcB 972436 972843 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_17590 972840 973655 gene locus_tag LOCUS_17600 972840 973655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 974500 973682 gene locus_tag LOCUS_17610 974500 973682 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395766.1 protein_id gnl|my_center|LOCUS_17610 974445 974702 gene locus_tag LOCUS_17620 974445 974702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 974702 976072 gene locus_tag LOCUS_17630 974702 976072 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965040.1 protein_id gnl|my_center|LOCUS_17630 976402 978267 gene locus_tag LOCUS_17640 976402 978267 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445450.1 protein_id gnl|my_center|LOCUS_17640 978453 978274 gene locus_tag LOCUS_17650 978453 978274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 978665 979354 gene locus_tag LOCUS_17660 978665 979354 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967032.1 protein_id gnl|my_center|LOCUS_17660 979403 980374 gene locus_tag LOCUS_17670 979403 980374 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 protein_id gnl|my_center|LOCUS_17670 980382 980933 gene locus_tag LOCUS_17680 980382 980933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 980933 981160 gene locus_tag LOCUS_17690 980933 981160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 981160 982437 gene locus_tag LOCUS_17700 981160 982437 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529044.1 protein_id gnl|my_center|LOCUS_17700 982447 983517 gene locus_tag LOCUS_17710 982447 983517 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972886.1 protein_id gnl|my_center|LOCUS_17710 983552 984769 gene locus_tag LOCUS_17720 gene uxuA 983552 984769 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338476.1 protein_id gnl|my_center|LOCUS_17720 984766 986235 gene locus_tag LOCUS_17730 984766 986235 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538275.1 protein_id gnl|my_center|LOCUS_17730 986240 987121 gene locus_tag LOCUS_17740 986240 987121 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314657.1 protein_id gnl|my_center|LOCUS_17740 988059 987157 gene locus_tag LOCUS_17750 988059 987157 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017263128.1 protein_id gnl|my_center|LOCUS_17750 988922 988161 gene locus_tag LOCUS_17760 988922 988161 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970211.1 protein_id gnl|my_center|LOCUS_17760 989041 989928 gene locus_tag LOCUS_17770 989041 989928 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970212.1 protein_id gnl|my_center|LOCUS_17770 989931 990869 gene locus_tag LOCUS_17780 989931 990869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970213.1 protein_id gnl|my_center|LOCUS_17780 990866 991690 gene locus_tag LOCUS_17790 990866 991690 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970214.1 protein_id gnl|my_center|LOCUS_17790 991687 993414 gene locus_tag LOCUS_17800 991687 993414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339155.1 protein_id gnl|my_center|LOCUS_17800 993487 995016 gene locus_tag LOCUS_17810 993487 995016 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970216.1 protein_id gnl|my_center|LOCUS_17810 995862 995059 gene locus_tag LOCUS_17820 995862 995059 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338389.1 protein_id gnl|my_center|LOCUS_17820 996181 997530 gene locus_tag LOCUS_17830 996181 997530 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626135.1 protein_id gnl|my_center|LOCUS_17830 997654 998208 gene locus_tag LOCUS_17840 997654 998208 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389121.1 protein_id gnl|my_center|LOCUS_17840 998307 999209 gene locus_tag LOCUS_17850 998307 999209 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066678.1 protein_id gnl|my_center|LOCUS_17850 999209 1000027 gene locus_tag LOCUS_17860 999209 1000027 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066677.1 protein_id gnl|my_center|LOCUS_17860 1000024 1000956 gene locus_tag LOCUS_17870 1000024 1000956 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389116.1 protein_id gnl|my_center|LOCUS_17870 1000964 1001944 gene locus_tag LOCUS_17880 1000964 1001944 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389120.1 protein_id gnl|my_center|LOCUS_17880 1001994 1003076 gene locus_tag LOCUS_17890 gene ugpC 1001994 1003076 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252937.1 protein_id gnl|my_center|LOCUS_17890 1003108 1004142 gene locus_tag LOCUS_17900 1003108 1004142 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969998.1 protein_id gnl|my_center|LOCUS_17900 1004316 1005044 gene locus_tag LOCUS_17910 1004316 1005044 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530726.1 protein_id gnl|my_center|LOCUS_17910 1005047 1006651 gene locus_tag LOCUS_17920 1005047 1006651 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530727.1 protein_id gnl|my_center|LOCUS_17920 1007734 1006655 gene locus_tag LOCUS_17930 1007734 1006655 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969480.1 protein_id gnl|my_center|LOCUS_17930 1008276 1007815 gene locus_tag LOCUS_17940 1008276 1007815 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975746.1 protein_id gnl|my_center|LOCUS_17940 1008612 1009343 gene locus_tag LOCUS_17950 1008612 1009343 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973549.1 protein_id gnl|my_center|LOCUS_17950 1009404 1010504 gene locus_tag LOCUS_17960 1009404 1010504 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974669.1 protein_id gnl|my_center|LOCUS_17960 1010588 1011583 gene locus_tag LOCUS_17970 1010588 1011583 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975171.1 protein_id gnl|my_center|LOCUS_17970 1011595 1012398 gene locus_tag LOCUS_17980 1011595 1012398 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975170.1 protein_id gnl|my_center|LOCUS_17980 1012402 1013472 gene locus_tag LOCUS_17990 1012402 1013472 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969485.1 protein_id gnl|my_center|LOCUS_17990 1013560 1015038 gene locus_tag LOCUS_18000 1013560 1015038 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969486.1 protein_id gnl|my_center|LOCUS_18000 1015044 1015634 gene locus_tag LOCUS_18010 1015044 1015634 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974672.1 protein_id gnl|my_center|LOCUS_18010 1015639 1016175 gene locus_tag LOCUS_18020 1015639 1016175 CDS product CMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974673.1 protein_id gnl|my_center|LOCUS_18020 1016178 1016786 gene locus_tag LOCUS_18030 1016178 1016786 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975166.1 protein_id gnl|my_center|LOCUS_18030 1016787 1018151 gene locus_tag LOCUS_18040 1016787 1018151 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974675.1 protein_id gnl|my_center|LOCUS_18040 1019195 1018176 gene locus_tag LOCUS_18050 1019195 1018176 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525363.1 protein_id gnl|my_center|LOCUS_18050 1020220 1019192 gene locus_tag LOCUS_18060 1020220 1019192 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525364.1 protein_id gnl|my_center|LOCUS_18060 1022530 1020242 gene locus_tag LOCUS_18070 1022530 1020242 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525365.1 protein_id gnl|my_center|LOCUS_18070 1023141 1022527 gene locus_tag LOCUS_18080 1023141 1022527 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525366.1 protein_id gnl|my_center|LOCUS_18080 1024550 1023138 gene locus_tag LOCUS_18090 1024550 1023138 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113845.1 protein_id gnl|my_center|LOCUS_18090 1025023 1024562 gene locus_tag LOCUS_18100 1025023 1024562 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525368.1 protein_id gnl|my_center|LOCUS_18100 1026651 1025038 gene locus_tag LOCUS_18110 1026651 1025038 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525369.1 protein_id gnl|my_center|LOCUS_18110 1027826 1026837 gene locus_tag LOCUS_18120 1027826 1026837 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550164.1 protein_id gnl|my_center|LOCUS_18120 1028904 1027888 gene locus_tag LOCUS_18130 gene tehA 1028904 1027888 CDS product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966370.1 protein_id gnl|my_center|LOCUS_18130 1029078 1028932 gene locus_tag LOCUS_18140 gene cydX 1029078 1028932 CDS product cytochrome bd-I oxidase subunit CydX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313811.1 protein_id gnl|my_center|LOCUS_18140 1030253 1029096 gene locus_tag LOCUS_18150 gene cydB 1030253 1029096 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973557.1 protein_id gnl|my_center|LOCUS_18150 1031835 1030258 gene locus_tag LOCUS_18160 1031835 1030258 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973556.1 protein_id gnl|my_center|LOCUS_18160 1033710 1031941 gene locus_tag LOCUS_18170 1033710 1031941 CDS product amino acid ABC transporter ATP-binding/permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973555.1 protein_id gnl|my_center|LOCUS_18170 1035425 1033707 gene locus_tag LOCUS_18180 gene cydD 1035425 1033707 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538124.1 protein_id gnl|my_center|LOCUS_18180 1036044 1035427 gene locus_tag LOCUS_18190 1036044 1035427 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313806.1 protein_id gnl|my_center|LOCUS_18190 1037329 1036448 gene locus_tag LOCUS_18200 1037329 1036448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18200 1038342 1037326 gene locus_tag LOCUS_18210 1038342 1037326 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969483.1 protein_id gnl|my_center|LOCUS_18210 1039430 1038339 gene locus_tag LOCUS_18220 1039430 1038339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_18220 1040815 1039640 gene locus_tag LOCUS_18230 1040815 1039640 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666442.1 protein_id gnl|my_center|LOCUS_18230 1042163 1041114 gene locus_tag LOCUS_18240 1042163 1041114 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389005.1 protein_id gnl|my_center|LOCUS_18240 1043190 1042216 gene locus_tag LOCUS_18250 1043190 1042216 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138161721.1 protein_id gnl|my_center|LOCUS_18250 1044521 1043325 gene locus_tag LOCUS_18260 gene proB 1044521 1043325 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083260.1 protein_id gnl|my_center|LOCUS_18260 1046509 1045475 gene locus_tag LOCUS_18270 gene obgE 1046509 1045475 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083257.1 protein_id gnl|my_center|LOCUS_18270 1047249 1046581 gene locus_tag LOCUS_18280 1047249 1046581 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965053.1 protein_id gnl|my_center|LOCUS_18280 1047242 1047421 gene locus_tag LOCUS_18290 1047242 1047421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1047662 1047393 gene locus_tag LOCUS_18300 gene rpmA 1047662 1047393 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067214.1 protein_id gnl|my_center|LOCUS_18300 1047999 1047694 gene locus_tag LOCUS_18310 gene rplU 1047999 1047694 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083252.1 protein_id gnl|my_center|LOCUS_18310 1048303 1048629 gene locus_tag LOCUS_18320 1048303 1048629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1048807 1048896 gene locus_tag LOCUS_t00280 1048807 1048896 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1049720 1049019 gene locus_tag LOCUS_18330 1049720 1049019 CDS product DUF2161 family putative PD-(D/E)XK-type phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086936.1 protein_id gnl|my_center|LOCUS_18330 1049884 1049693 gene locus_tag LOCUS_18340 1049884 1049693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1050105 1049881 gene locus_tag LOCUS_18350 1050105 1049881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 1051293 1050595 gene locus_tag LOCUS_18360 1051293 1050595 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_18360 1051435 1052784 gene locus_tag LOCUS_18370 1051435 1052784 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947065.1 protein_id gnl|my_center|LOCUS_18370 1053572 1052826 gene locus_tag LOCUS_18380 1053572 1052826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 1053673 1053972 gene locus_tag LOCUS_18390 1053673 1053972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1056765 1054015 gene locus_tag LOCUS_18400 1056765 1054015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1057871 1056795 gene locus_tag LOCUS_18410 1057871 1056795 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926712.1 protein_id gnl|my_center|LOCUS_18410 1058968 1058048 gene locus_tag LOCUS_18420 1058968 1058048 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036667.1 protein_id gnl|my_center|LOCUS_18420 1059064 1059300 gene locus_tag LOCUS_18430 1059064 1059300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1059495 1060481 gene locus_tag LOCUS_18440 1059495 1060481 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391427.1 protein_id gnl|my_center|LOCUS_18440 1060707 1061693 gene locus_tag LOCUS_18450 1060707 1061693 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_18450 1062425 1061709 gene locus_tag LOCUS_18460 1062425 1061709 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039642.1 protein_id gnl|my_center|LOCUS_18460 1062928 1062542 gene locus_tag LOCUS_18470 1062928 1062542 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605909.1 protein_id gnl|my_center|LOCUS_18470 1063173 1062925 gene locus_tag LOCUS_18480 1063173 1062925 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389024.1 protein_id gnl|my_center|LOCUS_18480 1063212 1064147 gene locus_tag LOCUS_18490 1063212 1064147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1064356 1064775 gene locus_tag LOCUS_18500 1064356 1064775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 1065025 1066212 gene locus_tag LOCUS_18510 1065025 1066212 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337429.1 protein_id gnl|my_center|LOCUS_18510 1066212 1067762 gene locus_tag LOCUS_18520 1066212 1067762 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140147.1 protein_id gnl|my_center|LOCUS_18520 1067804 1068235 gene locus_tag LOCUS_18530 1067804 1068235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1068444 1068791 gene locus_tag LOCUS_18540 1068444 1068791 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337425.1 protein_id gnl|my_center|LOCUS_18540 1068788 1069084 gene locus_tag LOCUS_18550 1068788 1069084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1069090 1069509 gene locus_tag LOCUS_18560 1069090 1069509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 1069512 1071113 gene locus_tag LOCUS_18570 1069512 1071113 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140144.1 protein_id gnl|my_center|LOCUS_18570 1071126 1071530 gene locus_tag LOCUS_18580 1071126 1071530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1071556 1071921 gene locus_tag LOCUS_18590 1071556 1071921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence08 561 2237 gene locus_tag LOCUS_18600 561 2237 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063682649.1 protein_id gnl|my_center|LOCUS_18600 4059 2323 gene locus_tag LOCUS_18610 4059 2323 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389723.1 protein_id gnl|my_center|LOCUS_18610 5098 4103 gene locus_tag LOCUS_18620 gene pfkB 5098 4103 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336985.1 protein_id gnl|my_center|LOCUS_18620 7632 5095 gene locus_tag LOCUS_18630 gene ptsP 7632 5095 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037513.1 protein_id gnl|my_center|LOCUS_18630 7817 8827 gene locus_tag LOCUS_18640 7817 8827 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037512.1 protein_id gnl|my_center|LOCUS_18640 9665 8859 gene locus_tag LOCUS_18650 9665 8859 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092173.1 protein_id gnl|my_center|LOCUS_18650 13123 9806 gene locus_tag LOCUS_18660 13123 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 14478 13792 gene locus_tag LOCUS_18670 14478 13792 CDS product DUF6064 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392262.1 protein_id gnl|my_center|LOCUS_18670 15344 14478 gene locus_tag LOCUS_18680 15344 14478 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456728.1 protein_id gnl|my_center|LOCUS_18680 15229 15687 gene locus_tag LOCUS_18690 15229 15687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 16391 15684 gene locus_tag LOCUS_18700 16391 15684 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087631.1 protein_id gnl|my_center|LOCUS_18700 17293 16706 gene locus_tag LOCUS_18710 17293 16706 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975569.1 protein_id gnl|my_center|LOCUS_18710 18408 17290 gene locus_tag LOCUS_18720 18408 17290 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088034.1 protein_id gnl|my_center|LOCUS_18720 19661 18381 gene locus_tag LOCUS_18730 19661 18381 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003516526.1 protein_id gnl|my_center|LOCUS_18730 20239 19658 gene locus_tag LOCUS_18740 20239 19658 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243986.1 protein_id gnl|my_center|LOCUS_18740 21362 20349 gene locus_tag LOCUS_18750 21362 20349 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_18750 22213 21443 gene locus_tag LOCUS_18760 22213 21443 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971598.1 protein_id gnl|my_center|LOCUS_18760 23426 22227 gene locus_tag LOCUS_18770 23426 22227 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210343307.1 protein_id gnl|my_center|LOCUS_18770 24406 23585 gene locus_tag LOCUS_18780 24406 23585 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532967.1 protein_id gnl|my_center|LOCUS_18780 34706 24564 gene locus_tag LOCUS_18790 34706 24564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 34822 35730 gene locus_tag LOCUS_18800 34822 35730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 36156 38129 gene locus_tag LOCUS_18810 36156 38129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 38235 40631 gene locus_tag LOCUS_18820 38235 40631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 41639 40674 gene locus_tag LOCUS_18830 41639 40674 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096380.1 protein_id gnl|my_center|LOCUS_18830 41596 41775 gene locus_tag LOCUS_18840 41596 41775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 42263 43234 gene locus_tag LOCUS_18850 42263 43234 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970046.1 protein_id gnl|my_center|LOCUS_18850 43344 43739 gene locus_tag LOCUS_18860 43344 43739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 44334 43855 gene locus_tag LOCUS_18870 44334 43855 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332654.1 protein_id gnl|my_center|LOCUS_18870 44483 45613 gene locus_tag LOCUS_18880 gene alr 44483 45613 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332653.1 protein_id gnl|my_center|LOCUS_18880 45638 46891 gene locus_tag LOCUS_18890 45638 46891 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972918.1 protein_id gnl|my_center|LOCUS_18890 47008 47889 gene locus_tag LOCUS_18900 47008 47889 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970789.1 protein_id gnl|my_center|LOCUS_18900 47886 48620 gene locus_tag LOCUS_18910 47886 48620 CDS product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973661.1 protein_id gnl|my_center|LOCUS_18910 48631 49980 gene locus_tag LOCUS_18920 48631 49980 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010914750.1 protein_id gnl|my_center|LOCUS_18920 50078 51394 gene locus_tag LOCUS_18930 gene glnT 50078 51394 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532906.1 protein_id gnl|my_center|LOCUS_18930 51547 53229 gene locus_tag LOCUS_18940 51547 53229 CDS product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626633.1 protein_id gnl|my_center|LOCUS_18940 53454 55154 gene locus_tag LOCUS_18950 53454 55154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 58789 55274 gene locus_tag LOCUS_18960 58789 55274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 60156 59278 gene locus_tag LOCUS_18970 60156 59278 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528030.1 protein_id gnl|my_center|LOCUS_18970 62794 60344 gene locus_tag LOCUS_18980 62794 60344 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 protein_id gnl|my_center|LOCUS_18980 63625 62891 gene locus_tag LOCUS_18990 63625 62891 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528029.1 protein_id gnl|my_center|LOCUS_18990 63988 65115 gene locus_tag LOCUS_19000 63988 65115 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532897.1 protein_id gnl|my_center|LOCUS_19000 67726 65432 gene locus_tag LOCUS_19010 67726 65432 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067519.1 protein_id gnl|my_center|LOCUS_19010 69124 67766 gene locus_tag LOCUS_19020 69124 67766 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532892.1 protein_id gnl|my_center|LOCUS_19020 69447 70052 gene locus_tag LOCUS_19030 69447 70052 CDS product dimethylamine monooxygenase subunit DmmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968352.1 protein_id gnl|my_center|LOCUS_19030 70049 70999 gene locus_tag LOCUS_19040 70049 70999 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067516.1 protein_id gnl|my_center|LOCUS_19040 71013 72080 gene locus_tag LOCUS_19050 71013 72080 CDS product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067517.1 protein_id gnl|my_center|LOCUS_19050 72087 72791 gene locus_tag LOCUS_19060 72087 72791 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970790.1 protein_id gnl|my_center|LOCUS_19060 72930 73871 gene locus_tag LOCUS_19070 72930 73871 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_19070 73978 75060 gene locus_tag LOCUS_19080 73978 75060 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_19080 75057 77045 gene locus_tag LOCUS_19090 75057 77045 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 protein_id gnl|my_center|LOCUS_19090 77805 77089 gene locus_tag LOCUS_19100 77805 77089 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975830.1 protein_id gnl|my_center|LOCUS_19100 78914 77790 gene locus_tag LOCUS_19110 78914 77790 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975831.1 protein_id gnl|my_center|LOCUS_19110 79136 80851 gene locus_tag LOCUS_19120 79136 80851 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090638.1 protein_id gnl|my_center|LOCUS_19120 80923 82164 gene locus_tag LOCUS_19130 80923 82164 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525075.1 protein_id gnl|my_center|LOCUS_19130 82305 87419 gene locus_tag LOCUS_19140 82305 87419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 88215 87673 gene locus_tag LOCUS_19150 88215 87673 CDS product DUF4269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495197.1 protein_id gnl|my_center|LOCUS_19150 89891 88512 gene locus_tag LOCUS_19160 89891 88512 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918893.1 protein_id gnl|my_center|LOCUS_19160 91672 89900 gene locus_tag LOCUS_19170 91672 89900 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387750.1 protein_id gnl|my_center|LOCUS_19170 95126 91755 gene locus_tag LOCUS_19180 95126 91755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 95554 95478 gene locus_tag LOCUS_t00290 95554 95478 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 95927 96985 gene locus_tag LOCUS_19190 95927 96985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 98021 97176 gene locus_tag LOCUS_19200 98021 97176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 99025 98027 gene locus_tag LOCUS_19210 99025 98027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 99342 98968 gene locus_tag LOCUS_19220 99342 98968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 99980 99345 gene locus_tag LOCUS_19230 99980 99345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 100301 100011 gene locus_tag LOCUS_19240 100301 100011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 101047 100301 gene locus_tag LOCUS_19250 101047 100301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 101370 101627 gene locus_tag LOCUS_19260 101370 101627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 101624 101896 gene locus_tag LOCUS_19270 101624 101896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 101893 102678 gene locus_tag LOCUS_19280 101893 102678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 102720 103355 gene locus_tag LOCUS_19290 102720 103355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 103435 105666 gene locus_tag LOCUS_19300 103435 105666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 105881 106588 gene locus_tag LOCUS_19310 105881 106588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 106714 107136 gene locus_tag LOCUS_19320 106714 107136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 107133 107561 gene locus_tag LOCUS_19330 107133 107561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 107977 108720 gene locus_tag LOCUS_19340 107977 108720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 108713 109639 gene locus_tag LOCUS_19350 108713 109639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 109636 110340 gene locus_tag LOCUS_19360 109636 110340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 110422 111630 gene locus_tag LOCUS_19370 110422 111630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 112099 111647 gene locus_tag LOCUS_19380 112099 111647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 112375 112124 gene locus_tag LOCUS_19390 112375 112124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 112485 113057 gene locus_tag LOCUS_19400 112485 113057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 113005 114996 gene locus_tag LOCUS_19410 113005 114996 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_19410 115015 115224 gene locus_tag LOCUS_19420 115015 115224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 115224 116759 gene locus_tag LOCUS_19430 115224 116759 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339612.1 protein_id gnl|my_center|LOCUS_19430 116816 118831 gene locus_tag LOCUS_19440 116816 118831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 118876 119226 gene locus_tag LOCUS_19450 118876 119226 CDS product DUF2190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384024.1 protein_id gnl|my_center|LOCUS_19450 119223 119540 gene locus_tag LOCUS_19460 119223 119540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 119902 119543 gene locus_tag LOCUS_19470 119902 119543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 120523 119915 gene locus_tag LOCUS_19480 120523 119915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 120590 121222 gene locus_tag LOCUS_19490 120590 121222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 121237 121671 gene locus_tag LOCUS_19500 121237 121671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 121696 122967 gene locus_tag LOCUS_19510 121696 122967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 123010 123366 gene locus_tag LOCUS_19520 123010 123366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 123477 123674 gene locus_tag LOCUS_19530 123477 123674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 123671 127018 gene locus_tag LOCUS_19540 123671 127018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 127430 127020 gene locus_tag LOCUS_19550 127430 127020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 127518 128108 gene locus_tag LOCUS_19560 127518 128108 CDS product DUF2460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383957.1 protein_id gnl|my_center|LOCUS_19560 128186 128536 gene locus_tag LOCUS_19570 128186 128536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 128634 129521 gene locus_tag LOCUS_19580 128634 129521 CDS product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 protein_id gnl|my_center|LOCUS_19580 129518 129958 gene locus_tag LOCUS_19590 129518 129958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 129977 133927 gene locus_tag LOCUS_19600 129977 133927 CDS product glycoside hydrolase/phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383960.1 protein_id gnl|my_center|LOCUS_19600 133940 134638 gene locus_tag LOCUS_19610 133940 134638 CDS product DUF2793 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920229.1 protein_id gnl|my_center|LOCUS_19610 134654 134992 gene locus_tag LOCUS_19620 134654 134992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 135070 135639 gene locus_tag LOCUS_19630 135070 135639 CDS product TIGR02594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021245869.1 protein_id gnl|my_center|LOCUS_19630 135664 135861 gene locus_tag LOCUS_19640 135664 135861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 135858 136091 gene locus_tag LOCUS_19650 135858 136091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 136003 136263 gene locus_tag LOCUS_19660 136003 136263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 136485 136297 gene locus_tag LOCUS_19670 136485 136297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 137870 136647 gene locus_tag LOCUS_19680 137870 136647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 138169 137873 gene locus_tag LOCUS_19690 138169 137873 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_19690 138379 140166 gene locus_tag LOCUS_19700 138379 140166 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393174.1 protein_id gnl|my_center|LOCUS_19700 140235 141479 gene locus_tag LOCUS_19710 140235 141479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 141476 144406 gene locus_tag LOCUS_19720 141476 144406 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393172.1 protein_id gnl|my_center|LOCUS_19720 144417 144734 gene locus_tag LOCUS_19730 144417 144734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 144929 144853 gene locus_tag LOCUS_t00300 144929 144853 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 145083 145982 gene locus_tag LOCUS_19740 145083 145982 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973899.1 protein_id gnl|my_center|LOCUS_19740 146036 146962 gene locus_tag LOCUS_19750 146036 146962 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067112.1 protein_id gnl|my_center|LOCUS_19750 147220 148425 gene locus_tag LOCUS_19760 147220 148425 CDS product NAD-dependent formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169958.1 protein_id gnl|my_center|LOCUS_19760 150964 148556 gene locus_tag LOCUS_19770 150964 148556 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085599.1 protein_id gnl|my_center|LOCUS_19770 151094 151564 gene locus_tag LOCUS_19780 151094 151564 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027546512.1 protein_id gnl|my_center|LOCUS_19780 151623 152429 gene locus_tag LOCUS_19790 151623 152429 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338609.1 protein_id gnl|my_center|LOCUS_19790 154926 152545 gene locus_tag LOCUS_19800 154926 152545 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927044.1 protein_id gnl|my_center|LOCUS_19800 156027 155014 gene locus_tag LOCUS_19810 156027 155014 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396347.1 protein_id gnl|my_center|LOCUS_19810 156234 157262 gene locus_tag LOCUS_19820 gene adhP 156234 157262 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088401.1 protein_id gnl|my_center|LOCUS_19820 157350 158396 gene locus_tag LOCUS_19830 157350 158396 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 protein_id gnl|my_center|LOCUS_19830 158393 161101 gene locus_tag LOCUS_19840 gene rbbA 158393 161101 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 protein_id gnl|my_center|LOCUS_19840 161107 162228 gene locus_tag LOCUS_19850 161107 162228 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943323.1 protein_id gnl|my_center|LOCUS_19850 162412 163224 gene locus_tag LOCUS_19860 162412 163224 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731550.1 protein_id gnl|my_center|LOCUS_19860 163221 165569 gene locus_tag LOCUS_19870 163221 165569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 166930 165893 gene locus_tag LOCUS_19880 166930 165893 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083793.1 protein_id gnl|my_center|LOCUS_19880 167822 167217 gene locus_tag LOCUS_19890 167822 167217 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313570.1 protein_id gnl|my_center|LOCUS_19890 169008 167830 gene locus_tag LOCUS_19900 169008 167830 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974748.1 protein_id gnl|my_center|LOCUS_19900 169647 169081 gene locus_tag LOCUS_19910 169647 169081 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168558.1 protein_id gnl|my_center|LOCUS_19910 170837 169785 gene locus_tag LOCUS_19920 gene selD 170837 169785 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967014.1 protein_id gnl|my_center|LOCUS_19920 172122 170983 gene locus_tag LOCUS_19930 172122 170983 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967012.1 protein_id gnl|my_center|LOCUS_19930 172831 172136 gene locus_tag LOCUS_19940 172831 172136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 173047 176133 gene locus_tag LOCUS_19950 gene fdoG 173047 176133 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967000.1 transl_except (pos:173644..173646,aa:Sec) note codon on position 200 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_19950 176147 177136 gene locus_tag LOCUS_19960 gene fdxH 176147 177136 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967001.1 protein_id gnl|my_center|LOCUS_19960 177136 177864 gene locus_tag LOCUS_19970 177136 177864 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967002.1 protein_id gnl|my_center|LOCUS_19970 177934 178845 gene locus_tag LOCUS_19980 gene fdhE 177934 178845 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967003.1 protein_id gnl|my_center|LOCUS_19980 178850 180268 gene locus_tag LOCUS_19990 gene selA 178850 180268 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967004.1 protein_id gnl|my_center|LOCUS_19990 180265 182283 gene locus_tag LOCUS_20000 gene selB 180265 182283 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967006.1 protein_id gnl|my_center|LOCUS_20000 182237 182332 gene locus_tag LOCUS_t00310 182237 182332 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 184727 182415 gene locus_tag LOCUS_20010 184727 182415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 185704 184718 gene locus_tag LOCUS_20020 185704 184718 CDS product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970096.1 protein_id gnl|my_center|LOCUS_20020 188457 185767 gene locus_tag LOCUS_20030 188457 185767 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876943.1 protein_id gnl|my_center|LOCUS_20030 190670 188463 gene locus_tag LOCUS_20040 gene bcsA 190670 188463 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970094.1 protein_id gnl|my_center|LOCUS_20040 190951 192111 gene locus_tag LOCUS_20050 190951 192111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 192327 193397 gene locus_tag LOCUS_20060 192327 193397 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257389.1 protein_id gnl|my_center|LOCUS_20060 193426 193992 gene locus_tag LOCUS_20070 193426 193992 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929688.1 protein_id gnl|my_center|LOCUS_20070 195683 194076 gene locus_tag LOCUS_20080 gene pyk 195683 194076 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390218.1 protein_id gnl|my_center|LOCUS_20080 196231 197388 gene locus_tag LOCUS_20090 196231 197388 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965507.