>Feature sequence001 2 205 gene locus_tag LOCUS_00010 2 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 202 1137 gene locus_tag LOCUS_00020 202 1137 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054072.1 protein_id gnl|my_center|LOCUS_00020 1656 1216 gene locus_tag LOCUS_00030 1656 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1853 5452 gene locus_tag LOCUS_00040 gene dnaE 1853 5452 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812245.1 protein_id gnl|my_center|LOCUS_00040 7483 5606 gene locus_tag LOCUS_00050 7483 5606 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053331.1 protein_id gnl|my_center|LOCUS_00050 7853 8158 gene locus_tag LOCUS_00060 7853 8158 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819828.1 protein_id gnl|my_center|LOCUS_00060 8299 9642 gene locus_tag LOCUS_00070 8299 9642 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054367.1 protein_id gnl|my_center|LOCUS_00070 10548 9649 gene locus_tag LOCUS_00080 10548 9649 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389641.1 protein_id gnl|my_center|LOCUS_00080 11229 10714 gene locus_tag LOCUS_00090 11229 10714 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_00090 11505 12623 gene locus_tag LOCUS_00100 11505 12623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112954.1 protein_id gnl|my_center|LOCUS_00100 12620 13609 gene locus_tag LOCUS_00110 12620 13609 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 protein_id gnl|my_center|LOCUS_00110 13609 13899 gene locus_tag LOCUS_00120 13609 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13942 14568 gene locus_tag LOCUS_00130 13942 14568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00130 14578 15699 gene locus_tag LOCUS_00140 14578 15699 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084365.1 protein_id gnl|my_center|LOCUS_00140 16052 17425 gene locus_tag LOCUS_00150 16052 17425 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_00150 17609 18148 gene locus_tag LOCUS_00160 17609 18148 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067975.1 protein_id gnl|my_center|LOCUS_00160 18262 19800 gene locus_tag LOCUS_00170 18262 19800 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067976.1 protein_id gnl|my_center|LOCUS_00170 19954 21351 gene locus_tag LOCUS_00180 gene hisD 19954 21351 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812265.1 protein_id gnl|my_center|LOCUS_00180 21450 22625 gene locus_tag LOCUS_00190 21450 22625 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389646.1 protein_id gnl|my_center|LOCUS_00190 22723 23325 gene locus_tag LOCUS_00200 gene hisB 22723 23325 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389647.1 protein_id gnl|my_center|LOCUS_00200 23325 24077 gene locus_tag LOCUS_00210 23325 24077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815225.1 protein_id gnl|my_center|LOCUS_00210 24150 24797 gene locus_tag LOCUS_00220 gene hisH 24150 24797 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067978.1 protein_id gnl|my_center|LOCUS_00220 24865 25590 gene locus_tag LOCUS_00230 gene priA 24865 25590 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054385.1 protein_id gnl|my_center|LOCUS_00230 27181 25724 gene locus_tag LOCUS_00240 27181 25724 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812277.1 protein_id gnl|my_center|LOCUS_00240 27253 28590 gene locus_tag LOCUS_00250 gene glnA 27253 28590 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052524.1 protein_id gnl|my_center|LOCUS_00250 28600 29808 gene locus_tag LOCUS_00260 28600 29808 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037401.1 protein_id gnl|my_center|LOCUS_00260 30703 29831 gene locus_tag LOCUS_00270 30703 29831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389652.1 protein_id gnl|my_center|LOCUS_00270 35040 30919 gene locus_tag LOCUS_00280 gene hrpA 35040 30919 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389653.1 protein_id gnl|my_center|LOCUS_00280 35771 35118 gene locus_tag LOCUS_00290 35771 35118 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054390.1 protein_id gnl|my_center|LOCUS_00290 35913 37445 gene locus_tag LOCUS_00300 gene hflX 35913 37445 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067980.1 protein_id gnl|my_center|LOCUS_00300 37735 38697 gene locus_tag LOCUS_00310 37735 38697 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052533.1 protein_id gnl|my_center|LOCUS_00310 38831 39778 gene locus_tag LOCUS_00320 38831 39778 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812298.1 protein_id gnl|my_center|LOCUS_00320 40607 39888 gene locus_tag LOCUS_00330 gene lexA 40607 39888 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052535.1 protein_id gnl|my_center|LOCUS_00330 40760 41089 gene locus_tag LOCUS_00340 40760 41089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41403 41104 gene locus_tag LOCUS_00350 41403 41104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 41431 41766 gene locus_tag LOCUS_00360 41431 41766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 43066 41867 gene locus_tag LOCUS_00370 gene serA 43066 41867 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363235.1 protein_id gnl|my_center|LOCUS_00370 45426 43147 gene locus_tag LOCUS_00380 45426 43147 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052539.1 protein_id gnl|my_center|LOCUS_00380 45737 46252 gene locus_tag LOCUS_00390 gene mraZ 45737 46252 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812311.1 protein_id gnl|my_center|LOCUS_00390 46252 47328 gene locus_tag LOCUS_00400 gene rsmH 46252 47328 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389657.1 protein_id gnl|my_center|LOCUS_00400 47328 47771 gene locus_tag LOCUS_00410 47328 47771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389658.1 protein_id gnl|my_center|LOCUS_00410 47768 49576 gene locus_tag LOCUS_00420 47768 49576 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052544.1 protein_id gnl|my_center|LOCUS_00420 49616 50521 gene locus_tag LOCUS_00430 49616 50521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067982.1 protein_id gnl|my_center|LOCUS_00430 50562 52082 gene locus_tag LOCUS_00440 50562 52082 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389661.1 protein_id gnl|my_center|LOCUS_00440 52155 53255 gene locus_tag LOCUS_00450 gene mraY 52155 53255 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052547.1 protein_id gnl|my_center|LOCUS_00450 53337 54767 gene locus_tag LOCUS_00460 gene murD 53337 54767 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389662.1 protein_id gnl|my_center|LOCUS_00460 54754 56088 gene locus_tag LOCUS_00470 54754 56088 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389663.1 protein_id gnl|my_center|LOCUS_00470 56151 57320 gene locus_tag LOCUS_00480 56151 57320 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052550.1 protein_id gnl|my_center|LOCUS_00480 57380 58942 gene locus_tag LOCUS_00490 gene murC 57380 58942 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389664.1 protein_id gnl|my_center|LOCUS_00490 59570 58878 gene locus_tag LOCUS_00500 59570 58878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 59491 60318 gene locus_tag LOCUS_00510 59491 60318 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817017.1 protein_id gnl|my_center|LOCUS_00510 60527 60923 gene locus_tag LOCUS_tm00010 60527 60923 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 61213 64365 gene locus_tag LOCUS_00520 61213 64365 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067986.1 protein_id gnl|my_center|LOCUS_00520 64538 67696 gene locus_tag LOCUS_00530 64538 67696 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067987.1 protein_id gnl|my_center|LOCUS_00530 67951 71058 gene locus_tag LOCUS_00540 67951 71058 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067988.1 protein_id gnl|my_center|LOCUS_00540 71278 72549 gene locus_tag LOCUS_00550 71278 72549 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080901.1 protein_id gnl|my_center|LOCUS_00550 72581 73513 gene locus_tag LOCUS_00560 72581 73513 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067989.1 protein_id gnl|my_center|LOCUS_00560 73513 74367 gene locus_tag LOCUS_00570 73513 74367 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067990.1 protein_id gnl|my_center|LOCUS_00570 74380 75675 gene locus_tag LOCUS_00580 74380 75675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067991.1 protein_id gnl|my_center|LOCUS_00580 75789 78305 gene locus_tag LOCUS_00590 75789 78305 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150394337.1 protein_id gnl|my_center|LOCUS_00590 78442 81255 gene locus_tag LOCUS_00600 78442 81255 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236023556.1 protein_id gnl|my_center|LOCUS_00600 81448 82557 gene locus_tag LOCUS_00610 81448 82557 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067994.1 protein_id gnl|my_center|LOCUS_00610 83942 82707 gene locus_tag LOCUS_00620 83942 82707 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054321935.1 protein_id gnl|my_center|LOCUS_00620 85346 84048 gene locus_tag LOCUS_00630 85346 84048 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829550.1 protein_id gnl|my_center|LOCUS_00630 86945 85563 gene locus_tag LOCUS_00640 86945 85563 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101035.1 protein_id gnl|my_center|LOCUS_00640 87420 87031 gene locus_tag LOCUS_00650 87420 87031 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 protein_id gnl|my_center|LOCUS_00650 88596 87700 gene locus_tag LOCUS_00660 88596 87700 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389668.1 protein_id gnl|my_center|LOCUS_00660 89904 88687 gene locus_tag LOCUS_00670 89904 88687 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812341.1 protein_id gnl|my_center|LOCUS_00670 90181 90915 gene locus_tag LOCUS_00680 90181 90915 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143294.1 protein_id gnl|my_center|LOCUS_00680 91298 90912 gene locus_tag LOCUS_00690 91298 90912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 91180 92481 gene locus_tag LOCUS_00700 91180 92481 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068762.1 protein_id gnl|my_center|LOCUS_00700 92624 93595 gene locus_tag LOCUS_00710 92624 93595 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829947.1 protein_id gnl|my_center|LOCUS_00710 93592 94557 gene locus_tag LOCUS_00720 93592 94557 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068764.1 protein_id gnl|my_center|LOCUS_00720 94719 96971 gene locus_tag LOCUS_00730 gene gnpA 94719 96971 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 protein_id gnl|my_center|LOCUS_00730 97080 98165 gene locus_tag LOCUS_00740 gene nahK 97080 98165 CDS product N-acetylhexosamine 1-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068766.1 protein_id gnl|my_center|LOCUS_00740 98162 99736 gene locus_tag LOCUS_00750 98162 99736 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389960.1 protein_id gnl|my_center|LOCUS_00750 99794 100735 gene locus_tag LOCUS_00760 99794 100735 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389961.1 protein_id gnl|my_center|LOCUS_00760 102016 100877 gene locus_tag LOCUS_00770 102016 100877 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819272.1 protein_id gnl|my_center|LOCUS_00770 102312 103124 gene locus_tag LOCUS_00780 gene nagB 102312 103124 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052563.1 protein_id gnl|my_center|LOCUS_00780 103216 104475 gene locus_tag LOCUS_00790 gene nagA 103216 104475 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817047.1 protein_id gnl|my_center|LOCUS_00790 104917 106566 gene locus_tag LOCUS_00800 104917 106566 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050760733.1 protein_id gnl|my_center|LOCUS_00800 106682 107767 gene locus_tag LOCUS_00810 106682 107767 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052566.1 protein_id gnl|my_center|LOCUS_00810 107769 108965 gene locus_tag LOCUS_00820 107769 108965 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363253.1 protein_id gnl|my_center|LOCUS_00820 108962 110692 gene locus_tag LOCUS_00830 108962 110692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389671.1 protein_id gnl|my_center|LOCUS_00830 111370 110849 gene locus_tag LOCUS_00840 111370 110849 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817058.1 protein_id gnl|my_center|LOCUS_00840 112985 111384 gene locus_tag LOCUS_00850 112985 111384 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389672.1 protein_id gnl|my_center|LOCUS_00850 113184 114800 gene locus_tag LOCUS_00860 113184 114800 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389673.1 protein_id gnl|my_center|LOCUS_00860 114907 118617 gene locus_tag LOCUS_00870 gene smc 114907 118617 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068006.1 protein_id gnl|my_center|LOCUS_00870 119663 118665 gene locus_tag LOCUS_00880 119663 118665 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068007.1 protein_id gnl|my_center|LOCUS_00880 121301 119736 gene locus_tag LOCUS_00890 121301 119736 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054433.1 protein_id gnl|my_center|LOCUS_00890 121439 122281 gene locus_tag LOCUS_00900 121439 122281 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057260.1 protein_id gnl|my_center|LOCUS_00900 122278 122697 gene locus_tag LOCUS_00910 122278 122697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054435.1 protein_id gnl|my_center|LOCUS_00910 123936 122986 gene locus_tag LOCUS_00920 123936 122986 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112999.1 protein_id gnl|my_center|LOCUS_00920 124159 125151 gene locus_tag LOCUS_00930 124159 125151 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821233.1 protein_id gnl|my_center|LOCUS_00930 125673 125164 gene locus_tag LOCUS_00940 gene ybaK 125673 125164 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812394.1 protein_id gnl|my_center|LOCUS_00940 128437 125858 gene locus_tag LOCUS_00950 128437 125858 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027862.1 protein_id gnl|my_center|LOCUS_00950 128622 130211 gene locus_tag LOCUS_00960 128622 130211 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_00960 130489 131511 gene locus_tag LOCUS_00970 130489 131511 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804785.1 protein_id gnl|my_center|LOCUS_00970 131747 133474 gene locus_tag LOCUS_00980 131747 133474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680485.1 protein_id gnl|my_center|LOCUS_00980 133471 135339 gene locus_tag LOCUS_00990 133471 135339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 136506 135448 gene locus_tag LOCUS_01000 gene gap 136506 135448 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812396.1 protein_id gnl|my_center|LOCUS_01000 137493 136768 gene locus_tag LOCUS_01010 137493 136768 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_01010 137601 139292 gene locus_tag LOCUS_01020 137601 139292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 139578 140279 gene locus_tag LOCUS_01030 gene infC 139578 140279 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817101.1 protein_id gnl|my_center|LOCUS_01030 140298 140492 gene locus_tag LOCUS_01040 gene rpmI 140298 140492 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812404.1 protein_id gnl|my_center|LOCUS_01040 140543 140926 gene locus_tag LOCUS_01050 gene rplT 140543 140926 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812406.1 protein_id gnl|my_center|LOCUS_01050 141016 142011 gene locus_tag LOCUS_01060 gene xerD 141016 142011 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389683.1 protein_id gnl|my_center|LOCUS_01060 142237 143076 gene locus_tag LOCUS_01070 142237 143076 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389684.1 protein_id gnl|my_center|LOCUS_01070 143289 144089 gene locus_tag LOCUS_01080 143289 144089 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389685.1 protein_id gnl|my_center|LOCUS_01080 144086 144763 gene locus_tag LOCUS_01090 gene scpB 144086 144763 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389686.1 protein_id gnl|my_center|LOCUS_01090 145171 145974 gene locus_tag LOCUS_01100 145171 145974 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389687.1 protein_id gnl|my_center|LOCUS_01100 146242 148170 gene locus_tag LOCUS_01110 gene typA 146242 148170 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812425.1 protein_id gnl|my_center|LOCUS_01110 148798 148983 gene locus_tag LOCUS_01120 148798 148983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 149173 149748 gene locus_tag LOCUS_01130 149173 149748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 149745 150812 gene locus_tag LOCUS_01140 149745 150812 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389691.1 protein_id gnl|my_center|LOCUS_01140 150806 151867 gene locus_tag LOCUS_01150 150806 151867 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389692.1 protein_id gnl|my_center|LOCUS_01150 152147 151896 gene locus_tag LOCUS_01160 152147 151896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812433.1 protein_id gnl|my_center|LOCUS_01160 153240 152266 gene locus_tag LOCUS_01170 153240 152266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 153919 153293 gene locus_tag LOCUS_01180 153919 153293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 154330 154010 gene locus_tag LOCUS_01190 154330 154010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 155047 154415 gene locus_tag LOCUS_01200 155047 154415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 155468 155136 gene locus_tag LOCUS_01210 155468 155136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 155732 156880 gene locus_tag LOCUS_01220 155732 156880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 156871 157494 gene locus_tag LOCUS_01230 156871 157494 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814716.1 protein_id gnl|my_center|LOCUS_01230 157505 158638 gene locus_tag LOCUS_01240 157505 158638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363811.1 protein_id gnl|my_center|LOCUS_01240 161578 158666 gene locus_tag LOCUS_01250 161578 158666 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028773.1 protein_id gnl|my_center|LOCUS_01250 162480 161575 gene locus_tag LOCUS_01260 162480 161575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_01260 162567 163475 gene locus_tag LOCUS_01270 162567 163475 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389693.1 protein_id gnl|my_center|LOCUS_01270 163521 164378 gene locus_tag LOCUS_01280 163521 164378 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058594.1 protein_id gnl|my_center|LOCUS_01280 >Feature sequence002 403 1377 gene locus_tag LOCUS_01290 403 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068504.1 protein_id gnl|my_center|LOCUS_01290 3224 1515 gene locus_tag LOCUS_01300 3224 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 4588 3518 gene locus_tag LOCUS_01310 4588 3518 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_01310 6354 4756 gene locus_tag LOCUS_01320 6354 4756 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057431.1 protein_id gnl|my_center|LOCUS_01320 7949 6390 gene locus_tag LOCUS_01330 7949 6390 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054128.1 protein_id gnl|my_center|LOCUS_01330 8055 10211 gene locus_tag LOCUS_01340 8055 10211 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068664.1 protein_id gnl|my_center|LOCUS_01340 10336 11394 gene locus_tag LOCUS_01350 10336 11394 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068665.1 protein_id gnl|my_center|LOCUS_01350 11829 12845 gene locus_tag LOCUS_01360 11829 12845 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068667.1 protein_id gnl|my_center|LOCUS_01360 13156 14745 gene locus_tag LOCUS_01370 13156 14745 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_01370 14908 15909 gene locus_tag LOCUS_01380 14908 15909 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_01380 15956 16915 gene locus_tag LOCUS_01390 15956 16915 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_01390 17453 17172 gene locus_tag LOCUS_01400 17453 17172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 17422 18165 gene locus_tag LOCUS_01410 17422 18165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 18255 19805 gene locus_tag LOCUS_01420 gene gltX 18255 19805 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811622.1 protein_id gnl|my_center|LOCUS_01420 20201 20274 gene locus_tag LOCUS_t00010 20201 20274 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20572 20645 gene locus_tag LOCUS_t00020 20572 20645 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20683 20757 gene locus_tag LOCUS_t00030 20683 20757 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20871 22151 gene locus_tag LOCUS_01430 20871 22151 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389459.1 protein_id gnl|my_center|LOCUS_01430 22505 22152 gene locus_tag LOCUS_01440 22505 22152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390355.1 protein_id gnl|my_center|LOCUS_01440 23203 22502 gene locus_tag LOCUS_01450 23203 22502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390354.1 protein_id gnl|my_center|LOCUS_01450 23651 25513 gene locus_tag LOCUS_01460 gene metG 23651 25513 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390353.1 protein_id gnl|my_center|LOCUS_01460 26431 27921 gene locus_tag LOCUS_01470 26431 27921 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068757.1 protein_id gnl|my_center|LOCUS_01470 28162 29139 gene locus_tag LOCUS_01480 28162 29139 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051219.1 protein_id gnl|my_center|LOCUS_01480 30775 29279 gene locus_tag LOCUS_01490 30775 29279 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068657.1 protein_id gnl|my_center|LOCUS_01490 31038 32021 gene locus_tag LOCUS_01500 31038 32021 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138444.1 protein_id gnl|my_center|LOCUS_01500 32042 33055 gene locus_tag LOCUS_01510 32042 33055 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112747.1 protein_id gnl|my_center|LOCUS_01510 33080 35254 gene locus_tag LOCUS_01520 33080 35254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_01520 35642 37396 gene locus_tag LOCUS_01530 35642 37396 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947105.1 protein_id gnl|my_center|LOCUS_01530 38018 39865 gene locus_tag LOCUS_01540 38018 39865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582988.1 protein_id gnl|my_center|LOCUS_01540 39958 41757 gene locus_tag LOCUS_01550 39958 41757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052919.1 protein_id gnl|my_center|LOCUS_01550 42267 42395 gene locus_tag LOCUS_01560 42267 42395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 42893 44536 gene locus_tag LOCUS_01570 42893 44536 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967238.1 protein_id gnl|my_center|LOCUS_01570 44670 44431 gene locus_tag LOCUS_01580 44670 44431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 44762 45871 gene locus_tag LOCUS_01590 44762 45871 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967239.1 protein_id gnl|my_center|LOCUS_01590 45868 46680 gene locus_tag LOCUS_01600 45868 46680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967240.1 protein_id gnl|my_center|LOCUS_01600 46677 48419 gene locus_tag LOCUS_01610 46677 48419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804199.1 protein_id gnl|my_center|LOCUS_01610 48437 48934 gene locus_tag LOCUS_01620 48437 48934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 49498 50721 gene locus_tag LOCUS_01630 49498 50721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 51063 50800 gene locus_tag LOCUS_01640 51063 50800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 51458 51162 gene locus_tag LOCUS_01650 51458 51162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 51675 52712 gene locus_tag LOCUS_01660 51675 52712 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050496022.1 protein_id gnl|my_center|LOCUS_01660 54203 52725 gene locus_tag LOCUS_01670 54203 52725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 54669 56228 gene locus_tag LOCUS_01680 54669 56228 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_01680 56681 56950 gene locus_tag LOCUS_01690 56681 56950 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125586694.1 protein_id gnl|my_center|LOCUS_01690 56947 57207 gene locus_tag LOCUS_01700 56947 57207 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775363.1 protein_id gnl|my_center|LOCUS_01700 57854 58876 gene locus_tag LOCUS_01710 gene galE 57854 58876 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389959.1 protein_id gnl|my_center|LOCUS_01710 59334 59023 gene locus_tag LOCUS_01720 59334 59023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 59838 59341 gene locus_tag LOCUS_01730 59838 59341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 59948 61258 gene locus_tag LOCUS_01740 59948 61258 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367172.1 protein_id gnl|my_center|LOCUS_01740 61753 61391 gene locus_tag LOCUS_01750 61753 61391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 62271 62834 gene locus_tag LOCUS_01760 62271 62834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 62840 63652 gene locus_tag LOCUS_01770 62840 63652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 63826 65376 gene locus_tag LOCUS_01780 63826 65376 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_01780 65529 65942 gene locus_tag LOCUS_01790 65529 65942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 67216 66086 gene locus_tag LOCUS_01800 gene uxuA 67216 66086 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 protein_id gnl|my_center|LOCUS_01800 69004 67370 gene locus_tag LOCUS_01810 69004 67370 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129429.1 protein_id gnl|my_center|LOCUS_01810 70459 69041 gene locus_tag LOCUS_01820 gene uxaC 70459 69041 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777068.1 protein_id gnl|my_center|LOCUS_01820 70432 70596 gene locus_tag LOCUS_01830 70432 70596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 70700 71731 gene locus_tag LOCUS_01840 70700 71731 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 protein_id gnl|my_center|LOCUS_01840 71813 74599 gene locus_tag LOCUS_01850 71813 74599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 74773 77940 gene locus_tag LOCUS_01860 74773 77940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 78160 78927 gene locus_tag LOCUS_01870 78160 78927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 79139 81331 gene locus_tag LOCUS_01880 79139 81331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 82317 81460 gene locus_tag LOCUS_01890 82317 81460 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714088.1 protein_id gnl|my_center|LOCUS_01890 83363 82314 gene locus_tag LOCUS_01900 83363 82314 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068660.1 protein_id gnl|my_center|LOCUS_01900 83855 85480 gene locus_tag LOCUS_01910 83855 85480 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_01910 85627 86604 gene locus_tag LOCUS_01920 85627 86604 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_01920 86640 87596 gene locus_tag LOCUS_01930 86640 87596 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_01930 88048 89151 gene locus_tag LOCUS_01940 88048 89151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 89225 90385 gene locus_tag LOCUS_01950 89225 90385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 90563 92749 gene locus_tag LOCUS_01960 90563 92749 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_01960 92881 93939 gene locus_tag LOCUS_01970 92881 93939 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068660.1 protein_id gnl|my_center|LOCUS_01970 94373 94498 gene locus_tag LOCUS_01980 94373 94498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 94663 94589 gene locus_tag LOCUS_t00040 94663 94589 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 95412 94816 gene locus_tag LOCUS_01990 95412 94816 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890784.1 protein_id gnl|my_center|LOCUS_01990 95601 95891 gene locus_tag LOCUS_02000 95601 95891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 96039 97649 gene locus_tag LOCUS_02010 96039 97649 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931645.1 protein_id gnl|my_center|LOCUS_02010 99448 97967 gene locus_tag LOCUS_02020 99448 97967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068715.1 protein_id gnl|my_center|LOCUS_02020 100203 99445 gene locus_tag LOCUS_02030 100203 99445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 100543 101625 gene locus_tag LOCUS_02040 100543 101625 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003824238.1 protein_id gnl|my_center|LOCUS_02040 101841 101769 gene locus_tag LOCUS_t00050 101841 101769 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 102459 102372 gene locus_tag LOCUS_t00060 102459 102372 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 103199 102783 gene locus_tag LOCUS_02050 103199 102783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 103773 104333 gene locus_tag LOCUS_02060 103773 104333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 104682 106196 gene locus_tag LOCUS_02070 104682 106196 CDS product riboflavin deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820534.1 protein_id gnl|my_center|LOCUS_02070 106678 106199 gene locus_tag LOCUS_02080 gene rlmH 106678 106199 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811533.1 protein_id gnl|my_center|LOCUS_02080 107869 106691 gene locus_tag LOCUS_02090 gene glf 107869 106691 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068697.1 protein_id gnl|my_center|LOCUS_02090 109002 107989 gene locus_tag LOCUS_02100 109002 107989 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389491.1 protein_id gnl|my_center|LOCUS_02100 109203 109499 gene locus_tag LOCUS_02110 gene rpsF 109203 109499 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886572.1 protein_id gnl|my_center|LOCUS_02110 109548 110240 gene locus_tag LOCUS_02120 109548 110240 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068475.1 protein_id gnl|my_center|LOCUS_02120 110309 110557 gene locus_tag LOCUS_02130 gene rpsR 110309 110557 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051545.1 protein_id gnl|my_center|LOCUS_02130 110576 111022 gene locus_tag LOCUS_02140 gene rplI 110576 111022 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051544.1 protein_id gnl|my_center|LOCUS_02140 111278 111352 gene locus_tag LOCUS_t00070 111278 111352 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 111548 112861 gene locus_tag LOCUS_02150 111548 112861 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_02150 114104 112833 gene locus_tag LOCUS_02160 114104 112833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 114253 114501 gene locus_tag LOCUS_02170 114253 114501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 115184 115504 gene locus_tag LOCUS_02180 115184 115504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 115578 116168 gene locus_tag LOCUS_02190 115578 116168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 116156 116971 gene locus_tag LOCUS_02200 116156 116971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 117152 118432 gene locus_tag LOCUS_02210 117152 118432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 118488 118961 gene locus_tag LOCUS_02220 118488 118961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 122560 119027 gene locus_tag LOCUS_02230 122560 119027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 122690 122971 gene locus_tag LOCUS_02240 122690 122971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 123292 124023 gene locus_tag LOCUS_02250 123292 124023 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389498.1 protein_id gnl|my_center|LOCUS_02250 124256 125374 gene locus_tag LOCUS_02260 124256 125374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 >Feature sequence003 <1 1950 gene locus_tag LOCUS_02270 <1 1950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083312.1:FAD-binding protein 1985 2830 gene locus_tag LOCUS_02280 1985 2830 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728493.1 protein_id gnl|my_center|LOCUS_02280 2966 3496 gene locus_tag LOCUS_02290 2966 3496 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390305.1 protein_id gnl|my_center|LOCUS_02290 3826 5724 gene locus_tag LOCUS_02300 3826 5724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814218.1 protein_id gnl|my_center|LOCUS_02300 5726 7594 gene locus_tag LOCUS_02310 5726 7594 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143606.1 protein_id gnl|my_center|LOCUS_02310 7910 8860 gene locus_tag LOCUS_02320 7910 8860 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068342.1 protein_id gnl|my_center|LOCUS_02320 9829 11085 gene locus_tag LOCUS_02330 9829 11085 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390139.1 protein_id gnl|my_center|LOCUS_02330 12154 11153 gene locus_tag LOCUS_02340 12154 11153 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674791.1 protein_id gnl|my_center|LOCUS_02340 13458 12229 gene locus_tag LOCUS_02350 13458 12229 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286869.1 protein_id gnl|my_center|LOCUS_02350 14613 13522 gene locus_tag LOCUS_02360 14613 13522 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102058.1 protein_id gnl|my_center|LOCUS_02360 15738 14809 gene locus_tag LOCUS_02370 15738 14809 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227879.1 protein_id gnl|my_center|LOCUS_02370 16571 15792 gene locus_tag LOCUS_02380 16571 15792 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235787673.1 protein_id gnl|my_center|LOCUS_02380 17301 16621 gene locus_tag LOCUS_02390 17301 16621 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293786.1 protein_id gnl|my_center|LOCUS_02390 18347 17298 gene locus_tag LOCUS_02400 18347 17298 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296186.1 protein_id gnl|my_center|LOCUS_02400 18742 19635 gene locus_tag LOCUS_02410 18742 19635 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390147.1 protein_id gnl|my_center|LOCUS_02410 19808 21115 gene locus_tag LOCUS_02420 19808 21115 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390138.1 protein_id gnl|my_center|LOCUS_02420 21481 21630 gene locus_tag LOCUS_02430 21481 21630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 21737 26182 gene locus_tag LOCUS_02440 21737 26182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 26331 28340 gene locus_tag LOCUS_02450 26331 28340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 28571 29158 gene locus_tag LOCUS_02460 28571 29158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 29268 30137 gene locus_tag LOCUS_02470 29268 30137 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389614.1 protein_id gnl|my_center|LOCUS_02470 30567 30259 gene locus_tag LOCUS_02480 30567 30259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 31628 30651 gene locus_tag LOCUS_02490 31628 30651 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582853.1 protein_id gnl|my_center|LOCUS_02490 32613 31675 gene locus_tag LOCUS_02500 32613 31675 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390137.1 protein_id gnl|my_center|LOCUS_02500 33814 33020 gene locus_tag LOCUS_02510 gene murI 33814 33020 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053283.1 protein_id gnl|my_center|LOCUS_02510 33895 34794 gene locus_tag LOCUS_02520 gene dapF 33895 34794 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054039.1 protein_id gnl|my_center|LOCUS_02520 35490 34822 gene locus_tag LOCUS_02530 35490 34822 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389616.1 protein_id gnl|my_center|LOCUS_02530 35818 36702 gene locus_tag LOCUS_02540 35818 36702 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054041.1 protein_id gnl|my_center|LOCUS_02540 37007 36783 gene locus_tag LOCUS_02550 37007 36783 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821409.1 protein_id gnl|my_center|LOCUS_02550 39017 37119 gene locus_tag LOCUS_02560 39017 37119 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389618.1 protein_id gnl|my_center|LOCUS_02560 39206 40762 gene locus_tag LOCUS_02570 39206 40762 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067953.1 protein_id gnl|my_center|LOCUS_02570 42461 40842 gene locus_tag LOCUS_02580 42461 40842 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389620.1 protein_id gnl|my_center|LOCUS_02580 42526 43479 gene locus_tag LOCUS_02590 42526 43479 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389621.1 protein_id gnl|my_center|LOCUS_02590 43562 43978 gene locus_tag LOCUS_02600 43562 43978 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053292.1 protein_id gnl|my_center|LOCUS_02600 44138 44063 gene locus_tag LOCUS_t00080 44138 44063 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 44320 45804 gene locus_tag LOCUS_02610 44320 45804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 45801 46988 gene locus_tag LOCUS_02620 gene dxr 45801 46988 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389635.1 protein_id gnl|my_center|LOCUS_02620 47017 48300 gene locus_tag LOCUS_02630 gene ispG 47017 48300 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054049.1 protein_id gnl|my_center|LOCUS_02630 48366 50027 gene locus_tag LOCUS_02640 48366 50027 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143274.1 protein_id gnl|my_center|LOCUS_02640 50092 50880 gene locus_tag LOCUS_02650 gene recO 50092 50880 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055411.1 protein_id gnl|my_center|LOCUS_02650 50826 51677 gene locus_tag LOCUS_02660 50826 51677 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055433.1 protein_id gnl|my_center|LOCUS_02660 53486 51909 gene locus_tag LOCUS_02670 53486 51909 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782652.1 protein_id gnl|my_center|LOCUS_02670 55085 53748 gene locus_tag LOCUS_02680 55085 53748 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067958.1 protein_id gnl|my_center|LOCUS_02680 56657 55623 gene locus_tag LOCUS_02690 56657 55623 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067959.1 protein_id gnl|my_center|LOCUS_02690 57179 56895 gene locus_tag LOCUS_02700 57179 56895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 57105 58544 gene locus_tag LOCUS_02710 57105 58544 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217063484.1 protein_id gnl|my_center|LOCUS_02710 58653 60098 gene locus_tag LOCUS_02720 58653 60098 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068360.1 protein_id gnl|my_center|LOCUS_02720 60095 61408 gene locus_tag LOCUS_02730 60095 61408 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969120.1 protein_id gnl|my_center|LOCUS_02730 61405 63279 gene locus_tag LOCUS_02740 61405 