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence09 1077 265 gene locus_tag LOCUS_20100 1077 265 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328249.1 protein_id gnl|my_center|LOCUS_20100 1319 1954 gene locus_tag LOCUS_20110 1319 1954 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974547.1 protein_id gnl|my_center|LOCUS_20110 2112 2039 gene locus_tag LOCUS_t00320 2112 2039 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2229 2145 gene locus_tag LOCUS_t00330 2229 2145 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2454 3332 gene locus_tag LOCUS_20120 gene rlmB 2454 3332 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921492.1 protein_id gnl|my_center|LOCUS_20120 3732 5363 gene locus_tag LOCUS_20130 3732 5363 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463736.1 protein_id gnl|my_center|LOCUS_20130 5828 5487 gene locus_tag LOCUS_20140 5828 5487 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180940249.1 protein_id gnl|my_center|LOCUS_20140 6573 5947 gene locus_tag LOCUS_20150 6573 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 7027 6605 gene locus_tag LOCUS_20160 7027 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 7315 7389 gene locus_tag LOCUS_t00340 7315 7389 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8297 7395 gene locus_tag LOCUS_20170 8297 7395 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793191.1 protein_id gnl|my_center|LOCUS_20170 8720 9640 gene locus_tag LOCUS_20180 8720 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 10435 9740 gene locus_tag LOCUS_20190 10435 9740 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_20190 11305 10574 gene locus_tag LOCUS_20200 11305 10574 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267668.1 protein_id gnl|my_center|LOCUS_20200 11767 12891 gene locus_tag LOCUS_20210 11767 12891 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846694.1 protein_id gnl|my_center|LOCUS_20210 13050 14126 gene locus_tag LOCUS_20220 13050 14126 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887944.1 protein_id gnl|my_center|LOCUS_20220 14119 15156 gene locus_tag LOCUS_20230 14119 15156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 15353 16150 gene locus_tag LOCUS_20240 15353 16150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 16266 16865 gene locus_tag LOCUS_20250 16266 16865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 16976 17968 gene locus_tag LOCUS_20260 16976 17968 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087556.1 protein_id gnl|my_center|LOCUS_20260 18097 18360 gene locus_tag LOCUS_20270 18097 18360 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089470.1 protein_id gnl|my_center|LOCUS_20270 18717 18412 gene locus_tag LOCUS_20280 18717 18412 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_20280 18885 19586 gene locus_tag LOCUS_20290 18885 19586 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967522.1 protein_id gnl|my_center|LOCUS_20290 20735 19605 gene locus_tag LOCUS_20300 20735 19605 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088267.1 protein_id gnl|my_center|LOCUS_20300 21917 20823 gene locus_tag LOCUS_20310 21917 20823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 22087 22650 gene locus_tag LOCUS_20320 22087 22650 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157335780.1 protein_id gnl|my_center|LOCUS_20320 22654 23253 gene locus_tag LOCUS_20330 22654 23253 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531972.1 protein_id gnl|my_center|LOCUS_20330 23337 24044 gene locus_tag LOCUS_20340 23337 24044 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311122.1 protein_id gnl|my_center|LOCUS_20340 24154 24795 gene locus_tag LOCUS_20350 gene parA 24154 24795 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_20350 25026 25376 gene locus_tag LOCUS_20360 25026 25376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 25711 27690 gene locus_tag LOCUS_20370 25711 27690 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530880.1 protein_id gnl|my_center|LOCUS_20370 27690 31949 gene locus_tag LOCUS_20380 27690 31949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 32768 31956 gene locus_tag LOCUS_20390 32768 31956 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975110.1 protein_id gnl|my_center|LOCUS_20390 32937 34379 gene locus_tag LOCUS_20400 32937 34379 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390653.1 protein_id gnl|my_center|LOCUS_20400 34494 35525 gene locus_tag LOCUS_20410 34494 35525 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719301.1 protein_id gnl|my_center|LOCUS_20410 35525 36241 gene locus_tag LOCUS_20420 35525 36241 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531460.1 protein_id gnl|my_center|LOCUS_20420 36305 37168 gene locus_tag LOCUS_20430 gene sseA 36305 37168 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_20430 37923 37174 gene locus_tag LOCUS_20440 gene map 37923 37174 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087638.1 protein_id gnl|my_center|LOCUS_20440 39026 38229 gene locus_tag LOCUS_20450 39026 38229 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874280.1 protein_id gnl|my_center|LOCUS_20450 40419 39043 gene locus_tag LOCUS_20460 40419 39043 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087220.1 protein_id gnl|my_center|LOCUS_20460 41617 40430 gene locus_tag LOCUS_20470 41617 40430 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 protein_id gnl|my_center|LOCUS_20470 42754 41732 gene locus_tag LOCUS_20480 42754 41732 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_20480 43027 44220 gene locus_tag LOCUS_20490 gene metC 43027 44220 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087217.1 protein_id gnl|my_center|LOCUS_20490 45767 44223 gene locus_tag LOCUS_20500 45767 44223 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087212.1 protein_id gnl|my_center|LOCUS_20500 45714 45887 gene locus_tag LOCUS_20510 45714 45887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 48353 46065 gene locus_tag LOCUS_20520 48353 46065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 49129 48488 gene locus_tag LOCUS_20530 gene ureG 49129 48488 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084276.1 protein_id gnl|my_center|LOCUS_20530 49851 49144 gene locus_tag LOCUS_20540 49851 49144 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084275.1 protein_id gnl|my_center|LOCUS_20540 50595 49861 gene locus_tag LOCUS_20550 50595 49861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 52407 50695 gene locus_tag LOCUS_20560 gene ureC 52407 50695 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965370.1 protein_id gnl|my_center|LOCUS_20560 53079 52459 gene locus_tag LOCUS_20570 53079 52459 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889578.1 protein_id gnl|my_center|LOCUS_20570 54019 53153 gene locus_tag LOCUS_20580 54019 53153 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213364411.1 protein_id gnl|my_center|LOCUS_20580 54689 53994 gene locus_tag LOCUS_20590 gene urtE 54689 53994 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084269.1 protein_id gnl|my_center|LOCUS_20590 55503 54694 gene locus_tag LOCUS_20600 gene urtD 55503 54694 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084268.1 protein_id gnl|my_center|LOCUS_20600 56669 55515 gene locus_tag LOCUS_20610 gene urtC 56669 55515 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 protein_id gnl|my_center|LOCUS_20610 58246 56666 gene locus_tag LOCUS_20620 gene urtB 58246 56666 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084266.1 protein_id gnl|my_center|LOCUS_20620 59803 58493 gene locus_tag LOCUS_20630 gene urtA 59803 58493 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244008.1 protein_id gnl|my_center|LOCUS_20630 61224 60034 gene locus_tag LOCUS_20640 61224 60034 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086586.1 protein_id gnl|my_center|LOCUS_20640 62434 61334 gene locus_tag LOCUS_20650 62434 61334 CDS product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249265.1 protein_id gnl|my_center|LOCUS_20650 63569 62445 gene locus_tag LOCUS_20660 63569 62445 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064172.1 protein_id gnl|my_center|LOCUS_20660 64895 63582 gene locus_tag LOCUS_20670 64895 63582 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268823.1 protein_id gnl|my_center|LOCUS_20670 66352 64895 gene locus_tag LOCUS_20680 66352 64895 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391101.1 protein_id gnl|my_center|LOCUS_20680 67655 66360 gene locus_tag LOCUS_20690 67655 66360 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968505.1 protein_id gnl|my_center|LOCUS_20690 68116 67829 gene locus_tag LOCUS_20700 68116 67829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 69737 68424 gene locus_tag LOCUS_20710 69737 68424 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086738.1 protein_id gnl|my_center|LOCUS_20710 71724 69904 gene locus_tag LOCUS_20720 gene recJ 71724 69904 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967117.1 protein_id gnl|my_center|LOCUS_20720 71898 73265 gene locus_tag LOCUS_20730 71898 73265 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089807.1 protein_id gnl|my_center|LOCUS_20730 74192 73323 gene locus_tag LOCUS_20740 74192 73323 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064142.1 protein_id gnl|my_center|LOCUS_20740 74402 75097 gene locus_tag LOCUS_20750 74402 75097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 75605 75264 gene locus_tag LOCUS_20760 75605 75264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 76820 75822 gene locus_tag LOCUS_20770 gene glpX 76820 75822 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087135.1 protein_id gnl|my_center|LOCUS_20770 78153 76834 gene locus_tag LOCUS_20780 78153 76834 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087134.1 protein_id gnl|my_center|LOCUS_20780 79428 78211 gene locus_tag LOCUS_20790 79428 78211 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171284.1 protein_id gnl|my_center|LOCUS_20790 79855 79592 gene locus_tag LOCUS_20800 79855 79592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 80306 79956 gene locus_tag LOCUS_20810 80306 79956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 80474 80313 gene locus_tag LOCUS_20820 80474 80313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 80422 82245 gene locus_tag LOCUS_20830 gene phaC 80422 82245 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531993.1 protein_id gnl|my_center|LOCUS_20830 83455 82400 gene locus_tag LOCUS_20840 gene argC 83455 82400 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390174.1 protein_id gnl|my_center|LOCUS_20840 83636 83920 gene locus_tag LOCUS_20850 83636 83920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 84019 86061 gene locus_tag LOCUS_20860 gene parE 84019 86061 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087127.1 protein_id gnl|my_center|LOCUS_20860 86707 86078 gene locus_tag LOCUS_20870 86707 86078 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390920.1 protein_id gnl|my_center|LOCUS_20870 87192 86707 gene locus_tag LOCUS_20880 gene greA 87192 86707 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920063.1 protein_id gnl|my_center|LOCUS_20880 87408 89045 gene locus_tag LOCUS_20890 87408 89045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 89451 89095 gene locus_tag LOCUS_20900 89451 89095 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975635.1 protein_id gnl|my_center|LOCUS_20900 89853 89464 gene locus_tag LOCUS_20910 89853 89464 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463761.1 protein_id gnl|my_center|LOCUS_20910 90415 89969 gene locus_tag LOCUS_20920 90415 89969 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275140.1 protein_id gnl|my_center|LOCUS_20920 90792 90409 gene locus_tag LOCUS_20930 90792 90409 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532157.1 protein_id gnl|my_center|LOCUS_20930 92036 90789 gene locus_tag LOCUS_20940 92036 90789 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969430.1 protein_id gnl|my_center|LOCUS_20940 93493 92180 gene locus_tag LOCUS_20950 gene sufD 93493 92180 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087113.1 protein_id gnl|my_center|LOCUS_20950 94268 93504 gene locus_tag LOCUS_20960 gene sufC 94268 93504 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171266.1 protein_id gnl|my_center|LOCUS_20960 95850 94378 gene locus_tag LOCUS_20970 gene sufB 95850 94378 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087111.1 protein_id gnl|my_center|LOCUS_20970 97141 95972 gene locus_tag LOCUS_20980 97141 95972 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_20980 97483 98148 gene locus_tag LOCUS_20990 97483 98148 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143006.1 protein_id gnl|my_center|LOCUS_20990 98589 98224 gene locus_tag LOCUS_21000 98589 98224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 99933 98779 gene locus_tag LOCUS_21010 99933 98779 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087104.1 protein_id gnl|my_center|LOCUS_21010 100020 101276 gene locus_tag LOCUS_21020 gene tyrS 100020 101276 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975628.1 protein_id gnl|my_center|LOCUS_21020 104938 101405 gene locus_tag LOCUS_21030 104938 101405 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171255.1 protein_id gnl|my_center|LOCUS_21030 105100 105567 gene locus_tag LOCUS_21040 gene bcp 105100 105567 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971896.1 protein_id gnl|my_center|LOCUS_21040 106745 105615 gene locus_tag LOCUS_21050 gene prfB 106745 105615 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097531964.1 protein_id gnl|my_center|LOCUS_21050 106902 107519 gene locus_tag LOCUS_21060 106902 107519 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388742.1 protein_id gnl|my_center|LOCUS_21060 109985 107547 gene locus_tag LOCUS_21070 109985 107547 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087080.1 protein_id gnl|my_center|LOCUS_21070 109939 110187 gene locus_tag LOCUS_21080 109939 110187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 111419 110100 gene locus_tag LOCUS_21090 111419 110100 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 protein_id gnl|my_center|LOCUS_21090 111872 111510 gene locus_tag LOCUS_21100 111872 111510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 112169 114949 gene locus_tag LOCUS_21110 112169 114949 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669211.1 protein_id gnl|my_center|LOCUS_21110 115888 115046 gene locus_tag LOCUS_21120 115888 115046 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971279.1 protein_id gnl|my_center|LOCUS_21120 116038 116418 gene locus_tag LOCUS_21130 116038 116418 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971278.1 protein_id gnl|my_center|LOCUS_21130 117638 116445 gene locus_tag LOCUS_21140 117638 116445 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087069.1 protein_id gnl|my_center|LOCUS_21140 117794 119257 gene locus_tag LOCUS_21150 117794 119257 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087068.1 protein_id gnl|my_center|LOCUS_21150 119270 120043 gene locus_tag LOCUS_21160 119270 120043 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087067.1 protein_id gnl|my_center|LOCUS_21160 120180 120617 gene locus_tag LOCUS_21170 gene aroQ 120180 120617 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106162.1 protein_id gnl|my_center|LOCUS_21170 120648 121118 gene locus_tag LOCUS_21180 gene accB 120648 121118 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975143.1 protein_id gnl|my_center|LOCUS_21180 121129 122481 gene locus_tag LOCUS_21190 gene accC 121129 122481 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087063.1 protein_id gnl|my_center|LOCUS_21190 122667 123344 gene locus_tag LOCUS_21200 gene aat 122667 123344 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087059.1 protein_id gnl|my_center|LOCUS_21200 123910 123275 gene locus_tag LOCUS_21210 123910 123275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 124600 124058 gene locus_tag LOCUS_21220 124600 124058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 125208 128915 gene locus_tag LOCUS_21230 125208 128915 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087047.1 protein_id gnl|my_center|LOCUS_21230 129758 130288 gene locus_tag LOCUS_21240 129758 130288 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327899.1 protein_id gnl|my_center|LOCUS_21240 130633 130388 gene locus_tag LOCUS_21250 130633 130388 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008141931.1 protein_id gnl|my_center|LOCUS_21250 131119 130907 gene locus_tag LOCUS_21260 131119 130907 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008141931.1 protein_id gnl|my_center|LOCUS_21260 131680 131372 gene locus_tag LOCUS_21270 131680 131372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 134140 131861 gene locus_tag LOCUS_21280 134140 131861 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086918.1 protein_id gnl|my_center|LOCUS_21280 134316 136334 gene locus_tag LOCUS_21290 134316 136334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966787.1 protein_id gnl|my_center|LOCUS_21290 138504 136477 gene locus_tag LOCUS_21300 138504 136477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 139136 138666 gene locus_tag LOCUS_21310 139136 138666 CDS product DUF992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529650.1 protein_id gnl|my_center|LOCUS_21310 139276 140424 gene locus_tag LOCUS_21320 gene rnd 139276 140424 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086908.1 protein_id gnl|my_center|LOCUS_21320 142008 140491 gene locus_tag LOCUS_21330 gene ppx 142008 140491 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086895.1 protein_id gnl|my_center|LOCUS_21330 144232 142013 gene locus_tag LOCUS_21340 144232 142013 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171108.1 protein_id gnl|my_center|LOCUS_21340 145068 144349 gene locus_tag LOCUS_21350 145068 144349 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086897.1 protein_id gnl|my_center|LOCUS_21350 146202 145072 gene locus_tag LOCUS_21360 146202 145072 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312858.1 protein_id gnl|my_center|LOCUS_21360 146467 147216 gene locus_tag LOCUS_21370 146467 147216 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529221.1 protein_id gnl|my_center|LOCUS_21370 147306 148451 gene locus_tag LOCUS_21380 147306 148451 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337231.1 protein_id gnl|my_center|LOCUS_21380 148529 149608 gene locus_tag LOCUS_21390 gene purM 148529 149608 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086899.1 protein_id gnl|my_center|LOCUS_21390 149707 150381 gene locus_tag LOCUS_21400 gene purN 149707 150381 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390017.1 protein_id gnl|my_center|LOCUS_21400 151211 150384 gene locus_tag LOCUS_21410 151211 150384 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_21410 153463 151310 gene locus_tag LOCUS_21420 153463 151310 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088785.1 protein_id gnl|my_center|LOCUS_21420 154293 153544 gene locus_tag LOCUS_21430 154293 153544 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064061.1 protein_id gnl|my_center|LOCUS_21430 155145 154453 gene locus_tag LOCUS_21440 155145 154453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 155939 155517 gene locus_tag LOCUS_21450 gene ndk 155939 155517 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086893.1 protein_id gnl|my_center|LOCUS_21450 156067 156441 gene locus_tag LOCUS_21460 156067 156441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 156748 156449 gene locus_tag LOCUS_21470 156748 156449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 156708 156926 gene locus_tag LOCUS_21480 156708 156926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 157366 157944 gene locus_tag LOCUS_21490 157366 157944 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974971.1 protein_id gnl|my_center|LOCUS_21490 158023 159888 gene locus_tag LOCUS_21500 158023 159888 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532466.1 protein_id gnl|my_center|LOCUS_21500 161338 160112 gene locus_tag LOCUS_21510 161338 160112 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532581.1 protein_id gnl|my_center|LOCUS_21510 162105 161659 gene locus_tag LOCUS_21520 162105 161659 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532504.1 protein_id gnl|my_center|LOCUS_21520 163628 162120 gene locus_tag LOCUS_21530 163628 162120 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171097.1 protein_id gnl|my_center|LOCUS_21530 163834 164991 gene locus_tag LOCUS_21540 gene lptF 163834 164991 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086881.1 protein_id gnl|my_center|LOCUS_21540 165029 166114 gene locus_tag LOCUS_21550 gene lptG 165029 166114 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966780.1 protein_id gnl|my_center|LOCUS_21550 166111 168591 gene locus_tag LOCUS_21560 166111 168591 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084755.1 protein_id gnl|my_center|LOCUS_21560 168862 169743 gene locus_tag LOCUS_21570 168862 169743 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171094.1 protein_id gnl|my_center|LOCUS_21570 169865 170845 gene locus_tag LOCUS_21580 gene pdxA 169865 170845 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086877.1 protein_id gnl|my_center|LOCUS_21580 170842 171726 gene locus_tag LOCUS_21590 gene rsmA 170842 171726 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314585.1 protein_id gnl|my_center|LOCUS_21590 172361 171699 gene locus_tag LOCUS_21600 gene gmk 172361 171699 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971396.1 protein_id gnl|my_center|LOCUS_21600 173256 172369 gene locus_tag LOCUS_21610 173256 172369 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086861.1 protein_id gnl|my_center|LOCUS_21610 174490 173327 gene locus_tag LOCUS_21620 gene mltG 174490 173327 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086860.1 protein_id gnl|my_center|LOCUS_21620 175879 174617 gene locus_tag LOCUS_21630 gene fabF 175879 174617 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086859.1 protein_id gnl|my_center|LOCUS_21630 176185 175949 gene locus_tag LOCUS_21640 176185 175949 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130699.1 protein_id gnl|my_center|LOCUS_21640 177151 176414 gene locus_tag LOCUS_21650 gene fabG 177151 176414 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086858.1 protein_id gnl|my_center|LOCUS_21650 178117 177167 gene locus_tag LOCUS_21660 gene fabD 178117 177167 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086857.1 protein_id gnl|my_center|LOCUS_21660 178308 179162 gene locus_tag LOCUS_21670 178308 179162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 179421 179909 gene locus_tag LOCUS_21680 179421 179909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 179909 180178 gene locus_tag LOCUS_21690 gene rpsR 179909 180178 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615089.1 protein_id gnl|my_center|LOCUS_21690 180319 181275 gene locus_tag LOCUS_21700 180319 181275 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086853.1 protein_id gnl|my_center|LOCUS_21700 181313 181891 gene locus_tag LOCUS_21710 gene rplI 181313 181891 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532521.1 protein_id gnl|my_center|LOCUS_21710 182112 183371 gene locus_tag LOCUS_21720 182112 183371 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171076.1 protein_id gnl|my_center|LOCUS_21720 183548 185032 gene locus_tag LOCUS_21730 183548 185032 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532525.1 protein_id gnl|my_center|LOCUS_21730 185067 186182 gene locus_tag LOCUS_21740 gene alr 185067 186182 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967543.1 protein_id gnl|my_center|LOCUS_21740 186547 186164 gene locus_tag LOCUS_21750 186547 186164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 186701 188209 gene locus_tag LOCUS_21760 gene radA 186701 188209 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086838.1 protein_id gnl|my_center|LOCUS_21760 188315 188896 gene locus_tag LOCUS_21770 188315 188896 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086837.1 protein_id gnl|my_center|LOCUS_21770 189000 190499 gene locus_tag LOCUS_21780 gene purF 189000 190499 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086836.1 protein_id gnl|my_center|LOCUS_21780 190516 190932 gene locus_tag LOCUS_21790 190516 190932 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043877724.1 protein_id gnl|my_center|LOCUS_21790 190949 191707 gene locus_tag LOCUS_21800 190949 191707 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086835.1 protein_id gnl|my_center|LOCUS_21800 192620 191682 gene locus_tag LOCUS_21810 192620 191682 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193566.1 protein_id gnl|my_center|LOCUS_21810 194188 192836 gene locus_tag LOCUS_21820 gene der 194188 192836 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086828.1 protein_id gnl|my_center|LOCUS_21820 194484 194209 gene locus_tag LOCUS_21830 194484 194209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 195205 194495 gene locus_tag LOCUS_21840 195205 194495 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086826.1 protein_id gnl|my_center|LOCUS_21840 196164 195343 gene locus_tag LOCUS_21850 gene panB 196164 195343 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086824.1 protein_id gnl|my_center|LOCUS_21850 196767 196198 gene locus_tag LOCUS_21860 196767 196198 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061445.1 protein_id gnl|my_center|LOCUS_21860 196946 197377 gene locus_tag LOCUS_21870 196946 197377 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090878.1 protein_id gnl|my_center|LOCUS_21870 197473 198624 gene locus_tag LOCUS_21880 197473 198624 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531843.1 protein_id gnl|my_center|LOCUS_21880 200249 198642 gene locus_tag LOCUS_21890 200249 198642 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086821.1 protein_id gnl|my_center|LOCUS_21890 200656 200309 gene locus_tag LOCUS_21900 200656 200309 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067705.1 protein_id gnl|my_center|LOCUS_21900 201480 200674 gene locus_tag LOCUS_21910 201480 200674 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388722.1 protein_id gnl|my_center|LOCUS_21910 201974 201486 gene locus_tag LOCUS_21920 201974 201486 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175651.1 protein_id gnl|my_center|LOCUS_21920 202471 202007 gene locus_tag LOCUS_21930 202471 202007 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175650.1 protein_id gnl|my_center|LOCUS_21930 202826 204043 gene locus_tag LOCUS_21940 202826 204043 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097941129.1 protein_id gnl|my_center|LOCUS_21940 204145 205008 gene locus_tag LOCUS_21950 204145 205008 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_21950 205005 205937 gene locus_tag LOCUS_21960 205005 205937 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546311.1 protein_id gnl|my_center|LOCUS_21960 205934 206692 gene locus_tag LOCUS_21970 205934 206692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809682.1 protein_id gnl|my_center|LOCUS_21970 206685 207401 gene locus_tag LOCUS_21980 206685 207401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173513.1 protein_id gnl|my_center|LOCUS_21980 207502 208995 gene locus_tag LOCUS_21990 207502 208995 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_21990 209008 209997 gene locus_tag LOCUS_22000 209008 209997 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_22000 209987 210790 gene locus_tag LOCUS_22010 209987 210790 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_22010 210920 211867 gene locus_tag LOCUS_22020 210920 211867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 214429 211991 gene locus_tag LOCUS_22030 214429 211991 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406167.1 protein_id gnl|my_center|LOCUS_22030 215209 214433 gene locus_tag LOCUS_22040 215209 214433 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389258.1 protein_id gnl|my_center|LOCUS_22040 215320 216093 gene locus_tag LOCUS_22050 gene pxpB 215320 216093 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_22050 216090 217127 gene locus_tag LOCUS_22060 216090 217127 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389259.1 protein_id gnl|my_center|LOCUS_22060 217196 217987 gene locus_tag LOCUS_22070 217196 217987 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812103.1 protein_id gnl|my_center|LOCUS_22070 219196 218009 gene locus_tag LOCUS_22080 219196 218009 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086136.1 protein_id gnl|my_center|LOCUS_22080 220041 219193 gene locus_tag LOCUS_22090 220041 219193 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086135.1 protein_id gnl|my_center|LOCUS_22090 222341 220038 gene locus_tag LOCUS_22100 222341 220038 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086134.1 protein_id gnl|my_center|LOCUS_22100 222225 222440 gene locus_tag LOCUS_22110 222225 222440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 222596 224908 gene locus_tag LOCUS_22120 222596 224908 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_22120 225295 224984 gene locus_tag LOCUS_22130 225295 224984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 225248 226321 gene locus_tag LOCUS_22140 225248 226321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 227096 226362 gene locus_tag LOCUS_22150 227096 226362 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088990.1 protein_id gnl|my_center|LOCUS_22150 228775 227213 gene locus_tag LOCUS_22160 228775 227213 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 protein_id gnl|my_center|LOCUS_22160 229312 228815 gene locus_tag LOCUS_22170 229312 228815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090222.1 protein_id gnl|my_center|LOCUS_22170 230309 229362 gene locus_tag LOCUS_22180 230309 229362 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086130.1 protein_id gnl|my_center|LOCUS_22180 231156 230320 gene locus_tag LOCUS_22190 231156 230320 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066677.1 protein_id gnl|my_center|LOCUS_22190 232283 231357 gene locus_tag LOCUS_22200 232283 231357 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066914.1 protein_id gnl|my_center|LOCUS_22200 233899 232502 gene locus_tag LOCUS_22210 233899 232502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 235113 233941 gene locus_tag LOCUS_22220 gene ugpC 235113 233941 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727007.1 protein_id gnl|my_center|LOCUS_22220 236207 235110 gene locus_tag LOCUS_22230 236207 235110 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339184.1 protein_id gnl|my_center|LOCUS_22230 237089 236391 gene locus_tag LOCUS_22240 gene cofC 237089 236391 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256112.1 protein_id gnl|my_center|LOCUS_22240 238033 237086 gene locus_tag LOCUS_22250 gene cofD 238033 237086 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_22250 238788 238030 gene locus_tag LOCUS_22260 gene cofE 238788 238030 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_22260 239799 238795 gene locus_tag LOCUS_22270 gene fgd 239799 238795 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892203.1 protein_id gnl|my_center|LOCUS_22270 240009 241037 gene locus_tag LOCUS_22280 240009 241037 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095519074.1 protein_id gnl|my_center|LOCUS_22280 241050 242600 gene locus_tag LOCUS_22290 241050 242600 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817405.1 protein_id gnl|my_center|LOCUS_22290 242937 242716 gene locus_tag LOCUS_22300 242937 242716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 243206 244468 gene locus_tag LOCUS_22310 243206 244468 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240214.1 protein_id gnl|my_center|LOCUS_22310 244843 244499 gene locus_tag LOCUS_22320 244843 244499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 246079 244877 gene locus_tag LOCUS_22330 gene gltS 246079 244877 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209005.1 protein_id gnl|my_center|LOCUS_22330 246238 247065 gene locus_tag LOCUS_22340 246238 247065 CDS product quinoprotein dehydrogenase-associated SoxYZ-like carrier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532068.1 protein_id gnl|my_center|LOCUS_22340 247370 249163 gene locus_tag LOCUS_22350 247370 249163 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066137.1 protein_id gnl|my_center|LOCUS_22350 249712 249275 gene locus_tag LOCUS_22360 249712 249275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975077.1 protein_id gnl|my_center|LOCUS_22360 250437 249757 gene locus_tag LOCUS_22370 250437 249757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162305183.1 protein_id gnl|my_center|LOCUS_22370 251629 250460 gene locus_tag LOCUS_22380 gene pqqE 251629 250460 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532078.1 protein_id gnl|my_center|LOCUS_22380 251937 251626 gene locus_tag LOCUS_22390 gene pqqD 251937 251626 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391417.1 protein_id gnl|my_center|LOCUS_22390 252671 251934 gene locus_tag LOCUS_22400 gene pqqC 252671 251934 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038061.1 protein_id gnl|my_center|LOCUS_22400 253345 252668 gene locus_tag LOCUS_22410 253345 252668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 254589 253900 gene locus_tag LOCUS_22420 254589 253900 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_22420 256202 254586 gene locus_tag LOCUS_22430 256202 254586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 256581 256372 gene locus_tag LOCUS_22440 256581 256372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 257056 257565 gene locus_tag LOCUS_22450 gene fae 257056 257565 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532036.1 protein_id gnl|my_center|LOCUS_22450 258576 257833 gene locus_tag LOCUS_22460 258576 257833 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532066.1 protein_id gnl|my_center|LOCUS_22460 259322 258573 gene locus_tag LOCUS_22470 259322 258573 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173656.1 protein_id gnl|my_center|LOCUS_22470 260325 259330 gene locus_tag LOCUS_22480 260325 259330 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532064.1 protein_id gnl|my_center|LOCUS_22480 260858 260322 gene locus_tag LOCUS_22490 260858 260322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 261206 262453 gene locus_tag LOCUS_22500 261206 262453 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088928.1 protein_id gnl|my_center|LOCUS_22500 262491 263474 gene locus_tag LOCUS_22510 262491 263474 CDS product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140179.1 protein_id gnl|my_center|LOCUS_22510 263522 263947 gene locus_tag LOCUS_22520 263522 263947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 264029 264826 gene locus_tag LOCUS_22530 264029 264826 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088930.1 protein_id gnl|my_center|LOCUS_22530 264823 265665 gene locus_tag LOCUS_22540 264823 265665 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088931.1 protein_id gnl|my_center|LOCUS_22540 265713 266363 gene locus_tag LOCUS_22550 265713 266363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088932.1 protein_id gnl|my_center|LOCUS_22550 266954 266367 gene locus_tag LOCUS_22560 266954 266367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 267596 267000 gene locus_tag LOCUS_22570 267596 267000 CDS product PQQ-dependent catabolism-associated CXXCW motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088934.1 protein_id gnl|my_center|LOCUS_22570 268350 267625 gene locus_tag LOCUS_22580 268350 267625 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966732.1 protein_id gnl|my_center|LOCUS_22580 269062 268469 gene locus_tag LOCUS_22590 269062 268469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 271108 269303 gene locus_tag LOCUS_22600 271108 269303 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975084.1 protein_id gnl|my_center|LOCUS_22600 272500 271493 gene locus_tag LOCUS_22610 272500 271493 CDS product quinoprotein relay system zinc metallohydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966742.1 protein_id gnl|my_center|LOCUS_22610 272945 272541 gene locus_tag LOCUS_22620 272945 272541 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975083.1 protein_id gnl|my_center|LOCUS_22620 273115 273300 gene locus_tag LOCUS_22630 273115 273300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 274124 273225 gene locus_tag LOCUS_22640 274124 273225 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089700.1 protein_id gnl|my_center|LOCUS_22640 274364 275152 gene locus_tag LOCUS_22650 274364 275152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 276089 275172 gene locus_tag LOCUS_22660 276089 275172 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243122.1 protein_id gnl|my_center|LOCUS_22660 277168 276275 gene locus_tag LOCUS_22670 277168 276275 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104428.1 protein_id gnl|my_center|LOCUS_22670 277666 277379 gene locus_tag LOCUS_22680 277666 277379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 277721 278209 gene locus_tag LOCUS_22690 277721 278209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 278391 280451 gene locus_tag LOCUS_22700 278391 280451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 280466 280672 gene locus_tag LOCUS_22710 280466 280672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 280669 281622 gene locus_tag LOCUS_22720 280669 281622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 281747 282523 gene locus_tag LOCUS_22730 281747 282523 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082773.1 protein_id gnl|my_center|LOCUS_22730 282548 283663 gene locus_tag LOCUS_22740 282548 283663 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974144.1 protein_id gnl|my_center|LOCUS_22740 283871 284062 gene locus_tag LOCUS_22750 283871 284062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 286179 284140 gene locus_tag LOCUS_22760 286179 284140 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083089.1 protein_id gnl|my_center|LOCUS_22760 286449 287291 gene locus_tag LOCUS_22770 286449 287291 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268112.1 protein_id gnl|my_center|LOCUS_22770 290412 287332 gene locus_tag LOCUS_22780 290412 287332 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086679.1 protein_id gnl|my_center|LOCUS_22780 291545 290415 gene locus_tag LOCUS_22790 291545 290415 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966871.1 protein_id gnl|my_center|LOCUS_22790 292588 291671 gene locus_tag LOCUS_22800 292588 291671 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089701.1 protein_id gnl|my_center|LOCUS_22800 292680 293678 gene locus_tag LOCUS_22810 292680 293678 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973721.1 protein_id gnl|my_center|LOCUS_22810 293695 294516 gene locus_tag LOCUS_22820 293695 294516 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973722.1 protein_id gnl|my_center|LOCUS_22820 294528 295745 gene locus_tag LOCUS_22830 294528 295745 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811192.1 protein_id gnl|my_center|LOCUS_22830 295841 296272 gene locus_tag LOCUS_22840 295841 296272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 297865 296294 gene locus_tag LOCUS_22850 gene guaA 297865 296294 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310127.1 protein_id gnl|my_center|LOCUS_22850 299236 297911 gene locus_tag LOCUS_22860 299236 297911 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086762.1 protein_id gnl|my_center|LOCUS_22860 299678 299247 gene locus_tag LOCUS_22870 299678 299247 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171008.1 protein_id gnl|my_center|LOCUS_22870 301214 299724 gene locus_tag LOCUS_22880 gene guaB 301214 299724 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974584.1 protein_id gnl|my_center|LOCUS_22880 301262 301447 gene locus_tag LOCUS_22890 301262 301447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 301552 302985 gene locus_tag LOCUS_22900 301552 302985 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086748.1 protein_id gnl|my_center|LOCUS_22900 303044 304009 gene locus_tag LOCUS_22910 303044 304009 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970872.1 protein_id gnl|my_center|LOCUS_22910 304006 304734 gene locus_tag LOCUS_22920 304006 304734 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970873.1 protein_id gnl|my_center|LOCUS_22920 306136 304847 gene locus_tag LOCUS_22930 306136 304847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 307428 306733 gene locus_tag LOCUS_22940 307428 306733 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086747.1 protein_id gnl|my_center|LOCUS_22940 308735 307431 gene locus_tag LOCUS_22950 308735 307431 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992219.1 protein_id gnl|my_center|LOCUS_22950 310168 308849 gene locus_tag LOCUS_22960 310168 308849 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531507.1 protein_id gnl|my_center|LOCUS_22960 310367 311590 gene locus_tag LOCUS_22970 gene cyoA 310367 311590 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082981.1 protein_id gnl|my_center|LOCUS_22970 311598 313607 gene locus_tag LOCUS_22980 gene cyoB 311598 313607 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531505.1 protein_id gnl|my_center|LOCUS_22980 313619 314251 gene locus_tag LOCUS_22990 gene cyoC 313619 314251 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082983.1 protein_id gnl|my_center|LOCUS_22990 314248 314652 gene locus_tag LOCUS_23000 gene cyoD 314248 314652 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809276.1 protein_id gnl|my_center|LOCUS_23000 314649 315443 gene locus_tag LOCUS_23010 314649 315443 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992415.1 protein_id gnl|my_center|LOCUS_23010 315660 315902 gene locus_tag LOCUS_23020 315660 315902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 316021 316140 gene locus_tag LOCUS_23030 316021 316140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 316297 316224 gene locus_tag LOCUS_t00350 316297 316224 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 316761 316964 gene locus_tag LOCUS_23040 316761 316964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 319083 316951 gene locus_tag LOCUS_23050 gene pbpC 319083 316951 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494094.1 protein_id gnl|my_center|LOCUS_23050 324413 319080 gene locus_tag LOCUS_23060 324413 319080 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087210.1 protein_id gnl|my_center|LOCUS_23060 324669 324950 gene locus_tag LOCUS_23070 324669 324950 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007592476.1 protein_id gnl|my_center|LOCUS_23070 324985 325497 gene locus_tag LOCUS_23080 324985 325497 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316342.1 protein_id gnl|my_center|LOCUS_23080 325490 326674 gene locus_tag LOCUS_23090 325490 326674 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086590.1 protein_id gnl|my_center|LOCUS_23090 326714 327994 gene locus_tag LOCUS_23100 326714 327994 