63279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 63276 64460 gene locus_tag LOCUS_02750 63276 64460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 64457 65059 gene locus_tag LOCUS_02760 64457 65059 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942604.1 protein_id gnl|my_center|LOCUS_02760 65056 66369 gene locus_tag LOCUS_02770 65056 66369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 66380 67513 gene locus_tag LOCUS_02780 66380 67513 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267353.1 protein_id gnl|my_center|LOCUS_02780 67562 68575 gene locus_tag LOCUS_02790 67562 68575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 68572 69573 gene locus_tag LOCUS_02800 68572 69573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 69608 70600 gene locus_tag LOCUS_02810 69608 70600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 70605 72125 gene locus_tag LOCUS_02820 70605 72125 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573158.1 protein_id gnl|my_center|LOCUS_02820 72172 73056 gene locus_tag LOCUS_02830 72172 73056 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476417.1 protein_id gnl|my_center|LOCUS_02830 73043 74209 gene locus_tag LOCUS_02840 73043 74209 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480862.1 protein_id gnl|my_center|LOCUS_02840 74425 74243 gene locus_tag LOCUS_02850 74425 74243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 74730 76238 gene locus_tag LOCUS_02860 74730 76238 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_02860 76536 77303 gene locus_tag LOCUS_02870 76536 77303 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053237.1 protein_id gnl|my_center|LOCUS_02870 77459 78700 gene locus_tag LOCUS_02880 77459 78700 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054004.1 protein_id gnl|my_center|LOCUS_02880 79639 78833 gene locus_tag LOCUS_02890 79639 78833 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389735.1 protein_id gnl|my_center|LOCUS_02890 81392 79716 gene locus_tag LOCUS_02900 81392 79716 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094796.1 protein_id gnl|my_center|LOCUS_02900 83878 81566 gene locus_tag LOCUS_02910 83878 81566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410302.1 protein_id gnl|my_center|LOCUS_02910 83929 87591 gene locus_tag LOCUS_02920 83929 87591 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582850.1 protein_id gnl|my_center|LOCUS_02920 87689 90430 gene locus_tag LOCUS_02930 gene ligA 87689 90430 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389738.1 protein_id gnl|my_center|LOCUS_02930 90564 91679 gene locus_tag LOCUS_02940 90564 91679 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054010.1 protein_id gnl|my_center|LOCUS_02940 92474 92184 gene locus_tag LOCUS_02950 92474 92184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 92841 94028 gene locus_tag LOCUS_02960 92841 94028 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110228.1 protein_id gnl|my_center|LOCUS_02960 94275 94111 gene locus_tag LOCUS_02970 94275 94111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 94669 94992 gene locus_tag LOCUS_02980 94669 94992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 94994 95191 gene locus_tag LOCUS_02990 94994 95191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 95267 96664 gene locus_tag LOCUS_03000 95267 96664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 97674 96730 gene locus_tag LOCUS_03010 97674 96730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 >Feature sequence004 272 520 gene locus_tag LOCUS_03020 272 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 520 702 gene locus_tag LOCUS_03030 520 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 999 811 gene locus_tag LOCUS_03040 999 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 1091 1279 gene locus_tag LOCUS_03050 1091 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 1276 1542 gene locus_tag LOCUS_03060 1276 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 1866 2066 gene locus_tag LOCUS_03070 1866 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 2128 2661 gene locus_tag LOCUS_03080 2128 2661 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068475.1 protein_id gnl|my_center|LOCUS_03080 2695 3186 gene locus_tag LOCUS_03090 2695 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 3159 3413 gene locus_tag LOCUS_03100 3159 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 3410 3604 gene locus_tag LOCUS_03110 3410 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 3601 4593 gene locus_tag LOCUS_03120 3601 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 4630 4992 gene locus_tag LOCUS_03130 4630 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 4989 5135 gene locus_tag LOCUS_03140 4989 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 5132 5500 gene locus_tag LOCUS_03150 5132 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813016.1 protein_id gnl|my_center|LOCUS_03150 5497 6123 gene locus_tag LOCUS_03160 5497 6123 CDS product oligoribonuclease Orn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820462.1 protein_id gnl|my_center|LOCUS_03160 6120 6494 gene locus_tag LOCUS_03170 6120 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 6491 6796 gene locus_tag LOCUS_03180 6491 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 6990 7166 gene locus_tag LOCUS_03190 6990 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 7163 7618 gene locus_tag LOCUS_03200 7163 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 7600 7878 gene locus_tag LOCUS_03210 7600 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813023.1 protein_id gnl|my_center|LOCUS_03210 7868 8065 gene locus_tag LOCUS_03220 7868 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 8149 8892 gene locus_tag LOCUS_03230 8149 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 9053 9143 gene locus_tag LOCUS_t00090 9053 9143 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9359 9682 gene locus_tag LOCUS_03240 9359 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 9818 10249 gene locus_tag LOCUS_03250 9818 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 10227 11660 gene locus_tag LOCUS_03260 10227 11660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 11660 13174 gene locus_tag LOCUS_03270 11660 13174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 13089 14780 gene locus_tag LOCUS_03280 13089 14780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 14780 15031 gene locus_tag LOCUS_03290 14780 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 15123 15602 gene locus_tag LOCUS_03300 15123 15602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 15648 16589 gene locus_tag LOCUS_03310 15648 16589 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922461.1 protein_id gnl|my_center|LOCUS_03310 16589 17080 gene locus_tag LOCUS_03320 16589 17080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 17173 17424 gene locus_tag LOCUS_03330 17173 17424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 17437 17832 gene locus_tag LOCUS_03340 17437 17832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 17829 18167 gene locus_tag LOCUS_03350 17829 18167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 18171 18449 gene locus_tag LOCUS_03360 18171 18449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 18449 18832 gene locus_tag LOCUS_03370 18449 18832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 18844 19422 gene locus_tag LOCUS_03380 18844 19422 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226354.1 protein_id gnl|my_center|LOCUS_03380 19532 19870 gene locus_tag LOCUS_03390 19532 19870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 19918 20319 gene locus_tag LOCUS_03400 19918 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 20335 23196 gene locus_tag LOCUS_03410 20335 23196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 23208 24173 gene locus_tag LOCUS_03420 23208 24173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 24187 28908 gene locus_tag LOCUS_03430 24187 28908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 28927 29316 gene locus_tag LOCUS_03440 28927 29316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 29330 29485 gene locus_tag LOCUS_03450 29330 29485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 29562 30140 gene locus_tag LOCUS_03460 29562 30140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 30149 30577 gene locus_tag LOCUS_03470 30149 30577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 30600 31175 gene locus_tag LOCUS_03480 30600 31175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 31172 31696 gene locus_tag LOCUS_03490 31172 31696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 31722 32111 gene locus_tag LOCUS_03500 31722 32111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 32131 32565 gene locus_tag LOCUS_03510 32131 32565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 32578 33018 gene locus_tag LOCUS_03520 32578 33018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 33021 33842 gene locus_tag LOCUS_03530 33021 33842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 34271 33930 gene locus_tag LOCUS_03540 34271 33930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 34544 34470 gene locus_tag LOCUS_t00100 34544 34470 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 37151 35016 gene locus_tag LOCUS_03550 gene der 37151 35016 CDS product bifunctional cytidylate kinase/GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389933.1 protein_id gnl|my_center|LOCUS_03550 37924 37148 gene locus_tag LOCUS_03560 37924 37148 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052866.1 protein_id gnl|my_center|LOCUS_03560 38207 39229 gene locus_tag LOCUS_03570 38207 39229 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052865.1 protein_id gnl|my_center|LOCUS_03570 39430 39146 gene locus_tag LOCUS_03580 39430 39146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813210.1 protein_id gnl|my_center|LOCUS_03580 41139 39508 gene locus_tag LOCUS_03590 gene purH 41139 39508 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389934.1 protein_id gnl|my_center|LOCUS_03590 42475 41087 gene locus_tag LOCUS_03600 42475 41087 CDS product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052863.1 protein_id gnl|my_center|LOCUS_03600 43401 42472 gene locus_tag LOCUS_03610 gene sucD 43401 42472 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389936.1 protein_id gnl|my_center|LOCUS_03610 44594 43401 gene locus_tag LOCUS_03620 gene sucC 44594 43401 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052861.1 protein_id gnl|my_center|LOCUS_03620 45248 44667 gene locus_tag LOCUS_03630 45248 44667 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068112.1 protein_id gnl|my_center|LOCUS_03630 45734 45318 gene locus_tag LOCUS_03640 45734 45318 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052859.1 protein_id gnl|my_center|LOCUS_03640 46869 45814 gene locus_tag LOCUS_03650 gene ruvB 46869 45814 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054282.1 protein_id gnl|my_center|LOCUS_03650 47512 46889 gene locus_tag LOCUS_03660 gene ruvA 47512 46889 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817463.1 protein_id gnl|my_center|LOCUS_03660 48210 47623 gene locus_tag LOCUS_03670 gene ruvC 48210 47623 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052856.1 protein_id gnl|my_center|LOCUS_03670 48973 48218 gene locus_tag LOCUS_03680 48973 48218 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813232.1 protein_id gnl|my_center|LOCUS_03680 51175 49130 gene locus_tag LOCUS_03690 gene thrS 51175 49130 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389942.1 protein_id gnl|my_center|LOCUS_03690 51441 51367 gene locus_tag LOCUS_t00110 51441 51367 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 51545 51472 gene locus_tag LOCUS_t00120 51545 51472 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 51638 51565 gene locus_tag LOCUS_t00130 51638 51565 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 51739 51667 gene locus_tag LOCUS_t00140 51739 51667 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 51850 51779 gene locus_tag LOCUS_t00150 51850 51779 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 51952 51879 gene locus_tag LOCUS_t00160 51952 51879 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 52126 52956 gene locus_tag LOCUS_03700 52126 52956 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813243.1 protein_id gnl|my_center|LOCUS_03700 53969 53064 gene locus_tag LOCUS_03710 gene uppP 53969 53064 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813246.1 protein_id gnl|my_center|LOCUS_03710 54123 54911 gene locus_tag LOCUS_03720 54123 54911 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817478.1 protein_id gnl|my_center|LOCUS_03720 55598 54957 gene locus_tag LOCUS_03730 55598 54957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054242.1 protein_id gnl|my_center|LOCUS_03730 56471 55743 gene locus_tag LOCUS_03740 56471 55743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 57357 56719 gene locus_tag LOCUS_03750 gene cysE 57357 56719 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929921.1 protein_id gnl|my_center|LOCUS_03750 58948 57458 gene locus_tag LOCUS_03760 58948 57458 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028661.1 protein_id gnl|my_center|LOCUS_03760 60429 59185 gene locus_tag LOCUS_03770 60429 59185 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222229.1 protein_id gnl|my_center|LOCUS_03770 60505 61509 gene locus_tag LOCUS_03780 60505 61509 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328117.1 protein_id gnl|my_center|LOCUS_03780 62809 61655 gene locus_tag LOCUS_03790 gene dnaJ 62809 61655 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052794.1 protein_id gnl|my_center|LOCUS_03790 64033 62861 gene locus_tag LOCUS_03800 gene hrcA 64033 62861 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068110.1 protein_id gnl|my_center|LOCUS_03800 64399 66501 gene locus_tag LOCUS_03810 gene tkt 64399 66501 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389947.1 protein_id gnl|my_center|LOCUS_03810 66601 67704 gene locus_tag LOCUS_03820 gene tal 66601 67704 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054288.1 protein_id gnl|my_center|LOCUS_03820 67908 69296 gene locus_tag LOCUS_03830 gene brnQ 67908 69296 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056806.1 protein_id gnl|my_center|LOCUS_03830 70671 69307 gene locus_tag LOCUS_03840 70671 69307 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389949.1 protein_id gnl|my_center|LOCUS_03840 71538 70780 gene locus_tag LOCUS_03850 71538 70780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068153.1 protein_id gnl|my_center|LOCUS_03850 72854 71649 gene locus_tag LOCUS_03860 gene rlmN 72854 71649 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068098.1 protein_id gnl|my_center|LOCUS_03860 73895 72909 gene locus_tag LOCUS_03870 73895 72909 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052757.1 protein_id gnl|my_center|LOCUS_03870 74587 74033 gene locus_tag LOCUS_03880 gene frr 74587 74033 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052756.1 protein_id gnl|my_center|LOCUS_03880 75421 74681 gene locus_tag LOCUS_03890 gene pyrH 75421 74681 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813336.1 protein_id gnl|my_center|LOCUS_03890 76281 75580 gene locus_tag LOCUS_03900 76281 75580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816512.1 protein_id gnl|my_center|LOCUS_03900 77416 76559 gene locus_tag LOCUS_03910 gene tsf 77416 76559 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813341.1 protein_id gnl|my_center|LOCUS_03910 78330 77491 gene locus_tag LOCUS_03920 gene rpsB 78330 77491 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056702.1 protein_id gnl|my_center|LOCUS_03920 79107 78619 gene locus_tag LOCUS_03930 gene def 79107 78619 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052751.1 protein_id gnl|my_center|LOCUS_03930 81197 79110 gene locus_tag LOCUS_03940 81197 79110 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389965.1 protein_id gnl|my_center|LOCUS_03940 81738 81253 gene locus_tag LOCUS_03950 81738 81253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816504.1 protein_id gnl|my_center|LOCUS_03950 83009 81912 gene locus_tag LOCUS_03960 83009 81912 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052748.1 protein_id gnl|my_center|LOCUS_03960 83148 84368 gene locus_tag LOCUS_03970 83148 84368 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813356.1 protein_id gnl|my_center|LOCUS_03970 84540 86093 gene locus_tag LOCUS_03980 84540 86093 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389967.1 protein_id gnl|my_center|LOCUS_03980 86287 86754 gene locus_tag LOCUS_03990 86287 86754 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813644.1 protein_id gnl|my_center|LOCUS_03990 86754 88286 gene locus_tag LOCUS_04000 86754 88286 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052067.1 protein_id gnl|my_center|LOCUS_04000 88283 89707 gene locus_tag LOCUS_04010 88283 89707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 90143 89799 gene locus_tag LOCUS_04020 90143 89799 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_04020 90229 92157 gene locus_tag LOCUS_04030 90229 92157 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414641.1 protein_id gnl|my_center|LOCUS_04030 92254 93195 gene locus_tag LOCUS_04040 92254 93195 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390058.1 protein_id gnl|my_center|LOCUS_04040 93240 93911 gene locus_tag LOCUS_04050 93240 93911 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390059.1 protein_id gnl|my_center|LOCUS_04050 94752 93925 gene locus_tag LOCUS_04060 94752 93925 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390060.1 protein_id gnl|my_center|LOCUS_04060 96004 94739 gene locus_tag LOCUS_04070 96004 94739 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068211.1 protein_id gnl|my_center|LOCUS_04070 96246 96172 gene locus_tag LOCUS_t00170 96246 96172 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 96354 96280 gene locus_tag LOCUS_t00180 96354 96280 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence005 2087 33 gene locus_tag LOCUS_04080 2087 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 2881 2372 gene locus_tag LOCUS_04090 2881 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065439155.1 protein_id gnl|my_center|LOCUS_04090 3491 3273 gene locus_tag LOCUS_04100 3491 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3376 3981 gene locus_tag LOCUS_04110 3376 3981 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389733.1 protein_id gnl|my_center|LOCUS_04110 4062 6899 gene locus_tag LOCUS_04120 4062 6899 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812574.1 protein_id gnl|my_center|LOCUS_04120 8077 7211 gene locus_tag LOCUS_04130 gene tenA 8077 7211 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171842511.1 protein_id gnl|my_center|LOCUS_04130 8791 9567 gene locus_tag LOCUS_04140 8791 9567 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390367.1 protein_id gnl|my_center|LOCUS_04140 10029 10838 gene locus_tag LOCUS_04150 10029 10838 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814840.1 protein_id gnl|my_center|LOCUS_04150 12505 10955 gene locus_tag LOCUS_04160 12505 10955 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389731.1 protein_id gnl|my_center|LOCUS_04160 13938 12892 gene locus_tag LOCUS_04170 13938 12892 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053225.1 protein_id gnl|my_center|LOCUS_04170 15032 13935 gene locus_tag LOCUS_04180 15032 13935 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053224.1 protein_id gnl|my_center|LOCUS_04180 16572 15034 gene locus_tag LOCUS_04190 16572 15034 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053223.1 protein_id gnl|my_center|LOCUS_04190 17798 16737 gene locus_tag LOCUS_04200 17798 16737 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053222.1 protein_id gnl|my_center|LOCUS_04200 19722 17932 gene locus_tag LOCUS_04210 19722 17932 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067925.1 protein_id gnl|my_center|LOCUS_04210 21677 19848 gene locus_tag LOCUS_04220 gene mtrB 21677 19848 CDS product MtrAB system histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067924.1 protein_id gnl|my_center|LOCUS_04220 22543 21752 gene locus_tag LOCUS_04230 gene mtrA 22543 21752 CDS product MtrAB system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067923.1 protein_id gnl|my_center|LOCUS_04230 24116 22749 gene locus_tag LOCUS_04240 24116 22749 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389730.1 protein_id gnl|my_center|LOCUS_04240 26020 26544 gene locus_tag LOCUS_04250 26020 26544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04250 26546 27436 gene locus_tag LOCUS_04260 26546 27436 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339156.1 protein_id gnl|my_center|LOCUS_04260 27439 28410 gene locus_tag LOCUS_04270 27439 28410 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085654.1 protein_id gnl|my_center|LOCUS_04270 28412 29347 gene locus_tag LOCUS_04280 28412 29347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105043.1 protein_id gnl|my_center|LOCUS_04280 29387 30958 gene locus_tag LOCUS_04290 29387 30958 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339154.1 protein_id gnl|my_center|LOCUS_04290 31040 32635 gene locus_tag LOCUS_04300 31040 32635 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803973.1 protein_id gnl|my_center|LOCUS_04300 32730 32984 gene locus_tag LOCUS_04310 32730 32984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 35569 33011 gene locus_tag LOCUS_04320 35569 33011 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389729.1 protein_id gnl|my_center|LOCUS_04320 36832 35774 gene locus_tag LOCUS_04330 36832 35774 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812567.1 protein_id gnl|my_center|LOCUS_04330 38215 37259 gene locus_tag LOCUS_04340 38215 37259 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_04340 38679 38251 gene locus_tag LOCUS_04350 38679 38251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 38751 39071 gene locus_tag LOCUS_04360 38751 39071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04360 39068 40000 gene locus_tag LOCUS_04370 39068 40000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04370 40467 40018 gene locus_tag LOCUS_04380 40467 40018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 40914 41957 gene locus_tag LOCUS_04390 40914 41957 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068660.1 protein_id gnl|my_center|LOCUS_04390 43719 42121 gene locus_tag LOCUS_04400 43719 42121 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_04400 45987 44203 gene locus_tag LOCUS_04410 45987 44203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285995.1 protein_id gnl|my_center|LOCUS_04410 47103 46087 gene locus_tag LOCUS_04420 47103 46087 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797938.1 protein_id gnl|my_center|LOCUS_04420 47428 47183 gene locus_tag LOCUS_04430 47428 47183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 47565 49136 gene locus_tag LOCUS_04440 47565 49136 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286004.1 protein_id gnl|my_center|LOCUS_04440 49280 50833 gene locus_tag LOCUS_04450 49280 50833 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286002.1 protein_id gnl|my_center|LOCUS_04450 50922 51473 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaaaccaacggacctccaccgcattaccccgc 53024 51615 gene locus_tag LOCUS_04460 gene uxaC 53024 51615 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303177.1 protein_id gnl|my_center|LOCUS_04460 54239 53211 gene locus_tag LOCUS_04470 54239 53211 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 protein_id gnl|my_center|LOCUS_04470 54460 55488 gene locus_tag LOCUS_04480 54460 55488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 55633 57165 gene locus_tag LOCUS_04490 55633 57165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 58643 57348 gene locus_tag LOCUS_04500 58643 57348 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067917.1 protein_id gnl|my_center|LOCUS_04500 59327 58650 gene locus_tag LOCUS_04510 59327 58650 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053211.1 protein_id gnl|my_center|LOCUS_04510 60165 59329 gene locus_tag LOCUS_04520 60165 59329 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363315.1 protein_id gnl|my_center|LOCUS_04520 60994 60230 gene locus_tag LOCUS_04530 60994 60230 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162094060.1 protein_id gnl|my_center|LOCUS_04530 61709 61158 gene locus_tag LOCUS_04540 61709 61158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 63210 61846 gene locus_tag LOCUS_04550 63210 61846 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_04550 65792 63279 gene locus_tag LOCUS_04560 65792 63279 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_04560 66016 67212 gene locus_tag LOCUS_04570 66016 67212 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101954.1 protein_id gnl|my_center|LOCUS_04570 68365 67322 gene locus_tag LOCUS_04580 68365 67322 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053640.1 protein_id gnl|my_center|LOCUS_04580 69197 68508 gene locus_tag LOCUS_04590 69197 68508 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057155.1 protein_id gnl|my_center|LOCUS_04590 69410 70990 gene locus_tag LOCUS_04600 69410 70990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352237.1 protein_id gnl|my_center|LOCUS_04600 71125 71973 gene locus_tag LOCUS_04610 71125 71973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 72806 72339 gene locus_tag LOCUS_04620 72806 72339 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051407.1 protein_id gnl|my_center|LOCUS_04620 75050 72810 gene locus_tag LOCUS_04630 75050 72810 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389826.1 protein_id gnl|my_center|LOCUS_04630 75314 77149 gene locus_tag LOCUS_04640 gene ilvD 75314 77149 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389701.1 protein_id gnl|my_center|LOCUS_04640 79139 77310 gene locus_tag LOCUS_04650 79139 77310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 82522 79136 gene locus_tag LOCUS_04660 gene carB 82522 79136 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363691.1 protein_id gnl|my_center|LOCUS_04660 83672 82515 gene locus_tag LOCUS_04670 gene carA 83672 82515 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819349.1 protein_id gnl|my_center|LOCUS_04670 84374 83838 gene locus_tag LOCUS_04680 gene nusB 84374 83838 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819348.1 protein_id gnl|my_center|LOCUS_04680 84986 84420 gene locus_tag LOCUS_04690 gene efp 84986 84420 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813823.1 protein_id gnl|my_center|LOCUS_04690 86384 85185 gene locus_tag LOCUS_04700 gene tuf 86384 85185 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815489.1 protein_id gnl|my_center|LOCUS_04700 88688 86559 gene locus_tag LOCUS_04710 gene fusA 88688 86559 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813832.1 protein_id gnl|my_center|LOCUS_04710 89189 88719 gene locus_tag LOCUS_04720 gene rpsG 89189 88719 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813834.1 protein_id gnl|my_center|LOCUS_04720 89566 89195 gene locus_tag LOCUS_04730 gene rpsL 89566 89195 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813881.1 protein_id gnl|my_center|LOCUS_04730 89989 89914 gene locus_tag LOCUS_t00190 89989 89914 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence006 <1 506 gene locus_tag LOCUS_04740 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068756.1:phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) 2139 1147 gene locus_tag LOCUS_04750 2139 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 2759 2481 gene locus_tag LOCUS_04760 2759 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 2975 4072 gene locus_tag LOCUS_04770 2975 4072 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390211.1 protein_id gnl|my_center|LOCUS_04770 4199 4897 gene locus_tag LOCUS_04780 gene rpiA 4199 4897 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814612.1 protein_id gnl|my_center|LOCUS_04780 5965 5303 gene locus_tag LOCUS_04790 5965 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052313.1 protein_id gnl|my_center|LOCUS_04790 6206 6033 gene locus_tag LOCUS_04800 6206 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 6205 7731 gene locus_tag LOCUS_04810 6205 7731 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055359.1 protein_id gnl|my_center|LOCUS_04810 7990 9585 gene locus_tag LOCUS_04820 7990 9585 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783579.1 protein_id gnl|my_center|LOCUS_04820 9791 11134 gene locus_tag LOCUS_04830 9791 11134 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051223.1 protein_id gnl|my_center|LOCUS_04830 11445 11993 gene locus_tag LOCUS_04840 11445 11993 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051224.1 protein_id gnl|my_center|LOCUS_04840 12203 13075 gene locus_tag LOCUS_04850 12203 13075 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053658.1 protein_id gnl|my_center|LOCUS_04850 13214 14104 gene locus_tag LOCUS_04860 13214 14104 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053659.1 protein_id gnl|my_center|LOCUS_04860 14101 14937 gene locus_tag LOCUS_04870 14101 14937 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051227.1 protein_id gnl|my_center|LOCUS_04870 16501 15221 gene locus_tag LOCUS_04880 16501 15221 CDS product riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003823255.1 protein_id gnl|my_center|LOCUS_04880 18041 16920 gene locus_tag LOCUS_04890 18041 16920 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068748.1 protein_id gnl|my_center|LOCUS_04890 18676 18125 gene locus_tag LOCUS_04900 18676 18125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 21818 18798 gene locus_tag LOCUS_04910 gene infB 21818 18798 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390214.1 protein_id gnl|my_center|LOCUS_04910 23108 22083 gene locus_tag LOCUS_04920 gene nusA 23108 22083 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815687.1 protein_id gnl|my_center|LOCUS_04920 23210 24226 gene locus_tag LOCUS_04930 23210 24226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582922.1 protein_id gnl|my_center|LOCUS_04930 25784 24234 gene locus_tag LOCUS_04940 25784 24234 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068745.1 protein_id gnl|my_center|LOCUS_04940 26165 26077 gene locus_tag LOCUS_t00200 26165 26077 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27195 26395 gene locus_tag LOCUS_04950 27195 26395 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814594.1 protein_id gnl|my_center|LOCUS_04950 29495 27303 gene locus_tag LOCUS_04960 29495 27303 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390215.1 protein_id gnl|my_center|LOCUS_04960 30609 29686 gene locus_tag LOCUS_04970 30609 29686 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022173241.1 protein_id gnl|my_center|LOCUS_04970 31265 30789 gene locus_tag LOCUS_04980 31265 30789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 32348 31353 gene locus_tag LOCUS_04990 32348 31353 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053048.1 protein_id gnl|my_center|LOCUS_04990 32834 32433 gene locus_tag LOCUS_05000 gene rpsK 32834 32433 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105468.1 protein_id gnl|my_center|LOCUS_05000 33300 32923 gene locus_tag LOCUS_05010 gene rpsM 33300 32923 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808138.1 protein_id gnl|my_center|LOCUS_05010 33803 33585 gene locus_tag LOCUS_05020 gene infA 33803 33585 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808114.1 protein_id gnl|my_center|LOCUS_05020 34523 33960 gene locus_tag LOCUS_05030 34523 33960 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815675.1 protein_id gnl|my_center|LOCUS_05030 36051 34714 gene locus_tag LOCUS_05040 gene secY 36051 34714 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053045.1 protein_id gnl|my_center|LOCUS_05040 36788 36330 gene locus_tag LOCUS_05050 gene rplO 36788 36330 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114381.1 protein_id gnl|my_center|LOCUS_05050 36973 36791 gene locus_tag LOCUS_05060 gene rpmD 36973 36791 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814541.1 protein_id gnl|my_center|LOCUS_05060 37711 36977 gene locus_tag LOCUS_05070 gene rpsE 37711 36977 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815670.1 protein_id gnl|my_center|LOCUS_05070 38079 37708 gene locus_tag LOCUS_05080 gene rplR 38079 37708 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053041.1 protein_id gnl|my_center|LOCUS_05080 38620 38081 gene locus_tag LOCUS_05090 gene rplF 38620 38081 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114374.1 protein_id gnl|my_center|LOCUS_05090 39036 38638 gene locus_tag LOCUS_05100 gene rpsH 39036 38638 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829896.1 protein_id gnl|my_center|LOCUS_05100 39312 39127 gene locus_tag LOCUS_05110 39312 39127 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114370.1 protein_id gnl|my_center|LOCUS_05110 39886 39314 gene locus_tag LOCUS_05120 gene rplE 39886 39314 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814525.1 protein_id gnl|my_center|LOCUS_05120 40218 39883 gene locus_tag LOCUS_05130 gene rplX 40218 39883 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114367.1 protein_id gnl|my_center|LOCUS_05130 40588 40220 gene locus_tag LOCUS_05140 gene rplN 40588 40220 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814521.1 protein_id gnl|my_center|LOCUS_05140 40940 40680 gene locus_tag LOCUS_05150 gene rpsQ 40940 40680 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055338.1 protein_id gnl|my_center|LOCUS_05150 41197 40940 gene locus_tag LOCUS_05160 gene rpmC 41197 40940 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814517.1 protein_id gnl|my_center|LOCUS_05160 41616 41197 gene locus_tag LOCUS_05170 gene rplP 41616 41197 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814515.1 protein_id gnl|my_center|LOCUS_05170 42430 41621 gene locus_tag LOCUS_05180 gene rpsC 42430 41621 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814512.1 protein_id gnl|my_center|LOCUS_05180 42792 42433 gene locus_tag LOCUS_05190 gene rplV 42792 42433 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053035.1 protein_id gnl|my_center|LOCUS_05190 43088 42810 gene locus_tag LOCUS_05200 gene rpsS 43088 42810 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814508.1 protein_id gnl|my_center|LOCUS_05200 43934 43104 gene locus_tag LOCUS_05210 gene rplB 43934 43104 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814500.1 protein_id gnl|my_center|LOCUS_05210 44267 43971 gene locus_tag LOCUS_05220 gene rplW 44267 43971 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814498.1 protein_id gnl|my_center|LOCUS_05220 44938 44273 gene locus_tag LOCUS_05230 gene rplD 44938 44273 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815665.1 protein_id gnl|my_center|LOCUS_05230 45600 44953 gene locus_tag LOCUS_05240 gene rplC 45600 44953 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814493.1 protein_id gnl|my_center|LOCUS_05240 45926 45618 gene locus_tag LOCUS_05250 gene rpsJ 45926 45618 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808013.1 protein_id gnl|my_center|LOCUS_05250 47100 46333 gene locus_tag LOCUS_05260 gene budA 47100 46333 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390224.1 protein_id gnl|my_center|LOCUS_05260 48303 47362 gene locus_tag LOCUS_05270 48303 47362 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051923104.1 protein_id gnl|my_center|LOCUS_05270 48758 49621 gene locus_tag LOCUS_05280 48758 49621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 53245 50513 gene locus_tag LOCUS_05290 gene adhE 53245 50513 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363862.1 protein_id gnl|my_center|LOCUS_05290 53659 54966 gene locus_tag LOCUS_05300 53659 54966 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068741.1 protein_id gnl|my_center|LOCUS_05300 55106 57763 gene locus_tag LOCUS_05310 gene glgX 55106 57763 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814482.1 protein_id gnl|my_center|LOCUS_05310 58810 57785 gene locus_tag LOCUS_05320 58810 57785 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112255.1 protein_id gnl|my_center|LOCUS_05320 61360 59048 gene locus_tag LOCUS_05330 61360 59048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 61465 61773 gene locus_tag LOCUS_05340 61465 61773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 62993 61680 gene locus_tag LOCUS_05350 62993 61680 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776937.1 protein_id gnl|my_center|LOCUS_05350 64109 63156 gene locus_tag LOCUS_05360 64109 63156 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776935.1 protein_id gnl|my_center|LOCUS_05360 65034 64102 gene locus_tag LOCUS_05370 65034 64102 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776936.1 protein_id gnl|my_center|LOCUS_05370 67939 66794 gene locus_tag LOCUS_05380 67939 66794 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112255.1 protein_id gnl|my_center|LOCUS_05380 68432 70000 gene locus_tag LOCUS_05390 68432 70000 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775818.1 protein_id gnl|my_center|LOCUS_05390 70151 72058 gene locus_tag LOCUS_05400 70151 72058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 72253 72543 gene locus_tag LOCUS_05410 72253 72543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 72540 74360 gene locus_tag LOCUS_05420 72540 74360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 74996 74505 gene locus_tag LOCUS_05430 gene rpsI 74996 74505 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814481.1 protein_id gnl|my_center|LOCUS_05430 75467 75018 gene locus_tag LOCUS_05440 gene rplM 75467 75018 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053026.1 protein_id gnl|my_center|LOCUS_05440 77961 75796 gene locus_tag LOCUS_05450 gene malQ 77961 75796 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053798.1 protein_id gnl|my_center|LOCUS_05450 78981 78199 gene locus_tag LOCUS_05460 78981 78199 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390230.1 protein_id gnl|my_center|LOCUS_05460 79632 78994 gene locus_tag LOCUS_05470 79632 78994 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053023.1 protein_id gnl|my_center|LOCUS_05470 81062 79644 gene locus_tag LOCUS_05480 81062 79644 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815644.1 protein_id gnl|my_center|LOCUS_05480 81783 82130 gene locus_tag LOCUS_05490 81783 82130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 85340 82188 gene locus_tag