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086589.1 protein_id gnl|my_center|LOCUS_23100 327991 328743 gene locus_tag LOCUS_23110 327991 328743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 328855 329877 gene locus_tag LOCUS_23120 328855 329877 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240549.1 protein_id gnl|my_center|LOCUS_23120 329898 330815 gene locus_tag LOCUS_23130 329898 330815 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086588.1 protein_id gnl|my_center|LOCUS_23130 332231 331122 gene locus_tag LOCUS_23140 332231 331122 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530248.1 protein_id gnl|my_center|LOCUS_23140 333765 332362 gene locus_tag LOCUS_23150 333765 332362 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037491.1 protein_id gnl|my_center|LOCUS_23150 333934 335313 gene locus_tag LOCUS_23160 333934 335313 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 protein_id gnl|my_center|LOCUS_23160 335394 336773 gene locus_tag LOCUS_23170 335394 336773 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528228.1 protein_id gnl|my_center|LOCUS_23170 337270 336929 gene locus_tag LOCUS_23180 337270 336929 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210342306.1 protein_id gnl|my_center|LOCUS_23180 338383 337361 gene locus_tag LOCUS_23190 338383 337361 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404420.1 protein_id gnl|my_center|LOCUS_23190 338603 339505 gene locus_tag LOCUS_23200 338603 339505 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530338.1 protein_id gnl|my_center|LOCUS_23200 339576 340799 gene locus_tag LOCUS_23210 gene chrA 339576 340799 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186611.1 protein_id gnl|my_center|LOCUS_23210 341587 340817 gene locus_tag LOCUS_23220 341587 340817 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939072.1 protein_id gnl|my_center|LOCUS_23220 341854 342441 gene locus_tag LOCUS_23230 341854 342441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 342807 343049 gene locus_tag LOCUS_23240 342807 343049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 344025 343150 gene locus_tag LOCUS_23250 344025 343150 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086578.1 protein_id gnl|my_center|LOCUS_23250 344755 344057 gene locus_tag LOCUS_23260 344755 344057 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086577.1 protein_id gnl|my_center|LOCUS_23260 346950 344914 gene locus_tag LOCUS_23270 346950 344914 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086576.1 protein_id gnl|my_center|LOCUS_23270 347410 347057 gene locus_tag LOCUS_23280 347410 347057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 347577 348188 gene locus_tag LOCUS_23290 347577 348188 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170865.1 protein_id gnl|my_center|LOCUS_23290 349442 348198 gene locus_tag LOCUS_23300 349442 348198 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965436.1 protein_id gnl|my_center|LOCUS_23300 349704 350873 gene locus_tag LOCUS_23310 349704 350873 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976508.1 protein_id gnl|my_center|LOCUS_23310 351605 351081 gene locus_tag LOCUS_23320 351605 351081 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966251.1 protein_id gnl|my_center|LOCUS_23320 352996 351602 gene locus_tag LOCUS_23330 gene cysS 352996 351602 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086571.1 protein_id gnl|my_center|LOCUS_23330 353364 353696 gene locus_tag LOCUS_23340 353364 353696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170860.1 protein_id gnl|my_center|LOCUS_23340 354328 353816 gene locus_tag LOCUS_23350 354328 353816 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086924.1 protein_id gnl|my_center|LOCUS_23350 354505 355542 gene locus_tag LOCUS_23360 354505 355542 CDS product DUF2865 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086569.1 protein_id gnl|my_center|LOCUS_23360 357024 355678 gene locus_tag LOCUS_23370 gene gltX 357024 355678 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531892.1 protein_id gnl|my_center|LOCUS_23370 358703 357030 gene locus_tag LOCUS_23380 358703 357030 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086561.1 protein_id gnl|my_center|LOCUS_23380 360436 358754 gene locus_tag LOCUS_23390 360436 358754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 361985 360549 gene locus_tag LOCUS_23400 361985 360549 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086559.1 protein_id gnl|my_center|LOCUS_23400 363499 362078 gene locus_tag LOCUS_23410 gene gor 363499 362078 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086538.1 protein_id gnl|my_center|LOCUS_23410 363701 364663 gene locus_tag LOCUS_23420 363701 364663 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969884.1 protein_id gnl|my_center|LOCUS_23420 364748 365230 gene locus_tag LOCUS_23430 364748 365230 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244097.1 protein_id gnl|my_center|LOCUS_23430 365243 366754 gene locus_tag LOCUS_23440 365243 366754 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172209.1 protein_id gnl|my_center|LOCUS_23440 367421 366840 gene locus_tag LOCUS_23450 367421 366840 CDS product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086537.1 protein_id gnl|my_center|LOCUS_23450 368158 367445 gene locus_tag LOCUS_23460 gene rpiA 368158 367445 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086536.1 protein_id gnl|my_center|LOCUS_23460 368851 368306 gene locus_tag LOCUS_23470 368851 368306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 369341 369087 gene locus_tag LOCUS_23480 369341 369087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 369885 370568 gene locus_tag LOCUS_23490 369885 370568 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086535.1 protein_id gnl|my_center|LOCUS_23490 370662 370736 gene locus_tag LOCUS_t00360 370662 370736 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 371825 370932 gene locus_tag LOCUS_23500 371825 370932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 372636 371992 gene locus_tag LOCUS_23510 372636 371992 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087468.1 protein_id gnl|my_center|LOCUS_23510 373095 374120 gene locus_tag LOCUS_23520 373095 374120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 374379 374191 gene locus_tag LOCUS_23530 374379 374191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 374285 374878 gene locus_tag LOCUS_23540 374285 374878 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172955.1 protein_id gnl|my_center|LOCUS_23540 375534 375154 gene locus_tag LOCUS_23550 375534 375154 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328553.1 protein_id gnl|my_center|LOCUS_23550 375769 376815 gene locus_tag LOCUS_23560 gene moaA 375769 376815 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971804.1 protein_id gnl|my_center|LOCUS_23560 376952 378151 gene locus_tag LOCUS_23570 376952 378151 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186025.1 protein_id gnl|my_center|LOCUS_23570 378266 379204 gene locus_tag LOCUS_23580 378266 379204 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328556.1 protein_id gnl|my_center|LOCUS_23580 380407 379307 gene locus_tag LOCUS_23590 380407 379307 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170829.1 protein_id gnl|my_center|LOCUS_23590 381581 380457 gene locus_tag LOCUS_23600 381581 380457 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170829.1 protein_id gnl|my_center|LOCUS_23600 382854 381763 gene locus_tag LOCUS_23610 382854 381763 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170829.1 protein_id gnl|my_center|LOCUS_23610 383061 383939 gene locus_tag LOCUS_23620 383061 383939 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395810.1 protein_id gnl|my_center|LOCUS_23620 385151 383946 gene locus_tag LOCUS_23630 385151 383946 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170828.1 protein_id gnl|my_center|LOCUS_23630 385395 386171 gene locus_tag LOCUS_23640 385395 386171 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535100.1 protein_id gnl|my_center|LOCUS_23640 386265 386987 gene locus_tag LOCUS_23650 386265 386987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971933.1 protein_id gnl|my_center|LOCUS_23650 386987 387736 gene locus_tag LOCUS_23660 386987 387736 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969531.1 protein_id gnl|my_center|LOCUS_23660 388400 387762 gene locus_tag LOCUS_23670 388400 387762 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531711.1 protein_id gnl|my_center|LOCUS_23670 389189 388737 gene locus_tag LOCUS_23680 389189 388737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 390334 389312 gene locus_tag LOCUS_23690 gene cobT 390334 389312 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535313.1 protein_id gnl|my_center|LOCUS_23690 390412 391116 gene locus_tag LOCUS_23700 gene bluB 390412 391116 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391283.1 protein_id gnl|my_center|LOCUS_23700 391132 391965 gene locus_tag LOCUS_23710 gene cobS 391132 391965 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388426.1 protein_id gnl|my_center|LOCUS_23710 392119 391943 gene locus_tag LOCUS_23720 392119 391943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 392147 392872 gene locus_tag LOCUS_23730 392147 392872 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314021.1 protein_id gnl|my_center|LOCUS_23730 393729 392893 gene locus_tag LOCUS_23740 393729 392893 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965087.1 protein_id gnl|my_center|LOCUS_23740 394706 393729 gene locus_tag LOCUS_23750 gene dusA 394706 393729 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086515.1 protein_id gnl|my_center|LOCUS_23750 396026 395100 gene locus_tag LOCUS_23760 396026 395100 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965085.1 protein_id gnl|my_center|LOCUS_23760 396178 397092 gene locus_tag LOCUS_23770 396178 397092 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_23770 398540 397491 gene locus_tag LOCUS_23780 398540 397491 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268656.1 protein_id gnl|my_center|LOCUS_23780 399667 398774 gene locus_tag LOCUS_23790 399667 398774 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088296.1 protein_id gnl|my_center|LOCUS_23790 400066 400416 gene locus_tag LOCUS_23800 400066 400416 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967777.1 protein_id gnl|my_center|LOCUS_23800 400561 400893 gene locus_tag LOCUS_23810 400561 400893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 401084 401530 gene locus_tag LOCUS_23820 401084 401530 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967781.1 protein_id gnl|my_center|LOCUS_23820 401542 403782 gene locus_tag LOCUS_23830 401542 403782 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967780.1 protein_id gnl|my_center|LOCUS_23830 405198 403987 gene locus_tag LOCUS_23840 405198 403987 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705164.1 protein_id gnl|my_center|LOCUS_23840 405565 406632 gene locus_tag LOCUS_23850 405565 406632 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 protein_id gnl|my_center|LOCUS_23850 406693 407388 gene locus_tag LOCUS_23860 406693 407388 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530572.1 protein_id gnl|my_center|LOCUS_23860 407501 408745 gene locus_tag LOCUS_23870 407501 408745 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083372.1 protein_id gnl|my_center|LOCUS_23870 408975 409361 gene locus_tag LOCUS_23880 408975 409361 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971000.1 protein_id gnl|my_center|LOCUS_23880 409469 410683 gene locus_tag LOCUS_23890 409469 410683 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061389.1 protein_id gnl|my_center|LOCUS_23890 411783 410809 gene locus_tag LOCUS_23900 411783 410809 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337354.1 protein_id gnl|my_center|LOCUS_23900 413259 411808 gene locus_tag LOCUS_23910 413259 411808 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337991.1 protein_id gnl|my_center|LOCUS_23910 414372 413356 gene locus_tag LOCUS_23920 414372 413356 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337989.1 protein_id gnl|my_center|LOCUS_23920 415213 414383 gene locus_tag LOCUS_23930 415213 414383 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066579.1 protein_id gnl|my_center|LOCUS_23930 416087 415215 gene locus_tag LOCUS_23940 416087 415215 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337987.1 protein_id gnl|my_center|LOCUS_23940 417671 416349 gene locus_tag LOCUS_23950 417671 416349 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387630.1 protein_id gnl|my_center|LOCUS_23950 418932 417976 gene locus_tag LOCUS_23960 418932 417976 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337985.1 protein_id gnl|my_center|LOCUS_23960 419621 418929 gene locus_tag LOCUS_23970 419621 418929 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337984.1 protein_id gnl|my_center|LOCUS_23970 420152 420649 gene locus_tag LOCUS_23980 420152 420649 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974565.1 protein_id gnl|my_center|LOCUS_23980 420751 421680 gene locus_tag LOCUS_23990 420751 421680 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974566.1 protein_id gnl|my_center|LOCUS_23990 421781 424213 gene locus_tag LOCUS_24000 421781 424213 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066717.1 protein_id gnl|my_center|LOCUS_24000 424240 425187 gene locus_tag LOCUS_24010 424240 425187 CDS product ferric iron reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162180344.1 protein_id gnl|my_center|LOCUS_24010 425184 426110 gene locus_tag LOCUS_24020 425184 426110 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066713.1 protein_id gnl|my_center|LOCUS_24020 426107 427144 gene locus_tag LOCUS_24030 426107 427144 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973254.1 protein_id gnl|my_center|LOCUS_24030 427144 428085 gene locus_tag LOCUS_24040 427144 428085 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973255.1 protein_id gnl|my_center|LOCUS_24040 428078 428872 gene locus_tag LOCUS_24050 428078 428872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973256.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence10 1742 414 gene locus_tag LOCUS_24060 gene ispG 1742 414 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083758.1 protein_id gnl|my_center|LOCUS_24060 2497 1844 gene locus_tag LOCUS_24070 2497 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2781 3236 gene locus_tag LOCUS_24080 2781 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 3372 4157 gene locus_tag LOCUS_24090 3372 4157 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529312.1 protein_id gnl|my_center|LOCUS_24090 4154 5797 gene locus_tag LOCUS_24100 4154 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 8118 5872 gene locus_tag LOCUS_24110 8118 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 8374 9126 gene locus_tag LOCUS_24120 8374 9126 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174878.1 protein_id gnl|my_center|LOCUS_24120 10159 9188 gene locus_tag LOCUS_24130 10159 9188 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528618.1 protein_id gnl|my_center|LOCUS_24130 10429 11736 gene locus_tag LOCUS_24140 10429 11736 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_24140 11911 13629 gene locus_tag LOCUS_24150 11911 13629 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965110.1 protein_id gnl|my_center|LOCUS_24150 14452 13742 gene locus_tag LOCUS_24160 14452 13742 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 protein_id gnl|my_center|LOCUS_24160 14684 19543 gene locus_tag LOCUS_24170 14684 19543 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090718.1 protein_id gnl|my_center|LOCUS_24170 20320 19559 gene locus_tag LOCUS_24180 20320 19559 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401743.1 protein_id gnl|my_center|LOCUS_24180 22430 20472 gene locus_tag LOCUS_24190 gene acs 22430 20472 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174953.1 protein_id gnl|my_center|LOCUS_24190 23240 22551 gene locus_tag LOCUS_24200 23240 22551 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564970.1 protein_id gnl|my_center|LOCUS_24200 23656 23237 gene locus_tag LOCUS_24210 23656 23237 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_24210 24647 23658 gene locus_tag LOCUS_24220 24647 23658 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083397.1 protein_id gnl|my_center|LOCUS_24220 25708 24647 gene locus_tag LOCUS_24230 gene tsaD 25708 24647 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083396.1 protein_id gnl|my_center|LOCUS_24230 25772 26701 gene locus_tag LOCUS_24240 gene hemC 25772 26701 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393857.1 protein_id gnl|my_center|LOCUS_24240 26709 27410 gene locus_tag LOCUS_24250 26709 27410 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067177.1 protein_id gnl|my_center|LOCUS_24250 27508 28911 gene locus_tag LOCUS_24260 27508 28911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083394.1 protein_id gnl|my_center|LOCUS_24260 28908 30560 gene locus_tag LOCUS_24270 28908 30560 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083393.1 protein_id gnl|my_center|LOCUS_24270 33280 31196 gene locus_tag LOCUS_24280 gene cobT 33280 31196 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083010.1 protein_id gnl|my_center|LOCUS_24280 34415 33429 gene locus_tag LOCUS_24290 gene cobS 34415 33429 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523293.1 protein_id gnl|my_center|LOCUS_24290 35087 34470 gene locus_tag LOCUS_24300 35087 34470 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973195.1 protein_id gnl|my_center|LOCUS_24300 35198 35521 gene locus_tag LOCUS_24310 35198 35521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 36409 35576 gene locus_tag LOCUS_24320 36409 35576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 37846 36572 gene locus_tag LOCUS_24330 37846 36572 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083018.1 protein_id gnl|my_center|LOCUS_24330 39007 37856 gene locus_tag LOCUS_24340 gene aroB 39007 37856 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529358.1 protein_id gnl|my_center|LOCUS_24340 39594 39004 gene locus_tag LOCUS_24350 39594 39004 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175815.1 protein_id gnl|my_center|LOCUS_24350 39811 39954 gene locus_tag LOCUS_24360 39811 39954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 40023 40964 gene locus_tag LOCUS_24370 gene xerD 40023 40964 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083022.1 protein_id gnl|my_center|LOCUS_24370 41080 42033 gene locus_tag LOCUS_24380 41080 42033 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083023.1 protein_id gnl|my_center|LOCUS_24380 42187 43965 gene locus_tag LOCUS_24390 42187 43965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 44454 44053 gene locus_tag LOCUS_24400 44454 44053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 47243 44454 gene locus_tag LOCUS_24410 gene secA 47243 44454 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083036.1 protein_id gnl|my_center|LOCUS_24410 47683 48690 gene locus_tag LOCUS_24420 47683 48690 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175805.1 protein_id gnl|my_center|LOCUS_24420 48818 49102 gene locus_tag LOCUS_24430 48818 49102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 49089 49415 gene locus_tag LOCUS_24440 49089 49415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 49566 50813 gene locus_tag LOCUS_24450 gene argJ 49566 50813 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083038.1 protein_id gnl|my_center|LOCUS_24450 50979 51389 gene locus_tag LOCUS_24460 50979 51389 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 protein_id gnl|my_center|LOCUS_24460 52456 51578 gene locus_tag LOCUS_24470 52456 51578 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966655.1 protein_id gnl|my_center|LOCUS_24470 52574 53395 gene locus_tag LOCUS_24480 52574 53395 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083041.1 protein_id gnl|my_center|LOCUS_24480 53409 53723 gene locus_tag LOCUS_24490 gene grxC 53409 53723 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721669.1 protein_id gnl|my_center|LOCUS_24490 53740 54657 gene locus_tag LOCUS_24500 53740 54657 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 protein_id gnl|my_center|LOCUS_24500 54654 55148 gene locus_tag LOCUS_24510 54654 55148 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083044.1 protein_id gnl|my_center|LOCUS_24510 55987 55352 gene locus_tag LOCUS_24520 55987 55352 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083302.1 protein_id gnl|my_center|LOCUS_24520 56154 55984 gene locus_tag LOCUS_24530 56154 55984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 56898 56164 gene locus_tag LOCUS_24540 56898 56164 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532296.1 protein_id gnl|my_center|LOCUS_24540 57032 57442 gene locus_tag LOCUS_24550 57032 57442 CDS product DUF930 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974429.1 protein_id gnl|my_center|LOCUS_24550 59091 57574 gene locus_tag LOCUS_24560 59091 57574 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056367.1 protein_id gnl|my_center|LOCUS_24560 59363 60910 gene locus_tag LOCUS_24570 gene ffh 59363 60910 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965072.1 protein_id gnl|my_center|LOCUS_24570 61057 61440 gene locus_tag LOCUS_24580 gene rpsP 61057 61440 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083313.1 protein_id gnl|my_center|LOCUS_24580 61605 62147 gene locus_tag LOCUS_24590 gene rimM 61605 62147 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083314.1 protein_id gnl|my_center|LOCUS_24590 62294 63013 gene locus_tag LOCUS_24600 gene trmD 62294 63013 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083317.1 protein_id gnl|my_center|LOCUS_24600 63125 63532 gene locus_tag LOCUS_24610 63125 63532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 63923 63645 gene locus_tag LOCUS_24620 63923 63645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 64132 64326 gene locus_tag LOCUS_24630 64132 64326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 64405 65826 gene locus_tag LOCUS_24640 gene leuC 64405 65826 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528868.1 protein_id gnl|my_center|LOCUS_24640 65844 65978 gene locus_tag LOCUS_24650 65844 65978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 65983 66414 gene locus_tag LOCUS_24660 65983 66414 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965074.1 protein_id gnl|my_center|LOCUS_24660 66462 67037 gene locus_tag LOCUS_24670 66462 67037 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528613.1 protein_id gnl|my_center|LOCUS_24670 67136 67741 gene locus_tag LOCUS_24680 gene leuD 67136 67741 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083326.1 protein_id gnl|my_center|LOCUS_24680 67826 68212 gene locus_tag LOCUS_24690 67826 68212 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531294.1 protein_id gnl|my_center|LOCUS_24690 68295 68636 gene locus_tag LOCUS_24700 68295 68636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 68752 69147 gene locus_tag LOCUS_24710 68752 69147 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531853.1 protein_id gnl|my_center|LOCUS_24710 69215 69751 gene locus_tag LOCUS_24720 69215 69751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531852.1 protein_id gnl|my_center|LOCUS_24720 69767 71338 gene locus_tag LOCUS_24730 69767 71338 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090223.1 protein_id gnl|my_center|LOCUS_24730 71562 72671 gene locus_tag LOCUS_24740 gene leuB 71562 72671 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083334.1 protein_id gnl|my_center|LOCUS_24740 73069 72797 gene locus_tag LOCUS_24750 73069 72797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 74095 73160 gene locus_tag LOCUS_24760 74095 73160 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529224.1 protein_id gnl|my_center|LOCUS_24760 74271 74951 gene locus_tag LOCUS_24770 gene mtgA 74271 74951 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577769.1 protein_id gnl|my_center|LOCUS_24770 75174 75359 gene locus_tag LOCUS_24780 gene rpmF 75174 75359 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598106.1 protein_id gnl|my_center|LOCUS_24780 75550 76842 gene locus_tag LOCUS_24790 75550 76842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 77016 78722 gene locus_tag LOCUS_24800 77016 78722 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965204.1 protein_id gnl|my_center|LOCUS_24800 79352 78774 gene locus_tag LOCUS_24810 gene phaR 79352 78774 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083059.1 protein_id gnl|my_center|LOCUS_24810 79622 80800 gene locus_tag LOCUS_24820 79622 80800 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175239.1 protein_id gnl|my_center|LOCUS_24820 80959 81669 gene locus_tag LOCUS_24830 80959 81669 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067323.1 protein_id gnl|my_center|LOCUS_24830 81811 82674 gene locus_tag LOCUS_24840 81811 82674 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083056.1 protein_id gnl|my_center|LOCUS_24840 83114 82677 gene locus_tag LOCUS_24850 83114 82677 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083055.1 protein_id gnl|my_center|LOCUS_24850 83895 83122 gene locus_tag LOCUS_24860 gene gloB 83895 83122 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083054.1 protein_id gnl|my_center|LOCUS_24860 84570 84013 gene locus_tag LOCUS_24870 84570 84013 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529690.1 protein_id gnl|my_center|LOCUS_24870 85201 84773 gene locus_tag LOCUS_24880 85201 84773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 85798 85265 gene locus_tag LOCUS_24890 gene thpR 85798 85265 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083289.1 protein_id gnl|my_center|LOCUS_24890 85985 86818 gene locus_tag LOCUS_24900 85985 86818 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_24900 88126 86951 gene locus_tag LOCUS_24910 88126 86951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 89551 88700 gene locus_tag LOCUS_24920 gene prmC 89551 88700 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083051.1 protein_id gnl|my_center|LOCUS_24920 90645 89548 gene locus_tag LOCUS_24930 gene prfA 90645 89548 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083050.1 protein_id gnl|my_center|LOCUS_24930 92923 90656 gene locus_tag LOCUS_24940 gene ptsP 92923 90656 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083049.1 protein_id gnl|my_center|LOCUS_24940 94253 93003 gene locus_tag LOCUS_24950 94253 93003 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529459.1 protein_id gnl|my_center|LOCUS_24950 94418 95161 gene locus_tag LOCUS_24960 gene ubiG 94418 95161 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529456.1 protein_id gnl|my_center|LOCUS_24960 95239 96504 gene locus_tag LOCUS_24970 95239 96504 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096774.1 protein_id gnl|my_center|LOCUS_24970 96660 99281 gene locus_tag LOCUS_24980 gene clpB 96660 99281 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084221.1 protein_id gnl|my_center|LOCUS_24980 100282 99392 gene locus_tag LOCUS_24990 gene galU 100282 99392 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970204.1 protein_id gnl|my_center|LOCUS_24990 100590 101975 gene locus_tag LOCUS_25000 100590 101975 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463741.1 protein_id gnl|my_center|LOCUS_25000 102096 103559 gene locus_tag LOCUS_25010 102096 103559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 104033 103569 gene locus_tag LOCUS_25020 104033 103569 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887982.1 protein_id gnl|my_center|LOCUS_25020 105467 104043 gene locus_tag LOCUS_25030 105467 104043 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970206.1 protein_id gnl|my_center|LOCUS_25030 110428 105698 gene locus_tag LOCUS_25040 gene gltB 110428 105698 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066927.1 protein_id gnl|my_center|LOCUS_25040 110936 111856 gene locus_tag LOCUS_25050 110936 111856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 112416 111937 gene locus_tag LOCUS_25060 112416 111937 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709372.1 protein_id gnl|my_center|LOCUS_25060 112646 113008 gene locus_tag LOCUS_25070 112646 113008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 113163 114113 gene locus_tag LOCUS_25080 113163 114113 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090464.1 protein_id gnl|my_center|LOCUS_25080 114911 114126 gene locus_tag LOCUS_25090 gene hisN 114911 114126 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090456.1 protein_id gnl|my_center|LOCUS_25090 117395 116511 gene locus_tag LOCUS_25100 117395 116511 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090455.1 protein_id gnl|my_center|LOCUS_25100 117752 118111 gene locus_tag LOCUS_25110 gene cpdR1 117752 118111 CDS product response regulator CpdR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709376.1 protein_id gnl|my_center|LOCUS_25110 118234 118308 gene locus_tag LOCUS_t00370 118234 118308 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 118476 119564 gene locus_tag LOCUS_25120 118476 119564 CDS product rhamnan synthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382865.1 protein_id gnl|my_center|LOCUS_25120 119841 119581 gene locus_tag LOCUS_25130 119841 119581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 120033 120305 gene locus_tag LOCUS_25140 120033 120305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 121064 120348 gene locus_tag LOCUS_25150 121064 120348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 121246 123087 gene locus_tag LOCUS_25160 121246 123087 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089865.1 protein_id gnl|my_center|LOCUS_25160 125113 123167 gene locus_tag LOCUS_25170 125113 123167 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494191.1 protein_id gnl|my_center|LOCUS_25170 126358 125309 gene locus_tag LOCUS_25180 126358 125309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814748.1 protein_id gnl|my_center|LOCUS_25180 126460 127296 gene locus_tag LOCUS_25190 126460 127296 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136617434.1 protein_id gnl|my_center|LOCUS_25190 128242 127325 gene locus_tag LOCUS_25200 128242 127325 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971315.1 protein_id gnl|my_center|LOCUS_25200 128374 128979 gene locus_tag LOCUS_25210 128374 128979 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971316.1 protein_id gnl|my_center|LOCUS_25210 129064 129762 gene locus_tag LOCUS_25220 129064 129762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337285.1 protein_id gnl|my_center|LOCUS_25220 129759 130370 gene locus_tag LOCUS_25230 129759 130370 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391434.1 protein_id gnl|my_center|LOCUS_25230 130367 130924 gene locus_tag LOCUS_25240 130367 130924 CDS product BioY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337283.1 protein_id gnl|my_center|LOCUS_25240 130924 132339 gene locus_tag LOCUS_25250 130924 132339 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244910.1 protein_id gnl|my_center|LOCUS_25250 132336 133466 gene locus_tag LOCUS_25260 132336 133466 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391134.1 protein_id gnl|my_center|LOCUS_25260 133583 134368 gene locus_tag LOCUS_25270 133583 134368 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085220.1 protein_id gnl|my_center|LOCUS_25270 134611 135573 gene locus_tag LOCUS_25280 134611 135573 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529392.1 protein_id gnl|my_center|LOCUS_25280 135573 137285 gene locus_tag LOCUS_25290 gene ade 135573 137285 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992329.1 protein_id gnl|my_center|LOCUS_25290 137942 137472 gene locus_tag LOCUS_25300 137942 137472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 138333 139097 gene locus_tag LOCUS_25310 138333 139097 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626547.1 protein_id gnl|my_center|LOCUS_25310 139094 140374 gene locus_tag LOCUS_25320 139094 140374 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085615.1 protein_id gnl|my_center|LOCUS_25320 140490 141401 gene locus_tag LOCUS_25330 140490 141401 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528025.1 protein_id gnl|my_center|LOCUS_25330 141532 142707 gene locus_tag LOCUS_25340 141532 142707 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397072.1 protein_id gnl|my_center|LOCUS_25340 142879 143919 gene locus_tag LOCUS_25350 142879 143919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528023.1 protein_id gnl|my_center|LOCUS_25350 143916 144863 gene locus_tag LOCUS_25360 143916 144863 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210183137.1 protein_id gnl|my_center|LOCUS_25360 145026 145826 gene locus_tag LOCUS_25370 145026 145826 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397078.1 protein_id gnl|my_center|LOCUS_25370 145837 147288 gene locus_tag LOCUS_25380 145837 147288 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528020.1 protein_id gnl|my_center|LOCUS_25380 147480 148577 gene locus_tag LOCUS_25390 147480 148577 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_25390 148588 151662 gene locus_tag LOCUS_25400 148588 151662 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814731.1 protein_id gnl|my_center|LOCUS_25400 151976 154177 gene locus_tag LOCUS_25410 151976 154177 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463822.1 protein_id gnl|my_center|LOCUS_25410 154215 154796 gene locus_tag LOCUS_25420 154215 154796 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972364.1 protein_id gnl|my_center|LOCUS_25420 155618 154854 gene locus_tag LOCUS_25430 155618 154854 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969935.1 protein_id gnl|my_center|LOCUS_25430 156717 155629 gene locus_tag LOCUS_25440 156717 155629 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_25440 157654 156737 gene locus_tag LOCUS_25450 157654 156737 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329256.1 protein_id gnl|my_center|LOCUS_25450 158683 157802 gene locus_tag LOCUS_25460 158683 157802 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530273.1 protein_id gnl|my_center|LOCUS_25460 160097 158817 gene locus_tag LOCUS_25470 160097 158817 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530272.1 protein_id gnl|my_center|LOCUS_25470 160974 160177 gene locus_tag LOCUS_25480 160974 160177 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530271.1 protein_id gnl|my_center|LOCUS_25480 162137 160995 gene locus_tag LOCUS_25490 162137 160995 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530270.1 protein_id gnl|my_center|LOCUS_25490 163110 162310 gene locus_tag LOCUS_25500 163110 162310 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530269.1 protein_id gnl|my_center|LOCUS_25500 163266 164123 gene locus_tag LOCUS_25510 163266 164123 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530268.1 protein_id gnl|my_center|LOCUS_25510 164162 164962 gene locus_tag LOCUS_25520 164162 164962 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530267.1 protein_id gnl|my_center|LOCUS_25520 165108 166610 gene locus_tag LOCUS_25530 165108 166610 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530266.1 protein_id gnl|my_center|LOCUS_25530 166607 167239 gene locus_tag LOCUS_25540 166607 167239 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530265.1 protein_id gnl|my_center|LOCUS_25540 169841 167262 gene locus_tag LOCUS_25550 169841 167262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 170952 169891 gene locus_tag LOCUS_25560 170952 169891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 173341 171074 gene locus_tag LOCUS_25570 173341 171074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 173986 173366 gene locus_tag LOCUS_25580 173986 173366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 174450 173983 gene locus_tag LOCUS_25590 174450 173983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 175154 174447 gene locus_tag LOCUS_25600 175154 174447 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525084.1 protein_id gnl|my_center|LOCUS_25600 176061 175165 gene locus_tag LOCUS_25610 176061 175165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 176226 176639 gene locus_tag LOCUS_25620 176226 176639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 176835 177041 gene locus_tag LOCUS_25630 176835 177041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 177468 177395 gene locus_tag LOCUS_t00380 177468 177395 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 178429 177557 gene locus_tag LOCUS_25640 gene rfbA 178429 177557 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919025.1 protein_id gnl|my_center|LOCUS_25640 179349 178426 gene locus_tag LOCUS_25650 gene rfbD 179349 178426 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974013.1 protein_id gnl|my_center|LOCUS_25650 180414 179353 gene locus_tag LOCUS_25660 gene rfbB 180414 179353 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077983494.1 protein_id gnl|my_center|LOCUS_25660 181021 180467 gene locus_tag LOCUS_25670 gene rfbC 181021 180467 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974015.1 protein_id gnl|my_center|LOCUS_25670 181411 181037 gene locus_tag LOCUS_25680 181411 181037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 181424 181678 gene locus_tag LOCUS_25690 181424 181678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 181730 181969 gene locus_tag LOCUS_25700 181730 181969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 183084 182449 gene locus_tag LOCUS_25710 183084 182449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 184727 183099 gene locus_tag LOCUS_25720 184727 183099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965361.1 protein_id gnl|my_center|LOCUS_25720 185173 184724 gene locus_tag LOCUS_25730 185173 184724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 185444 185178 gene locus_tag LOCUS_25740 185444 185178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 186495 185479 gene locus_tag LOCUS_25750 186495 185479 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173513.1 protein_id gnl|my_center|LOCUS_25750 186494 186709 gene locus_tag LOCUS_25760 186494 186709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 187767 186661 gene locus_tag LOCUS_25770 187767 186661 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527941.1 protein_id gnl|my_center|LOCUS_25770 189987 188062 gene locus_tag LOCUS_25780 189987 188062 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173514.1 protein_id gnl|my_center|LOCUS_25780 192163 190214 gene locus_tag LOCUS_25790 192163 190214 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084241.1 protein_id gnl|my_center|LOCUS_25790 193012 192377 gene locus_tag LOCUS_25800 193012 192377 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084240.1 protein_id gnl|my_center|LOCUS_25800 193230 193994 gene locus_tag LOCUS_25810 193230 193994 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970654.1 protein_id gnl|my_center|LOCUS_25810 193991 194842 gene locus_tag LOCUS_25820 193991 194842 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_25820 196087 194849 gene locus_tag LOCUS_25830 196087 