LOCUS_05500 85340 82188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 85818 85474 gene locus_tag LOCUS_05510 85818 85474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 86247 86159 gene locus_tag LOCUS_t00210 86247 86159 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 87298 86363 gene locus_tag LOCUS_05520 87298 86363 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053020.1 protein_id gnl|my_center|LOCUS_05520 87286 87498 gene locus_tag LOCUS_05530 87286 87498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 87503 88792 gene locus_tag LOCUS_05540 gene dinB 87503 88792 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390232.1 protein_id gnl|my_center|LOCUS_05540 <90083 88818 gene locus_tag LOCUS_05550 <90083 88818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068736.1:succinyldiaminopimelate transaminase >Feature sequence007 443 874 gene locus_tag LOCUS_05560 443 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 1307 993 gene locus_tag LOCUS_05570 1307 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 2516 1662 gene locus_tag LOCUS_05580 2516 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 3168 3899 gene locus_tag LOCUS_05590 3168 3899 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068121.1 protein_id gnl|my_center|LOCUS_05590 4368 4853 gene locus_tag LOCUS_05600 4368 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 4925 5476 gene locus_tag LOCUS_05610 4925 5476 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052759.1 protein_id gnl|my_center|LOCUS_05610 6295 5480 gene locus_tag LOCUS_05620 6295 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 6466 7815 gene locus_tag LOCUS_05630 gene aroA 6466 7815 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812770.1 protein_id gnl|my_center|LOCUS_05630 9139 7910 gene locus_tag LOCUS_05640 9139 7910 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363379.1 protein_id gnl|my_center|LOCUS_05640 10940 9270 gene locus_tag LOCUS_05650 gene pta 10940 9270 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812775.1 protein_id gnl|my_center|LOCUS_05650 12623 11142 gene locus_tag LOCUS_05660 12623 11142 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_05660 12848 13891 gene locus_tag LOCUS_05670 12848 13891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 13897 15345 gene locus_tag LOCUS_05680 13897 15345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 17015 15453 gene locus_tag LOCUS_05690 gene guaA 17015 15453 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389788.1 protein_id gnl|my_center|LOCUS_05690 17474 19951 gene locus_tag LOCUS_05700 17474 19951 CDS product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068223.1 protein_id gnl|my_center|LOCUS_05700 20213 22033 gene locus_tag LOCUS_05710 20213 22033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 22030 23577 gene locus_tag LOCUS_05720 22030 23577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 23574 25802 gene locus_tag LOCUS_05730 23574 25802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143321.1 protein_id gnl|my_center|LOCUS_05730 26612 25887 gene locus_tag LOCUS_05740 26612 25887 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389790.1 protein_id gnl|my_center|LOCUS_05740 27882 26671 gene locus_tag LOCUS_05750 27882 26671 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389791.1 protein_id gnl|my_center|LOCUS_05750 28015 28968 gene locus_tag LOCUS_05760 28015 28968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057287.1 protein_id gnl|my_center|LOCUS_05760 29011 30297 gene locus_tag LOCUS_05770 29011 30297 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389793.1 protein_id gnl|my_center|LOCUS_05770 30284 31711 gene locus_tag LOCUS_05780 30284 31711 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389794.1 protein_id gnl|my_center|LOCUS_05780 33217 31727 gene locus_tag LOCUS_05790 33217 31727 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052115.1 protein_id gnl|my_center|LOCUS_05790 34754 33405 gene locus_tag LOCUS_05800 34754 33405 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_05800 35368 34787 gene locus_tag LOCUS_05810 35368 34787 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057285.1 protein_id gnl|my_center|LOCUS_05810 35507 37411 gene locus_tag LOCUS_05820 35507 37411 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812844.1 protein_id gnl|my_center|LOCUS_05820 37515 40190 gene locus_tag LOCUS_05830 37515 40190 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389805.1 protein_id gnl|my_center|LOCUS_05830 40428 40835 gene locus_tag LOCUS_05840 40428 40835 CDS product DUF4418 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816922.1 protein_id gnl|my_center|LOCUS_05840 40838 42055 gene locus_tag LOCUS_05850 40838 42055 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820805.1 protein_id gnl|my_center|LOCUS_05850 42055 42840 gene locus_tag LOCUS_05860 42055 42840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052129.1 protein_id gnl|my_center|LOCUS_05860 43090 43716 gene locus_tag LOCUS_05870 gene rpsD 43090 43716 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812853.1 protein_id gnl|my_center|LOCUS_05870 43829 44503 gene locus_tag LOCUS_05880 43829 44503 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389807.1 protein_id gnl|my_center|LOCUS_05880 44610 45005 gene locus_tag LOCUS_05890 44610 45005 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812859.1 protein_id gnl|my_center|LOCUS_05890 45005 45244 gene locus_tag LOCUS_05900 45005 45244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812861.1 protein_id gnl|my_center|LOCUS_05900 45353 48031 gene locus_tag LOCUS_05910 gene alaS 45353 48031 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389808.1 protein_id gnl|my_center|LOCUS_05910 48039 48521 gene locus_tag LOCUS_05920 gene ruvX 48039 48521 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812865.1 protein_id gnl|my_center|LOCUS_05920 48514 49704 gene locus_tag LOCUS_05930 gene mltG 48514 49704 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003823435.1 protein_id gnl|my_center|LOCUS_05930 50171 49701 gene locus_tag LOCUS_05940 50171 49701 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143357.1 protein_id gnl|my_center|LOCUS_05940 50223 51419 gene locus_tag LOCUS_05950 gene aroC 50223 51419 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816938.1 protein_id gnl|my_center|LOCUS_05950 51416 53056 gene locus_tag LOCUS_05960 51416 53056 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363407.1 protein_id gnl|my_center|LOCUS_05960 53088 53543 gene locus_tag LOCUS_05970 gene aroQ 53088 53543 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052141.1 protein_id gnl|my_center|LOCUS_05970 53658 55325 gene locus_tag LOCUS_05980 53658 55325 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812880.1 protein_id gnl|my_center|LOCUS_05980 55490 57142 gene locus_tag LOCUS_05990 55490 57142 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052144.1 protein_id gnl|my_center|LOCUS_05990 57389 58885 gene locus_tag LOCUS_06000 gene sufB 57389 58885 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055081.1 protein_id gnl|my_center|LOCUS_06000 58891 60120 gene locus_tag LOCUS_06010 gene sufD 58891 60120 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389813.1 protein_id gnl|my_center|LOCUS_06010 60162 60941 gene locus_tag LOCUS_06020 gene sufC 60162 60941 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389814.1 protein_id gnl|my_center|LOCUS_06020 61097 62368 gene locus_tag LOCUS_06030 61097 62368 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389815.1 protein_id gnl|my_center|LOCUS_06030 62372 62920 gene locus_tag LOCUS_06040 62372 62920 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816902.1 protein_id gnl|my_center|LOCUS_06040 62996 63595 gene locus_tag LOCUS_06050 62996 63595 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812893.1 protein_id gnl|my_center|LOCUS_06050 64963 63716 gene locus_tag LOCUS_06060 gene glgC 64963 63716 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812894.1 protein_id gnl|my_center|LOCUS_06060 65983 65117 gene locus_tag LOCUS_06070 65983 65117 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812896.1 protein_id gnl|my_center|LOCUS_06070 66166 66077 gene locus_tag LOCUS_t00220 66166 66077 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 66285 67079 gene locus_tag LOCUS_06080 66285 67079 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052153.1 protein_id gnl|my_center|LOCUS_06080 67173 67511 gene locus_tag LOCUS_06090 67173 67511 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055091.1 protein_id gnl|my_center|LOCUS_06090 67616 68872 gene locus_tag LOCUS_06100 67616 68872 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052155.1 protein_id gnl|my_center|LOCUS_06100 68869 69414 gene locus_tag LOCUS_06110 gene ybeY 68869 69414 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052156.1 protein_id gnl|my_center|LOCUS_06110 69499 70938 gene locus_tag LOCUS_06120 69499 70938 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816896.1 protein_id gnl|my_center|LOCUS_06120 70940 71926 gene locus_tag LOCUS_06130 gene era 70940 71926 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053368.1 protein_id gnl|my_center|LOCUS_06130 71952 74831 gene locus_tag LOCUS_06140 71952 74831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 77016 74980 gene locus_tag LOCUS_06150 77016 74980 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582533.1 protein_id gnl|my_center|LOCUS_06150 77279 78424 gene locus_tag LOCUS_06160 77279 78424 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816824.1 protein_id gnl|my_center|LOCUS_06160 78443 78757 gene locus_tag LOCUS_06170 78443 78757 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_06170 78758 80209 gene locus_tag LOCUS_06180 78758 80209 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812914.1 protein_id gnl|my_center|LOCUS_06180 81290 80319 gene locus_tag LOCUS_06190 81290 80319 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053364.1 protein_id gnl|my_center|LOCUS_06190 81677 82303 gene locus_tag LOCUS_06200 81677 82303 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812918.1 protein_id gnl|my_center|LOCUS_06200 82620 83747 gene locus_tag LOCUS_06210 82620 83747 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068176.1 protein_id gnl|my_center|LOCUS_06210 83984 84142 gene locus_tag LOCUS_06220 83984 84142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 84139 84420 gene locus_tag LOCUS_06230 84139 84420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 84530 85378 gene locus_tag LOCUS_06240 84530 85378 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 protein_id gnl|my_center|LOCUS_06240 85597 85740 gene locus_tag LOCUS_06250 85597 85740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence008 601 871 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgcatgcggggatgatcc 1069 1320 gene locus_tag LOCUS_06260 1069 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1313 1513 gene locus_tag LOCUS_06270 1313 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812975.1 protein_id gnl|my_center|LOCUS_06270 1731 5294 gene locus_tag LOCUS_06280 1731 5294 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812027.1 protein_id gnl|my_center|LOCUS_06280 5478 9488 gene locus_tag LOCUS_06290 5478 9488 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363162.1 protein_id gnl|my_center|LOCUS_06290 10260 10589 gene locus_tag LOCUS_06300 10260 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 11259 11693 gene locus_tag LOCUS_06310 11259 11693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 13356 12067 gene locus_tag LOCUS_06320 13356 12067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 14713 13460 gene locus_tag LOCUS_06330 14713 13460 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051313.1 protein_id gnl|my_center|LOCUS_06330 20919 14716 gene locus_tag LOCUS_06340 20919 14716 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389587.1 protein_id gnl|my_center|LOCUS_06340 22523 20928 gene locus_tag LOCUS_06350 22523 20928 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389588.1 protein_id gnl|my_center|LOCUS_06350 22971 25124 gene locus_tag LOCUS_06360 22971 25124 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068658.1 protein_id gnl|my_center|LOCUS_06360 25303 29526 gene locus_tag LOCUS_06370 25303 29526 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068347.1 protein_id gnl|my_center|LOCUS_06370 29523 33569 gene locus_tag LOCUS_06380 29523 33569 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389590.1 protein_id gnl|my_center|LOCUS_06380 33807 34559 gene locus_tag LOCUS_06390 gene dapB 33807 34559 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816186.1 protein_id gnl|my_center|LOCUS_06390 34611 35513 gene locus_tag LOCUS_06400 gene dapA 34611 35513 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389595.1 protein_id gnl|my_center|LOCUS_06400 35668 37725 gene locus_tag LOCUS_06410 35668 37725 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812067.1 protein_id gnl|my_center|LOCUS_06410 37806 40415 gene locus_tag LOCUS_06420 gene pepN 37806 40415 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389596.1 protein_id gnl|my_center|LOCUS_06420 40811 42199 gene locus_tag LOCUS_06430 gene glmM 40811 42199 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812074.1 protein_id gnl|my_center|LOCUS_06430 42253 42906 gene locus_tag LOCUS_06440 42253 42906 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816189.1 protein_id gnl|my_center|LOCUS_06440 42903 44360 gene locus_tag LOCUS_06450 42903 44360 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068339.1 protein_id gnl|my_center|LOCUS_06450 44502 46151 gene locus_tag LOCUS_06460 44502 46151 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390129.1 protein_id gnl|my_center|LOCUS_06460 46319 47296 gene locus_tag LOCUS_06470 46319 47296 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814940.1 protein_id gnl|my_center|LOCUS_06470 47293 48363 gene locus_tag LOCUS_06480 47293 48363 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068324.1 protein_id gnl|my_center|LOCUS_06480 48360 49142 gene locus_tag LOCUS_06490 48360 49142 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814944.1 protein_id gnl|my_center|LOCUS_06490 49142 49882 gene locus_tag LOCUS_06500 49142 49882 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783136.1 protein_id gnl|my_center|LOCUS_06500 50563 49892 gene locus_tag LOCUS_06510 50563 49892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06510 50940 50584 gene locus_tag LOCUS_06520 50940 50584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06520 51111 51395 gene locus_tag LOCUS_06530 gene rpoZ 51111 51395 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053158.1 protein_id gnl|my_center|LOCUS_06530 51728 52951 gene locus_tag LOCUS_06540 gene metK 51728 52951 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389702.1 protein_id gnl|my_center|LOCUS_06540 53225 54529 gene locus_tag LOCUS_06550 53225 54529 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055349.1 protein_id gnl|my_center|LOCUS_06550 54585 56852 gene locus_tag LOCUS_06560 54585 56852 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068842.1 protein_id gnl|my_center|LOCUS_06560 56978 57682 gene locus_tag LOCUS_06570 56978 57682 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812477.1 protein_id gnl|my_center|LOCUS_06570 57873 58844 gene locus_tag LOCUS_06580 gene fmt 57873 58844 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815830.1 protein_id gnl|my_center|LOCUS_06580 59621 58920 gene locus_tag LOCUS_06590 gene serB 59621 58920 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057164.1 protein_id gnl|my_center|LOCUS_06590 59675 60373 gene locus_tag LOCUS_06600 59675 60373 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057155.1 protein_id gnl|my_center|LOCUS_06600 60370 61917 gene locus_tag LOCUS_06610 gene arc 60370 61917 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389705.1 protein_id gnl|my_center|LOCUS_06610 61959 63611 gene locus_tag LOCUS_06620 gene dop 61959 63611 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389706.1 protein_id gnl|my_center|LOCUS_06620 63749 64582 gene locus_tag LOCUS_06630 63749 64582 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812487.1 protein_id gnl|my_center|LOCUS_06630 64715 64918 gene locus_tag LOCUS_06640 64715 64918 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812488.1 protein_id gnl|my_center|LOCUS_06640 65008 66504 gene locus_tag LOCUS_06650 gene pafA 65008 66504 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389708.1 protein_id gnl|my_center|LOCUS_06650 66873 66592 gene locus_tag LOCUS_06660 66873 66592 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812492.1 protein_id gnl|my_center|LOCUS_06660 69680 67161 gene locus_tag LOCUS_06670 69680 67161 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389709.1 protein_id gnl|my_center|LOCUS_06670 71159 69723 gene locus_tag LOCUS_06680 gene purB 71159 69723 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053172.1 protein_id gnl|my_center|LOCUS_06680 71452 72219 gene locus_tag LOCUS_06690 71452 72219 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966022.1 protein_id gnl|my_center|LOCUS_06690 72479 73507 gene locus_tag LOCUS_06700 72479 73507 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004846624.1 protein_id gnl|my_center|LOCUS_06700 73507 74385 gene locus_tag LOCUS_06710 73507 74385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 74399 75343 gene locus_tag LOCUS_06720 74399 75343 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966017.1 protein_id gnl|my_center|LOCUS_06720 76949 75363 gene locus_tag LOCUS_06730 76949 75363 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782718.1 protein_id gnl|my_center|LOCUS_06730 77275 76949 gene locus_tag LOCUS_06740 77275 76949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 78107 77385 gene locus_tag LOCUS_06750 78107 77385 CDS product DUF6466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389711.1 protein_id gnl|my_center|LOCUS_06750 79153 78104 gene locus_tag LOCUS_06760 79153 78104 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782716.1 protein_id gnl|my_center|LOCUS_06760 80265 79150 gene locus_tag LOCUS_06770 80265 79150 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053180.1 protein_id gnl|my_center|LOCUS_06770 80792 80265 gene locus_tag LOCUS_06780 80792 80265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021975282.1 protein_id gnl|my_center|LOCUS_06780 81751 80789 gene locus_tag LOCUS_06790 81751 80789 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053182.1 protein_id gnl|my_center|LOCUS_06790 82815 81748 gene locus_tag LOCUS_06800 82815 81748 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053183.