194849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 197059 196226 gene locus_tag LOCUS_25840 gene fabI 197059 196226 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083593.1 protein_id gnl|my_center|LOCUS_25840 198314 197094 gene locus_tag LOCUS_25850 gene fabB 198314 197094 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083592.1 protein_id gnl|my_center|LOCUS_25850 198926 198420 gene locus_tag LOCUS_25860 gene fabA 198926 198420 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037377826.1 protein_id gnl|my_center|LOCUS_25860 199437 199901 gene locus_tag LOCUS_25870 199437 199901 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008131763.1 protein_id gnl|my_center|LOCUS_25870 200825 199965 gene locus_tag LOCUS_25880 200825 199965 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088016.1 protein_id gnl|my_center|LOCUS_25880 200937 201341 gene locus_tag LOCUS_25890 200937 201341 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088015.1 protein_id gnl|my_center|LOCUS_25890 201899 201351 gene locus_tag LOCUS_25900 201899 201351 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083590.1 protein_id gnl|my_center|LOCUS_25900 202141 203142 gene locus_tag LOCUS_25910 202141 203142 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083589.1 protein_id gnl|my_center|LOCUS_25910 204408 203536 gene locus_tag LOCUS_25920 gene moeB 204408 203536 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083588.1 protein_id gnl|my_center|LOCUS_25920 205179 205364 gene locus_tag LOCUS_25930 205179 205364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence11 >Feature sequence12 381 839 gene locus_tag LOCUS_25940 381 839 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085932.1 protein_id gnl|my_center|LOCUS_25940 1820 909 gene locus_tag LOCUS_25950 gene rpoH 1820 909 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090072.1 protein_id gnl|my_center|LOCUS_25950 3051 2005 gene locus_tag LOCUS_25960 3051 2005 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090071.1 protein_id gnl|my_center|LOCUS_25960 3050 3391 gene locus_tag LOCUS_25970 3050 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 3488 3562 gene locus_tag LOCUS_t00390 3488 3562 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4771 3671 gene locus_tag LOCUS_25980 4771 3671 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814320.1 protein_id gnl|my_center|LOCUS_25980 5448 4768 gene locus_tag LOCUS_25990 5448 4768 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140961.1 protein_id gnl|my_center|LOCUS_25990 6207 5491 gene locus_tag LOCUS_26000 6207 5491 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530557.1 protein_id gnl|my_center|LOCUS_26000 6870 6211 gene locus_tag LOCUS_26010 6870 6211 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067190.1 protein_id gnl|my_center|LOCUS_26010 7474 6911 gene locus_tag LOCUS_26020 7474 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 >Feature sequence13 108 1085 gene locus_tag LOCUS_26030 108 1085 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041807480.1 protein_id gnl|my_center|LOCUS_26030 1241 1317 gene locus_tag LOCUS_t00400 1241 1317 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1872 3503 gene locus_tag LOCUS_26040 1872 3503 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085524.1 protein_id gnl|my_center|LOCUS_26040 3840 4106 gene locus_tag LOCUS_26050 3840 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26050 4103 4405 gene locus_tag LOCUS_26060 4103 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26060 4416 4895 gene locus_tag LOCUS_26070 4416 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26070 6707 5175 gene locus_tag LOCUS_26080 6707 5175 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_26080 7356 6901 gene locus_tag LOCUS_26090 7356 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 7788 8717 gene locus_tag LOCUS_26100 7788 8717 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087235.1 protein_id gnl|my_center|LOCUS_26100 8813 10426 gene locus_tag LOCUS_26110 8813 10426 CDS product amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087236.1 protein_id gnl|my_center|LOCUS_26110 10487 11725 gene locus_tag LOCUS_26120 10487 11725 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087237.1 protein_id gnl|my_center|LOCUS_26120 11814 14153 gene locus_tag LOCUS_26130 11814 14153 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967157.1 protein_id gnl|my_center|LOCUS_26130 14549 15055 gene locus_tag LOCUS_26140 gene paoA 14549 15055 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275317.1 protein_id gnl|my_center|LOCUS_26140 15052 16002 gene locus_tag LOCUS_26150 15052 16002 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968216.1 protein_id gnl|my_center|LOCUS_26150 16006 18216 gene locus_tag LOCUS_26160 16006 18216 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968217.1 protein_id gnl|my_center|LOCUS_26160 18930 18247 gene locus_tag LOCUS_26170 18930 18247 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 protein_id gnl|my_center|LOCUS_26170 21629 18927 gene locus_tag LOCUS_26180 21629 18927 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970241.1 protein_id gnl|my_center|LOCUS_26180 22238 21642 gene locus_tag LOCUS_26190 gene kdpC 22238 21642 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973321.1 protein_id gnl|my_center|LOCUS_26190 22128 22328 gene locus_tag LOCUS_26200 22128 22328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 24397 22331 gene locus_tag LOCUS_26210 gene kdpB 24397 22331 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973322.1 protein_id gnl|my_center|LOCUS_26210 26126 24417 gene locus_tag LOCUS_26220 gene kdpA 26126 24417 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968198.1 protein_id gnl|my_center|LOCUS_26220 28303 26591 gene locus_tag LOCUS_26230 28303 26591 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083199.1 protein_id gnl|my_center|LOCUS_26230 29036 28314 gene locus_tag LOCUS_26240 29036 28314 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089566.1 protein_id gnl|my_center|LOCUS_26240 29161 30114 gene locus_tag LOCUS_26250 29161 30114 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089568.1 protein_id gnl|my_center|LOCUS_26250 30665 31768 gene locus_tag LOCUS_26260 30665 31768 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768050.1 protein_id gnl|my_center|LOCUS_26260 31807 32853 gene locus_tag LOCUS_26270 31807 32853 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188909205.1 protein_id gnl|my_center|LOCUS_26270 32990 34246 gene locus_tag LOCUS_26280 32990 34246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113206.1 protein_id gnl|my_center|LOCUS_26280 34252 35079 gene locus_tag LOCUS_26290 34252 35079 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269123.1 protein_id gnl|my_center|LOCUS_26290 36440 35145 gene locus_tag LOCUS_26300 36440 35145 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085015.1 protein_id gnl|my_center|LOCUS_26300 37804 36476 gene locus_tag LOCUS_26310 37804 36476 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972714.1 protein_id gnl|my_center|LOCUS_26310 38021 39625 gene locus_tag LOCUS_26320 38021 39625 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389103.1 protein_id gnl|my_center|LOCUS_26320 41048 39669 gene locus_tag LOCUS_26330 41048 39669 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939113.1 protein_id gnl|my_center|LOCUS_26330 42457 41144 gene locus_tag LOCUS_26340 42457 41144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 42530 43000 gene locus_tag LOCUS_26350 gene nsrR 42530 43000 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_26350 43040 44107 gene locus_tag LOCUS_26360 43040 44107 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532427.1 protein_id gnl|my_center|LOCUS_26360 44209 45717 gene locus_tag LOCUS_26370 44209 45717 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_26370 45722 46384 gene locus_tag LOCUS_26380 gene cbiZ 45722 46384 CDS product adenosylcobinamide amidohydrolase CbiZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337466.1 protein_id gnl|my_center|LOCUS_26380 47694 46381 gene locus_tag LOCUS_26390 47694 46381 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390757.1 protein_id gnl|my_center|LOCUS_26390 48728 47691 gene locus_tag LOCUS_26400 48728 47691 CDS product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974512.1 protein_id gnl|my_center|LOCUS_26400 49477 48773 gene locus_tag LOCUS_26410 49477 48773 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974505.1 protein_id gnl|my_center|LOCUS_26410 50360 49521 gene locus_tag LOCUS_26420 50360 49521 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390758.1 protein_id gnl|my_center|LOCUS_26420 51151 50357 gene locus_tag LOCUS_26430 51151 50357 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390760.1 protein_id gnl|my_center|LOCUS_26430 52072 51155 gene locus_tag LOCUS_26440 52072 51155 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974507.1 protein_id gnl|my_center|LOCUS_26440 53181 52075 gene locus_tag LOCUS_26450 53181 52075 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974508.1 protein_id gnl|my_center|LOCUS_26450 54538 53384 gene locus_tag LOCUS_26460 54538 53384 CDS product PotD/PotF family extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974509.1 protein_id gnl|my_center|LOCUS_26460 54796 55575 gene locus_tag LOCUS_26470 gene fabG 54796 55575 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390765.1 protein_id gnl|my_center|LOCUS_26470 55909 56586 gene locus_tag LOCUS_26480 55909 56586 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388217.1 protein_id gnl|my_center|LOCUS_26480 56750 57979 gene locus_tag LOCUS_26490 56750 57979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 59511 58033 gene locus_tag LOCUS_26500 59511 58033 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388808.1 protein_id gnl|my_center|LOCUS_26500 59809 60183 gene locus_tag LOCUS_26510 59809 60183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 60409 60948 gene locus_tag LOCUS_26520 60409 60948 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315177.1 protein_id gnl|my_center|LOCUS_26520 61006 62418 gene locus_tag LOCUS_26530 61006 62418 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315176.1 protein_id gnl|my_center|LOCUS_26530 62947 62426 gene locus_tag LOCUS_26540 62947 62426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965306.1 protein_id gnl|my_center|LOCUS_26540 63196 64443 gene locus_tag LOCUS_26550 63196 64443 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971915.1 protein_id gnl|my_center|LOCUS_26550 64941 64471 gene locus_tag LOCUS_26560 64941 64471 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254100.1 protein_id gnl|my_center|LOCUS_26560 65050 65448 gene locus_tag LOCUS_26570 65050 65448 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037778.1 protein_id gnl|my_center|LOCUS_26570 65795 65586 gene locus_tag LOCUS_26580 65795 65586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 66635 65892 gene locus_tag LOCUS_26590 66635 65892 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528671.1 protein_id gnl|my_center|LOCUS_26590 67061 69388 gene locus_tag LOCUS_26600 67061 69388 CDS product MHYT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090708.1 protein_id gnl|my_center|LOCUS_26600 69558 70640 gene locus_tag LOCUS_26610 gene thiO 69558 70640 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969800.1 protein_id gnl|my_center|LOCUS_26610 70618 70815 gene locus_tag LOCUS_26620 gene thiS 70618 70815 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969799.1 protein_id gnl|my_center|LOCUS_26620 70818 71648 gene locus_tag LOCUS_26630 70818 71648 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614697.1 protein_id gnl|my_center|LOCUS_26630 71669 72277 gene locus_tag LOCUS_26640 71669 72277 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969797.1 protein_id gnl|my_center|LOCUS_26640 73889 72297 gene locus_tag LOCUS_26650 73889 72297 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974139.1 protein_id gnl|my_center|LOCUS_26650 75317 73947 gene locus_tag LOCUS_26660 75317 73947 CDS product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259035.1 protein_id gnl|my_center|LOCUS_26660 76735 75437 gene locus_tag LOCUS_26670 76735 75437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084978.1 protein_id gnl|my_center|LOCUS_26670 77546 76935 gene locus_tag LOCUS_26680 77546 76935 CDS product DUF1134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084979.1 protein_id gnl|my_center|LOCUS_26680 78561 77719 gene locus_tag LOCUS_26690 gene cysQ 78561 77719 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329315.1 protein_id gnl|my_center|LOCUS_26690 78731 79411 gene locus_tag LOCUS_26700 78731 79411 CDS product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967810.1 protein_id gnl|my_center|LOCUS_26700 79605 80792 gene locus_tag LOCUS_26710 79605 80792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 80903 81262 gene locus_tag LOCUS_26720 80903 81262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 81320 81721 gene locus_tag LOCUS_26730 81320 81721 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974606.1 protein_id gnl|my_center|LOCUS_26730 81988 82170 gene locus_tag LOCUS_26740 81988 82170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 82912 82211 gene locus_tag LOCUS_26750 82912 82211 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008138878.1 protein_id gnl|my_center|LOCUS_26750 83163 83456 gene locus_tag LOCUS_26760 83163 83456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 83443 83838 gene locus_tag LOCUS_26770 gene fliJ 83443 83838 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084990.1 protein_id gnl|my_center|LOCUS_26770 84518 83889 gene locus_tag LOCUS_26780 84518 83889 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084228.1 protein_id gnl|my_center|LOCUS_26780 84684 85781 gene locus_tag LOCUS_26790 84684 85781 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391150.1 protein_id gnl|my_center|LOCUS_26790 86434 85799 gene locus_tag LOCUS_26800 86434 85799 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268547.1 protein_id gnl|my_center|LOCUS_26800 87607 86576 gene locus_tag LOCUS_26810 87607 86576 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087474.1 protein_id gnl|my_center|LOCUS_26810 88360 87806 gene locus_tag LOCUS_26820 88360 87806 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087475.1 protein_id gnl|my_center|LOCUS_26820 90319 88481 gene locus_tag LOCUS_26830 gene recQ 90319 88481 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529051.1 protein_id gnl|my_center|LOCUS_26830 90434 91408 gene locus_tag LOCUS_26840 gene cbiB 90434 91408 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531121.1 protein_id gnl|my_center|LOCUS_26840 92105 91452 gene locus_tag LOCUS_26850 92105 91452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 92350 94506 gene locus_tag LOCUS_26860 92350 94506 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068954085.1 protein_id gnl|my_center|LOCUS_26860 94500 95651 gene locus_tag LOCUS_26870 94500 95651 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396879.1 protein_id gnl|my_center|LOCUS_26870 95655 96791 gene locus_tag LOCUS_26880 95655 96791 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530811.1 protein_id gnl|my_center|LOCUS_26880 97229 96873 gene locus_tag LOCUS_26890 97229 96873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 97332 97655 gene locus_tag LOCUS_26900 97332 97655 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104617623.1 protein_id gnl|my_center|LOCUS_26900 97655 98443 gene locus_tag LOCUS_26910 97655 98443 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967853.1 protein_id gnl|my_center|LOCUS_26910 99363 98569 gene locus_tag LOCUS_26920 99363 98569 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974575.1 protein_id gnl|my_center|LOCUS_26920 100662 99556 gene locus_tag LOCUS_26930 100662 99556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 100793 102409 gene locus_tag LOCUS_26940 100793 102409 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726806.1 protein_id gnl|my_center|LOCUS_26940 102536 103270 gene locus_tag LOCUS_26950 102536 103270 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085479.1 protein_id gnl|my_center|LOCUS_26950 103705 103295 gene locus_tag LOCUS_26960 gene mexG 103705 103295 CDS product multidrug efflux RND transporter inhibitory subunit MexG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093607.1 protein_id gnl|my_center|LOCUS_26960 105078 103783 gene locus_tag LOCUS_26970 105078 103783 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_26970 106132 105215 gene locus_tag LOCUS_26980 106132 105215 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974548.1 protein_id gnl|my_center|LOCUS_26980 106866 106396 gene locus_tag LOCUS_26990 106866 106396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 108198 107266 gene locus_tag LOCUS_27000 108198 107266 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975807.1 protein_id gnl|my_center|LOCUS_27000 108104 108325 gene locus_tag LOCUS_27010 108104 108325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 108364 109677 gene locus_tag LOCUS_27020 108364 109677 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919685.1 protein_id gnl|my_center|LOCUS_27020 109937 110536 gene locus_tag LOCUS_27030 109937 110536 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090887.1 protein_id gnl|my_center|LOCUS_27030 110886 111233 gene locus_tag LOCUS_27040 110886 111233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 111299 111751 gene locus_tag LOCUS_27050 111299 111751 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965172.1 protein_id gnl|my_center|LOCUS_27050 111755 113974 gene locus_tag LOCUS_27060 111755 113974 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 protein_id gnl|my_center|LOCUS_27060 114872 114030 gene locus_tag LOCUS_27070 114872 114030 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172659.1 protein_id gnl|my_center|LOCUS_27070 114951 115856 gene locus_tag LOCUS_27080 114951 115856 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141439.1 protein_id gnl|my_center|LOCUS_27080 116147 116605 gene locus_tag LOCUS_27090 116147 116605 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971001.1 protein_id gnl|my_center|LOCUS_27090 116616 118802 gene locus_tag LOCUS_27100 116616 118802 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085521.1 protein_id gnl|my_center|LOCUS_27100 118802 119107 gene locus_tag LOCUS_27110 118802 119107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 119115 120359 gene locus_tag LOCUS_27120 119115 120359 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921427.1 protein_id gnl|my_center|LOCUS_27120 120365 120823 gene locus_tag LOCUS_27130 120365 120823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 120827 121312 gene locus_tag LOCUS_27140 120827 121312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 121309 121629 gene locus_tag LOCUS_27150 gene soxZ 121309 121629 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085518.1 protein_id gnl|my_center|LOCUS_27150 121629 122426 gene locus_tag LOCUS_27160 gene soxA 121629 122426 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174733.1 protein_id gnl|my_center|LOCUS_27160 124010 122466 gene locus_tag LOCUS_27170 124010 122466 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029723090.1 protein_id gnl|my_center|LOCUS_27170 124726 124007 gene locus_tag LOCUS_27180 124726 124007 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970997.1 protein_id gnl|my_center|LOCUS_27180 125008 125283 gene locus_tag LOCUS_27190 125008 125283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 125830 125543 gene locus_tag LOCUS_27200 125830 125543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 127586 126144 gene locus_tag LOCUS_27210 127586 126144 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972581.1 protein_id gnl|my_center|LOCUS_27210 127977 127753 gene locus_tag LOCUS_27220 127977 127753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 128727 128113 gene locus_tag LOCUS_27230 gene cobO 128727 128113 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531120.1 protein_id gnl|my_center|LOCUS_27230 129236 128724 gene locus_tag LOCUS_27240 gene cobU 129236 128724 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531119.1 protein_id gnl|my_center|LOCUS_27240 129711 130772 gene locus_tag LOCUS_27250 gene cobW 129711 130772 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531087.1 protein_id gnl|my_center|LOCUS_27250 130931 134398 gene locus_tag LOCUS_27260 gene cobN 130931 134398 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531086.1 protein_id gnl|my_center|LOCUS_27260 134395 135618 gene locus_tag LOCUS_27270 gene cobG 134395 135618 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970292.1 protein_id gnl|my_center|LOCUS_27270 135619 136254 gene locus_tag LOCUS_27280 135619 136254 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067032.1 protein_id gnl|my_center|LOCUS_27280 136251 136988 gene locus_tag LOCUS_27290 136251 136988 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531083.1 protein_id gnl|my_center|LOCUS_27290 136985 137773 gene locus_tag LOCUS_27300 136985 137773 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311008.1 protein_id gnl|my_center|LOCUS_27300 138543 137743 gene locus_tag LOCUS_27310 138543 137743 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531081.1 protein_id gnl|my_center|LOCUS_27310 138542 139813 gene locus_tag LOCUS_27320 138542 139813 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531080.1 protein_id gnl|my_center|LOCUS_27320 139824 140222 gene locus_tag LOCUS_27330 139824 140222 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531079.1 protein_id gnl|my_center|LOCUS_27330 140219 140977 gene locus_tag LOCUS_27340 gene cobM 140219 140977 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970288.1 protein_id gnl|my_center|LOCUS_27340 141114 142424 gene locus_tag LOCUS_27350 141114 142424 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531076.1 protein_id gnl|my_center|LOCUS_27350 142427 142804 gene locus_tag LOCUS_27360 142427 142804 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966082.1 protein_id gnl|my_center|LOCUS_27360 142890 145394 gene locus_tag LOCUS_27370 142890 145394 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765552.1 protein_id gnl|my_center|LOCUS_27370 145598 147844 gene locus_tag LOCUS_27380 gene glgB 145598 147844 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532700.1 protein_id gnl|my_center|LOCUS_27380 147859 149127 gene locus_tag LOCUS_27390 gene glgC 147859 149127 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089198.1 protein_id gnl|my_center|LOCUS_27390 149170 150627 gene locus_tag LOCUS_27400 gene glgA 149170 150627 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089199.1 protein_id gnl|my_center|LOCUS_27400 150624 154769 gene locus_tag LOCUS_27410 150624 154769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 155011 154817 gene locus_tag LOCUS_27420 155011 154817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 155280 155522 gene locus_tag LOCUS_27430 155280 155522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 155842 156525 gene locus_tag LOCUS_27440 gene modA 155842 156525 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101994.1 protein_id gnl|my_center|LOCUS_27440 156574 157263 gene locus_tag LOCUS_27450 gene modB 156574 157263 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388461.1 protein_id gnl|my_center|LOCUS_27450 157260 158360 gene locus_tag LOCUS_27460 gene modC 157260 158360 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531025.1 protein_id gnl|my_center|LOCUS_27460 158657 158460 gene locus_tag LOCUS_27470 158657 158460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 159128 158709 gene locus_tag LOCUS_27480 159128 158709 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389703.1 protein_id gnl|my_center|LOCUS_27480 160568 159201 gene locus_tag LOCUS_27490 160568 159201 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971988.1 protein_id gnl|my_center|LOCUS_27490 161207 160668 gene locus_tag LOCUS_27500 161207 160668 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529534.1 protein_id gnl|my_center|LOCUS_27500 161653 161291 gene locus_tag LOCUS_27510 161653 161291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 162584 161778 gene locus_tag LOCUS_27520 162584 161778 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061398.1 protein_id gnl|my_center|LOCUS_27520 163905 162595 gene locus_tag LOCUS_27530 163905 162595 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312497.1 protein_id gnl|my_center|LOCUS_27530 163835 164035 gene locus_tag LOCUS_27540 163835 164035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 165059 164019 gene locus_tag LOCUS_27550 gene xylF 165059 164019 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973156.1 protein_id gnl|my_center|LOCUS_27550 165341 166378 gene locus_tag LOCUS_27560 165341 166378 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086178.1 protein_id gnl|my_center|LOCUS_27560 166411 167868 gene locus_tag LOCUS_27570 gene xylB 166411 167868 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088529.1 protein_id gnl|my_center|LOCUS_27570 167865 169190 gene locus_tag LOCUS_27580 gene xylA 167865 169190 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083939.1 protein_id gnl|my_center|LOCUS_27580 169439 170056 gene locus_tag LOCUS_27590 169439 170056 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083844.1 protein_id gnl|my_center|LOCUS_27590 170091 171104 gene locus_tag LOCUS_27600 170091 171104 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083843.1 protein_id gnl|my_center|LOCUS_27600 171242 171679 gene locus_tag LOCUS_27610 171242 171679 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088783.1 protein_id gnl|my_center|LOCUS_27610 171991 172428 gene locus_tag LOCUS_27620 171991 172428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 172631 174091 gene locus_tag LOCUS_27630 172631 174091 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337463.1 protein_id gnl|my_center|LOCUS_27630 175740 174070 gene locus_tag LOCUS_27640 175740 174070 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529813.1 protein_id gnl|my_center|LOCUS_27640 175928 177001 gene locus_tag LOCUS_27650 175928 177001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529814.1 protein_id gnl|my_center|LOCUS_27650 177004 177927 gene locus_tag LOCUS_27660 177004 177927 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529815.1 protein_id gnl|my_center|LOCUS_27660 177920 178720 gene locus_tag LOCUS_27670 177920 178720 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529816.1 protein_id gnl|my_center|LOCUS_27670 178748 179782 gene locus_tag LOCUS_27680 178748 179782 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531376.1 protein_id gnl|my_center|LOCUS_27680 179995 179858 gene locus_tag LOCUS_27690 179995 179858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 180116 181528 gene locus_tag LOCUS_27700 180116 181528 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195432.1 protein_id gnl|my_center|LOCUS_27700 181677 181601 gene locus_tag LOCUS_t00410 181677 181601 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 182294 181794 gene locus_tag LOCUS_27710 182294 181794 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085245.1 protein_id gnl|my_center|LOCUS_27710 182325 183257 gene locus_tag LOCUS_27720 182325 183257 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529920.1 protein_id gnl|my_center|LOCUS_27720 183840 183241 gene locus_tag LOCUS_27730 183840 183241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 184022 185137 gene locus_tag LOCUS_27740 184022 185137 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872371.1 protein_id gnl|my_center|LOCUS_27740 185742 185134 gene locus_tag LOCUS_27750 185742 185134 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528837.1 protein_id gnl|my_center|LOCUS_27750 186535 185771 gene locus_tag LOCUS_27760 gene phnF 186535 185771 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084038.1 protein_id gnl|my_center|LOCUS_27760 186637 187113 gene locus_tag LOCUS_27770 gene phnG 186637 187113 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529524.1 protein_id gnl|my_center|LOCUS_27770 187115 187711 gene locus_tag LOCUS_27780 gene phnH 187115 187711 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529523.1 protein_id gnl|my_center|LOCUS_27780 187717 188829 gene locus_tag LOCUS_27790 187717 188829 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440333.1 protein_id gnl|my_center|LOCUS_27790 188826 189899 gene locus_tag LOCUS_27800 188826 189899 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084042.1 protein_id gnl|my_center|LOCUS_27800 189896 190681 gene locus_tag LOCUS_27810 gene phnK 189896 190681 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982278.1 protein_id gnl|my_center|LOCUS_27810 190868 191575 gene locus_tag LOCUS_27820 gene phnL 190868 191575 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529517.1 protein_id gnl|my_center|LOCUS_27820 191966 193105 gene locus_tag LOCUS_27830 191966 193105 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084045.1 protein_id gnl|my_center|LOCUS_27830 193102 193689 gene locus_tag LOCUS_27840 gene phnN 193102 193689 CDS product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170982.1 protein_id gnl|my_center|LOCUS_27840 194080 193805 gene locus_tag LOCUS_27850 194080 193805 CDS product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002714638.1 protein_id gnl|my_center|LOCUS_27850 194372 195559 gene locus_tag LOCUS_27860 gene mnmA 194372 195559 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089733.1 protein_id gnl|my_center|LOCUS_27860 195637 196335 gene locus_tag LOCUS_27870 195637 196335 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089732.1 protein_id gnl|my_center|LOCUS_27870 197224 196412 gene locus_tag LOCUS_27880 197224 196412 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531948.1 protein_id gnl|my_center|LOCUS_27880 198503 197262 gene locus_tag LOCUS_27890 198503 197262 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531949.1 protein_id gnl|my_center|LOCUS_27890 198698 199429 gene locus_tag LOCUS_27900 198698 199429 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089549.1 protein_id gnl|my_center|LOCUS_27900 199519 199812 gene locus_tag LOCUS_27910 199519 199812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 199809 200270 gene locus_tag LOCUS_27920 199809 200270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 201659 200334 gene locus_tag LOCUS_27930 201659 200334 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189302.1 protein_id gnl|my_center|LOCUS_27930 202812 201838 gene locus_tag LOCUS_27940 202812 201838 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969887.1 protein_id gnl|my_center|LOCUS_27940 203426 202908 gene locus_tag LOCUS_27950 203426 202908 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531041.1 protein_id gnl|my_center|LOCUS_27950 203791 204333 gene locus_tag LOCUS_27960 203791 204333 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085246.1 protein_id gnl|my_center|LOCUS_27960 204378 204620 gene locus_tag LOCUS_27970 204378 204620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 206722 204650 gene locus_tag LOCUS_27980 206722 204650 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085249.1 protein_id gnl|my_center|LOCUS_27980 207162 206719 gene locus_tag LOCUS_27990 207162 206719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 210035 207159 gene locus_tag LOCUS_28000 210035 207159 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976404.1 protein_id gnl|my_center|LOCUS_28000 210987 210046 gene locus_tag LOCUS_28010 210987 210046 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085251.1 protein_id gnl|my_center|LOCUS_28010 212066 211056 gene locus_tag LOCUS_28020 212066 211056 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085252.1 protein_id gnl|my_center|LOCUS_28020 212363 212971 gene locus_tag LOCUS_28030 212363 212971 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175034.1 protein_id gnl|my_center|LOCUS_28030 212968 213681 gene locus_tag LOCUS_28040 212968 213681 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967402.1 protein_id gnl|my_center|LOCUS_28040 213681 213941 gene locus_tag LOCUS_28050 213681 213941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 213938 215152 gene locus_tag LOCUS_28060 213938 215152 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085256.1 protein_id gnl|my_center|LOCUS_28060 215564 215262 gene locus_tag LOCUS_28070 215564 215262 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968460.1 protein_id gnl|my_center|LOCUS_28070 216517 215636 gene locus_tag LOCUS_28080 gene hemF 216517 215636 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175030.1 protein_id gnl|my_center|LOCUS_28080 217316 216621 gene locus_tag LOCUS_28090 217316 216621 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_28090 217451 219319 gene locus_tag LOCUS_28100 217451 219319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109184.1 protein_id gnl|my_center|LOCUS_28100 219788 219324 gene locus_tag LOCUS_28110 219788 219324 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311191.1 protein_id gnl|my_center|LOCUS_28110 220067 220627 gene locus_tag LOCUS_28120 gene petA 220067 220627 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534144.1 protein_id gnl|my_center|LOCUS_28120 220651 221925 gene locus_tag LOCUS_28130 220651 221925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 221949 222797 gene locus_tag LOCUS_28140 221949 222797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 223832 223110 gene locus_tag LOCUS_28150 223832 223110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 224308 223832 gene locus_tag LOCUS_28160 224308 223832 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090171.1 protein_id gnl|my_center|LOCUS_28160 224860 224318 gene locus_tag LOCUS_28170 224860 224318 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967283.1 protein_id gnl|my_center|LOCUS_28170 226046 224904 gene locus_tag LOCUS_28180 gene ychF 226046 224904 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090173.1 protein_id gnl|my_center|LOCUS_28180 226693 226091 gene locus_tag LOCUS_28190 gene pth 226693 226091 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090174.1 protein_id gnl|my_center|LOCUS_28190 227420 226797 gene locus_tag LOCUS_28200 227420 226797 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090175.