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence009 2378 540 gene locus_tag LOCUS_06810 2378 540 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068628.1 protein_id gnl|my_center|LOCUS_06810 2674 3915 gene locus_tag LOCUS_06820 2674 3915 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054616.1 protein_id gnl|my_center|LOCUS_06820 6551 4176 gene locus_tag LOCUS_06830 6551 4176 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390374.1 protein_id gnl|my_center|LOCUS_06830 7189 6701 gene locus_tag LOCUS_06840 7189 6701 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056534.1 protein_id gnl|my_center|LOCUS_06840 7460 9535 gene locus_tag LOCUS_06850 7460 9535 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390373.1 protein_id gnl|my_center|LOCUS_06850 10126 9545 gene locus_tag LOCUS_06860 gene dcd 10126 9545 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814973.1 protein_id gnl|my_center|LOCUS_06860 10530 11243 gene locus_tag LOCUS_06870 10530 11243 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783033.1 protein_id gnl|my_center|LOCUS_06870 14383 11375 gene locus_tag LOCUS_06880 14383 11375 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390375.1 protein_id gnl|my_center|LOCUS_06880 14931 15200 gene locus_tag LOCUS_06890 14931 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 15197 15532 gene locus_tag LOCUS_06900 15197 15532 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286801.1 protein_id gnl|my_center|LOCUS_06900 16844 15597 gene locus_tag LOCUS_06910 16844 15597 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068619.1 protein_id gnl|my_center|LOCUS_06910 16953 17954 gene locus_tag LOCUS_06920 gene rlmB 16953 17954 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814978.1 protein_id gnl|my_center|LOCUS_06920 22516 18125 gene locus_tag LOCUS_06930 22516 18125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 29484 22513 gene locus_tag LOCUS_06940 29484 22513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 34048 29849 gene locus_tag LOCUS_06950 34048 29849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 35914 34484 gene locus_tag LOCUS_06960 35914 34484 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390376.1 protein_id gnl|my_center|LOCUS_06960 36832 35942 gene locus_tag LOCUS_06970 36832 35942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 38646 37519 gene locus_tag LOCUS_06980 gene ugpC 38646 37519 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051809.1 protein_id gnl|my_center|LOCUS_06980 39041 39919 gene locus_tag LOCUS_06990 39041 39919 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813911.1 protein_id gnl|my_center|LOCUS_06990 39916 41298 gene locus_tag LOCUS_07000 39916 41298 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775459.1 protein_id gnl|my_center|LOCUS_07000 42325 41582 gene locus_tag LOCUS_07010 42325 41582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 44969 42318 gene locus_tag LOCUS_07020 44969 42318 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775403.1 protein_id gnl|my_center|LOCUS_07020 46446 45325 gene locus_tag LOCUS_07030 46446 45325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 46670 46855 gene locus_tag LOCUS_07040 46670 46855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 49748 46845 gene locus_tag LOCUS_07050 49748 46845 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_07050 50126 49971 gene locus_tag LOCUS_07060 50126 49971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 50086 52521 gene locus_tag LOCUS_07070 50086 52521 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390382.1 protein_id gnl|my_center|LOCUS_07070 52736 53722 gene locus_tag LOCUS_07080 52736 53722 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390383.1 protein_id gnl|my_center|LOCUS_07080 53890 53964 gene locus_tag LOCUS_t00230 53890 53964 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 54253 56058 gene locus_tag LOCUS_07090 54253 56058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 56188 57162 gene locus_tag LOCUS_07100 gene rsmA 56188 57162 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068602.1 protein_id gnl|my_center|LOCUS_07100 57155 58147 gene locus_tag LOCUS_07110 57155 58147 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143648.1 protein_id gnl|my_center|LOCUS_07110 58281 58991 gene locus_tag LOCUS_07120 58281 58991 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815003.1 protein_id gnl|my_center|LOCUS_07120 60518 59106 gene locus_tag LOCUS_07130 60518 59106 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051791.1 protein_id gnl|my_center|LOCUS_07130 60607 61338 gene locus_tag LOCUS_07140 60607 61338 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815006.1 protein_id gnl|my_center|LOCUS_07140 61340 63433 gene locus_tag LOCUS_07150 61340 63433 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173361541.1 protein_id gnl|my_center|LOCUS_07150 63430 67650 gene locus_tag LOCUS_07160 63430 67650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 67969 68925 gene locus_tag LOCUS_07170 gene trxB 67969 68925 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114045.1 protein_id gnl|my_center|LOCUS_07170 69168 70514 gene locus_tag LOCUS_07180 69168 70514 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_07180 70621 70472 gene locus_tag LOCUS_07190 70621 70472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 72208 70682 gene locus_tag LOCUS_07200 72208 70682 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068597.1 protein_id gnl|my_center|LOCUS_07200 73188 72211 gene locus_tag LOCUS_07210 73188 72211 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364057.1 protein_id gnl|my_center|LOCUS_07210 74338 73520 gene locus_tag LOCUS_07220 gene rsmG 74338 73520 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056575.1 protein_id gnl|my_center|LOCUS_07220 74869 74342 gene locus_tag LOCUS_07230 74869 74342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390392.1 protein_id gnl|my_center|LOCUS_07230 76051 75038 gene locus_tag LOCUS_07240 gene yidC 76051 75038 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051771.1 protein_id gnl|my_center|LOCUS_07240 76402 76055 gene locus_tag LOCUS_07250 gene yidD 76402 76055 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051770.1 protein_id gnl|my_center|LOCUS_07250 76782 76399 gene locus_tag LOCUS_07260 gene rnpA 76782 76399 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051769.1 protein_id gnl|my_center|LOCUS_07260 76941 76807 gene locus_tag LOCUS_07270 gene rpmH 76941 76807 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051768.1 protein_id gnl|my_center|LOCUS_07270 77256 78881 gene locus_tag LOCUS_07280 gene dnaA 77256 78881 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815928.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence010 2265 1507 gene locus_tag LOCUS_07290 2265 1507 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389567.1 protein_id gnl|my_center|LOCUS_07290 3290 2442 gene locus_tag LOCUS_07300 3290 2442 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815359.1 protein_id gnl|my_center|LOCUS_07300 4432 3374 gene locus_tag LOCUS_07310 4432 3374 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068391.1 protein_id gnl|my_center|LOCUS_07310 6616 4460 gene locus_tag LOCUS_07320 6616 4460 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068392.1 protein_id gnl|my_center|LOCUS_07320 6516 6827 gene locus_tag LOCUS_07330 6516 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 11087 6897 gene locus_tag LOCUS_07340 11087 6897 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068393.1 protein_id gnl|my_center|LOCUS_07340 11442 11101 gene locus_tag LOCUS_07350 11442 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 11333 12919 gene locus_tag LOCUS_07360 11333 12919 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_07360 14626 13052 gene locus_tag LOCUS_07370 14626 13052 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964648.1 protein_id gnl|my_center|LOCUS_07370 16597 15134 gene locus_tag LOCUS_07380 16597 15134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989104.1 protein_id gnl|my_center|LOCUS_07380 16992 18812 gene locus_tag LOCUS_07390 16992 18812 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414601.1 protein_id gnl|my_center|LOCUS_07390 19841 18888 gene locus_tag LOCUS_07400 19841 18888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 20043 20711 gene locus_tag LOCUS_07410 20043 20711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 20716 22377 gene locus_tag LOCUS_07420 20716 22377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 24197 22680 gene locus_tag LOCUS_07430 gene araA 24197 22680 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051388.1 protein_id gnl|my_center|LOCUS_07430 25047 24355 gene locus_tag LOCUS_07440 25047 24355 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051389.1 protein_id gnl|my_center|LOCUS_07440 26864 25221 gene locus_tag LOCUS_07450 26864 25221 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051390.1 protein_id gnl|my_center|LOCUS_07450 28281 27163 gene locus_tag LOCUS_07460 28281 27163 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143236.1 protein_id gnl|my_center|LOCUS_07460 29138 28425 gene locus_tag LOCUS_07470 29138 28425 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414600.1 protein_id gnl|my_center|LOCUS_07470 30042 29287 gene locus_tag LOCUS_07480 gene lepB 30042 29287 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081174.1 protein_id gnl|my_center|LOCUS_07480 30554 30189 gene locus_tag LOCUS_07490 gene rplS 30554 30189 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811942.1 protein_id gnl|my_center|LOCUS_07490 31588 31112 gene locus_tag LOCUS_07500 31588 31112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 32253 31663 gene locus_tag LOCUS_07510 32253 31663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 33319 32417 gene locus_tag LOCUS_07520 33319 32417 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_07520 35220 33520 gene locus_tag LOCUS_07530 gene pgi 35220 33520 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068403.1 protein_id gnl|my_center|LOCUS_07530 35567 35643 gene locus_tag LOCUS_t00240 35567 35643 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 36720 35719 gene locus_tag LOCUS_07540 36720 35719 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389548.1 protein_id gnl|my_center|LOCUS_07540 36883 36802 gene locus_tag LOCUS_t00250 36883 36802 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 38294 37023 gene locus_tag LOCUS_07550 38294 37023 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068407.1 protein_id gnl|my_center|LOCUS_07550 39242 38514 gene locus_tag LOCUS_07560 39242 38514 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051401.1 protein_id gnl|my_center|LOCUS_07560 40032 39268 gene locus_tag LOCUS_07570 gene rph 40032 39268 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811904.1 protein_id gnl|my_center|LOCUS_07570 40957 40322 gene locus_tag LOCUS_07580 40957 40322 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582373.1 protein_id gnl|my_center|LOCUS_07580 41091 42410 gene locus_tag LOCUS_07590 41091 42410 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055715.1 protein_id gnl|my_center|LOCUS_07590 42751 42425 gene locus_tag LOCUS_07600 42751 42425 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811884.1 protein_id gnl|my_center|LOCUS_07600 43028 43459 gene locus_tag LOCUS_07610 gene coaD 43028 43459 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051410.1 protein_id gnl|my_center|LOCUS_07610 43456 44490 gene locus_tag LOCUS_07620 43456 44490 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057854.1 protein_id gnl|my_center|LOCUS_07620 44494 45108 gene locus_tag LOCUS_07630 44494 45108 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054816.1 protein_id gnl|my_center|LOCUS_07630 45291 45485 gene locus_tag LOCUS_07640 gene rpmF 45291 45485 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113441.1 protein_id gnl|my_center|LOCUS_07640 45619 46392 gene locus_tag LOCUS_07650 gene rnc 45619 46392 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055729.1 protein_id gnl|my_center|LOCUS_07650 46666 48585 gene locus_tag LOCUS_07660 46666 48585 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389545.1 protein_id gnl|my_center|LOCUS_07660 48622 49176 gene locus_tag LOCUS_07670 gene ilvN 48622 49176 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054813.1 protein_id gnl|my_center|LOCUS_07670 49396 49956 gene locus_tag LOCUS_07680 49396 49956 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816569.1 protein_id gnl|my_center|LOCUS_07680 49968 51425 gene locus_tag LOCUS_07690 49968 51425 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814403.1 protein_id gnl|my_center|LOCUS_07690 51504 51782 gene locus_tag LOCUS_07700 51504 51782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 51788 52222 gene locus_tag LOCUS_07710 51788 52222 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051418.1 protein_id gnl|my_center|LOCUS_07710 52860 52345 gene locus_tag LOCUS_07720 52860 52345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 55213 52961 gene locus_tag LOCUS_07730 55213 52961 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068412.1 protein_id gnl|my_center|LOCUS_07730 56220 55495 gene locus_tag LOCUS_07740 56220 55495 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054810.1 protein_id gnl|my_center|LOCUS_07740 56357 58006 gene locus_tag LOCUS_07750 gene cysS 56357 58006 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389542.1 protein_id gnl|my_center|LOCUS_07750 59074 58169 gene locus_tag LOCUS_07760 59074 58169 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055692.1 protein_id gnl|my_center|LOCUS_07760 59405 61048 gene locus_tag LOCUS_07770 gene ffh 59405 61048 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389541.1 protein_id gnl|my_center|LOCUS_07770 61897 61118 gene locus_tag LOCUS_07780 61897 61118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 62725 61904 gene locus_tag LOCUS_07790 62725 61904 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816947.1 protein_id gnl|my_center|LOCUS_07790 63045 63968 gene locus_tag LOCUS_07800 63045 63968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 63978 65126 gene locus_tag LOCUS_07810 63978 65126 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068417.1 protein_id gnl|my_center|LOCUS_07810 66325 65186 gene locus_tag LOCUS_07820 66325 65186 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056552.1 protein_id gnl|my_center|LOCUS_07820 66762 67214 gene locus_tag LOCUS_07830 66762 67214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 67211 67450 gene locus_tag LOCUS_07840 67211 67450 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811858.1 protein_id gnl|my_center|LOCUS_07840 67447 68067 gene locus_tag LOCUS_07850 gene rimM 67447 68067 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389537.1 protein_id gnl|my_center|LOCUS_07850 68224 70143 gene locus_tag LOCUS_07860 68224 70143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814267.1 protein_id gnl|my_center|LOCUS_07860 70140 71954 gene locus_tag LOCUS_07870 70140 71954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459511.1 protein_id gnl|my_center|LOCUS_07870 72029 73012 gene locus_tag LOCUS_07880 gene trmD 72029 73012 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389536.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence011 2428 281 gene locus_tag LOCUS_07890 2428 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 5620 3149 gene locus_tag LOCUS_07900 5620 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 5928 6953 gene locus_tag LOCUS_07910 5928 6953 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_07910 6950 8200 gene locus_tag LOCUS_07920 6950 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 8389 9315 gene locus_tag LOCUS_07930 8389 9315 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_07930 11478 10222 gene locus_tag LOCUS_07940 11478 10222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 13506 11569 gene locus_tag LOCUS_07950 13506 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 15238 13661 gene locus_tag LOCUS_07960 15238 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 17547 15259 gene locus_tag LOCUS_07970 17547 15259 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390346.1 protein_id gnl|my_center|LOCUS_07970 19201 17711 gene locus_tag LOCUS_07980 19201 17711 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947073.1 protein_id gnl|my_center|LOCUS_07980 19771 21132 gene locus_tag LOCUS_07990 19771 21132 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814091.1 protein_id gnl|my_center|LOCUS_07990 21129 22457 gene locus_tag LOCUS_08000 21129 22457 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390347.1 protein_id gnl|my_center|LOCUS_08000 23618 22800 gene locus_tag LOCUS_08010 23618 22800 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390348.1 protein_id gnl|my_center|LOCUS_08010 24560 23676 gene locus_tag LOCUS_08020 24560 23676 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390349.1 protein_id gnl|my_center|LOCUS_08020 27014 24618 gene locus_tag LOCUS_08030 27014 24618 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816051.1 protein_id gnl|my_center|LOCUS_08030 28233 27274 gene locus_tag LOCUS_08040 28233 27274 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390350.1 protein_id gnl|my_center|LOCUS_08040 29599 28775 gene locus_tag LOCUS_08050 29599 28775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032736338.1 protein_id gnl|my_center|LOCUS_08050 31563 30598 gene locus_tag LOCUS_08060 31563 30598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 33439 31841 gene locus_tag LOCUS_08070 33439 31841 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_08070 33766 34911 gene locus_tag LOCUS_08080 33766 34911 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053078.1 protein_id gnl|my_center|LOCUS_08080 35008 36324 gene locus_tag LOCUS_08090 35008 36324 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056294.1 protein_id gnl|my_center|LOCUS_08090 37670 36579 gene locus_tag LOCUS_08100 37670 36579 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068660.1 protein_id gnl|my_center|LOCUS_08100 42184 37928 gene locus_tag LOCUS_08110 42184 37928 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389461.1 protein_id gnl|my_center|LOCUS_08110 43193 42507 gene locus_tag LOCUS_08120 gene leuD 43193 42507 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053083.1 protein_id gnl|my_center|LOCUS_08120 44793 43390 gene locus_tag LOCUS_08130 gene leuC 44793 43390 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811629.1 protein_id gnl|my_center|LOCUS_08130 45043 45891 gene locus_tag LOCUS_08140 45043 45891 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192829039.1 protein_id gnl|my_center|LOCUS_08140 48006 46093 gene locus_tag LOCUS_08150 gene leuA 48006 46093 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814147.1 protein_id gnl|my_center|LOCUS_08150 48247 49689 gene locus_tag LOCUS_08160 48247 49689 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143619.1 protein_id gnl|my_center|LOCUS_08160 49995 50909 gene locus_tag LOCUS_08170 49995 50909 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399385.1 protein_id gnl|my_center|LOCUS_08170 52057 51095 gene locus_tag LOCUS_08180 52057 51095 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993834.1 protein_id gnl|my_center|LOCUS_08180 53154 52309 gene locus_tag LOCUS_08190 53154 52309 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116524.1 protein_id gnl|my_center|LOCUS_08190 55226 53151 gene locus_tag LOCUS_08200 55226 53151 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993832.1 protein_id gnl|my_center|LOCUS_08200 56185 55229 gene locus_tag LOCUS_08210 56185 55229 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137618.1 protein_id gnl|my_center|LOCUS_08210 57901 56327 gene locus_tag LOCUS_08220 57901 56327 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116517.1 protein_id gnl|my_center|LOCUS_08220 58834 58166 gene locus_tag LOCUS_08230 58834 58166 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113937.1 protein_id gnl|my_center|LOCUS_08230 59945 58941 gene locus_tag LOCUS_08240 59945 58941 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993557.1 protein_id gnl|my_center|LOCUS_08240 60964 59942 gene locus_tag LOCUS_08250 60964 59942 CDS product DUF4862 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113941.1 protein_id gnl|my_center|LOCUS_08250 61783 61136 gene locus_tag LOCUS_08260 61783 61136 CDS product DUF5701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051613.1 protein_id gnl|my_center|LOCUS_08260 61943 63037 gene locus_tag LOCUS_08270 gene asd 61943 63037 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051614.1 protein_id gnl|my_center|LOCUS_08270 63722 63141 gene locus_tag LOCUS_08280 63722 63141 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819192.1 protein_id gnl|my_center|LOCUS_08280 64637 63873 gene locus_tag LOCUS_08290 64637 63873 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051616.1 protein_id gnl|my_center|LOCUS_08290 65716 64775 gene locus_tag LOCUS_08300 65716 64775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 66982 65753 gene locus_tag LOCUS_08310 66982 65753 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence012 761 78 gene locus_tag LOCUS_08320 gene pgsA 761 78 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813804.1 protein_id gnl|my_center|LOCUS_08320 1871 864 gene locus_tag LOCUS_08330 1871 864 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068252.1 protein_id gnl|my_center|LOCUS_08330 2552 1947 gene locus_tag LOCUS_08340 2552 1947 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068253.1 protein_id gnl|my_center|LOCUS_08340 3199 2549 gene locus_tag LOCUS_08350 3199 2549 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582483.1 protein_id gnl|my_center|LOCUS_08350 4598 3300 gene locus_tag LOCUS_08360 gene eno 4598 3300 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051126.1 protein_id gnl|my_center|LOCUS_08360 5338 4811 gene locus_tag LOCUS_08370 5338 4811 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053897.1 protein_id gnl|my_center|LOCUS_08370 8983 5396 gene locus_tag LOCUS_08380 gene mfd 8983 5396 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389755.1 protein_id gnl|my_center|LOCUS_08380 9572 8973 gene locus_tag LOCUS_08390 gene pth 9572 8973 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053586.1 protein_id gnl|my_center|LOCUS_08390 10218 9694 gene locus_tag LOCUS_08400 10218 9694 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389754.1 protein_id gnl|my_center|LOCUS_08400 11057 10266 gene locus_tag LOCUS_08410 11057 10266 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812647.1 protein_id gnl|my_center|LOCUS_08410 11853 11047 gene locus_tag LOCUS_08420 11853 11047 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389753.1 protein_id gnl|my_center|LOCUS_08420 12918 11875 gene locus_tag LOCUS_08430 12918 11875 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819097.1 protein_id gnl|my_center|LOCUS_08430 13646 12933 gene locus_tag LOCUS_08440 gene ispD 13646 12933 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389752.1 protein_id gnl|my_center|LOCUS_08440 15303 13831 gene locus_tag LOCUS_08450 15303 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 17115 15322 gene locus_tag LOCUS_08460 17115 15322 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389749.1 protein_id gnl|my_center|LOCUS_08460 17229 18377 gene locus_tag LOCUS_08470 17229 18377 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143333.1 protein_id gnl|my_center|LOCUS_08470 19616 18483 gene locus_tag LOCUS_08480 19616 18483 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067956.1 protein_id gnl|my_center|LOCUS_08480 20710 19619 gene locus_tag LOCUS_08490 20710 19619 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067957.1 protein_id gnl|my_center|LOCUS_08490 21095 21895 gene locus_tag LOCUS_08500 21095 21895 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056912.1 protein_id gnl|my_center|LOCUS_08500 25191 22012 gene locus_tag LOCUS_08510 25191 22012 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389747.1 protein_id gnl|my_center|LOCUS_08510 25588 26820 gene locus_tag LOCUS_08520 25588 26820 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389746.1 protein_id gnl|my_center|LOCUS_08520 27195 26860 gene locus_tag LOCUS_08530 27195 26860 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052362.1 protein_id gnl|my_center|LOCUS_08530 27995 27192 gene locus_tag LOCUS_08540 27995 27192 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410658.1 protein_id gnl|my_center|LOCUS_08540 29144 28116 gene locus_tag LOCUS_08550 29144 28116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 30036 29278 gene locus_tag LOCUS_08560 30036 29278 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706997.1 protein_id gnl|my_center|LOCUS_08560 30386 31171 gene locus_tag LOCUS_08570 30386 31171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054022.1 protein_id gnl|my_center|LOCUS_08570 31168 31965 gene locus_tag LOCUS_08580 gene fetB 31168 31965 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067944.1 protein_id gnl|my_center|LOCUS_08580 34260 32089 gene locus_tag LOCUS_08590 34260 32089 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068191.1 protein_id gnl|my_center|LOCUS_08590 35140 34430 gene locus_tag LOCUS_08600 35140 34430 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054307.1 protein_id gnl|my_center|LOCUS_08600 35502 35323 gene locus_tag LOCUS_08610 35502 35323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 35723 36649 gene locus_tag LOCUS_08620 35723 36649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 38025 36736 gene locus_tag LOCUS_08630 38025 36736 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052100.1 protein_id gnl|my_center|LOCUS_08630 38959 38147 gene locus_tag LOCUS_08640 38959 38147 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813549.1 protein_id gnl|my_center|LOCUS_08640 39893 39144 gene locus_tag LOCUS_08650 39893 39144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 40857 39874 gene locus_tag LOCUS_08660 40857 39874 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052677.1 protein_id gnl|my_center|LOCUS_08660 41685 40987 gene locus_tag LOCUS_08670 41685 40987 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390032.1 protein_id gnl|my_center|LOCUS_08670 42892 41672 gene locus_tag LOCUS_08680 42892 41672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 43656 43009 gene locus_tag LOCUS_08690 43656 43009 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390035.1 protein_id gnl|my_center|LOCUS_08690 43948 43736 gene locus_tag LOCUS_08700 43948 43736 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813569.1 protein_id gnl|my_center|LOCUS_08700 44328 44005 gene locus_tag LOCUS_08710 44328 44005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 46087 44507 gene locus_tag LOCUS_08720 46087 44507 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389978.1 protein_id gnl|my_center|LOCUS_08720 46706 46230 gene locus_tag LOCUS_08730 gene dtd 46706 46230 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928208.1 protein_id gnl|my_center|LOCUS_08730 47729 46902 gene locus_tag LOCUS_08740 47729 46902 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812255.1 protein_id gnl|my_center|LOCUS_08740 49121 47961 gene locus_tag LOCUS_08750 49121 47961 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390199.1 protein_id gnl|my_center|LOCUS_08750 49831 49214 gene locus_tag LOCUS_08760 49831 49214 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_08760 50090 51331 gene locus_tag LOCUS_08770 50090 51331 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813597.1 protein_id gnl|my_center|LOCUS_08770 52785 51529 gene locus_tag LOCUS_08780 52785 51529 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460692.1 protein_id gnl|my_center|LOCUS_08780 53848 53180 gene locus_tag LOCUS_08790 53848 53180 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223343.1 protein_id gnl|my_center|LOCUS_08790 53949 55460 gene locus_tag LOCUS_08800 53949 55460 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025727111.1 protein_id gnl|my_center|LOCUS_08800 56743 55646 gene locus_tag LOCUS_08810 gene ychF 56743 55646 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813598.1 protein_id gnl|my_center|LOCUS_08810 58700 56847 gene locus_tag LOCUS_08820 58700 56847 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189868312.1 protein_id gnl|my_center|LOCUS_08820 60196 58739 gene locus_tag LOCUS_08830 60196 58739 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055100.1 protein_id gnl|my_center|LOCUS_08830 61099 60296 gene locus_tag LOCUS_08840 gene proC 61099 60296 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363628.1 protein_id gnl|my_center|LOCUS_08840 62477 61131 gene locus_tag LOCUS_08850 62477 61131 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390049.1 protein_id gnl|my_center|LOCUS_08850 62668 65445 gene locus_tag LOCUS_08860 62668 65445 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813617.1 protein_id gnl|my_center|LOCUS_08860 65577 66284 gene locus_tag LOCUS_08870 65577 66284 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390051.1 protein_id gnl|my_center|LOCUS_08870 66515 66889 gene locus_tag LOCUS_08880 66515 66889 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence013 2438 399 gene locus_tag LOCUS_08890 gene aguA 2438 399 CDS product xylan alpha-(1->2)-glucuronosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082543.1 protein_id gnl|my_center|LOCUS_08890 3529 2552 gene locus_tag LOCUS_08900 3529 2552 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_08900 4544 3543 gene locus_tag LOCUS_08910 4544 3543 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_08910 6249 4630 gene locus_tag LOCUS_08920 6249 4630 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_08920 6534 7604 gene locus_tag LOCUS_08930 6534 7604 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_08930 7809 8828 gene locus_tag LOCUS_08940 7809 8828 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389470.1 protein_id gnl|my_center|LOCUS_08940 11872 10526 gene locus_tag LOCUS_08950 gene xylA 11872 10526 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053874.1 protein_id gnl|my_center|LOCUS_08950 13325 12096 gene locus_tag LOCUS_08960 13325 12096 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052436.1 protein_id gnl|my_center|LOCUS_08960 13608 14519 gene locus_tag LOCUS_08970 13608 14519 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816259.1 protein_id gnl|my_center|LOCUS_08970 14682 16226 gene locus_tag LOCUS_08980 gene zwf 14682 16226 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817686.1 protein_id gnl|my_center|LOCUS_08980 16223 17203 gene locus_tag LOCUS_08990 16223 17203 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818892.1 protein_id gnl|my_center|LOCUS_08990 17402 18193 gene locus_tag LOCUS_09000 gene pgl 17402 18193 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143563.1 protein_id gnl|my_center|LOCUS_09000 19227 18349 gene locus_tag LOCUS_09010 19227 18349 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409686.1 protein_id gnl|my_center|LOCUS_09010 21155 19707 gene locus_tag LOCUS_09020 gene gndA 21155 19707 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814647.1 protein_id gnl|my_center|LOCUS_09020 21492 22565 gene locus_tag LOCUS_09030 21492 22565 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056371.1 protein_id gnl|my_center|LOCUS_09030 23964 22777 gene locus_tag LOCUS_09040 23964 22777 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812081.1 protein_id gnl|my_center|LOCUS_09040 24657 23983 gene locus_tag LOCUS_09050 24657 23983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 24883 25965 gene locus_tag LOCUS_09060 24883 25965 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390188.1 protein_id gnl|my_center|LOCUS_09060 27361 25973 gene locus_tag LOCUS_09070 27361 25973 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390140.1 protein_id gnl|my_center|LOCUS_09070 28475 28400 gene locus_tag LOCUS_t00260 28475 28400 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 28598 28524 gene locus_tag LOCUS_t00270 28598 28524 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 29723 28740 gene locus_tag LOCUS_09080 29723 28740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 30664 29858 gene locus_tag LOCUS_09090 30664 29858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 31757 30681 gene locus_tag LOCUS_09100 31757 30681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 33225 34301 gene locus_tag LOCUS_09110 33225 34301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 34318 35124 gene locus_tag LOCUS_09120 34318 35124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 35259 36242 gene locus_tag LOCUS_09130 35259 36242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 36384 36458 gene locus_tag LOCUS_t00280 36384 36458 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 36507 36582 gene locus_tag LOCUS_t00290 36507 36582 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 37621 39009 gene locus_tag LOCUS_09140 37621 39009 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390140.1 protein_id gnl|my_center|LOCUS_09140 40099 39017 gene locus_tag LOCUS_09150 40099 39017 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390188.1 protein_id gnl|my_center|LOCUS_09150 40325 40999 gene locus_tag LOCUS_09160 40325 40999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 41018 42205 gene locus_tag LOCUS_09170 41018 42205 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812081.1 protein_id gnl|my_center|LOCUS_09170 43490 42417 gene locus_tag LOCUS_09180 43490 42417 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056371.1 protein_id gnl|my_center|LOCUS_09180 43827 45275 gene locus_tag LOCUS_09190 gene gndA 43827 45275 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814647.1 protein_id gnl|my_center|LOCUS_09190 45755 46633 gene locus_tag LOCUS_09200 45755 46633 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409686.1 protein_id gnl|my_center|LOCUS_09200 47580 46789 gene locus_tag LOCUS_09210 gene pgl 47580 46789 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143563.1 protein_id gnl|my_center|LOCUS_09210 48759 47779 gene locus_tag LOCUS_09220 48759 47779 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818892.1 protein_id gnl|my_center|LOCUS_09220 50300 48756 gene locus_tag LOCUS_09230 gene zwf 50300 48756 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817686.1 protein_id gnl|my_center|LOCUS_09230 51374 50463 gene locus_tag LOCUS_09240 51374 50463 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816259.1 protein_id gnl|my_center|LOCUS_09240 51657 52886 gene locus_tag LOCUS_09250 51657 52886 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052436.1 protein_id gnl|my_center|LOCUS_09250 53110 54456 gene locus_tag LOCUS_09260 gene xylA 53110 54456 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053874.1 protein_id gnl|my_center|LOCUS_09260 57173 56154 gene locus_tag LOCUS_09270 57173 56154 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389470.1 protein_id gnl|my_center|LOCUS_09270 58448 57378 gene locus_tag LOCUS_09280 58448 57378 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_09280 58733 60352 gene locus_tag LOCUS_09290 58733 60352 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_09290 60438 61439 gene locus_tag LOCUS_09300 60438 61439 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_09300 61453 62430 gene locus_tag LOCUS_09310 61453 62430 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_09310 62544 64583 gene locus_tag LOCUS_09320 gene aguA 62544 64583 CDS product xylan alpha-(1->2)-glucuronosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082543.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence014 2921 327 gene locus_tag LOCUS_09330 2921 327 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068114.1 protein_id gnl|my_center|LOCUS_09330 3302 2991 gene locus_tag LOCUS_09340 3302 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389921.1 protein_id gnl|my_center|LOCUS_09340 5358 3427 gene locus_tag LOCUS_09350 5358 3427 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817902.1 protein_id gnl|my_center|LOCUS_09350 6971 5544 gene locus_tag LOCUS_09360 6971 5544 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055741.1 protein_id gnl|my_center|LOCUS_09360 10263 7135 gene locus_tag LOCUS_09370 10263 7135 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389891.1 protein_id gnl|my_center|LOCUS_09370 10339 11421 gene locus_tag LOCUS_09380 10339 11421 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053811.1 protein_id gnl|my_center|LOCUS_09380 12584 11739 gene locus_tag LOCUS_09390 gene metF 12584 11739 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389889.1 protein_id gnl|my_center|LOCUS_09390 15032 12729 gene locus_tag LOCUS_09400 gene metE 15032 12729 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389888.1 protein_id gnl|my_center|LOCUS_09400 15488 15048 gene locus_tag LOCUS_09410 15488 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 15373 16476 gene locus_tag LOCUS_09420 15373 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 17090 16440 gene locus_tag LOCUS_09430 17090 16440 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389726.1 protein_id gnl|my_center|LOCUS_09430 17741 17184 gene locus_tag LOCUS_09440 17741 17184 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389849.1 protein_id gnl|my_center|LOCUS_09440 18989 17931 gene locus_tag LOCUS_09450 18989 17931 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068134.1 protein_id gnl|my_center|LOCUS_09450 19388 19182 gene locus_tag LOCUS_09460 19388 19182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 20293 19406 gene locus_tag LOCUS_09470 20293 19406 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582540.1 protein_id gnl|my_center|LOCUS_09470 21173 20319 gene locus_tag LOCUS_09480 21173 20319 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053343.1 protein_id gnl|my_center|LOCUS_09480 22553 21306 gene locus_tag LOCUS_09490 gene glgA 22553 21306 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068159.1 protein_id gnl|my_center|LOCUS_09490 23202 22732 gene locus_tag LOCUS_09500 23202 22732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812941.1 protein_id gnl|my_center|LOCUS_09500 23446 24609 gene locus_tag LOCUS_09510 23446 24609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 24606 25247 gene locus_tag LOCUS_09520 24606 25247 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125968857.1 protein_id gnl|my_center|LOCUS_09520 26254 25310 gene locus_tag LOCUS_09530 26254 25310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 27961 26429 gene locus_tag LOCUS_09540 27961 26429 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812939.1 protein_id gnl|my_center|LOCUS_09540 32534 27963 gene locus_tag LOCUS_09550 gene gltB 32534 27963 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389827.1 protein_id gnl|my_center|LOCUS_09550 32986 33207 gene locus_tag LOCUS_09560 32986 33207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 33325 33507 gene locus_tag LOCUS_09570 33325 33507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 