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28200 228435 227626 gene locus_tag LOCUS_28210 228435 227626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 229533 228580 gene locus_tag LOCUS_28220 229533 228580 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174674.1 protein_id gnl|my_center|LOCUS_28220 230383 229712 gene locus_tag LOCUS_28230 230383 229712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090181.1 protein_id gnl|my_center|LOCUS_28230 231619 230468 gene locus_tag LOCUS_28240 231619 230468 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530004.1 protein_id gnl|my_center|LOCUS_28240 231787 231882 gene locus_tag LOCUS_t00420 231787 231882 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 233525 232395 gene locus_tag LOCUS_28250 233525 232395 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140038.1 protein_id gnl|my_center|LOCUS_28250 234367 233522 gene locus_tag LOCUS_28260 gene lgt 234367 233522 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387355.1 protein_id gnl|my_center|LOCUS_28260 234660 234926 gene locus_tag LOCUS_28270 234660 234926 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090176.1 protein_id gnl|my_center|LOCUS_28270 235153 235650 gene locus_tag LOCUS_28280 235153 235650 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532890.1 protein_id gnl|my_center|LOCUS_28280 236011 236835 gene locus_tag LOCUS_28290 gene proC 236011 236835 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463862.1 protein_id gnl|my_center|LOCUS_28290 236947 237807 gene locus_tag LOCUS_28300 236947 237807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 237831 238184 gene locus_tag LOCUS_28310 237831 238184 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969865.1 protein_id gnl|my_center|LOCUS_28310 239600 238197 gene locus_tag LOCUS_28320 239600 238197 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090196.1 protein_id gnl|my_center|LOCUS_28320 240325 239597 gene locus_tag LOCUS_28330 240325 239597 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090195.1 protein_id gnl|my_center|LOCUS_28330 240951 240337 gene locus_tag LOCUS_28340 240951 240337 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000365.1 protein_id gnl|my_center|LOCUS_28340 241197 242087 gene locus_tag LOCUS_28350 241197 242087 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 protein_id gnl|my_center|LOCUS_28350 242903 242430 gene locus_tag LOCUS_28360 242903 242430 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090206.1 protein_id gnl|my_center|LOCUS_28360 243169 242918 gene locus_tag LOCUS_28370 gene moaD 243169 242918 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090205.1 protein_id gnl|my_center|LOCUS_28370 243807 243166 gene locus_tag LOCUS_28380 gene pgsA 243807 243166 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090204.1 protein_id gnl|my_center|LOCUS_28380 246204 243991 gene locus_tag LOCUS_28390 gene uvrC 246204 243991 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532481.1 protein_id gnl|my_center|LOCUS_28390 246367 247068 gene locus_tag LOCUS_28400 246367 247068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 247147 248082 gene locus_tag LOCUS_28410 247147 248082 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921808.1 protein_id gnl|my_center|LOCUS_28410 248874 248089 gene locus_tag LOCUS_28420 248874 248089 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532482.1 protein_id gnl|my_center|LOCUS_28420 249213 249827 gene locus_tag LOCUS_28430 249213 249827 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974623.1 protein_id gnl|my_center|LOCUS_28430 250271 250915 gene locus_tag LOCUS_28440 250271 250915 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087468.1 protein_id gnl|my_center|LOCUS_28440 251608 251003 gene locus_tag LOCUS_28450 251608 251003 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971416.1 protein_id gnl|my_center|LOCUS_28450 251926 251711 gene locus_tag LOCUS_28460 251926 251711 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544396.1 protein_id gnl|my_center|LOCUS_28460 252920 252027 gene locus_tag LOCUS_28470 252920 252027 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532491.1 protein_id gnl|my_center|LOCUS_28470 253614 252937 gene locus_tag LOCUS_28480 253614 252937 CDS product ribonuclease T2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090200.1 protein_id gnl|my_center|LOCUS_28480 254132 253611 gene locus_tag LOCUS_28490 254132 253611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174664.1 protein_id gnl|my_center|LOCUS_28490 254610 254284 gene locus_tag LOCUS_28500 254610 254284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 255003 254650 gene locus_tag LOCUS_28510 255003 254650 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532197.1 protein_id gnl|my_center|LOCUS_28510 256729 255116 gene locus_tag LOCUS_28520 256729 255116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085511.1 protein_id gnl|my_center|LOCUS_28520 257512 256811 gene locus_tag LOCUS_28530 257512 256811 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085510.1 protein_id gnl|my_center|LOCUS_28530 257902 258249 gene locus_tag LOCUS_28540 257902 258249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 258259 258621 gene locus_tag LOCUS_28550 258259 258621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 258678 259601 gene locus_tag LOCUS_28560 258678 259601 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707167.1 protein_id gnl|my_center|LOCUS_28560 259705 260502 gene locus_tag LOCUS_28570 259705 260502 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267764.1 protein_id gnl|my_center|LOCUS_28570 260667 263162 gene locus_tag LOCUS_28580 gene uvrB 260667 263162 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090165.1 protein_id gnl|my_center|LOCUS_28580 263594 263181 gene locus_tag LOCUS_28590 263594 263181 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771495.1 protein_id gnl|my_center|LOCUS_28590 263691 264077 gene locus_tag LOCUS_28600 263691 264077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 265178 264138 gene locus_tag LOCUS_28610 265178 264138 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844614.1 protein_id gnl|my_center|LOCUS_28610 265500 265330 gene locus_tag LOCUS_28620 265500 265330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 265858 268653 gene locus_tag LOCUS_28630 gene ppc 265858 268653 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085739.1 protein_id gnl|my_center|LOCUS_28630 268663 268956 gene locus_tag LOCUS_28640 268663 268956 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327634.1 protein_id gnl|my_center|LOCUS_28640 269094 269321 gene locus_tag LOCUS_28650 269094 269321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 269300 269602 gene locus_tag LOCUS_28660 269300 269602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 270359 269607 gene locus_tag LOCUS_28670 270359 269607 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530745.1 protein_id gnl|my_center|LOCUS_28670 270858 270385 gene locus_tag LOCUS_28680 270858 270385 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086743.1 protein_id gnl|my_center|LOCUS_28680 271204 273003 gene locus_tag LOCUS_28690 gene ggt 271204 273003 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974729.1 protein_id gnl|my_center|LOCUS_28690 273556 273188 gene locus_tag LOCUS_28700 273556 273188 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 protein_id gnl|my_center|LOCUS_28700 274871 273642 gene locus_tag LOCUS_28710 274871 273642 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008540630.1 protein_id gnl|my_center|LOCUS_28710 275656 274967 gene locus_tag LOCUS_28720 gene urtE 275656 274967 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083792.1 protein_id gnl|my_center|LOCUS_28720 276434 275667 gene locus_tag LOCUS_28730 gene urtD 276434 275667 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083791.1 protein_id gnl|my_center|LOCUS_28730 277626 276448 gene locus_tag LOCUS_28740 gene urtC 277626 276448 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083790.1 protein_id gnl|my_center|LOCUS_28740 278563 277637 gene locus_tag LOCUS_28750 gene urtB 278563 277637 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083789.1 protein_id gnl|my_center|LOCUS_28750 279943 278663 gene locus_tag LOCUS_28760 gene urtA 279943 278663 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965210.1 protein_id gnl|my_center|LOCUS_28760 280418 283804 gene locus_tag LOCUS_28770 280418 283804 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083787.1 protein_id gnl|my_center|LOCUS_28770 283794 284726 gene locus_tag LOCUS_28780 283794 284726 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161532938.1 protein_id gnl|my_center|LOCUS_28780 284963 285298 gene locus_tag LOCUS_28790 284963 285298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 285917 285507 gene locus_tag LOCUS_28800 285917 285507 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 protein_id gnl|my_center|LOCUS_28800 287558 286041 gene locus_tag LOCUS_28810 287558 286041 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329122.1 protein_id gnl|my_center|LOCUS_28810 287800 289719 gene locus_tag LOCUS_28820 287800 289719 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388687.1 protein_id gnl|my_center|LOCUS_28820 289723 290061 gene locus_tag LOCUS_28830 289723 290061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 290410 290045 gene locus_tag LOCUS_28840 gene mnhG 290410 290045 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394062.1 protein_id gnl|my_center|LOCUS_28840 290688 290407 gene locus_tag LOCUS_28850 290688 290407 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313274.1 protein_id gnl|my_center|LOCUS_28850 291182 290685 gene locus_tag LOCUS_28860 291182 290685 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339550.1 protein_id gnl|my_center|LOCUS_28860 292813 291179 gene locus_tag LOCUS_28870 292813 291179 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687984.1 protein_id gnl|my_center|LOCUS_28870 293151 292810 gene locus_tag LOCUS_28880 293151 292810 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329878.1 protein_id gnl|my_center|LOCUS_28880 296060 293142 gene locus_tag LOCUS_28890 296060 293142 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311017.1 protein_id gnl|my_center|LOCUS_28890 296150 296377 gene locus_tag LOCUS_28900 296150 296377 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265969.1 protein_id gnl|my_center|LOCUS_28900 296589 296987 gene locus_tag LOCUS_28910 296589 296987 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265510.1 protein_id gnl|my_center|LOCUS_28910 297136 297211 gene locus_tag LOCUS_t00430 297136 297211 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 298356 297154 gene locus_tag LOCUS_28920 298356 297154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 298622 298356 gene locus_tag LOCUS_28930 298622 298356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 299284 298643 gene locus_tag LOCUS_28940 299284 298643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 299629 299435 gene locus_tag LOCUS_28950 299629 299435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 300189 299626 gene locus_tag LOCUS_28960 300189 299626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 300270 300521 gene locus_tag LOCUS_28970 300270 300521 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107649648.1 protein_id gnl|my_center|LOCUS_28970 300578 300651 gene locus_tag LOCUS_t00440 300578 300651 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 301121 301345 gene locus_tag LOCUS_28980 301121 301345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 <301914 301361 gene locus_tag LOCUS_28990 <301914 301361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072857.1:phage tail tape measure protein >Feature sequence14 700 927 gene locus_tag LOCUS_29000 700 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 986 1345 gene locus_tag LOCUS_29010 986 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29010 1264 2019 gene locus_tag LOCUS_29020 1264 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29020 3105 2140 gene locus_tag LOCUS_29030 3105 2140 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806971.1 protein_id gnl|my_center|LOCUS_29030 3335 4588 gene locus_tag LOCUS_29040 3335 4588 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532907.1 protein_id gnl|my_center|LOCUS_29040 4588 4872 gene locus_tag LOCUS_29050 4588 4872 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821030.1 protein_id gnl|my_center|LOCUS_29050 4869 7832 gene locus_tag LOCUS_29060 4869 7832 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532909.1 protein_id gnl|my_center|LOCUS_29060 7825 8442 gene locus_tag LOCUS_29070 7825 8442 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532910.1 protein_id gnl|my_center|LOCUS_29070 8537 9406 gene locus_tag LOCUS_29080 gene purU 8537 9406 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921457.1 protein_id gnl|my_center|LOCUS_29080 9570 10445 gene locus_tag LOCUS_29090 gene folD 9570 10445 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 protein_id gnl|my_center|LOCUS_29090 14745 10588 gene locus_tag LOCUS_29100 14745 10588 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355187.1 protein_id gnl|my_center|LOCUS_29100 11762 11771 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15802 14954 gene locus_tag LOCUS_29110 15802 14954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29110 16167 15895 gene locus_tag LOCUS_29120 16167 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29120 16977 16198 gene locus_tag LOCUS_29130 16977 16198 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089223.1 protein_id gnl|my_center|LOCUS_29130 17504 16974 gene locus_tag LOCUS_29140 17504 16974 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089224.1 protein_id gnl|my_center|LOCUS_29140 19029 17572 gene locus_tag LOCUS_29150 19029 17572 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089225.1 protein_id gnl|my_center|LOCUS_29150 19561 19040 gene locus_tag LOCUS_29160 19561 19040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 19780 20205 gene locus_tag LOCUS_29170 19780 20205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 21640 20681 gene locus_tag LOCUS_29180 21640 20681 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563288.1 protein_id gnl|my_center|LOCUS_29180 22664 21666 gene locus_tag LOCUS_29190 22664 21666 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721763.1 protein_id gnl|my_center|LOCUS_29190 24156 22657 gene locus_tag LOCUS_29200 24156 22657 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338818.1 protein_id gnl|my_center|LOCUS_29200 25304 24156 gene locus_tag LOCUS_29210 25304 24156 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338817.1 protein_id gnl|my_center|LOCUS_29210 26359 25301 gene locus_tag LOCUS_29220 26359 25301 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509042.1 protein_id gnl|my_center|LOCUS_29220 26536 27531 gene locus_tag LOCUS_29230 26536 27531 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338815.1 protein_id gnl|my_center|LOCUS_29230 27711 28106 gene locus_tag LOCUS_29240 27711 28106 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257518.1 protein_id gnl|my_center|LOCUS_29240 28103 29023 gene locus_tag LOCUS_29250 28103 29023 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972680.1 protein_id gnl|my_center|LOCUS_29250 29368 29724 gene locus_tag LOCUS_29260 29368 29724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29260 31136 29922 gene locus_tag LOCUS_29270 31136 29922 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387806.1 protein_id gnl|my_center|LOCUS_29270 31414 31136 gene locus_tag LOCUS_29280 31414 31136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 33038 31572 gene locus_tag LOCUS_29290 33038 31572 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_29290 34418 33090 gene locus_tag LOCUS_29300 34418 33090 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052704.1 protein_id gnl|my_center|LOCUS_29300 34791 36134 gene locus_tag LOCUS_29310 34791 36134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 36234 36869 gene locus_tag LOCUS_29320 36234 36869 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530072.1 protein_id gnl|my_center|LOCUS_29320 37172 36897 gene locus_tag LOCUS_29330 37172 36897 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083527.1 protein_id gnl|my_center|LOCUS_29330 37585 37178 gene locus_tag LOCUS_29340 37585 37178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 37544 39805 gene locus_tag LOCUS_29350 37544 39805 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_29350 41274 39979 gene locus_tag LOCUS_29360 41274 39979 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039905.1 protein_id gnl|my_center|LOCUS_29360 42559 41681 gene locus_tag LOCUS_29370 gene nadC 42559 41681 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973559.1 protein_id gnl|my_center|LOCUS_29370 44206 42701 gene locus_tag LOCUS_29380 44206 42701 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085328.1 protein_id gnl|my_center|LOCUS_29380 45296 44229 gene locus_tag LOCUS_29390 gene nadA 45296 44229 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533321.1 protein_id gnl|my_center|LOCUS_29390 45501 46310 gene locus_tag LOCUS_29400 45501 46310 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395528.1 protein_id gnl|my_center|LOCUS_29400 46852 46313 gene locus_tag LOCUS_29410 46852 46313 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530108.1 protein_id gnl|my_center|LOCUS_29410 49322 46857 gene locus_tag LOCUS_29420 gene ligD 49322 46857 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395526.1 protein_id gnl|my_center|LOCUS_29420 50246 49329 gene locus_tag LOCUS_29430 50246 49329 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253416.1 protein_id gnl|my_center|LOCUS_29430 50812 50360 gene locus_tag LOCUS_29440 gene aroQ 50812 50360 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 protein_id gnl|my_center|LOCUS_29440 51469 50840 gene locus_tag LOCUS_29450 51469 50840 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338930.1 protein_id gnl|my_center|LOCUS_29450 51903 51466 gene locus_tag LOCUS_29460 51903 51466 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097137372.1 protein_id gnl|my_center|LOCUS_29460 52736 52059 gene locus_tag LOCUS_29470 52736 52059 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530450.1 protein_id gnl|my_center|LOCUS_29470 53172 52750 gene locus_tag LOCUS_29480 53172 52750 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877160.1 protein_id gnl|my_center|LOCUS_29480 54474 53212 gene locus_tag LOCUS_29490 gene argE 54474 53212 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064838.1 protein_id gnl|my_center|LOCUS_29490 54970 54479 gene locus_tag LOCUS_29500 gene rutF 54970 54479 CDS product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097198.1 protein_id gnl|my_center|LOCUS_29500 56451 54991 gene locus_tag LOCUS_29510 gene hpaB 56451 54991 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228328.1 protein_id gnl|my_center|LOCUS_29510 56542 57486 gene locus_tag LOCUS_29520 56542 57486 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084035.1 protein_id gnl|my_center|LOCUS_29520 57652 58242 gene locus_tag LOCUS_29530 57652 58242 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809213.1 protein_id gnl|my_center|LOCUS_29530 58511 59446 gene locus_tag LOCUS_29540 58511 59446 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970456.1 protein_id gnl|my_center|LOCUS_29540 59504 60529 gene locus_tag LOCUS_29550 59504 60529 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971010.1 protein_id gnl|my_center|LOCUS_29550 60806 61663 gene locus_tag LOCUS_29560 60806 61663 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086028.1 protein_id gnl|my_center|LOCUS_29560 61674 62465 gene locus_tag LOCUS_29570 61674 62465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383453.1 protein_id gnl|my_center|LOCUS_29570 62477 63607 gene locus_tag LOCUS_29580 62477 63607 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965492.1 protein_id gnl|my_center|LOCUS_29580 65713 63686 gene locus_tag LOCUS_29590 65713 63686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 66008 66187 gene locus_tag LOCUS_29600 66008 66187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 66243 66830 gene locus_tag LOCUS_29610 66243 66830 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083950.1 protein_id gnl|my_center|LOCUS_29610 68730 66775 gene locus_tag LOCUS_29620 68730 66775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 68964 69722 gene locus_tag LOCUS_29630 68964 69722 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083951.1 protein_id gnl|my_center|LOCUS_29630 69815 71479 gene locus_tag LOCUS_29640 69815 71479 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099307999.1 protein_id gnl|my_center|LOCUS_29640 71511 72113 gene locus_tag LOCUS_29650 71511 72113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 72292 72729 gene locus_tag LOCUS_29660 72292 72729 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061809.1 protein_id gnl|my_center|LOCUS_29660 74434 72746 gene locus_tag LOCUS_29670 74434 72746 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089552.1 protein_id gnl|my_center|LOCUS_29670 74991 74509 gene locus_tag LOCUS_29680 74991 74509 CDS product DUF2214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874850.1 protein_id gnl|my_center|LOCUS_29680 75423 75013 gene locus_tag LOCUS_29690 75423 75013 CDS product DUF6152 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874852.1 protein_id gnl|my_center|LOCUS_29690 75585 75983 gene locus_tag LOCUS_29700 75585 75983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 78476 76038 gene locus_tag LOCUS_29710 gene gyrB 78476 76038 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390482.1 protein_id gnl|my_center|LOCUS_29710 79149 78535 gene locus_tag LOCUS_29720 79149 78535 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533411.1 protein_id gnl|my_center|LOCUS_29720 80368 79184 gene locus_tag LOCUS_29730 gene recF 80368 79184 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083649.1 protein_id gnl|my_center|LOCUS_29730 81480 80365 gene locus_tag LOCUS_29740 gene dnaN 81480 80365 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083651.1 protein_id gnl|my_center|LOCUS_29740 83215 81713 gene locus_tag LOCUS_29750 gene dnaA 83215 81713 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083652.1 protein_id gnl|my_center|LOCUS_29750 84623 84357 gene locus_tag LOCUS_29760 gene rpsT 84623 84357 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533694.1 protein_id gnl|my_center|LOCUS_29760 85574 84801 gene locus_tag LOCUS_29770 85574 84801 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391548.1 protein_id gnl|my_center|LOCUS_29770 86483 85584 gene locus_tag LOCUS_29780 gene mutM 86483 85584 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083585.1 protein_id gnl|my_center|LOCUS_29780 87148 86528 gene locus_tag LOCUS_29790 87148 86528 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993993.1 protein_id gnl|my_center|LOCUS_29790 87676 87158 gene locus_tag LOCUS_29800 87676 87158 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185888.1 protein_id gnl|my_center|LOCUS_29800 87930 88910 gene locus_tag LOCUS_29810 87930 88910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 88994 90586 gene locus_tag LOCUS_29820 gene ctaD 88994 90586 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083990.1 protein_id gnl|my_center|LOCUS_29820 90747 91700 gene locus_tag LOCUS_29830 90747 91700 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083991.1 protein_id gnl|my_center|LOCUS_29830 91726 91908 gene locus_tag LOCUS_29840 91726 91908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083992.1 protein_id gnl|my_center|LOCUS_29840 91915 92547 gene locus_tag LOCUS_29850 91915 92547 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968908.1 protein_id gnl|my_center|LOCUS_29850 92649 93485 gene locus_tag LOCUS_29860 92649 93485 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083994.1 protein_id gnl|my_center|LOCUS_29860 93643 94029 gene locus_tag LOCUS_29870 93643 94029 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503617.1 protein_id gnl|my_center|LOCUS_29870 94026 94790 gene locus_tag LOCUS_29880 94026 94790 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456717.1 protein_id gnl|my_center|LOCUS_29880 94874 96283 gene locus_tag LOCUS_29890 gene thrC 94874 96283 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921382.1 protein_id gnl|my_center|LOCUS_29890 96280 97560 gene locus_tag LOCUS_29900 96280 97560 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084001.1 protein_id gnl|my_center|LOCUS_29900 97579 98187 gene locus_tag LOCUS_29910 97579 98187 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084002.1 protein_id gnl|my_center|LOCUS_29910 98417 98695 gene locus_tag LOCUS_29920 98417 98695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 98819 99298 gene locus_tag LOCUS_29930 gene bfr 98819 99298 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089420.1 protein_id gnl|my_center|LOCUS_29930 99536 100582 gene locus_tag LOCUS_29940 99536 100582 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550682.1 protein_id gnl|my_center|LOCUS_29940 100674 102335 gene locus_tag LOCUS_29950 100674 102335 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970878.1 protein_id gnl|my_center|LOCUS_29950 104338 102371 gene locus_tag LOCUS_29960 104338 102371 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968769.1 protein_id gnl|my_center|LOCUS_29960 104555 106408 gene locus_tag LOCUS_29970 104555 106408 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921541.1 protein_id gnl|my_center|LOCUS_29970 109183 106415 gene locus_tag LOCUS_29980 109183 106415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 109498 109908 gene locus_tag LOCUS_29990 109498 109908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 110116 110634 gene locus_tag LOCUS_30000 110116 110634 CDS product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090130.1 protein_id gnl|my_center|LOCUS_30000 110850 111146 gene locus_tag LOCUS_30010 gene groES 110850 111146 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533567.1 protein_id gnl|my_center|LOCUS_30010 111254 112894 gene locus_tag LOCUS_30020 gene groL 111254 112894 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090265.1 protein_id gnl|my_center|LOCUS_30020 113143 114039 gene locus_tag LOCUS_30030 113143 114039 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982129.1 protein_id gnl|my_center|LOCUS_30030 114228 114046 gene locus_tag LOCUS_30040 114228 114046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 114668 114237 gene locus_tag LOCUS_30050 114668 114237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30050 114813 115442 gene locus_tag LOCUS_30060 114813 115442 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085308.1 protein_id gnl|my_center|LOCUS_30060 116496 115474 gene locus_tag LOCUS_30070 gene cydB 116496 115474 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105098.1 protein_id gnl|my_center|LOCUS_30070 117912 116500 gene locus_tag LOCUS_30080 117912 116500 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064357.1 protein_id gnl|my_center|LOCUS_30080 118938 118039 gene locus_tag LOCUS_30090 118938 118039 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085310.1 protein_id gnl|my_center|LOCUS_30090 119049 120767 gene locus_tag LOCUS_30100 119049 120767 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327740.1 protein_id gnl|my_center|LOCUS_30100 121290 120829 gene locus_tag LOCUS_30110 121290 120829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 121641 122486 gene locus_tag LOCUS_30120 gene phnC 121641 122486 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104080.1 protein_id gnl|my_center|LOCUS_30120 122501 123502 gene locus_tag LOCUS_30130 gene phnD 122501 123502 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992002.1 protein_id gnl|my_center|LOCUS_30130 123686 124516 gene locus_tag LOCUS_30140 gene phnE 123686 124516 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302225.1 protein_id gnl|my_center|LOCUS_30140 124699 124938 gene locus_tag LOCUS_30150 124699 124938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 125292 127040 gene locus_tag LOCUS_30160 125292 127040 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 protein_id gnl|my_center|LOCUS_30160 128437 127058 gene locus_tag LOCUS_30170 gene clcA 128437 127058 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463563.1 protein_id gnl|my_center|LOCUS_30170 129484 128531 gene locus_tag LOCUS_30180 129484 128531 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389332.1 protein_id gnl|my_center|LOCUS_30180 131324 129735 gene locus_tag LOCUS_30190 gene purH 131324 129735 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083410.1 protein_id gnl|my_center|LOCUS_30190 132695 131511 gene locus_tag LOCUS_30200 132695 131511 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974706.1 protein_id gnl|my_center|LOCUS_30200 133501 132752 gene locus_tag LOCUS_30210 133501 132752 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389333.1 protein_id gnl|my_center|LOCUS_30210 133692 134528 gene locus_tag LOCUS_30220 133692 134528 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175380.1 protein_id gnl|my_center|LOCUS_30220 135630 134572 gene locus_tag LOCUS_30230 135630 134572 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388422.1 protein_id gnl|my_center|LOCUS_30230 136097 135651 gene locus_tag LOCUS_30240 136097 135651 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388423.1 protein_id gnl|my_center|LOCUS_30240 137590 136094 gene locus_tag LOCUS_30250 137590 136094 CDS product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316406.1 protein_id gnl|my_center|LOCUS_30250 137811 138911 gene locus_tag LOCUS_30260 137811 138911 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021528.1 protein_id gnl|my_center|LOCUS_30260 139005 139154 gene locus_tag LOCUS_30270 139005 139154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 139259 139183 gene locus_tag LOCUS_t00450 139259 139183 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 139446 139652 gene locus_tag LOCUS_30280 139446 139652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 139726 141147 gene locus_tag LOCUS_30290 139726 141147 CDS product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965237.1 protein_id gnl|my_center|LOCUS_30290 142275 141166 gene locus_tag LOCUS_30300 gene dmeF 142275 141166 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613684.1 protein_id gnl|my_center|LOCUS_30300 142568 142290 gene locus_tag LOCUS_30310 142568 142290 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383336.1 protein_id gnl|my_center|LOCUS_30310 143459 142653 gene locus_tag LOCUS_30320 143459 142653 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083972.1 protein_id gnl|my_center|LOCUS_30320 144382 143456 gene locus_tag LOCUS_30330 144382 143456 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172821.1 protein_id gnl|my_center|LOCUS_30330 144714 146003 gene locus_tag LOCUS_30340 144714 146003 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183209478.1 protein_id gnl|my_center|LOCUS_30340 146099 146449 gene locus_tag LOCUS_30350 146099 146449 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138408146.1 protein_id gnl|my_center|LOCUS_30350 147056 146427 gene locus_tag LOCUS_30360 147056 146427 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085831.1 protein_id gnl|my_center|LOCUS_30360 147449 147066 gene locus_tag LOCUS_30370 147449 147066 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087513.1 protein_id gnl|my_center|LOCUS_30370 148566 147574 gene locus_tag LOCUS_30380 gene meaB 148566 147574 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_30380 149446 148586 gene locus_tag LOCUS_30390 149446 148586 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966658.1 protein_id gnl|my_center|LOCUS_30390 150962 149580 gene locus_tag LOCUS_30400 150962 149580 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970659.1 protein_id gnl|my_center|LOCUS_30400 152555 151038 gene locus_tag LOCUS_30410 152555 151038 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085846.1 protein_id gnl|my_center|LOCUS_30410 152631 153560 gene locus_tag LOCUS_30420 gene folP 152631 153560 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438639.1 protein_id gnl|my_center|LOCUS_30420 153547 154092 gene locus_tag LOCUS_30430 gene folK 153547 154092 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085841.1 protein_id gnl|my_center|LOCUS_30430 154553 154164 gene locus_tag LOCUS_30440 154553 154164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 154735 155721 gene locus_tag LOCUS_30450 154735 155721 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 protein_id gnl|my_center|LOCUS_30450 155721 156062 gene locus_tag LOCUS_30460 155721 156062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 156753 156157 gene locus_tag LOCUS_30470 156753 156157 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014491764.1 protein_id gnl|my_center|LOCUS_30470 157056 158375 gene locus_tag LOCUS_30480 157056 158375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 160571 158475 gene locus_tag LOCUS_30490 160571 158475 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532662.1 protein_id gnl|my_center|LOCUS_30490 160996 160568 gene locus_tag LOCUS_30500 gene msrB 160996 160568 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144322.1 protein_id gnl|my_center|LOCUS_30500 161335 161754 gene locus_tag LOCUS_30510 161335 161754 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085852.1 protein_id gnl|my_center|LOCUS_30510 162073 161798 gene locus_tag LOCUS_30520 162073 161798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 162258 162641 gene locus_tag LOCUS_30530 162258 162641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 162631 163176 gene locus_tag LOCUS_30540 162631 163176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 163610 163173 gene locus_tag LOCUS_30550 163610 163173 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974817.1 protein_id gnl|my_center|LOCUS_30550 164174 163671 gene locus_tag LOCUS_30560 164174 163671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 164349 165002 gene locus_tag LOCUS_30570 164349 165002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 165011 165355 gene locus_tag LOCUS_30580 165011 165355 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085858.1 protein_id gnl|my_center|LOCUS_30580 166632 165361 gene locus_tag LOCUS_30590 166632 165361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 166817 166981 gene locus_tag LOCUS_30600 166817 166981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 167521 166976 gene locus_tag LOCUS_30610 167521 166976 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085884.1 protein_id gnl|my_center|LOCUS_30610 168093 167518 gene locus_tag LOCUS_30620 168093 167518 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085885.1 protein_id gnl|my_center|LOCUS_30620 170424 168184 gene locus_tag LOCUS_30630 170424 168184 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085886.1 protein_id gnl|my_center|LOCUS_30630 170640 171182 gene locus_tag LOCUS_30640 170640 171182 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085887.1 protein_id gnl|my_center|LOCUS_30640 172281 171148 gene locus_tag LOCUS_30650 172281 171148 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090144.1 protein_id gnl|my_center|LOCUS_30650 172385 173200 gene locus_tag LOCUS_30660 172385 173200 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389168.1 protein_id gnl|my_center|LOCUS_30660 174080 173172 gene locus_tag LOCUS_30670 174080 173172 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973109.1 protein_id gnl|my_center|LOCUS_30670 174188 174535 gene locus_tag LOCUS_30680 174188 174535 CDS product DUF6481 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528462.1 protein_id gnl|my_center|LOCUS_30680 175129 174572 gene locus_tag LOCUS_30690 gene dcd 175129 174572 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087770.1 protein_id gnl|my_center|LOCUS_30690 175416 175991 gene locus_tag LOCUS_30700 175416 175991 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919410.1 protein_id gnl|my_center|LOCUS_30700 177213 176482 gene locus_tag LOCUS_30710 177213 176482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 177555 178118 gene locus_tag LOCUS_30720 177555 178118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 178030 179406 gene locus_tag LOCUS_30730 178030 179406 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235776816.1 protein_id gnl|my_center|LOCUS_30730 180174 179455 gene locus_tag LOCUS_30740 180174 179455 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965209.1 protein_id gnl|my_center|LOCUS_30740 180617 181183 gene locus_tag LOCUS_30750 180617 181183 CDS product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 protein_id gnl|my_center|LOCUS_30750 181180 181506 gene locus_tag LOCUS_30760 181180 181506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 181580 181990 gene locus_tag LOCUS_30770 181580 181990 CDS product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532641.1 protein_id gnl|my_center|LOCUS_30770 182215 182574 gene locus_tag LOCUS_30780 182215 182574 CDS product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920622.1 protein_id gnl|my_center|LOCUS_30780 182658 183575 gene locus_tag LOCUS_30790 182658 183575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 183600 184385 gene locus_tag LOCUS_30800 183600 184385 CDS product glycosyl hydrolase 108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530785.1 protein_id gnl|my_center|LOCUS_30800 184382 184630 gene locus_tag LOCUS_30810 184382 184630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 185110 185736 gene locus_tag LOCUS_30820 185110 185736 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085905.1 protein_id gnl|my_center|LOCUS_30820 185736 187133 gene locus_tag LOCUS_30830 185736 187133 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_30830 187238 187705 gene locus_tag LOCUS_30840 187238 187705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532637.1 protein_id gnl|my_center|LOCUS_30840 187857 189008 gene locus_tag LOCUS_30850 gene ccmI 187857 189008 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085909.1 protein_id gnl|my_center|LOCUS_30850 189013 189459 gene locus_tag LOCUS_30860 gene ccmE 189013 189459 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085910.1 protein_id gnl|my_center|LOCUS_30860 189456 191453 gene locus_tag LOCUS_30870 189456 191453 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968989.1 protein_id gnl|my_center|LOCUS_30870 191585 192076 gene locus_tag LOCUS_30880 191585 192076 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085912.1 protein_id gnl|my_center|LOCUS_30880 192171 193739 gene locus_tag LOCUS_30890 192171 193739 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085914.1 protein_id gnl|my_center|LOCUS_30890 193898 194680 gene locus_tag LOCUS_30900 193898 194680 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965709.1 protein_id gnl|my_center|LOCUS_30900 194664 196070 gene locus_tag LOCUS_30910 194664 196070 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_30910 196259 199147 gene locus_tag LOCUS_30920 196259 199147 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085917.1 protein_id gnl|my_center|LOCUS_30920 200279 199155 gene locus_tag LOCUS_30930 200279 199155 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398410.1 protein_id gnl|my_center|LOCUS_30930 202619 200289 gene locus_tag LOCUS_30940 202619 200289 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085924.1 protein_id gnl|my_center|LOCUS_30940 202862 203401 gene locus_tag LOCUS_30950 gene fae 202862 203401 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326305.1 protein_id gnl|my_center|LOCUS_30950 206096 203448 gene locus_tag LOCUS_30960 gene pepN 206096 203448 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532626.1 protein_id gnl|my_center|LOCUS_30960 206270 207520 gene locus_tag LOCUS_30970 206270 207520 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532210.1 protein_id gnl|my_center|LOCUS_30970 207887 207525 gene locus_tag LOCUS_30980 gene folB 207887 207525 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027544155.1 protein_id gnl|my_center|LOCUS_30980 208946 207906 gene locus_tag LOCUS_30990 208946 207906 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532038.1 protein_id gnl|my_center|LOCUS_30990 209905 208943 gene locus_tag LOCUS_31000 209905 208943 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123514.1 protein_id gnl|my_center|LOCUS_31000 209950 210648 gene locus_tag LOCUS_31010 209950 210648 CDS product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827384.1 protein_id gnl|my_center|LOCUS_31010 211462 210638 gene locus_tag LOCUS_31020 211462 210638 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827560.1 protein_id gnl|my_center|LOCUS_31020 212364 211459 gene locus_tag LOCUS_31030 212364 211459 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532034.1 protein_id gnl|my_center|LOCUS_31030 213326 212361 gene locus_tag LOCUS_31040 gene mch 213326 212361 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532033.1 protein_id gnl|my_center|LOCUS_31040 214494 213334 gene locus_tag LOCUS_31050 214494 213334 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532032.1 protein_id gnl|my_center|LOCUS_31050 215356 214460 gene locus_tag LOCUS_31060 215356 214460 CDS product methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532031.1 protein_id gnl|my_center|LOCUS_31060 216483 215443 gene locus_tag LOCUS_31070 216483 215443 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_31070 216677 217057 gene locus_tag LOCUS_31080 216677 217057 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532029.1 protein_id gnl|my_center|LOCUS_31080 217075 218319 gene locus_tag LOCUS_31090 217075 218319 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020878.1 protein_id gnl|my_center|LOCUS_31090 218320 219987 gene locus_tag LOCUS_31100 218320 219987 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922276.1 protein_id gnl|my_center|LOCUS_31100 220331 221257 gene locus_tag LOCUS_31110 gene fhcD 220331 221257 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334456.1 protein_id gnl|my_center|LOCUS_31110 221254 222051 gene locus_tag LOCUS_31120 221254 222051 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122493.1 protein_id gnl|my_center|LOCUS_31120 223568 222165 gene locus_tag LOCUS_31130 gene mgtE 223568 222165 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531663.1 protein_id gnl|my_center|LOCUS_31130 223464 223829 gene locus_tag LOCUS_31140 223464 223829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 224870 224154 gene locus_tag LOCUS_31150 224870 224154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 225469 224867 gene locus_tag LOCUS_31160 225469 224867 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532039.1 protein_id gnl|my_center|LOCUS_31160 226985 225459 gene locus_tag LOCUS_31170 226985 225459 CDS product DUF6513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532040.1 protein_id gnl|my_center|LOCUS_31170 227544 226978 gene locus_tag LOCUS_31180 227544 226978 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532041.1 protein_id gnl|my_center|LOCUS_31180 228179 227541 gene locus_tag LOCUS_31190 228179 227541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 229250 228432 gene locus_tag LOCUS_31200 229250 228432 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529912.1 protein_id gnl|my_center|LOCUS_31200 229470 231248 gene locus_tag LOCUS_31210 gene mqo 229470 231248 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992235.1 protein_id gnl|my_center|LOCUS_31210 233381 231540 gene locus_tag LOCUS_31220 233381 231540 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086742.1 protein_id gnl|my_center|LOCUS_31220 233736 233431 gene locus_tag LOCUS_31230 233736 233431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 234010 233726 gene locus_tag LOCUS_31240 234010 233726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 234084 235502 gene locus_tag LOCUS_31250 234084 235502 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_31250 235713 236849 gene locus_tag LOCUS_31260 235713 236849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 236895 237434 gene locus_tag LOCUS_31270 gene exbD 236895 237434 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970692.1 protein_id gnl|my_center|LOCUS_31270 237431 238309 gene locus_tag LOCUS_31280 237431 238309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 239483 238296 gene locus_tag LOCUS_31290 239483 238296 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191808.1 protein_id gnl|my_center|LOCUS_31290 240478 239489 gene locus_tag LOCUS_31300 240478 239489 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400031.1 protein_id gnl|my_center|LOCUS_31300 241470 240475 gene locus_tag LOCUS_31310 241470 240475 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390112.1 protein_id gnl|my_center|LOCUS_31310 242204 241467 gene locus_tag LOCUS_31320 242204 241467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 243132 242209 gene locus_tag LOCUS_31330 243132 242209 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550972.1 protein_id gnl|my_center|LOCUS_31330 244135 243122 gene locus_tag LOCUS_31340 244135 243122 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974537.1 protein_id gnl|my_center|LOCUS_31340 246101 244503 gene locus_tag LOCUS_31350 246101 244503 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390109.1 protein_id gnl|my_center|LOCUS_31350 246356 247588 gene locus_tag LOCUS_31360 246356 247588 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085402.1 protein_id gnl|my_center|LOCUS_31360 248935 247595 gene locus_tag LOCUS_31370 248935 247595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 249857 248973 gene locus_tag LOCUS_31380 249857 248973 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391324.1 protein_id gnl|my_center|LOCUS_31380 250735 249896 gene locus_tag LOCUS_31390 250735 249896 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391324.1 protein_id gnl|my_center|LOCUS_31390 252269 250812 gene locus_tag LOCUS_31400 252269 250812 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104140.1 protein_id gnl|my_center|LOCUS_31400 252472 252840 gene locus_tag LOCUS_31410 252472 252840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 255608 252861 gene locus_tag LOCUS_31420 255608 252861 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456746.1 protein_id gnl|my_center|LOCUS_31420 256086 255769 gene locus_tag LOCUS_31430 256086 255769 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036600.1 protein_id gnl|my_center|LOCUS_31430 256255 256893 gene locus_tag LOCUS_31440 256255 256893 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534715.1 protein_id gnl|my_center|LOCUS_31440 259216 256922 gene locus_tag LOCUS_31450 259216 256922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 260120 259323 gene locus_tag LOCUS_31460 260120 259323 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252819.1 protein_id gnl|my_center|LOCUS_31460 261397 260117 gene locus_tag LOCUS_31470 261397 260117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969397.1 protein_id gnl|my_center|LOCUS_31470 263805 261628 gene locus_tag LOCUS_31480 263805 261628 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084290.1 protein_id gnl|my_center|LOCUS_31480 265286 263988 gene locus_tag LOCUS_31490 gene aceA 265286 263988 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787342.1 protein_id gnl|my_center|LOCUS_31490 265669 265442 gene locus_tag LOCUS_31500 265669 265442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 265813 267234 gene locus_tag LOCUS_31510 265813 267234 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 protein_id gnl|my_center|LOCUS_31510 269382 267376 gene locus_tag LOCUS_31520 269382 267376 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948595.1 protein_id gnl|my_center|LOCUS_31520 269699 269484 gene locus_tag LOCUS_31530 269699 269484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 271135 269696 gene locus_tag LOCUS_31540 271135 269696 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228607.1 protein_id gnl|my_center|LOCUS_31540 271333 272322 gene locus_tag LOCUS_31550 271333 272322 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207159.1 protein_id gnl|my_center|LOCUS_31550 272448 272945 gene locus_tag LOCUS_31560 272448 272945 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389200.1 protein_id gnl|my_center|LOCUS_31560 273393 273178 gene locus_tag LOCUS_31570 273393 273178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 273413 273832 gene locus_tag LOCUS_31580 273413 273832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 273977 274534 gene locus_tag LOCUS_31590 273977 274534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 274597 275109 gene locus_tag LOCUS_31600 274597 275109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 275239 275505 gene locus_tag LOCUS_31610 275239 275505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 275790 276068 gene locus_tag LOCUS_31620 275790 276068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 276155 276340 gene locus_tag LOCUS_31630 276155 276340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 276425 278092 gene locus_tag LOCUS_31640 276425 278092 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083724.1 protein_id gnl|my_center|LOCUS_31640 278658 278095 gene locus_tag LOCUS_31650 278658 278095 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329018.1 protein_id gnl|my_center|LOCUS_31650 280344 278746 gene locus_tag LOCUS_31660 280344 278746 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389949.1 protein_id gnl|my_center|LOCUS_31660 281334 280357 gene locus_tag LOCUS_31670 281334 280357 CDS product TIGR03885 family FMN-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975020.1 protein_id gnl|my_center|LOCUS_31670 281598 281347 gene locus_tag LOCUS_31680 281598 281347 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313814.1 protein_id gnl|my_center|LOCUS_31680 281906 283153 gene locus_tag LOCUS_31690 281906 283153 CDS product oxalate decarboxylase family bicupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974145.1 protein_id gnl|my_center|LOCUS_31690 284167 283184 gene locus_tag LOCUS_31700 gene yedA 284167 283184 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_31700 284382 286118 gene locus_tag LOCUS_31710 284382 286118 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528963.1 protein_id gnl|my_center|LOCUS_31710 287307 286153 gene locus_tag LOCUS_31720 287307 286153 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314859.1 protein_id gnl|my_center|LOCUS_31720 287750 287556 gene locus_tag LOCUS_31730 287750 287556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 288484 287804 gene locus_tag LOCUS_31740 288484 287804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194035.1 protein_id gnl|my_center|LOCUS_31740 289368 288544 gene locus_tag LOCUS_31750 289368 288544 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811217.1 protein_id gnl|my_center|LOCUS_31750 290780 289386 gene locus_tag LOCUS_31760 290780 289386 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811220.1 protein_id gnl|my_center|LOCUS_31760 292308 290773 gene locus_tag LOCUS_31770 292308 290773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 293846 292359 gene locus_tag LOCUS_31780 293846 292359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 295231 293843 gene locus_tag LOCUS_31790 295231 293843 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447772.1 protein_id gnl|my_center|LOCUS_31790 302517 295228 gene locus_tag LOCUS_31800 302517 295228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 305143 302603 gene locus_tag LOCUS_31810 305143 302603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 305765 308086 gene locus_tag LOCUS_31820 305765 308086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 308083 309492 gene locus_tag LOCUS_31830 308083 309492 CDS product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974404.1 protein_id gnl|my_center|LOCUS_31830 309489 310385 gene locus_tag LOCUS_31840 309489 310385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 310522 311988 gene locus_tag LOCUS_31850 310522 311988 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173221.1 protein_id gnl|my_center|LOCUS_31850 312013 313083 gene locus_tag LOCUS_31860 312013 313083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 313067 314485 gene locus_tag LOCUS_31870 313067 314485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 314489 315919 gene locus_tag LOCUS_31880 314489 315919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 316080 315835 gene locus_tag LOCUS_31890 316080 315835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 316039 317031 gene locus_tag LOCUS_31900 316039 317031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 317773 317060 gene locus_tag LOCUS_31910 317773 317060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 318830 317763 gene locus_tag LOCUS_31920 318830 317763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 319145 320137 gene locus_tag LOCUS_31930 319145 320137 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242572.1 protein_id gnl|my_center|LOCUS_31930 320134 321078 gene locus_tag LOCUS_31940 320134 321078 CDS product manganese/iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172901062.1 protein_id gnl|my_center|LOCUS_31940 321075 321938 gene locus_tag LOCUS_31950 321075 321938 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067127.1 protein_id gnl|my_center|LOCUS_31950 321938 322795 gene locus_tag LOCUS_31960 gene sitD 321938 322795 CDS product iron/manganese ABC transporter permease subunit SitD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477918.1 protein_id gnl|my_center|LOCUS_31960 324110 322815 gene locus_tag LOCUS_31970 324110 322815 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625669.1 protein_id gnl|my_center|LOCUS_31970 325782 324187 gene locus_tag LOCUS_31980 325782 324187 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544143.1 protein_id gnl|my_center|LOCUS_31980 328122 325867 gene locus_tag LOCUS_31990 328122 325867 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068954085.1 protein_id gnl|my_center|LOCUS_31990 328750 329751 gene locus_tag LOCUS_32000 328750 329751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 329818 330321 gene locus_tag LOCUS_32010 329818 330321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 330346 331866 gene locus_tag LOCUS_32020 330346 331866 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969453.1 protein_id gnl|my_center|LOCUS_32020 331863 333152 gene locus_tag LOCUS_32030 331863 333152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529859.1 protein_id gnl|my_center|LOCUS_32030 333164 333421 gene locus_tag LOCUS_32040 333164 333421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 335251 333440 gene locus_tag LOCUS_32050 335251 333440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 335400 336401 gene locus_tag LOCUS_32060 335400 336401 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 protein_id gnl|my_center|LOCUS_32060 336409 336810 gene locus_tag LOCUS_32070 336409 336810 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 protein_id gnl|my_center|LOCUS_32070 336821 337867 gene locus_tag LOCUS_32080 336821 337867 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 protein_id gnl|my_center|LOCUS_32080 337864 338700 gene locus_tag LOCUS_32090 337864 338700 CDS product trans-aconitate methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230076.1 protein_id gnl|my_center|LOCUS_32090 339286 338717 gene locus_tag LOCUS_32100 339286 338717 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969913.1 protein_id gnl|my_center|LOCUS_32100 340001 339273 gene locus_tag LOCUS_32110 340001 339273 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256067.1 protein_id gnl|my_center|LOCUS_32110 340166 341275 gene locus_tag LOCUS_32120 gene ribA 340166 341275 CDS product GTP cyclohydrolase II RibA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038822.1 protein_id gnl|my_center|LOCUS_32120 341523 342017 gene locus_tag LOCUS_32130 341523 342017 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 protein_id gnl|my_center|LOCUS_32130 342090 343073 gene locus_tag LOCUS_32140 342090 343073 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147971.1 protein_id gnl|my_center|LOCUS_32140 343198 345657 gene locus_tag LOCUS_32150 343198 345657 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390127.1 protein_id gnl|my_center|LOCUS_32150 345669 346583 gene locus_tag LOCUS_32160 345669 346583 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533593.1 protein_id gnl|my_center|LOCUS_32160 346576 348618 gene locus_tag LOCUS_32170 gene fhuB 346576 348618 CDS product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533592.1 protein_id gnl|my_center|LOCUS_32170 348615 349475 gene locus_tag LOCUS_32180 348615 349475 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533591.1 protein_id gnl|my_center|LOCUS_32180 349677 350144 gene locus_tag LOCUS_32190 349677 350144 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974469.1 protein_id gnl|my_center|LOCUS_32190 351040 350270 gene locus_tag LOCUS_32200 351040 350270 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088611.1 protein_id gnl|my_center|LOCUS_32200 351050 351178 gene locus_tag LOCUS_32210 351050 351178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 351320 352306 gene locus_tag LOCUS_32220 351320 352306 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039779.1 protein_id gnl|my_center|LOCUS_32220 352319 352768 gene locus_tag LOCUS_32230 352319 352768 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974585.1 protein_id gnl|my_center|LOCUS_32230 352782 354281 gene locus_tag LOCUS_32240 352782 354281 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039080.1 protein_id gnl|my_center|LOCUS_32240 354327 355091 gene locus_tag LOCUS_32250 gene hpaI 354327 355091 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 protein_id gnl|my_center|LOCUS_32250 >Feature sequence15 1090 134 gene locus_tag LOCUS_32260 1090 134 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_32260 1788 1087 gene locus_tag LOCUS_32270 1788 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 2275 2123 gene locus_tag LOCUS_32280 2275 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 2510 4525 gene locus_tag LOCUS_32290 2510 4525 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388093.1 protein_id gnl|my_center|LOCUS_32290 4525 6036 gene locus_tag LOCUS_32300 4525 6036 CDS product CRISPR-associated protein Cse1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388094.1 protein_id gnl|my_center|LOCUS_32300 6029 6559 gene locus_tag LOCUS_32310 6029 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 6552 7688 gene locus_tag LOCUS_32320 gene cas7e 6552 7688 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_32320 7685 8353 gene locus_tag LOCUS_32330 gene cas5e 7685 8353 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 protein_id gnl|my_center|LOCUS_32330 8350 9132 gene locus_tag LOCUS_32340 8350 9132 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388099.1 protein_id gnl|my_center|LOCUS_32340 9145 10125 gene locus_tag LOCUS_32350 gene cas1e 9145 10125 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388100.1 protein_id gnl|my_center|LOCUS_32350 10103 10411 gene locus_tag LOCUS_32360 gene cas2e 10103 10411 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388101.1 protein_id gnl|my_center|LOCUS_32360 10484 12158 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggctcccccgcccatgcggggatggaccc 12516 12322 gene locus_tag LOCUS_32370 12516 12322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 12876 12628 gene locus_tag LOCUS_32380 12876 12628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 14240 12978 gene locus_tag LOCUS_32390 14240 12978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 15717 14545 gene locus_tag LOCUS_32400 gene repC 15717 14545 CDS product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974840.1 protein_id gnl|my_center|LOCUS_32400 16196 16855 gene locus_tag LOCUS_32410 16196 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 16916 17173 gene locus_tag LOCUS_32420 16916 17173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 17151 17396 gene locus_tag LOCUS_32430 17151 17396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 17956 17393 gene locus_tag LOCUS_32440 17956 17393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 18593 18198 gene locus_tag LOCUS_32450 18593 18198 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220683.1 protein_id gnl|my_center|LOCUS_32450 19448 19032 gene locus_tag LOCUS_32460 19448 19032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 19923 20714 gene locus_tag LOCUS_32470 19923 20714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355475.1 protein_id gnl|my_center|LOCUS_32470 21016 21243 gene locus_tag LOCUS_32480 21016 21243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 21589 22149 gene locus_tag LOCUS_32490 21589 22149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 22467 23072 gene locus_tag LOCUS_32500 22467 23072 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_32500 23320 23772 gene locus_tag LOCUS_32510 23320 23772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 24033 25340 gene locus_tag LOCUS_32520 24033 25340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 26624 25383 gene locus_tag LOCUS_32530 26624 25383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 27060 26986 gene locus_tag LOCUS_t00460 27060 26986 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27312 27500 gene locus_tag LOCUS_32540 27312 27500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 27685 28974 gene locus_tag LOCUS_32550 gene murA 27685 28974 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530201.1 protein_id gnl|my_center|LOCUS_32550 29390 37534 gene locus_tag LOCUS_32560 29390 37534 CDS product autotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170100.1 protein_id gnl|my_center|LOCUS_32560 37538 37816 gene locus_tag LOCUS_32570 37538 37816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 38835 37912 gene locus_tag LOCUS_32580 38835 37912 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530452.1 protein_id gnl|my_center|LOCUS_32580 39031 40116 gene locus_tag LOCUS_32590 39031 40116 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926041.1 protein_id gnl|my_center|LOCUS_32590 41046 40231 gene locus_tag LOCUS_32600 41046 40231 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530513.1 protein_id gnl|my_center|LOCUS_32600 42148 41147 gene locus_tag LOCUS_32610 42148 41147 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530514.1 protein_id gnl|my_center|LOCUS_32610 43021 42233 gene locus_tag LOCUS_32620 43021 42233 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388863.1 protein_id gnl|my_center|LOCUS_32620 43131 43694 gene locus_tag LOCUS_32630 43131 43694 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974682.1 protein_id gnl|my_center|LOCUS_32630 44203 44685 gene locus_tag LOCUS_32640 44203 44685 CDS product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530200.1 protein_id gnl|my_center|LOCUS_32640 44799 46142 gene locus_tag LOCUS_32650 gene hisD 44799 46142 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084074.1 protein_id gnl|my_center|LOCUS_32650 46153 46707 gene locus_tag LOCUS_32660 46153 46707 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530198.1 protein_id gnl|my_center|LOCUS_32660 46710 47195 gene locus_tag LOCUS_32670 46710 47195 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084076.1 protein_id gnl|my_center|LOCUS_32670 47325 47948 gene locus_tag LOCUS_32680 47325 47948 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084077.1 protein_id gnl|my_center|LOCUS_32680 47964 48170 gene locus_tag LOCUS_32690 47964 48170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 48420 48495 gene locus_tag LOCUS_t00470 48420 48495 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 50044 48929 gene locus_tag LOCUS_32700 50044 48929 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086289.1 protein_id gnl|my_center|LOCUS_32700 50485 50114 gene locus_tag LOCUS_32710 50485 50114 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086290.1 protein_id gnl|my_center|LOCUS_32710 50916 50533 gene locus_tag LOCUS_32720 50916 50533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086291.1 protein_id gnl|my_center|LOCUS_32720 51046 51771 gene locus_tag LOCUS_32730 51046 51771 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086292.1 protein_id gnl|my_center|LOCUS_32730 51786 52355 gene locus_tag LOCUS_32740 51786 52355 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086294.1 protein_id gnl|my_center|LOCUS_32740 52999 52364 gene locus_tag LOCUS_32750 gene soxX 52999 52364 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228665.1 protein_id gnl|my_center|LOCUS_32750 53880 53011 gene locus_tag LOCUS_32760 gene soxA 53880 53011 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228668.1 protein_id gnl|my_center|LOCUS_32760 54147 54572 gene locus_tag LOCUS_32770 gene soxY 54147 54572 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086296.1 protein_id gnl|my_center|LOCUS_32770 54638 54967 gene locus_tag LOCUS_32780 gene soxZ 54638 54967 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_32780 55030 56724 gene locus_tag LOCUS_32790 gene soxB 55030 56724 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086299.1 protein_id gnl|my_center|LOCUS_32790 56800 58077 gene locus_tag LOCUS_32800 gene soxC 56800 58077 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_32800 58139 58732 gene locus_tag LOCUS_32810 58139 58732 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185828.1 protein_id gnl|my_center|LOCUS_32810 58785 59306 gene locus_tag LOCUS_32820 58785 59306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 59303 60583 gene locus_tag LOCUS_32830 59303 60583 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932694.1 protein_id gnl|my_center|LOCUS_32830 60903 60625 gene locus_tag LOCUS_32840 60903 60625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 61110 60922 gene locus_tag LOCUS_32850 61110 60922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 61906 61688 gene locus_tag LOCUS_32860 61906 61688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 61796 62290 gene locus_tag LOCUS_32870 61796 62290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 62287 63432 gene locus_tag LOCUS_32880 62287 63432 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087343.1 protein_id gnl|my_center|LOCUS_32880 63678 64997 gene locus_tag LOCUS_32890 63678 64997 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967301.1 protein_id gnl|my_center|LOCUS_32890 65021 65926 gene locus_tag LOCUS_32900 gene ntrB 65021 65926 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085588.1 protein_id gnl|my_center|LOCUS_32900 65940 66737 gene locus_tag LOCUS_32910 65940 66737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397937.1 protein_id gnl|my_center|LOCUS_32910 66745 67977 gene locus_tag LOCUS_32920 66745 67977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 67998 69791 gene locus_tag LOCUS_32930 67998 69791 CDS product NirA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967420.1 protein_id gnl|my_center|LOCUS_32930 69788 71413 gene locus_tag LOCUS_32940 69788 71413 CDS product sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087341.1 protein_id gnl|my_center|LOCUS_32940 71425 74112 gene locus_tag LOCUS_32950 71425 74112 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085593.1 protein_id gnl|my_center|LOCUS_32950 74094 74423 gene locus_tag LOCUS_32960 74094 74423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 74564 75445 gene locus_tag LOCUS_32970 74564 75445 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533668.1 protein_id gnl|my_center|LOCUS_32970 75541 76683 gene locus_tag LOCUS_32980 75541 76683 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105083.1 protein_id gnl|my_center|LOCUS_32980 76820 77383 gene locus_tag LOCUS_32990 76820 77383 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005125205.1 protein_id gnl|my_center|LOCUS_32990 77380 78768 gene locus_tag LOCUS_33000 77380 78768 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776660.1 protein_id gnl|my_center|LOCUS_33000 78865 79791 gene locus_tag LOCUS_33010 78865 79791 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550481.1 protein_id gnl|my_center|LOCUS_33010 79811 81028 gene locus_tag LOCUS_33020 gene yehY 79811 81028 CDS product glycine betaine ABC transporter permease YehY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221816.1 protein_id gnl|my_center|LOCUS_33020 81025 81945 gene locus_tag LOCUS_33030 gene yehX 81025 81945 CDS product glycine betaine ABC transporter ATP binding protein YehX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569342.1 protein_id gnl|my_center|LOCUS_33030 81948 82670 gene locus_tag LOCUS_33040 81948 82670 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824854.1 protein_id gnl|my_center|LOCUS_33040 82743 85100 gene locus_tag LOCUS_33050 82743 85100 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529820.1 protein_id gnl|my_center|LOCUS_33050 86949 85120 gene locus_tag LOCUS_33060 86949 85120 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719727.1 protein_id gnl|my_center|LOCUS_33060 87127 87588 gene locus_tag LOCUS_33070 87127 87588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 88182 87592 gene locus_tag LOCUS_33080 88182 87592 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080406.1 protein_id gnl|my_center|LOCUS_33080 89149 88190 gene locus_tag LOCUS_33090 gene speB 89149 88190 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055970141.1 protein_id gnl|my_center|LOCUS_33090 89960 89160 gene locus_tag LOCUS_33100 89960 89160 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726716.1 protein_id gnl|my_center|LOCUS_33100 90679 89957 gene locus_tag LOCUS_33110 gene tcyL 90679 89957 CDS product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919316.1 protein_id gnl|my_center|LOCUS_33110 91342 90683 gene locus_tag LOCUS_33120 91342 90683 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887210.1 protein_id gnl|my_center|LOCUS_33120 92218 91391 gene locus_tag LOCUS_33130 92218 91391 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167356.1 protein_id gnl|my_center|LOCUS_33130 93331 92342 gene locus_tag LOCUS_33140 93331 92342 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531517.1 protein_id gnl|my_center|LOCUS_33140 93484 94458 gene locus_tag LOCUS_33150 93484 94458 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245546.1 protein_id gnl|my_center|LOCUS_33150 94574 95599 gene locus_tag LOCUS_33160 94574 95599 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004213.1 protein_id gnl|my_center|LOCUS_33160 95904 95632 gene locus_tag LOCUS_33170 95904 95632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 96256 95969 gene locus_tag LOCUS_33180 96256 95969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 96562 96353 gene locus_tag LOCUS_33190 96562 96353 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173969.1 protein_id gnl|my_center|LOCUS_33190 97099 96743 gene locus_tag LOCUS_33200 97099 96743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 97984 97208 gene locus_tag LOCUS_33210 97984 97208 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083169.1 protein_id gnl|my_center|LOCUS_33210 98515 99060 gene locus_tag LOCUS_33220 98515 99060 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_33220 99060 100397 gene locus_tag LOCUS_33230 99060 100397 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 protein_id gnl|my_center|LOCUS_33230 100444 101553 gene locus_tag LOCUS_33240 100444 101553 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 protein_id gnl|my_center|LOCUS_33240 101674 103083 gene locus_tag LOCUS_33250 101674 103083 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895572.1 protein_id gnl|my_center|LOCUS_33250 103080 104300 gene locus_tag LOCUS_33260 103080 104300 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114295.1 protein_id gnl|my_center|LOCUS_33260 104300 105691 gene locus_tag LOCUS_33270 104300 105691 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114294.1 protein_id gnl|my_center|LOCUS_33270 105776 106168 gene locus_tag LOCUS_33280 105776 106168 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337696.1 protein_id gnl|my_center|LOCUS_33280 106179 107006 gene locus_tag LOCUS_33290 106179 107006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 107125 107835 gene locus_tag LOCUS_33300 gene arsH 107125 107835 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337697.1 protein_id gnl|my_center|LOCUS_33300 109982 107886 gene locus_tag LOCUS_33310 109982 107886 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082928.1 protein_id gnl|my_center|LOCUS_33310 110213 110908 gene locus_tag LOCUS_33320 110213 110908 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965346.1 protein_id gnl|my_center|LOCUS_33320 110968 112863 gene locus_tag LOCUS_33330 110968 112863 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084153.1 protein_id gnl|my_center|LOCUS_33330 113075 115405 gene locus_tag LOCUS_33340 113075 115405 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390820.1 protein_id gnl|my_center|LOCUS_33340 116139 115450 gene locus_tag LOCUS_33350 116139 115450 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162273439.1 protein_id gnl|my_center|LOCUS_33350 116336 117964 gene locus_tag LOCUS_33360 116336 117964 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083856.1 protein_id gnl|my_center|LOCUS_33360 118218 119231 gene locus_tag LOCUS_33370 118218 119231 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083857.1 protein_id gnl|my_center|LOCUS_33370 119243 120121 gene locus_tag LOCUS_33380 119243 120121 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083858.1 protein_id gnl|my_center|LOCUS_33380 120133 121854 gene locus_tag LOCUS_33390 120133 121854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086124.1 protein_id gnl|my_center|LOCUS_33390 121950 122930 gene locus_tag LOCUS_33400 121950 122930 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275480.1 protein_id gnl|my_center|LOCUS_33400 122935 123921 gene locus_tag LOCUS_33410 122935 123921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 127182 124003 gene locus_tag LOCUS_33420 127182 124003 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968567.1 protein_id gnl|my_center|LOCUS_33420 128492 127209 gene locus_tag LOCUS_33430 128492 127209 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312103.1 protein_id gnl|my_center|LOCUS_33430 129420 128509 gene locus_tag LOCUS_33440 129420 128509 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391805.1 protein_id gnl|my_center|LOCUS_33440 129464 130420 gene locus_tag LOCUS_33450 129464 130420 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327096.1 protein_id gnl|my_center|LOCUS_33450 131138 130410 gene locus_tag LOCUS_33460 131138 130410 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402676.1 protein_id gnl|my_center|LOCUS_33460 131775 131116 gene locus_tag LOCUS_33470 131775 131116 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867636.1 protein_id gnl|my_center|LOCUS_33470 132457 131786 gene locus_tag LOCUS_33480 132457 131786 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971582.1 protein_id gnl|my_center|LOCUS_33480 133386 132595 gene locus_tag LOCUS_33490 133386 132595 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971581.1 protein_id gnl|my_center|LOCUS_33490 134134 133391 gene locus_tag LOCUS_33500 134134 133391 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244022.1 protein_id gnl|my_center|LOCUS_33500 136554 134398 gene locus_tag LOCUS_33510 gene scpA 136554 134398 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085838.1 protein_id gnl|my_center|LOCUS_33510 136978 136589 gene locus_tag LOCUS_33520 136978 136589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 138898 137036 gene locus_tag LOCUS_33530 138898 137036 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085840.1 protein_id gnl|my_center|LOCUS_33530 140993 138978 gene locus_tag LOCUS_33540 140993 138978 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088023.1 protein_id gnl|my_center|LOCUS_33540 142670 141138 gene locus_tag LOCUS_33550 142670 141138 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088112.1 protein_id gnl|my_center|LOCUS_33550 142938 144374 gene locus_tag LOCUS_33560 gene pccR 142938 144374 CDS product propionyl-CoA assimilation transcriptional regulator PccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719339.1 protein_id gnl|my_center|LOCUS_33560 144533 144452 gene locus_tag LOCUS_t00480 144533 144452 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 145232 146626 gene locus_tag LOCUS_33570 gene sthA 145232 146626 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135175071.1 protein_id gnl|my_center|LOCUS_33570 >Feature sequence16 1397 489 gene locus_tag LOCUS_33580 1397 489 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577538.1 protein_id gnl|my_center|LOCUS_33580 1503 2903 gene locus_tag LOCUS_33590 gene murD 1503 2903 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089344.1 protein_id gnl|my_center|LOCUS_33590 2992 4164 gene locus_tag LOCUS_33600 2992 4164 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089343.1 protein_id gnl|my_center|LOCUS_33600 4173 5291 gene locus_tag LOCUS_33610 gene murG 4173 5291 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089342.1 protein_id gnl|my_center|LOCUS_33610 5409 6818 gene locus_tag LOCUS_33620 gene murC 5409 6818 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089341.1 protein_id gnl|my_center|LOCUS_33620 6815 7735 gene locus_tag LOCUS_33630 gene murB 6815 7735 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089340.1 protein_id gnl|my_center|LOCUS_33630 7795 8715 gene locus_tag LOCUS_33640 7795 8715 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972048.1 protein_id gnl|my_center|LOCUS_33640 8841 9713 gene locus_tag LOCUS_33650 8841 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 9710 11035 gene locus_tag LOCUS_33660 gene ftsA 9710 11035 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004442783.1 protein_id gnl|my_center|LOCUS_33660 11123 12862 gene locus_tag LOCUS_33670 gene ftsZ 11123 12862 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089336.1 protein_id gnl|my_center|LOCUS_33670 13180 14133 gene locus_tag LOCUS_33680 gene lpxC 13180 14133 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089335.1 protein_id gnl|my_center|LOCUS_33680 14286 15188 gene locus_tag LOCUS_33690 14286 15188 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089334.1 protein_id gnl|my_center|LOCUS_33690 15318 17006 gene locus_tag LOCUS_33700 gene recN 15318 17006 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089333.1 protein_id gnl|my_center|LOCUS_33700 17003 19165 gene locus_tag LOCUS_33710 gene ligA 17003 19165 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242938.1 protein_id gnl|my_center|LOCUS_33710 19204 19761 gene locus_tag LOCUS_33720 19204 19761 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103735.1 protein_id gnl|my_center|LOCUS_33720 20049 19897 gene locus_tag LOCUS_33730 20049 19897 CDS product DUF3309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720757.1 protein_id gnl|my_center|LOCUS_33730 21978 20146 gene locus_tag LOCUS_33740 21978 20146 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966432.1 protein_id gnl|my_center|LOCUS_33740 22670 22041 gene locus_tag LOCUS_33750 22670 22041 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970562.1 protein_id gnl|my_center|LOCUS_33750 22804 23601 gene locus_tag LOCUS_33760 22804 23601 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527986.1 protein_id gnl|my_center|LOCUS_33760 23710 26265 gene locus_tag LOCUS_33770 23710 26265 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972026.1 protein_id gnl|my_center|LOCUS_33770 26539 26832 gene locus_tag LOCUS_33780 26539 26832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 26899 27825 gene locus_tag LOCUS_33790 26899 27825 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089328.1 protein_id gnl|my_center|LOCUS_33790 28370 27858 gene locus_tag LOCUS_33800 28370 27858 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966456.1 protein_id gnl|my_center|LOCUS_33800 28612 30027 gene locus_tag LOCUS_33810 28612 30027 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089298.1 protein_id gnl|my_center|LOCUS_33810 30235 34008 gene locus_tag LOCUS_33820 30235 34008 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089276.1 protein_id gnl|my_center|LOCUS_33820 34906 34013 gene locus_tag LOCUS_33830 gene serB 34906 34013 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089245.1 protein_id gnl|my_center|LOCUS_33830 35003 35962 gene locus_tag LOCUS_33840 gene miaA 35003 35962 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089244.1 protein_id gnl|my_center|LOCUS_33840 36915 35959 gene locus_tag LOCUS_33850 36915 35959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 38185 37100 gene locus_tag LOCUS_33860 38185 37100 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089852.1 protein_id gnl|my_center|LOCUS_33860 38685 38185 gene locus_tag LOCUS_33870 gene purE 38685 38185 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089851.1 protein_id gnl|my_center|LOCUS_33870 39019 41028 gene locus_tag LOCUS_33880 39019 41028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 41247 43055 gene locus_tag LOCUS_33890 41247 43055 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089868.1 protein_id gnl|my_center|LOCUS_33890 43431 43153 gene locus_tag LOCUS_33900 43431 43153 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329758.1 protein_id gnl|my_center|LOCUS_33900 43929 43609 gene locus_tag LOCUS_33910 43929 43609 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970194.1 protein_id gnl|my_center|LOCUS_33910 44850 43966 gene locus_tag LOCUS_33920 44850 43966 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970193.1 protein_id gnl|my_center|LOCUS_33920 45027 46319 gene locus_tag LOCUS_33930 45027 46319 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090554.1 protein_id gnl|my_center|LOCUS_33930 46378 46836 gene locus_tag LOCUS_33940 46378 46836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 48462 46936 gene locus_tag LOCUS_33950 48462 46936 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089246.1 protein_id gnl|my_center|LOCUS_33950 48834 48649 gene locus_tag LOCUS_33960 48834 48649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 49794 48847 gene locus_tag LOCUS_33970 49794 48847 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089248.1 protein_id gnl|my_center|LOCUS_33970 50945 49791 gene locus_tag LOCUS_33980 gene hflK 50945 49791 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_33980 51408 51130 gene locus_tag LOCUS_33990 51408 51130 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089261.1 protein_id gnl|my_center|LOCUS_33990 51593 51405 gene locus_tag LOCUS_34000 51593 51405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 52146 52895 gene locus_tag LOCUS_34010 52146 52895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 53121 54512 gene locus_tag LOCUS_34020 gene fumC 53121 54512 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535082.1 protein_id gnl|my_center|LOCUS_34020 54646 55254 gene locus_tag LOCUS_34030 54646 55254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 55861 55382 gene locus_tag LOCUS_34040 55861 55382 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089251.1 protein_id gnl|my_center|LOCUS_34040 56669 55875 gene locus_tag LOCUS_34050 56669 55875 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531021.1 protein_id gnl|my_center|LOCUS_34050 56877 57254 gene locus_tag LOCUS_34060 56877 57254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 57813 57520 gene locus_tag LOCUS_34070 57813 57520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 57703 58539 gene locus_tag LOCUS_34080 57703 58539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 58552 59829 gene locus_tag LOCUS_34090 58552 59829 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083372.1 protein_id gnl|my_center|LOCUS_34090 59826 60350 gene locus_tag LOCUS_34100 59826 60350 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243065.1 protein_id gnl|my_center|LOCUS_34100 61130 60369 gene locus_tag LOCUS_34110 61130 60369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 61367 61242 gene locus_tag LOCUS_34120 gene ykgO 61367 61242 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006611362.1 protein_id gnl|my_center|LOCUS_34120 62057 61536 gene locus_tag LOCUS_34130 gene rnhA 62057 61536 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_34130 63034 62054 gene locus_tag LOCUS_34140 63034 62054 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390801.1 protein_id gnl|my_center|LOCUS_34140 64031 63060 gene locus_tag LOCUS_34150 gene ispH 64031 63060 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084132.1 protein_id gnl|my_center|LOCUS_34150 64741 64118 gene locus_tag LOCUS_34160 64741 64118 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038690.1 protein_id gnl|my_center|LOCUS_34160 65068 65775 gene locus_tag LOCUS_34170 65068 65775 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991851.1 protein_id gnl|my_center|LOCUS_34170 65878 66549 gene locus_tag LOCUS_34180 65878 66549 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090698.1 protein_id gnl|my_center|LOCUS_34180 68490 66562 gene locus_tag LOCUS_34190 68490 66562 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084127.1 protein_id gnl|my_center|LOCUS_34190 68950 68774 gene locus_tag LOCUS_34200 68950 68774 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314700.1 protein_id gnl|my_center|LOCUS_34200 69155 69358 gene locus_tag LOCUS_34210 69155 69358 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089847.1 protein_id gnl|my_center|LOCUS_34210 69935 69450 gene locus_tag LOCUS_34220 69935 69450 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084135.1 protein_id gnl|my_center|LOCUS_34220 70951 70103 gene locus_tag LOCUS_34230 70951 70103 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084307.1 protein_id gnl|my_center|LOCUS_34230 71153 71710 gene locus_tag LOCUS_34240 71153 71710 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084308.1 protein_id gnl|my_center|LOCUS_34240 75110 71754 gene locus_tag LOCUS_34250 75110 71754 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173457.1 protein_id gnl|my_center|LOCUS_34250 76559 75450 gene locus_tag LOCUS_34260 76559 75450 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084334.1 protein_id gnl|my_center|LOCUS_34260 77194 76559 gene locus_tag LOCUS_34270 77194 76559 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921389.1 protein_id gnl|my_center|LOCUS_34270 77506 77249 gene locus_tag LOCUS_34280 77506 77249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 77499 80003 gene locus_tag LOCUS_34290 77499 80003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 80925 80080 gene locus_tag LOCUS_34300 gene pstB 80925 80080 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083914.1 protein_id gnl|my_center|LOCUS_34300 82107 81082 gene locus_tag LOCUS_34310 82107 81082 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_34310 83431 82232 gene locus_tag LOCUS_34320 83431 82232 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529247.1 protein_id gnl|my_center|LOCUS_34320 84516 83506 gene locus_tag LOCUS_34330 gene gap 84516 83506 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066870.1 protein_id gnl|my_center|LOCUS_34330 86677 84683 gene locus_tag LOCUS_34340 gene tkt 86677 84683 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314727.1 protein_id gnl|my_center|LOCUS_34340 86686 87000 gene locus_tag LOCUS_34350 86686 87000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 87030 87323 gene locus_tag LOCUS_34360 87030 87323 CDS product DUF4164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084341.1 protein_id gnl|my_center|LOCUS_34360 87334 87717 gene locus_tag LOCUS_34370 87334 87717 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529252.1 protein_id gnl|my_center|LOCUS_34370 87832 88620 gene locus_tag LOCUS_34380 87832 88620 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084333.1 protein_id gnl|my_center|LOCUS_34380 89241 88681 gene locus_tag LOCUS_34390 89241 88681 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038981.1 protein_id gnl|my_center|LOCUS_34390 90371 89244 gene locus_tag LOCUS_34400 90371 89244 CDS product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877796.1 protein_id gnl|my_center|LOCUS_34400 90859 91926 gene locus_tag LOCUS_34410 90859 91926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965387.1 protein_id gnl|my_center|LOCUS_34410 91926 92960 gene locus_tag LOCUS_34420 91926 92960 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084326.1 protein_id gnl|my_center|LOCUS_34420 92957 93439 gene locus_tag LOCUS_34430 92957 93439 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084325.1 protein_id gnl|my_center|LOCUS_34430 95266 93479 gene locus_tag LOCUS_34440 95266 93479 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 protein_id gnl|my_center|LOCUS_34440 95438 95662 gene locus_tag LOCUS_34450 gene rpmE 95438 95662 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084323.1 protein_id gnl|my_center|LOCUS_34450 96420 95917 gene locus_tag LOCUS_34460 96420 95917 CDS product DUF1465 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084322.1 protein_id gnl|my_center|LOCUS_34460 96897 96694 gene locus_tag LOCUS_34470 96897 96694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 97007 98008 gene locus_tag LOCUS_34480 97007 98008 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 protein_id gnl|my_center|LOCUS_34480 98338 98946 gene locus_tag LOCUS_34490 98338 98946 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337060.1 protein_id gnl|my_center|LOCUS_34490 98952 99767 gene locus_tag LOCUS_34500 98952 99767 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173440.1 protein_id gnl|my_center|LOCUS_34500 99911 100657 gene locus_tag LOCUS_34510 99911 100657 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084350.1 protein_id gnl|my_center|LOCUS_34510 101712 100966 gene locus_tag LOCUS_34520 101712 100966 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992233.1 protein_id gnl|my_center|LOCUS_34520 101957 102907 gene locus_tag LOCUS_34530 101957 102907 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390819.1 protein_id gnl|my_center|LOCUS_34530 103005 103544 gene locus_tag LOCUS_34540 gene ruvC 103005 103544 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084351.1 protein_id gnl|my_center|LOCUS_34540 103558 104175 gene locus_tag LOCUS_34550 gene ruvA 103558 104175 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084352.1 protein_id gnl|my_center|LOCUS_34550 104261 105295 gene locus_tag LOCUS_34560 gene ruvB 104261 105295 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094976806.1 protein_id gnl|my_center|LOCUS_34560 105353 105985 gene locus_tag LOCUS_34570 105353 105985 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089896.1 protein_id gnl|my_center|LOCUS_34570 106031 106495 gene locus_tag LOCUS_34580 106031 106495 CDS product DUF2852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173002.1 protein_id gnl|my_center|LOCUS_34580 106605 107114 gene locus_tag LOCUS_34590 gene ybgC 106605 107114 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089947.1 protein_id gnl|my_center|LOCUS_34590 107390 108238 gene locus_tag LOCUS_34600 gene tolQ 107390 108238 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089890.1 protein_id gnl|my_center|LOCUS_34600 108317 108697 gene locus_tag LOCUS_34610 gene tolR 108317 108697 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529146.1 protein_id gnl|my_center|LOCUS_34610 108702 109652 gene locus_tag LOCUS_34620 108702 109652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 109693 111051 gene locus_tag LOCUS_34630 gene tolB 109693 111051 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173006.1 protein_id gnl|my_center|LOCUS_34630 111207 111701 gene locus_tag LOCUS_34640 gene pal 111207 111701 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089884.1 protein_id gnl|my_center|LOCUS_34640 111972 112937 gene locus_tag LOCUS_34650 gene ybgF 111972 112937 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173009.1 protein_id gnl|my_center|LOCUS_34650 112924 113955 gene locus_tag LOCUS_34660 gene tilS 112924 113955 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089882.1 protein_id gnl|my_center|LOCUS_34660 114145 113912 gene locus_tag LOCUS_34670 114145 113912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 114105 116024 gene locus_tag LOCUS_34680 gene ftsH 114105 116024 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089881.1 protein_id gnl|my_center|LOCUS_34680 116360 117055 gene locus_tag LOCUS_34690 116360 117055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 117200 118597 gene locus_tag LOCUS_34700 117200 118597 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088903.1 protein_id gnl|my_center|LOCUS_34700 118757 120100 gene locus_tag LOCUS_34710 gene glmM 118757 120100 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174702.1 protein_id gnl|my_center|LOCUS_34710 121504 120311 gene locus_tag LOCUS_34720 gene choV 121504 120311 CDS product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529958.1 protein_id gnl|my_center|LOCUS_34720 122359 121508 gene locus_tag LOCUS_34730 gene choW 122359 121508 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463667.1 protein_id gnl|my_center|LOCUS_34730 123534 122578 gene locus_tag LOCUS_34740 123534 122578 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972195.1 protein_id gnl|my_center|LOCUS_34740 123527 123766 gene locus_tag LOCUS_34750 123527 123766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 123996 126119 gene locus_tag LOCUS_34760 gene betB 123996 126119 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173573908.1 protein_id gnl|my_center|LOCUS_34760 126119 127786 gene locus_tag LOCUS_34770 gene betA 126119 127786 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214391123.1 protein_id gnl|my_center|LOCUS_34770 127860 128708 gene locus_tag LOCUS_34780 127860 128708 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_34780 129659 128892 gene locus_tag LOCUS_34790 129659 128892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 130317 129985 gene locus_tag LOCUS_34800 130317 129985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 132002 130314 gene locus_tag LOCUS_34810 132002 130314 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087212.1 protein_id gnl|my_center|LOCUS_34810 132854 132093 gene locus_tag LOCUS_34820 132854 132093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114449.1 protein_id gnl|my_center|LOCUS_34820 133945 132851 gene locus_tag LOCUS_34830 133945 132851 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114448.1 protein_id gnl|my_center|LOCUS_34830 135933 133942 gene locus_tag LOCUS_34840 gene dgcB 135933 133942 CDS product dimethylglycine demethylation protein DgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114447.1 protein_id gnl|my_center|LOCUS_34840 137988 135949 gene locus_tag LOCUS_34850 gene dgcA 137988 135949 CDS product dimethylglycine demethylation protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103128.1 protein_id gnl|my_center|LOCUS_34850 138967 138107 gene locus_tag LOCUS_34860 138967 138107 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 protein_id gnl|my_center|LOCUS_34860 139988 139011 gene locus_tag LOCUS_34870 139988 139011 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524362.1 protein_id gnl|my_center|LOCUS_34870 140144 140812 gene locus_tag LOCUS_34880 140144 140812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 142013 140847 gene locus_tag LOCUS_34890 142013 140847 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543120.1 protein_id gnl|my_center|LOCUS_34890 143276 142017 gene locus_tag LOCUS_34900 143276 142017 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523139.1 protein_id gnl|my_center|LOCUS_34900 144206 143433 gene locus_tag LOCUS_34910 144206 143433 CDS product DUF4394 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384314.1 protein_id gnl|my_center|LOCUS_34910 144365 144934 gene locus_tag LOCUS_34920 144365 144934 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970922.1 protein_id gnl|my_center|LOCUS_34920 144931 145698 gene locus_tag LOCUS_34930 144931 145698 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970923.1 protein_id gnl|my_center|LOCUS_34930 146763 145708 gene locus_tag LOCUS_34940 146763 145708 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533329.1 protein_id gnl|my_center|LOCUS_34940 148214 146847 gene locus_tag LOCUS_34950 148214 146847 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338178.1 protein_id gnl|my_center|LOCUS_34950 148889 148296 gene locus_tag LOCUS_34960 148889 148296 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329815.1 protein_id gnl|my_center|LOCUS_34960 151917 148882 gene locus_tag LOCUS_34970 151917 148882 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529659.1 protein_id gnl|my_center|LOCUS_34970 152207 151914 gene locus_tag LOCUS_34980 152207 151914 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973738.1 protein_id gnl|my_center|LOCUS_34980 153469 152219 gene locus_tag LOCUS_34990 153469 152219 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529656.1 protein_id gnl|my_center|LOCUS_34990 153707 154543 gene locus_tag LOCUS_35000 153707 154543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 154714 155343 gene locus_tag LOCUS_35010 154714 155343 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973269.1 protein_id gnl|my_center|LOCUS_35010 155505 156680 gene locus_tag LOCUS_35020 155505 156680 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970159.1 protein_id gnl|my_center|LOCUS_35020 156894 158480 gene locus_tag LOCUS_35030 gene serA 156894 158480 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090136.1 protein_id gnl|my_center|LOCUS_35030 159197 158550 gene locus_tag LOCUS_35040 gene eda 159197 158550 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_35040 159393 160310 gene locus_tag LOCUS_35050 gene puuE 159393 160310 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387502.1 protein_id gnl|my_center|LOCUS_35050 160316 160678 gene locus_tag LOCUS_35060 160316 160678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 161137 160697 gene locus_tag LOCUS_35070 161137 160697 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086249.1 protein_id gnl|my_center|LOCUS_35070 161173 162024 gene locus_tag LOCUS_35080 161173 162024 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088051.1 protein_id gnl|my_center|LOCUS_35080 162935 162021 gene locus_tag LOCUS_35090 162935 162021 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965523.1 protein_id gnl|my_center|LOCUS_35090 163946 163065 gene locus_tag LOCUS_35100 gene catE 163946 163065 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 protein_id gnl|my_center|LOCUS_35100 164224 165519 gene locus_tag LOCUS_35110 164224 165519 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089789.1 protein_id gnl|my_center|LOCUS_35110 165543 166937 gene locus_tag LOCUS_35120 165543 166937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089788.1 protein_id gnl|my_center|LOCUS_35120 168304 167408 gene locus_tag LOCUS_35130 gene sucD 168304 167408 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083285.1 protein_id gnl|my_center|LOCUS_35130 169503 168304 gene locus_tag LOCUS_35140 gene sucC 169503 168304 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083287.1 protein_id gnl|my_center|LOCUS_35140 170375 169602 gene locus_tag LOCUS_35150 170375 169602 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965702.1 protein_id gnl|my_center|LOCUS_35150 171365 170388 gene locus_tag LOCUS_35160 171365 170388 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085931.1 protein_id gnl|my_center|LOCUS_35160 >Feature sequence17 >Feature sequence18 371 1405 gene locus_tag LOCUS_35170 371 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 1793 2830 gene locus_tag LOCUS_35180 1793 2830 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242384.1 protein_id gnl|my_center|LOCUS_35180 3109 3744 gene locus_tag LOCUS_35190 3109 3744 CDS product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090480.1 protein_id gnl|my_center|LOCUS_35190 3741 4733 gene locus_tag LOCUS_35200 3741 4733 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807174.1 protein_id gnl|my_center|LOCUS_35200 5491 4751 gene locus_tag LOCUS_35210 5491 4751 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966163.1 protein_id gnl|my_center|LOCUS_35210 8732 5655 gene locus_tag LOCUS_35220 8732 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 9919 8924 gene locus_tag LOCUS_35230 9919 8924 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921554.1 protein_id gnl|my_center|LOCUS_35230 11014 10040 gene locus_tag LOCUS_35240 11014 10040 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090493.1 protein_id gnl|my_center|LOCUS_35240 12106 11135 gene locus_tag LOCUS_35250 12106 11135 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391451.1 protein_id gnl|my_center|LOCUS_35250 12987 12118 gene locus_tag LOCUS_35260 12987 12118 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090495.1 protein_id gnl|my_center|LOCUS_35260 13727 12984 gene locus_tag LOCUS_35270 13727 12984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173843.1 protein_id gnl|my_center|LOCUS_35270 13927 13727 gene locus_tag LOCUS_35280 13927 13727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 14264 14791 gene locus_tag LOCUS_35290 gene ppa 14264 14791 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917937.1 protein_id gnl|my_center|LOCUS_35290 14920 15639 gene locus_tag LOCUS_35300 14920 15639 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088990.1 protein_id gnl|my_center|LOCUS_35300 16685 15636 gene locus_tag LOCUS_35310 16685 15636 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 protein_id gnl|my_center|LOCUS_35310 17512 16685 gene locus_tag LOCUS_35320 17512 16685 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082924.1 protein_id gnl|my_center|LOCUS_35320 17985 17596 gene locus_tag LOCUS_35330 17985 17596 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531125.1 protein_id gnl|my_center|LOCUS_35330 18135 19142 gene locus_tag LOCUS_35340 18135 19142 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_35340 19206 20117 gene locus_tag LOCUS_35350 19206 20117 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531517.1 protein_id gnl|my_center|LOCUS_35350 20147 20929 gene locus_tag LOCUS_35360 20147 20929 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 protein_id gnl|my_center|LOCUS_35360 20948 21727 gene locus_tag LOCUS_35370 20948 21727 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082921.1 protein_id gnl|my_center|LOCUS_35370 21729 23069 gene locus_tag LOCUS_35380 21729 23069 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_35380 23059 24474 gene locus_tag LOCUS_35390 23059 24474 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_35390 24474 25061 gene locus_tag LOCUS_35400 24474 25061 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531132.1 protein_id gnl|my_center|LOCUS_35400 25415 25323 gene locus_tag LOCUS_t00490 25415 25323 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25755 26744 gene locus_tag LOCUS_35410 25755 26744 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082920.1 protein_id gnl|my_center|LOCUS_35410 26751 27509 gene locus_tag LOCUS_35420 26751 27509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 28388 27543 gene locus_tag LOCUS_35430 28388 27543 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084985.1 protein_id gnl|my_center|LOCUS_35430 29584 28385 gene locus_tag LOCUS_35440 29584 28385 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084984.1 protein_id gnl|my_center|LOCUS_35440 29991 29587 gene locus_tag LOCUS_35450 29991 29587 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007600538.1 protein_id gnl|my_center|LOCUS_35450 30467 29991 gene locus_tag LOCUS_35460 30467 29991 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083224.1 protein_id gnl|my_center|LOCUS_35460 33169 30464 gene locus_tag LOCUS_35470 33169 30464 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084982.1 protein_id gnl|my_center|LOCUS_35470 34910 33237 gene locus_tag LOCUS_35480 34910 33237 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063682649.1 protein_id gnl|my_center|LOCUS_35480 35463 34933 gene locus_tag LOCUS_35490 35463 34933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089586.1 protein_id gnl|my_center|LOCUS_35490 35849 35463 gene locus_tag LOCUS_35500 35849 35463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 36391 35846 gene locus_tag LOCUS_35510 36391 35846 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968751.1 protein_id gnl|my_center|LOCUS_35510 36843 36433 gene locus_tag LOCUS_35520 36843 36433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 37597 36845 gene locus_tag LOCUS_35530 gene fliR 37597 36845 CDS product flagellar biosynthesis protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089589.1 protein_id gnl|my_center|LOCUS_35530 39681 37594 gene locus_tag LOCUS_35540 gene flhA 39681 37594 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529769.1 protein_id gnl|my_center|LOCUS_35540 39954 39688 gene locus_tag LOCUS_35550 39954 39688 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529857.1 protein_id gnl|my_center|LOCUS_35550 40353 39958 gene locus_tag LOCUS_35560 gene flgD 40353 39958 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529774.1 protein_id gnl|my_center|LOCUS_35560 40762 40364 gene locus_tag LOCUS_35570 gene flbT 40762 40364 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974490.1 protein_id gnl|my_center|LOCUS_35570 41120 40773 gene locus_tag LOCUS_35580 gene flaF 41120 40773 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974489.1 protein_id gnl|my_center|LOCUS_35580 42174 41137 gene locus_tag LOCUS_35590 42174 41137 CDS product flagellar hook-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529777.1 protein_id gnl|my_center|LOCUS_35590 43633 42179 gene locus_tag LOCUS_35600 gene flgK 43633 42179 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089595.1 protein_id gnl|my_center|LOCUS_35600 44897 43641 gene locus_tag LOCUS_35610 44897 43641 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529779.1 protein_id gnl|my_center|LOCUS_35610 46304 44982 gene locus_tag LOCUS_35620 gene fliI 46304 44982 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089623.1 protein_id gnl|my_center|LOCUS_35620 47025 46306 gene locus_tag LOCUS_35630 gene flgF 47025 46306 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089622.1 protein_id gnl|my_center|LOCUS_35630 47805 47029 gene locus_tag LOCUS_35640 47805 47029 CDS product DUF1217 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215323.1 protein_id gnl|my_center|LOCUS_35640 47999 48883 gene locus_tag LOCUS_35650 gene motA 47999 48883 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529803.1 protein_id gnl|my_center|LOCUS_35650 48887 49831 gene locus_tag LOCUS_35660 48887 49831 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089619.1 protein_id gnl|my_center|LOCUS_35660 49812 50150 gene locus_tag LOCUS_35670 49812 50150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 50147 50476 gene locus_tag LOCUS_35680 50147 50476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 50490 51521 gene locus_tag LOCUS_35690 50490 51521 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089616.1 protein_id gnl|my_center|LOCUS_35690 51545 52621 gene locus_tag LOCUS_35700 gene flhB 51545 52621 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089615.1 protein_id gnl|my_center|LOCUS_35700 52608 53066 gene locus_tag LOCUS_35710 52608 53066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 53217 53600 gene locus_tag LOCUS_35720 gene flgB 53217 53600 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089614.1 protein_id gnl|my_center|LOCUS_35720 53600 54022 gene locus_tag LOCUS_35730 gene flgC 53600 54022 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974466.1 protein_id gnl|my_center|LOCUS_35730 54019 54345 gene locus_tag LOCUS_35740 54019 54345 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089612.1 protein_id gnl|my_center|LOCUS_35740 54356 55144 gene locus_tag LOCUS_35750 gene flgG 54356 55144 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089611.1 protein_id gnl|my_center|LOCUS_35750 55262 55870 gene locus_tag LOCUS_35760 55262 55870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 55882 57009 gene locus_tag LOCUS_35770 gene flgI 55882 57009 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089609.1 protein_id gnl|my_center|LOCUS_35770 57073 57882 gene locus_tag LOCUS_35780 57073 57882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 57879 58595 gene locus_tag LOCUS_35790 gene flgH 57879 58595 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089607.1 protein_id gnl|my_center|LOCUS_35790 58622 59125 gene locus_tag LOCUS_35800 58622 59125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 59122 59880 gene locus_tag LOCUS_35810 gene fliP 59122 59880 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089605.1 protein_id gnl|my_center|LOCUS_35810 60168 61421 gene locus_tag LOCUS_35820 60168 61421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 61765 63426 gene locus_tag LOCUS_35830 gene fliF 61765 63426 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921537.1 protein_id gnl|my_center|LOCUS_35830 63426 64085 gene locus_tag LOCUS_35840 63426 64085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 64091 65353 gene locus_tag LOCUS_35850 64091 65353 CDS product MotB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529784.1 protein_id gnl|my_center|LOCUS_35850 65350 67350 gene locus_tag LOCUS_35860 65350 67350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 67347 68948 gene locus_tag LOCUS_35870 67347 68948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 68902 69465 gene locus_tag LOCUS_35880 68902 69465 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089597.1 protein_id gnl|my_center|LOCUS_35880 70360 69614 gene locus_tag LOCUS_35890 70360 69614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 70540 70923 gene locus_tag LOCUS_35900 70540 70923 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 protein_id gnl|my_center|LOCUS_35900 71157 71846 gene locus_tag LOCUS_35910 71157 71846 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529780.1 protein_id gnl|my_center|LOCUS_35910 72691 71885 gene locus_tag LOCUS_35920 72691 71885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 73911 72691 gene locus_tag LOCUS_35930 73911 72691 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037833.1 protein_id gnl|my_center|LOCUS_35930 74314 73913 gene locus_tag LOCUS_35940 74314 73913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 75971 74325 gene locus_tag LOCUS_35950 75971 74325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 76527 76042 gene locus_tag LOCUS_35960 76527 76042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 77070 76888 gene locus_tag LOCUS_35970 77070 76888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 76987 79041 gene locus_tag LOCUS_35980 76987 79041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 79318 79121 gene locus_tag LOCUS_35990 79318 79121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 79214 80929 gene locus_tag LOCUS_36000 79214 80929 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529771.1 protein_id gnl|my_center|LOCUS_36000 81259 81570 gene locus_tag LOCUS_36010 81259 81570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 >Feature sequence19 1550 42 gene locus_tag LOCUS_36020 1550 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 1873 1646 gene locus_tag LOCUS_36030 1873 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 3906 2380 gene locus_tag LOCUS_36040 gene mqo 3906 2380 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083116.1 protein_id gnl|my_center|LOCUS_36040 4316 3921 gene locus_tag LOCUS_36050 4316 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083117.1 protein_id gnl|my_center|LOCUS_36050 5750 4335 gene locus_tag LOCUS_36060 gene fumC 5750 4335 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990844.1 protein_id gnl|my_center|LOCUS_36060 6905 6120 gene locus_tag LOCUS_36070 6905 6120 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920702.1 protein_id gnl|my_center|LOCUS_36070 8599 6905 gene locus_tag LOCUS_36080 8599 6905 CDS product bifunctional protein tyrosine phosphatase family protein/NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527135.1 protein_id gnl|my_center|LOCUS_36080 9613 8690 gene locus_tag LOCUS_36090 9613 8690 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_36090 9713 10366 gene locus_tag LOCUS_36100 9713 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 10369 10797 gene locus_tag LOCUS_36110 10369 10797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 11124 10825 gene locus_tag LOCUS_36120 11124 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 11326 12801 gene locus_tag LOCUS_36130 11326 12801 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389402.1 protein_id gnl|my_center|LOCUS_36130 13060 12839 gene locus_tag LOCUS_36140 13060 12839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 14009 13179 gene locus_tag LOCUS_36150 14009 13179 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972744.1 protein_id gnl|my_center|LOCUS_36150 15027 14176 gene locus_tag LOCUS_36160 15027 14176 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391586.1 protein_id gnl|my_center|LOCUS_36160 16514 15207 gene locus_tag LOCUS_36170 16514 15207 CDS product PotD/PotF family extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242231.1 protein_id gnl|my_center|LOCUS_36170 17692 16598 gene locus_tag LOCUS_36180 17692 16598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972747.1 protein_id gnl|my_center|LOCUS_36180 18021 18983 gene locus_tag LOCUS_36190 18021 18983 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526811.1 protein_id gnl|my_center|LOCUS_36190 20382 19153 gene locus_tag LOCUS_36200 20382 19153 CDS product URC4/urg3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089973.1 protein_id gnl|my_center|LOCUS_36200 21822 20554 gene locus_tag LOCUS_36210 21822 20554 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216144.1 protein_id gnl|my_center|LOCUS_36210 22077 22760 gene locus_tag LOCUS_36220 gene upp 22077 22760 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947952.1 protein_id gnl|my_center|LOCUS_36220 22949 23569 gene locus_tag LOCUS_36230 22949 23569 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528397.1 protein_id gnl|my_center|LOCUS_36230 23861 25081 gene locus_tag LOCUS_36240 23861 25081 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243172.1 protein_id gnl|my_center|LOCUS_36240 25233 25739 gene locus_tag LOCUS_36250 25233 25739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243171.1 protein_id gnl|my_center|LOCUS_36250 25874 27100 gene locus_tag LOCUS_36260 gene hemA 25874 27100 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084018.1 protein_id gnl|my_center|LOCUS_36260 28268 27141 gene locus_tag LOCUS_36270 28268 27141 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084159.1 protein_id gnl|my_center|LOCUS_36270 28379 29698 gene locus_tag LOCUS_36280 gene hemN 28379 29698 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089823.1 protein_id gnl|my_center|LOCUS_36280 30421 29780 gene locus_tag LOCUS_36290 gene fixK 30421 29780 CDS product transcriptional regulator FixK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918638.1 protein_id gnl|my_center|LOCUS_36290 30955 30641 gene locus_tag LOCUS_36300 30955 30641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 31699 31079 gene locus_tag LOCUS_36310 31699 31079 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083218.1 protein_id gnl|my_center|LOCUS_36310 32866 31709 gene locus_tag LOCUS_36320 32866 31709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 34182 32980 gene locus_tag LOCUS_36330 34182 32980 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533609.1 protein_id gnl|my_center|LOCUS_36330 34559 34362 gene locus_tag LOCUS_36340 34559 34362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 34919 34707 gene locus_tag LOCUS_36350 34919 34707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 >Feature sequence20 1655 1290 gene locus_tag LOCUS_36360 1655 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 2085 1681 gene locus_tag LOCUS_36370 2085 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 3705 2263 gene locus_tag LOCUS_36380 3705 2263 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640585.1 protein_id gnl|my_center|LOCUS_36380 4633 4187 gene locus_tag LOCUS_36390 4633 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 5101 4661 gene locus_tag LOCUS_36400 5101 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 5624 6241 gene locus_tag LOCUS_36410 5624 6241 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921284.1 protein_id gnl|my_center|LOCUS_36410 6255 7064 gene locus_tag LOCUS_36420 6255 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 7064 7696 gene locus_tag LOCUS_36430 7064 7696 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923284.1 protein_id gnl|my_center|LOCUS_36430 7786 9618 gene locus_tag LOCUS_36440 gene ilvD 7786 9618 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970221.1 protein_id gnl|my_center|LOCUS_36440 9720 10025 gene locus_tag LOCUS_36450 9720 10025 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974886.1 protein_id gnl|my_center|LOCUS_36450 10130 11452 gene locus_tag LOCUS_36460 10130 11452 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766669.1 protein_id gnl|my_center|LOCUS_36460 12197 11658 gene locus_tag LOCUS_36470 12197 11658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 12547 13269 gene locus_tag LOCUS_36480 12547 13269 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537551.1 protein_id gnl|my_center|LOCUS_36480 14219 13266 gene locus_tag LOCUS_36490 14219 13266 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391037.1 protein_id gnl|my_center|LOCUS_36490 14334 14729 gene locus_tag LOCUS_36500 14334 14729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 15931 14978 gene locus_tag LOCUS_36510 15931 14978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 16076 15897 gene locus_tag LOCUS_36520 16076 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 16272 18554 gene locus_tag LOCUS_36530 gene piuA 16272 18554 CDS product TonB-dependent siderophore receptor PiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_36530 18650 19333 gene locus_tag LOCUS_36540 18650 19333 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639859.1 protein_id gnl|my_center|LOCUS_36540 19424 19690 gene locus_tag LOCUS_36550 19424 19690 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089200.1 protein_id gnl|my_center|LOCUS_36550 19694 20047 gene locus_tag LOCUS_36560 19694 20047 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719341.1 protein_id gnl|my_center|LOCUS_36560 20447 20055 gene locus_tag LOCUS_36570 20447 20055 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723565.1 protein_id gnl|my_center|LOCUS_36570 21704 20502 gene locus_tag LOCUS_36580 21704 20502 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027989172.1 protein_id gnl|my_center|LOCUS_36580 22181 21825 gene locus_tag LOCUS_36590 22181 21825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 22955 22314 gene locus_tag LOCUS_36600 22955 22314 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090153.1 protein_id gnl|my_center|LOCUS_36600 23103 24305 gene locus_tag LOCUS_36610 23103 24305 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174694.1 protein_id gnl|my_center|LOCUS_36610 24412 24903 gene locus_tag LOCUS_36620 24412 24903 CDS product DUF992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090150.1 protein_id gnl|my_center|LOCUS_36620 25130 26125 gene locus_tag LOCUS_36630 gene msrP 25130 26125 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_36630 26530 27039 gene locus_tag LOCUS_36640 26530 27039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 27967 27044 gene locus_tag LOCUS_36650 27967 27044 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172837.1 protein_id gnl|my_center|LOCUS_36650 28962 27982 gene locus_tag LOCUS_36660 gene trxB 28962 27982 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090115.1 protein_id gnl|my_center|LOCUS_36660 28946 29137 gene locus_tag LOCUS_36670 28946 29137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 29227 29703 gene locus_tag LOCUS_36680 29227 29703 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157328319.1 protein_id gnl|my_center|LOCUS_36680 29717 30784 gene locus_tag LOCUS_36690 29717 30784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 30781 31605 gene locus_tag LOCUS_36700 30781 31605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329496.1 protein_id gnl|my_center|LOCUS_36700 32751 31612 gene locus_tag LOCUS_36710 32751 31612 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338917.1 protein_id gnl|my_center|LOCUS_36710 33250 32777 gene locus_tag LOCUS_36720 gene greA 33250 32777 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090113.1 protein_id gnl|my_center|LOCUS_36720 36728 33393 gene locus_tag LOCUS_36730 gene carB 36728 33393 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090112.1 protein_id gnl|my_center|LOCUS_36730 37439 36936 gene locus_tag LOCUS_36740 37439 36936 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976099.1 protein_id gnl|my_center|LOCUS_36740 38968 37487 gene locus_tag LOCUS_36750 38968 37487 CDS product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056783.1 protein_id gnl|my_center|LOCUS_36750 40179 38965 gene locus_tag LOCUS_36760 40179 38965 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385774.1 protein_id gnl|my_center|LOCUS_36760 40659 40240 gene locus_tag LOCUS_36770 40659 40240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 40767 41519 gene locus_tag LOCUS_36780 40767 41519 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971207.1 protein_id gnl|my_center|LOCUS_36780 42799 41594 gene locus_tag LOCUS_36790 gene carA 42799 41594 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090106.1 protein_id gnl|my_center|LOCUS_36790 43042 43497 gene locus_tag LOCUS_36800 43042 43497 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532937.1 protein_id gnl|my_center|LOCUS_36800 43538 44263 gene locus_tag LOCUS_36810 43538 44263 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480275.1 protein_id gnl|my_center|LOCUS_36810 44271 44579 gene locus_tag LOCUS_36820 44271 44579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 45178 44627 gene locus_tag LOCUS_36830 45178 44627 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930760.1 protein_id gnl|my_center|LOCUS_36830 45597 45175 gene locus_tag LOCUS_36840 45597 45175 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972013.1 protein_id gnl|my_center|LOCUS_36840 45772 47709 gene locus_tag LOCUS_36850 gene dnaG 45772 47709 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090085.1 protein_id gnl|my_center|LOCUS_36850 47891 49888 gene locus_tag LOCUS_36860 gene rpoD 47891 49888 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530149.1 protein_id gnl|my_center|LOCUS_36860 50055 50678 gene locus_tag LOCUS_36870 50055 50678 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971209.1 protein_id gnl|my_center|LOCUS_36870 51026 50895 gene locus_tag LOCUS_36880 51026 50895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 51316 51137 gene locus_tag LOCUS_36890 51316 51137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 52732 51392 gene locus_tag LOCUS_36900 52732 51392 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314722.1 protein_id gnl|my_center|LOCUS_36900 52867 53781 gene locus_tag LOCUS_36910 52867 53781 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193666682.1 protein_id gnl|my_center|LOCUS_36910 54916 53837 gene locus_tag LOCUS_36920 54916 53837 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073536.1 protein_id gnl|my_center|LOCUS_36920 56383 55001 gene locus_tag LOCUS_36930 56383 55001 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390238.1 protein_id gnl|my_center|LOCUS_36930 58161 56368 gene locus_tag LOCUS_36940 58161 56368 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_36940 58964 58158 gene locus_tag LOCUS_36950 gene otsB 58964 58158 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338618.1 protein_id gnl|my_center|LOCUS_36950 60120 59134 gene locus_tag LOCUS_36960 60120 59134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 60470 62125 gene locus_tag LOCUS_36970 gene ettA 60470 62125 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089425.1 protein_id gnl|my_center|LOCUS_36970 62428 62132 gene locus_tag LOCUS_36980 62428 62132 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971035.1 protein_id gnl|my_center|LOCUS_36980 62688 62425 gene locus_tag LOCUS_36990 62688 62425 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971036.1 protein_id gnl|my_center|LOCUS_36990 62803 64023 gene locus_tag LOCUS_37000 62803 64023 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089424.1 protein_id gnl|my_center|LOCUS_37000 65393 64551 gene locus_tag LOCUS_37010 gene blaOXA 65393 64551 CDS product OXA-12 family class D beta-lactamase AmpS/OXA-725 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707905.1 protein_id gnl|my_center|LOCUS_37010 66423 65479 gene locus_tag LOCUS_37020 gene prmB 66423 65479 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090207.1 protein_id gnl|my_center|LOCUS_37020 66614 66898 gene locus_tag LOCUS_37030 66614 66898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 67843 66941 gene locus_tag LOCUS_37040 67843 66941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 68634 67846 gene locus_tag LOCUS_37050 68634 67846 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083922.1 protein_id gnl|my_center|LOCUS_37050 69836 68631 gene locus_tag LOCUS_37060 69836 68631 CDS product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083921.1 protein_id gnl|my_center|LOCUS_37060 70425 69847 gene locus_tag LOCUS_37070 70425 69847 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391330.1 protein_id gnl|my_center|LOCUS_37070 70585 71289 gene locus_tag LOCUS_37080 70585 71289 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530927.1 protein_id gnl|my_center|LOCUS_37080 72538 71381 gene locus_tag LOCUS_37090 72538 71381 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921646.1 protein_id gnl|my_center|LOCUS_37090 73281 72769 gene locus_tag LOCUS_37100 gene tsaA 73281 72769 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087894.1 protein_id gnl|my_center|LOCUS_37100 73473 74471 gene locus_tag LOCUS_37110 73473 74471 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328973.1 protein_id gnl|my_center|LOCUS_37110 74471 75400 gene locus_tag LOCUS_37120 gene metF 74471 75400 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173518.1 protein_id gnl|my_center|LOCUS_37120 75510 75851 gene locus_tag LOCUS_37130 75510 75851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 75863 79603 gene locus_tag LOCUS_37140 gene metH 75863 79603 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084235.1 protein_id gnl|my_center|LOCUS_37140 80906 79632 gene locus_tag LOCUS_37150 80906 79632 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087863.1 protein_id gnl|my_center|LOCUS_37150 81077 81925 gene locus_tag LOCUS_37160 gene pdxY 81077 81925 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_37160 81922 82827 gene locus_tag LOCUS_37170 81922 82827 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530005.1 protein_id gnl|my_center|LOCUS_37170 82858 83604 gene locus_tag LOCUS_37180 82858 83604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089220.1 protein_id gnl|my_center|LOCUS_37180 83709 84746 gene locus_tag LOCUS_37190 83709 84746 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390594.1 protein_id gnl|my_center|LOCUS_37190 84896 86443 gene locus_tag LOCUS_37200 84896 86443 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390595.1 protein_id gnl|my_center|LOCUS_37200 86682 87749 gene locus_tag LOCUS_37210 86682 87749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390596.1 protein_id gnl|my_center|LOCUS_37210 87749 88693 gene locus_tag LOCUS_37220 87749 88693 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402896.1 protein_id gnl|my_center|LOCUS_37220 88707 89999 gene locus_tag LOCUS_37230 88707 89999 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393085.1 protein_id gnl|my_center|LOCUS_37230 90099 92210 gene locus_tag LOCUS_37240 90099 92210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 93021 92188 gene locus_tag LOCUS_37250 93021 92188 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970172.1 protein_id gnl|my_center|LOCUS_37250 93759 93124 gene locus_tag LOCUS_37260 93759 93124 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083722.1 protein_id gnl|my_center|LOCUS_37260 94026 93856 gene locus_tag LOCUS_37270 94026 93856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 94333 94121 gene locus_tag LOCUS_37280 94333 94121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 94639 94397 gene locus_tag LOCUS_37290 94639 94397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 96549 94642 gene locus_tag LOCUS_37300 96549 94642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 96762 98567 gene locus_tag LOCUS_37310 gene lepA 96762 98567 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175920.1 protein_id gnl|my_center|LOCUS_37310 98571 98843 gene locus_tag LOCUS_37320 98571 98843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 98840 99229 gene locus_tag LOCUS_37330 98840 99229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 99317 99499 gene locus_tag LOCUS_37340 99317 99499 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258281.1 protein_id gnl|my_center|LOCUS_37340 100009 99560 gene locus_tag LOCUS_37350 100009 99560 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135179495.1 protein_id gnl|my_center|LOCUS_37350 100181 101188 gene locus_tag LOCUS_37360 100181 101188 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036507.1 protein_id gnl|my_center|LOCUS_37360 101191 102066 gene locus_tag LOCUS_37370 gene mepA 101191 102066 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967706.1 protein_id gnl|my_center|LOCUS_37370 103897 102272 gene locus_tag LOCUS_37380 103897 102272 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085804.1 protein_id gnl|my_center|LOCUS_37380 104853 104014 gene locus_tag LOCUS_37390 104853 104014 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087492.1 protein_id gnl|my_center|LOCUS_37390 105663 104920 gene locus_tag LOCUS_37400 105663 104920 CDS product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391328.1 protein_id gnl|my_center|LOCUS_37400 105901 107298 gene locus_tag LOCUS_37410 105901 107298 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089468.1 protein_id gnl|my_center|LOCUS_37410 107495 108826 gene locus_tag LOCUS_37420 107495 108826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 108884 110122 gene locus_tag LOCUS_37430 gene cfa1 108884 110122 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330709.1 protein_id gnl|my_center|LOCUS_37430 110292 112859 gene locus_tag LOCUS_37440 110292 112859 CDS product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972107.1 protein_id gnl|my_center|LOCUS_37440 113500 112838 gene locus_tag LOCUS_37450 113500 112838 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089363.1 protein_id gnl|my_center|LOCUS_37450 113655 114827 gene locus_tag LOCUS_37460 113655 114827 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970276.1 protein_id gnl|my_center|LOCUS_37460 114851 116425 gene locus_tag LOCUS_37470 114851 116425 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394130.1 protein_id gnl|my_center|LOCUS_37470 116891 118441 gene locus_tag LOCUS_37480 116891 118441 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089175.1 protein_id gnl|my_center|LOCUS_37480 118587 119306 gene locus_tag LOCUS_37490 118587 119306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 120116 119325 gene locus_tag LOCUS_37500 120116 119325 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920789.1 protein_id gnl|my_center|LOCUS_37500 120820 120113 gene locus_tag LOCUS_37510 120820 120113 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497769.1 protein_id gnl|my_center|LOCUS_37510 122256 120817 gene locus_tag LOCUS_37520 gene pabB 122256 120817 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967940.1 protein_id gnl|my_center|LOCUS_37520 122470 123447 gene locus_tag LOCUS_37530 122470 123447 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969733.1 protein_id gnl|my_center|LOCUS_37530 123537 124016 gene locus_tag LOCUS_37540 123537 124016 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086237.1 protein_id gnl|my_center|LOCUS_37540 124032 125531 gene locus_tag LOCUS_37550 124032 125531 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309942.1 protein_id gnl|my_center|LOCUS_37550 125622 125697 gene locus_tag LOCUS_t00500 125622 125697 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 125880 127025 gene locus_tag LOCUS_37560 125880 127025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 127321 127656 gene locus_tag LOCUS_37570 127321 127656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 127678 128568 gene locus_tag LOCUS_37580 127678 128568 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389600.1 protein_id gnl|my_center|LOCUS_37580 129726 128629 gene locus_tag LOCUS_37590 129726 128629 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085232.1 protein_id gnl|my_center|LOCUS_37590 129930 131222 gene locus_tag LOCUS_37600 gene pncB 129930 131222 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338912.1 protein_id gnl|my_center|LOCUS_37600 131433 131597 gene locus_tag LOCUS_37610 131433 131597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 131594 132910 gene locus_tag LOCUS_37620 131594 132910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 133074 134072 gene locus_tag LOCUS_37630 133074 134072 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088659.1 protein_id gnl|my_center|LOCUS_37630 134086 135255 gene locus_tag LOCUS_37640 134086 135255 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967037.1 protein_id gnl|my_center|LOCUS_37640 135336 136889 gene locus_tag LOCUS_37650 gene murJ 135336 136889 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088657.1 protein_id gnl|my_center|LOCUS_37650 137016 138233 gene locus_tag LOCUS_37660 137016 138233 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246281.1 protein_id gnl|my_center|LOCUS_37660 138251 141424 gene locus_tag LOCUS_37670 138251 141424 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393635.1 protein_id gnl|my_center|LOCUS_37670 142073 141489 gene locus_tag LOCUS_37680 142073 141489 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661920.1 protein_id gnl|my_center|LOCUS_37680 142277 143266 gene locus_tag LOCUS_37690 142277 143266 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967041.1 protein_id gnl|my_center|LOCUS_37690 144338 143280 gene locus_tag LOCUS_37700 144338 143280 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090884.1 protein_id gnl|my_center|LOCUS_37700 145144 144338 gene locus_tag LOCUS_37710 145144 144338 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088645.1 protein_id gnl|my_center|LOCUS_37710 145901 145278 gene locus_tag LOCUS_37720 145901 145278 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927085.1 protein_id gnl|my_center|LOCUS_37720 146913 146104 gene locus_tag LOCUS_37730 146913 146104 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 protein_id gnl|my_center|LOCUS_37730 147171 147611 gene locus_tag LOCUS_37740 147171 147611 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532666.1 protein_id gnl|my_center|LOCUS_37740 147614 148315 gene locus_tag LOCUS_37750 147614 148315 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_37750 148379 149305 gene locus_tag LOCUS_37760 148379 149305 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921380.1 protein_id gnl|my_center|LOCUS_37760 149567 149331 gene locus_tag LOCUS_37770 149567 149331 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014493934.1 protein_id gnl|my_center|LOCUS_37770 149879 150697 gene locus_tag LOCUS_37780 gene thiD 149879 150697 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_37780 150807 151931 gene locus_tag LOCUS_37790 150807 151931 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088637.1 protein_id gnl|my_center|LOCUS_37790 152909 151932 gene locus_tag LOCUS_37800 152909 151932 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969505.1 protein_id gnl|my_center|LOCUS_37800 153185 154333 gene locus_tag LOCUS_37810 153185 154333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921501.1 protein_id gnl|my_center|LOCUS_37810 154349 155170 gene locus_tag LOCUS_37820 154349 155170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173242.1 protein_id gnl|my_center|LOCUS_37820 155179 156225 gene locus_tag LOCUS_37830 155179 156225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 156280 156885 gene locus_tag LOCUS_37840 156280 156885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 163097 157041 gene locus_tag LOCUS_37850 163097 157041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088628.1 protein_id gnl|my_center|LOCUS_37850 163478 163798 gene locus_tag LOCUS_37860 163478 163798 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088626.1 protein_id gnl|my_center|LOCUS_37860 164839 163814 gene locus_tag LOCUS_37870 164839 163814 CDS product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089989.1 protein_id gnl|my_center|LOCUS_37870 166310 164847 gene locus_tag LOCUS_37880 166310 164847 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089988.1 protein_id gnl|my_center|LOCUS_37880 166838 166320 gene locus_tag LOCUS_37890 166838 166320 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_37890 167108 167971 gene locus_tag LOCUS_37900 167108 167971 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532361.1 protein_id gnl|my_center|LOCUS_37900 168280 168696 gene locus_tag LOCUS_37910 gene dksA 168280 168696 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531862.1 protein_id gnl|my_center|LOCUS_37910 170043 168811 gene locus_tag LOCUS_37920 170043 168811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 170341 172863 gene locus_tag LOCUS_37930 170341 172863 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088552.1 protein_id gnl|my_center|LOCUS_37930 172897 174540 gene locus_tag LOCUS_37940 gene pgi 172897 174540 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252578.1 protein_id gnl|my_center|LOCUS_37940 174662 176290 gene locus_tag LOCUS_37950 174662 176290 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970236.1 protein_id gnl|my_center|LOCUS_37950 176959 176396 gene locus_tag LOCUS_37960 176959 176396 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018012869.1 protein_id gnl|my_center|LOCUS_37960 177697 177212 gene locus_tag LOCUS_37970 gene dps 177697 177212 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312098.1 protein_id gnl|my_center|LOCUS_37970 178773 177817 gene locus_tag LOCUS_37980 gene speB 178773 177817 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055970141.1 protein_id gnl|my_center|LOCUS_37980 179729 178773 gene locus_tag LOCUS_37990 gene speB 179729 178773 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112934.1 protein_id gnl|my_center|LOCUS_37990 180693 179917 gene locus_tag LOCUS_38000 180693 179917 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 protein_id gnl|my_center|LOCUS_38000 181451 180726 gene locus_tag LOCUS_38010 181451 180726 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031472.1 protein_id gnl|my_center|LOCUS_38010 182203 181445 gene locus_tag LOCUS_38020 182203 181445 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172783.1 protein_id gnl|my_center|LOCUS_38020 182489 183430 gene locus_tag LOCUS_38030 182489 183430 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192567381.1 protein_id gnl|my_center|LOCUS_38030 185532 183415 gene locus_tag LOCUS_38040 185532 183415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 186977 185652 gene locus_tag LOCUS_38050 186977 185652 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391467.1 protein_id gnl|my_center|LOCUS_38050 187114 187494 gene locus_tag LOCUS_38060 187114 187494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 187623 188471 gene locus_tag LOCUS_38070 187623 188471 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391463.1 protein_id gnl|my_center|LOCUS_38070 188573 189352 gene locus_tag LOCUS_38080 188573 189352 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391464.1 protein_id gnl|my_center|LOCUS_38080 189349 190698 gene locus_tag LOCUS_38090 189349 190698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391465.1 protein_id gnl|my_center|LOCUS_38090 190700 191548 gene locus_tag LOCUS_38100 190700 191548 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626644.1 protein_id gnl|my_center|LOCUS_38100 192502 191555 gene locus_tag LOCUS_38110 192502 191555 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391469.1 protein_id gnl|my_center|LOCUS_38110 193935 192520 gene locus_tag LOCUS_38120 193935 192520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 195177 194164 gene locus_tag LOCUS_38130 195177 194164 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327780.1 protein_id gnl|my_center|LOCUS_38130 196345 195272 gene locus_tag LOCUS_38140 196345 195272 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921622.1 protein_id gnl|my_center|LOCUS_38140 197772 196342 gene locus_tag LOCUS_38150 gene trmFO 197772 196342 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087495.1 protein_id gnl|my_center|LOCUS_38150 198096 197935 gene locus_tag LOCUS_38160 198096 197935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 199589 198300 gene locus_tag LOCUS_38170 199589 198300 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087730.1 protein_id gnl|my_center|LOCUS_38170 199894 199706 gene locus_tag LOCUS_38180 199894 199706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 200398 199898 gene locus_tag LOCUS_38190 200398 199898 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312735.1 protein_id gnl|my_center|LOCUS_38190 200637 201098 gene locus_tag LOCUS_38200 gene rplM 200637 201098 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312738.1 protein_id gnl|my_center|LOCUS_38200 201101 201577 gene locus_tag LOCUS_38210 gene rpsI 201101 201577 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087725.1 protein_id gnl|my_center|LOCUS_38210 201811 202995 gene locus_tag LOCUS_38220 201811 202995 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966314.1 protein_id gnl|my_center|LOCUS_38220 203036 204286 gene locus_tag LOCUS_38230 203036 204286 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966314.1 protein_id gnl|my_center|LOCUS_38230 205818 204409 gene locus_tag LOCUS_38240 gene glnA 205818 204409 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087712.1 protein_id gnl|my_center|LOCUS_38240 206288 205950 gene locus_tag LOCUS_38250 206288 205950 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603495.1 protein_id gnl|my_center|LOCUS_38250 206641 208131 gene locus_tag LOCUS_38260 206641 208131 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966309.1 protein_id gnl|my_center|LOCUS_38260 208312 208396 gene locus_tag LOCUS_t00510 208312 208396 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 208526 209875 gene locus_tag LOCUS_38270 gene tig 208526 209875 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087709.1 protein_id gnl|my_center|LOCUS_38270 210055 210663 gene locus_tag LOCUS_38280 210055 210663 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087708.1 protein_id gnl|my_center|LOCUS_38280 211041 212312 gene locus_tag LOCUS_38290 gene clpX 211041 212312 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008547851.1 protein_id gnl|my_center|LOCUS_38290 212568 215009 gene locus_tag LOCUS_38300 gene lon 212568 215009 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087707.1 protein_id gnl|my_center|LOCUS_38300 215312 215590 gene locus_tag LOCUS_38310 215312 215590 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_38310 215882 215957 gene locus_tag LOCUS_t00520 215882 215957 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 216000 216671 gene locus_tag LOCUS_38320 216000 216671 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385291.1 protein_id gnl|my_center|LOCUS_38320 216668 217426 gene locus_tag LOCUS_38330 216668 217426 CDS product ATP12 family chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401742.1 protein_id gnl|my_center|LOCUS_38330 217966 218679 gene locus_tag LOCUS_38340 217966 218679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 218841 219995 gene locus_tag LOCUS_38350 218841 219995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 220146 220859 gene locus_tag LOCUS_38360 220146 220859 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389242.1 protein_id gnl|my_center|LOCUS_38360 220868 222352 gene locus_tag LOCUS_38370 220868 222352 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389246.1 protein_id gnl|my_center|LOCUS_38370 222962 222414 gene locus_tag LOCUS_38380 222962 222414 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265507.1 protein_id gnl|my_center|LOCUS_38380 223288 225483 gene locus_tag LOCUS_38390 223288 225483 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_38390 225480 226139 gene locus_tag LOCUS_38400 225480 226139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 227339 226152 gene locus_tag LOCUS_38410 227339 226152 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 protein_id gnl|my_center|LOCUS_38410 228299 227343 gene locus_tag LOCUS_38420 228299 227343 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064309.1 protein_id gnl|my_center|LOCUS_38420 229154 228444 gene locus_tag LOCUS_38430 229154 228444 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384632.1 protein_id gnl|my_center|LOCUS_38430 229437 229216 gene locus_tag LOCUS_38440 229437 229216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 229337 230341 gene locus_tag LOCUS_38450 229337 230341 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384631.1 protein_id gnl|my_center|LOCUS_38450 230352 231182 gene locus_tag LOCUS_38460 230352 231182 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384630.1 protein_id gnl|my_center|LOCUS_38460 231186 231992 gene locus_tag LOCUS_38470 231186 231992 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384629.1 protein_id gnl|my_center|LOCUS_38470 232004 232756 gene locus_tag LOCUS_38480 232004 232756 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384628.1 protein_id gnl|my_center|LOCUS_38480 232756 233460 gene locus_tag LOCUS_38490 232756 233460 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384627.1 protein_id gnl|my_center|LOCUS_38490 233910 233515 gene locus_tag LOCUS_38500 233910 233515 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087239.1 protein_id gnl|my_center|LOCUS_38500 235233 233935 gene locus_tag LOCUS_38510 235233 233935 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088984.1 protein_id gnl|my_center|LOCUS_38510 235419 236624 gene locus_tag LOCUS_38520 gene hutI 235419 236624 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088983.1 protein_id gnl|my_center|LOCUS_38520 236621 238156 gene locus_tag LOCUS_38530 gene hutH 236621 238156 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640105.1 protein_id gnl|my_center|LOCUS_38530 238527 239360 gene locus_tag LOCUS_38540 gene hutG 238527 239360 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532301.1 protein_id gnl|my_center|LOCUS_38540 239373 241040 gene locus_tag LOCUS_38550 239373 241040 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918841.1 protein_id gnl|my_center|LOCUS_38550 241147 241698 gene locus_tag LOCUS_38560 241147 241698 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928641.1 protein_id gnl|my_center|LOCUS_38560 242472 241702 gene locus_tag LOCUS_38570 gene hutC 242472 241702 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918846.1 protein_id gnl|my_center|LOCUS_38570 242734 243783 gene locus_tag LOCUS_38580 gene recA 242734 243783 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532151.1 protein_id gnl|my_center|LOCUS_38580 244111 246762 gene locus_tag LOCUS_38590 gene alaS 244111 246762 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969477.1 protein_id gnl|my_center|LOCUS_38590 247088 247246 gene locus_tag LOCUS_38600 247088 247246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 247921 249171 gene locus_tag LOCUS_38610 247921 249171 CDS product cyclic nucleotide-gated ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967190.1 protein_id gnl|my_center|LOCUS_38610 250555 249344 gene locus_tag LOCUS_38620 250555 249344 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969471.1 protein_id gnl|my_center|LOCUS_38620 250825 251703 gene locus_tag LOCUS_38630 250825 251703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 251771 252703 gene locus_tag LOCUS_38640 gene murI 251771 252703 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088448.1 protein_id gnl|my_center|LOCUS_38640 252802 254085 gene locus_tag LOCUS_38650 252802 254085 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087152.1 protein_id gnl|my_center|LOCUS_38650 254127 254360 gene locus_tag LOCUS_38660 254127 254360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 254556 255173 gene locus_tag LOCUS_38670 gene rpsD 254556 255173 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088452.1 protein_id gnl|my_center|LOCUS_38670 255678 255340 gene locus_tag LOCUS_38680 gene grxD 255678 255340 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532137.1 protein_id gnl|my_center|LOCUS_38680 255989 255756 gene locus_tag LOCUS_38690 255989 255756 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 protein_id gnl|my_center|LOCUS_38690 258213 256003 gene locus_tag LOCUS_38700 gene purL 258213 256003 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088464.1 protein_id gnl|my_center|LOCUS_38700 258969 258271 gene locus_tag LOCUS_38710 gene purQ 258969 258271 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088468.1 protein_id gnl|my_center|LOCUS_38710 259202 258966 gene locus_tag LOCUS_38720 259202 258966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 259478 259236 gene locus_tag LOCUS_38730 gene purS 259478 259236 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088473.1 protein_id gnl|my_center|LOCUS_38730 260394 259618 gene locus_tag LOCUS_38740 260394 259618 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008974302.1 protein_id gnl|my_center|LOCUS_38740 260739 261062 gene locus_tag LOCUS_38750 260739 261062 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 protein_id gnl|my_center|LOCUS_38750 261238 264114 gene locus_tag LOCUS_38760 261238 264114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 262860 262946 gene locus_tag LOCUS_t00530 262860 262946 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 264347 264066 gene locus_tag LOCUS_38770 264347 264066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 264283 264825 gene locus_tag LOCUS_38780 264283 264825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 266202 264895 gene locus_tag LOCUS_38790 gene purB 266202 264895 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088436.1 protein_id gnl|my_center|LOCUS_38790 266992 266306 gene locus_tag LOCUS_38800 gene rpe 266992 266306 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088426.1 protein_id gnl|my_center|LOCUS_38800 267161 267529 gene locus_tag LOCUS_38810 267161 267529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 268646 267630 gene locus_tag LOCUS_38820 268646 267630 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088424.1 protein_id gnl|my_center|LOCUS_38820 268752 269483 gene locus_tag LOCUS_38830 268752 269483 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085573.1 protein_id gnl|my_center|LOCUS_38830 270767 269667 gene locus_tag LOCUS_38840 270767 269667 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525631.1 protein_id gnl|my_center|LOCUS_38840 271369 270896 gene locus_tag LOCUS_38850 271369 270896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 272154 271372 gene locus_tag LOCUS_38860 272154 271372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529095.1 protein_id gnl|my_center|LOCUS_38860 273116 272151 gene locus_tag LOCUS_38870 273116 272151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329312.1 protein_id gnl|my_center|LOCUS_38870 274549 273116 gene locus_tag LOCUS_38880 gene livM 274549 273116 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394369.1 protein_id gnl|my_center|LOCUS_38880 275478 274561 gene locus_tag LOCUS_38890 275478 274561 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529092.1 protein_id gnl|my_center|LOCUS_38890 275818 276372 gene locus_tag LOCUS_38900 275818 276372 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531440.1 protein_id gnl|my_center|LOCUS_38900 277627 276440 gene locus_tag LOCUS_38910 277627 276440 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919352.1 protein_id gnl|my_center|LOCUS_38910 278685 277624 gene locus_tag LOCUS_38920 278685 277624 CDS product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087160.1 protein_id gnl|my_center|LOCUS_38920 278812 279135 gene locus_tag LOCUS_38930 278812 279135 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975638.1 protein_id gnl|my_center|LOCUS_38930 279135 279836 gene locus_tag LOCUS_38940 279135 279836 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532111.1 protein_id gnl|my_center|LOCUS_38940 279833 281494 gene locus_tag LOCUS_38950 279833 281494 CDS product molybdopterin-binding/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088405.1 protein_id gnl|my_center|LOCUS_38950 282226 281498 gene locus_tag LOCUS_38960 282226 281498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 282890 282426 gene locus_tag LOCUS_38970 282890 282426 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088388.1 protein_id gnl|my_center|LOCUS_38970 283054 284529 gene locus_tag LOCUS_38980 283054 284529 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240434.1 protein_id gnl|my_center|LOCUS_38980 284042 284118 gene locus_tag LOCUS_t00540 284042 284118 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 286013 284685 gene locus_tag LOCUS_38990 286013 284685 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339250.1 protein_id gnl|my_center|LOCUS_38990 286639 286013 gene locus_tag LOCUS_39000 286639 286013 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810992.1 protein_id gnl|my_center|LOCUS_39000 287928 286789 gene locus_tag LOCUS_39010 287928 286789 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810994.1 protein_id gnl|my_center|LOCUS_39010 288194 290407 gene locus_tag LOCUS_39020 288194 290407 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390989.1 protein_id gnl|my_center|LOCUS_39020 290571 291602 gene locus_tag LOCUS_39030 290571 291602 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390879.1 protein_id gnl|my_center|LOCUS_39030 291599 292597 gene locus_tag LOCUS_39040 291599 292597 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_39040 292594 293754 gene locus_tag LOCUS_39050 292594 293754 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088394.1 protein_id gnl|my_center|LOCUS_39050 294655 293837 gene locus_tag LOCUS_39060 294655 293837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 294765 295832 gene locus_tag LOCUS_39070 294765 295832 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089758.1 protein_id gnl|my_center|LOCUS_39070 295829 296914 gene locus_tag LOCUS_39080 295829 296914 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527920.1 protein_id gnl|my_center|LOCUS_39080 296911 299994 gene locus_tag LOCUS_39090 296911 299994 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527921.1 protein_id gnl|my_center|LOCUS_39090 >Feature sequence21 1587 502 gene locus_tag LOCUS_39100 gene mraY 1587 502 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089345.1 protein_id gnl|my_center|LOCUS_39100 3152 1710 gene locus_tag LOCUS_39110 3152 1710 CDS product UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diaminopimelate--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972056.1 protein_id gnl|my_center|LOCUS_39110 4645 3158 gene locus_tag LOCUS_39120 4645 3158 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089347.1 protein_id gnl|my_center|LOCUS_39120 6545 4752 gene locus_tag LOCUS_39130 6545 4752 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089348.1 protein_id gnl|my_center|LOCUS_39130 7156 6563 gene locus_tag LOCUS_39140 7156 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 8197 7166 gene locus_tag LOCUS_39150 gene rsmH 8197 7166 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966431.1 protein_id gnl|my_center|LOCUS_39150 8700 8197 gene locus_tag LOCUS_39160 gene mraZ 8700 8197 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708642.1 protein_id gnl|my_center|LOCUS_39160 8969 9766 gene locus_tag LOCUS_39170 8969 9766 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972065.1 protein_id gnl|my_center|LOCUS_39170 10005 10520 gene locus_tag LOCUS_39180 10005 10520 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976233.1 protein_id gnl|my_center|LOCUS_39180 11692 10586 gene locus_tag LOCUS_39190 11692 10586 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398980.1 protein_id gnl|my_center|LOCUS_39190 11861 12952 gene locus_tag LOCUS_39200 11861 12952 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068883688.1 protein_id gnl|my_center|LOCUS_39200 13483 14289 gene locus_tag LOCUS_39210 gene dapB 13483 14289 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257160.1 protein_id gnl|my_center|LOCUS_39210 15645 14308 gene locus_tag LOCUS_39220 15645 14308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 >Feature sequence22 >Feature sequence23 1933 959 gene locus_tag LOCUS_39230 1933 959 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815667.1 protein_id gnl|my_center|LOCUS_39230 2095 3600 gene locus_tag LOCUS_39240 2095 3600 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061255.1 protein_id gnl|my_center|LOCUS_39240 3621 4544 gene locus_tag LOCUS_39250 3621 4544 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970565.1 protein_id gnl|my_center|LOCUS_39250 4541 5518 gene locus_tag LOCUS_39260 4541 5518 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970014.1 protein_id gnl|my_center|LOCUS_39260 5515 6468 gene locus_tag LOCUS_39270 5515 6468 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246965.1 protein_id gnl|my_center|LOCUS_39270 6486 7394 gene locus_tag LOCUS_39280 6486 7394 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_39280 7451 8251 gene locus_tag LOCUS_39290 7451 8251 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966449.1 protein_id gnl|my_center|LOCUS_39290 8264 9049 gene locus_tag LOCUS_39300 8264 9049 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339313.1 protein_id gnl|my_center|LOCUS_39300 9068 9769 gene locus_tag LOCUS_39310 9068 9769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 9842 11173 gene locus_tag LOCUS_39320 9842 11173 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268750.1 protein_id gnl|my_center|LOCUS_39320 >Feature sequence24 >Feature sequence25 541 617 gene locus_tag LOCUS_t00550 541 617 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 796 993 gene locus_tag LOCUS_39330 gene secE 796 993 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523719.1 protein_id gnl|my_center|LOCUS_39330 1005 1535 gene locus_tag LOCUS_39340 gene nusG 1005 1535 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088165.1 protein_id gnl|my_center|LOCUS_39340 1716 2318 gene locus_tag LOCUS_39350 1716 2318 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930417.1 protein_id gnl|my_center|LOCUS_39350 2412 2789 gene locus_tag LOCUS_39360 2412 2789 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973855.1 protein_id gnl|my_center|LOCUS_39360 3029 3478 gene locus_tag LOCUS_39370 gene rplK 3029 3478 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088164.1 protein_id gnl|my_center|LOCUS_39370 3483 4184 gene locus_tag LOCUS_39380 gene rplA 3483 4184 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328057.1 protein_id gnl|my_center|LOCUS_39380 4651 5169 gene locus_tag LOCUS_39390 gene rplJ 4651 5169 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_249163115.1 protein_id gnl|my_center|LOCUS_39390 5220 5594 gene locus_tag LOCUS_39400 gene rplL 5220 5594 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088160.1 protein_id gnl|my_center|LOCUS_39400 5871 10001 gene locus_tag LOCUS_39410 gene rpoB 5871 10001 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088159.1 protein_id gnl|my_center|LOCUS_39410 10127 14317 gene locus_tag LOCUS_39420 gene rpoC 10127 14317 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088158.1 protein_id gnl|my_center|LOCUS_39420 14843 14421 gene locus_tag LOCUS_39430 14843 14421 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968954.1 protein_id gnl|my_center|LOCUS_39430 15863 16234 gene locus_tag LOCUS_39440 gene rpsL 15863 16234 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507760.1 protein_id gnl|my_center|LOCUS_39440 16246 16716 gene locus_tag LOCUS_39450 gene rpsG 16246 16716 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008875664.1 protein_id gnl|my_center|LOCUS_39450 16744 18819 gene locus_tag LOCUS_39460 gene fusA 16744 18819 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088153.1 protein_id gnl|my_center|LOCUS_39460