34357 33572 gene locus_tag LOCUS_09580 34357 33572 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068074.1 protein_id gnl|my_center|LOCUS_09580 34874 34350 gene locus_tag LOCUS_09590 34874 34350 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068074.1 protein_id gnl|my_center|LOCUS_09590 35266 35970 gene locus_tag LOCUS_09600 35266 35970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 37709 36168 gene locus_tag LOCUS_09610 37709 36168 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812931.1 protein_id gnl|my_center|LOCUS_09610 38874 37975 gene locus_tag LOCUS_09620 38874 37975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 39026 39682 gene locus_tag LOCUS_09630 39026 39682 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762312.1 protein_id gnl|my_center|LOCUS_09630 41983 39752 gene locus_tag LOCUS_09640 41983 39752 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068490.1 protein_id gnl|my_center|LOCUS_09640 44514 41983 gene locus_tag LOCUS_09650 44514 41983 CDS product YhgE/Pip family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143686.1 protein_id gnl|my_center|LOCUS_09650 48178 44759 gene locus_tag LOCUS_09660 48178 44759 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775222.1 protein_id gnl|my_center|LOCUS_09660 48873 48172 gene locus_tag LOCUS_09670 48873 48172 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837230.1 protein_id gnl|my_center|LOCUS_09670 49167 49787 gene locus_tag LOCUS_09680 49167 49787 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984482.1 protein_id gnl|my_center|LOCUS_09680 50741 49878 gene locus_tag LOCUS_09690 50741 49878 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_09690 50947 51576 gene locus_tag LOCUS_09700 50947 51576 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_09700 51674 52531 gene locus_tag LOCUS_09710 51674 52531 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_09710 52613 53686 gene locus_tag LOCUS_09720 52613 53686 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_09720 54141 53809 gene locus_tag LOCUS_09730 54141 53809 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895125.1 protein_id gnl|my_center|LOCUS_09730 54140 54697 gene locus_tag LOCUS_09740 54140 54697 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816860.1 protein_id gnl|my_center|LOCUS_09740 57557 54861 gene locus_tag LOCUS_09750 57557 54861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 57823 58515 gene locus_tag LOCUS_09760 57823 58515 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_09760 58502 59593 gene locus_tag LOCUS_09770 58502 59593 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_09770 60565 59642 gene locus_tag LOCUS_09780 60565 59642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 <61334 60593 gene locus_tag LOCUS_09790 <61334 60593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223849864.1:ISL3 family transposase >Feature sequence015 89 292 gene locus_tag LOCUS_09800 89 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1159 329 gene locus_tag LOCUS_09810 1159 329 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812712.1 protein_id gnl|my_center|LOCUS_09810 2049 1159 gene locus_tag LOCUS_09820 2049 1159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053564.1 protein_id gnl|my_center|LOCUS_09820 3353 2232 gene locus_tag LOCUS_09830 3353 2232 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389774.1 protein_id gnl|my_center|LOCUS_09830 3460 4341 gene locus_tag LOCUS_09840 3460 4341 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389775.1 protein_id gnl|my_center|LOCUS_09840 4574 6055 gene locus_tag LOCUS_09850 gene rpsA 4574 6055 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812721.1 protein_id gnl|my_center|LOCUS_09850 6218 6871 gene locus_tag LOCUS_09860 gene coaE 6218 6871 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055464.1 protein_id gnl|my_center|LOCUS_09860 6871 8982 gene locus_tag LOCUS_09870 gene uvrB 6871 8982 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389776.1 protein_id gnl|my_center|LOCUS_09870 9128 10132 gene locus_tag LOCUS_09880 9128 10132 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812727.1 protein_id gnl|my_center|LOCUS_09880 10291 11733 gene locus_tag LOCUS_09890 gene pyk 10291 11733 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812729.1 protein_id gnl|my_center|LOCUS_09890 12443 11844 gene locus_tag LOCUS_09900 12443 11844 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051922.1 protein_id gnl|my_center|LOCUS_09900 12657 12731 gene locus_tag LOCUS_t00300 12657 12731 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12865 13668 gene locus_tag LOCUS_09910 12865 13668 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812733.1 protein_id gnl|my_center|LOCUS_09910 13661 16498 gene locus_tag LOCUS_09920 gene polA 13661 16498 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068236.1 protein_id gnl|my_center|LOCUS_09920 16581 17474 gene locus_tag LOCUS_09930 16581 17474 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582492.1 protein_id gnl|my_center|LOCUS_09930 17516 18103 gene locus_tag LOCUS_09940 17516 18103 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052016.1 protein_id gnl|my_center|LOCUS_09940 18230 20350 gene locus_tag LOCUS_09950 gene glgX 18230 20350 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055470.1 protein_id gnl|my_center|LOCUS_09950 21764 20493 gene locus_tag LOCUS_09960 21764 20493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389781.1 protein_id gnl|my_center|LOCUS_09960 22247 22321 gene locus_tag LOCUS_t00310 22247 22321 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22493 23140 gene locus_tag LOCUS_09970 22493 23140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 23950 23186 gene locus_tag LOCUS_09980 23950 23186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 24480 24070 gene locus_tag LOCUS_09990 24480 24070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033492239.1 protein_id gnl|my_center|LOCUS_09990 24908 24477 gene locus_tag LOCUS_10000 24908 24477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 27252 24910 gene locus_tag LOCUS_10010 27252 24910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 28063 27356 gene locus_tag LOCUS_10020 28063 27356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 29076 28129 gene locus_tag LOCUS_10030 29076 28129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 29459 29073 gene locus_tag LOCUS_10040 29459 29073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 30006 29611 gene locus_tag LOCUS_10050 30006 29611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 30292 29999 gene locus_tag LOCUS_10060 30292 29999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 30534 30286 gene locus_tag LOCUS_10070 30534 30286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 30903 30544 gene locus_tag LOCUS_10080 30903 30544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 31168 30929 gene locus_tag LOCUS_10090 31168 30929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 31243 31689 gene locus_tag LOCUS_10100 31243 31689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 31710 32132 gene locus_tag LOCUS_10110 31710 32132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389855.1 protein_id gnl|my_center|LOCUS_10110 32147 33538 gene locus_tag LOCUS_10120 32147 33538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 34152 33598 gene locus_tag LOCUS_10130 34152 33598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 35103 35285 gene locus_tag LOCUS_10140 35103 35285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 35396 35653 gene locus_tag LOCUS_10150 35396 35653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 35625 37103 gene locus_tag LOCUS_10160 35625 37103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 37117 38646 gene locus_tag LOCUS_10170 37117 38646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 38609 39391 gene locus_tag LOCUS_10180 38609 39391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 39455 39994 gene locus_tag LOCUS_10190 39455 39994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 40017 40937 gene locus_tag LOCUS_10200 40017 40937 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922461.1 protein_id gnl|my_center|LOCUS_10200 40937 41338 gene locus_tag LOCUS_10210 40937 41338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 41349 41777 gene locus_tag LOCUS_10220 41349 41777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 41774 42109 gene locus_tag LOCUS_10230 41774 42109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 42148 42381 gene locus_tag LOCUS_10240 42148 42381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 42381 42746 gene locus_tag LOCUS_10250 42381 42746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 42766 43512 gene locus_tag LOCUS_10260 42766 43512 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226354.1 protein_id gnl|my_center|LOCUS_10260 43612 43866 gene locus_tag LOCUS_10270 43612 43866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 43842 44282 gene locus_tag LOCUS_10280 43842 44282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 44299 47163 gene locus_tag LOCUS_10290 44299 47163 CDS product phage tail length tape measure family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963389.1 protein_id gnl|my_center|LOCUS_10290 47166 48011 gene locus_tag LOCUS_10300 47166 48011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 48030 50126 gene locus_tag LOCUS_10310 48030 50126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 50138 51457 gene locus_tag LOCUS_10320 50138 51457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 51464 51805 gene locus_tag LOCUS_10330 51464 51805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 51877 53076 gene locus_tag LOCUS_10340 51877 53076 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389917.1 protein_id gnl|my_center|LOCUS_10340 53463 53612 gene locus_tag LOCUS_10350 53463 53612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 53791 53582 gene locus_tag LOCUS_10360 53791 53582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 54466 53885 gene locus_tag LOCUS_10370 54466 53885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10370 54999 54721 gene locus_tag LOCUS_10380 54999 54721 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033512961.1 protein_id gnl|my_center|LOCUS_10380 55076 55390 gene locus_tag LOCUS_10390 55076 55390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 55387 56127 gene locus_tag LOCUS_10400 gene istB 55387 56127 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence016 247 498 gene locus_tag LOCUS_10410 247 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390368.1 protein_id gnl|my_center|LOCUS_10410 1134 739 gene locus_tag LOCUS_10420 1134 739 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814031.1 protein_id gnl|my_center|LOCUS_10420 1167 1481 gene locus_tag LOCUS_10430 1167 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1492 2190 gene locus_tag LOCUS_10440 1492 2190 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814034.1 protein_id gnl|my_center|LOCUS_10440 4185 2410 gene locus_tag LOCUS_10450 4185 2410 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055555.1 protein_id gnl|my_center|LOCUS_10450 4736 5101 gene locus_tag LOCUS_10460 4736 5101 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813590.1 protein_id gnl|my_center|LOCUS_10460 5211 5294 gene locus_tag LOCUS_t00320 5211 5294 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6720 5779 gene locus_tag LOCUS_10470 6720 5779 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053065.1 protein_id gnl|my_center|LOCUS_10470 6867 8555 gene locus_tag LOCUS_10480 6867 8555 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_10480 10084 8795 gene locus_tag LOCUS_10490 gene tgt 10084 8795 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389403.1 protein_id gnl|my_center|LOCUS_10490 10607 12580 gene locus_tag LOCUS_10500 10607 12580 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068543.1 protein_id gnl|my_center|LOCUS_10500 12934 15783 gene locus_tag LOCUS_10510 12934 15783 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068542.1 protein_id gnl|my_center|LOCUS_10510 16171 17640 gene locus_tag LOCUS_10520 16171 17640 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811466.1 protein_id gnl|my_center|LOCUS_10520 18064 19245 gene locus_tag LOCUS_10530 18064 19245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 19663 20598 gene locus_tag LOCUS_10540 gene htpX 19663 20598 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389407.1 protein_id gnl|my_center|LOCUS_10540 22496 20595 gene locus_tag LOCUS_10550 22496 20595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671827.1 protein_id gnl|my_center|LOCUS_10550 24382 22493 gene locus_tag LOCUS_10560 24382 22493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_10560 25279 24602 gene locus_tag LOCUS_10570 25279 24602 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389343.1 protein_id gnl|my_center|LOCUS_10570 26061 25366 gene locus_tag LOCUS_10580 26061 25366 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_10580 26253 26325 gene locus_tag LOCUS_t00330 26253 26325 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 26847 26775 gene locus_tag LOCUS_t00340 26847 26775 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 27039 27452 gene locus_tag LOCUS_10590 27039 27452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10590 27459 27734 gene locus_tag LOCUS_10600 27459 27734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 27821 28498 gene locus_tag LOCUS_10610 27821 28498 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389343.1 protein_id gnl|my_center|LOCUS_10610 28718 30607 gene locus_tag LOCUS_10620 28718 30607 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_10620 30604 32505 gene locus_tag LOCUS_10630 30604 32505 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671827.1 protein_id gnl|my_center|LOCUS_10630 33437 32502 gene locus_tag LOCUS_10640 gene htpX 33437 32502 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389407.1 protein_id gnl|my_center|LOCUS_10640 35036 33855 gene locus_tag LOCUS_10650 35036 33855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 36929 35460 gene locus_tag LOCUS_10660 36929 35460 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811466.1 protein_id gnl|my_center|LOCUS_10660 40166 37317 gene locus_tag LOCUS_10670 40166 37317 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068542.1 protein_id gnl|my_center|LOCUS_10670 42493 40520 gene locus_tag LOCUS_10680 42493 40520 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068543.1 protein_id gnl|my_center|LOCUS_10680 43016 44305 gene locus_tag LOCUS_10690 gene tgt 43016 44305 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389403.1 protein_id gnl|my_center|LOCUS_10690 46233 44545 gene locus_tag LOCUS_10700 46233 44545 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_10700 46380 47321 gene locus_tag LOCUS_10710 46380 47321 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053065.1 protein_id gnl|my_center|LOCUS_10710 47889 47806 gene locus_tag LOCUS_t00350 47889 47806 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 48364 47999 gene locus_tag LOCUS_10720 48364 47999 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813590.1 protein_id gnl|my_center|LOCUS_10720 48915 50690 gene locus_tag LOCUS_10730 48915 50690 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055555.1 protein_id gnl|my_center|LOCUS_10730 51608 50910 gene locus_tag LOCUS_10740 51608 50910 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814034.1 protein_id gnl|my_center|LOCUS_10740 51933 51619 gene locus_tag LOCUS_10750 51933 51619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 51966 52361 gene locus_tag LOCUS_10760 51966 52361 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814031.1 protein_id gnl|my_center|LOCUS_10760 52853 52602 gene locus_tag LOCUS_10770 52853 52602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390368.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence017 <1 570 gene locus_tag LOCUS_10780 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972061.1:IS3-like element ISAtu3 family transposase 1845 769 gene locus_tag LOCUS_10790 1845 769 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258589.1 protein_id gnl|my_center|LOCUS_10790 2646 1849 gene locus_tag LOCUS_10800 2646 1849 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 protein_id gnl|my_center|LOCUS_10800 3629 2757 gene locus_tag LOCUS_10810 3629 2757 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256269.1 protein_id gnl|my_center|LOCUS_10810 4990 3731 gene locus_tag LOCUS_10820 4990 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 6664 5222 gene locus_tag LOCUS_10830 6664 5222 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296810.1 protein_id gnl|my_center|LOCUS_10830 6957 7118 gene locus_tag LOCUS_10840 6957 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 7130 7474 gene locus_tag LOCUS_10850 7130 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 7488 7865 gene locus_tag LOCUS_10860 7488 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 7890 8378 gene locus_tag LOCUS_10870 7890 8378 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363541.1 protein_id gnl|my_center|LOCUS_10870 8977 8471 gene locus_tag LOCUS_10880 8977 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 9233 9628 gene locus_tag LOCUS_10890 9233 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 9610 11052 gene locus_tag LOCUS_10900 9610 11052 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389442.1 protein_id gnl|my_center|LOCUS_10900 11083 12000 gene locus_tag LOCUS_10910 11083 12000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 12012 12335 gene locus_tag LOCUS_10920 12012 12335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 12332 12742 gene locus_tag LOCUS_10930 12332 12742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 12739 14412 gene locus_tag LOCUS_10940 12739 14412 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010247013.1 protein_id gnl|my_center|LOCUS_10940 14564 14637 gene locus_tag LOCUS_t00360 14564 14637 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 14798 16267 gene locus_tag LOCUS_10950 14798 16267 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109309.1 protein_id gnl|my_center|LOCUS_10950 17589 16582 gene locus_tag LOCUS_10960 17589 16582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 18166 17621 gene locus_tag LOCUS_10970 18166 17621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 18842 18195 gene locus_tag LOCUS_10980 18842 18195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 18757 19107 gene locus_tag LOCUS_10990 18757 19107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 21835 19514 gene locus_tag LOCUS_11000 21835 19514 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861114.1 protein_id gnl|my_center|LOCUS_11000 22242 21877 gene locus_tag LOCUS_11010 22242 21877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 23120 22269 gene locus_tag LOCUS_11020 23120 22269 CDS product conjugal transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980125.1 protein_id gnl|my_center|LOCUS_11020 23388 23185 gene locus_tag LOCUS_11030 23388 23185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 26462 23553 gene locus_tag LOCUS_11040 26462 23553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 28457 26745 gene locus_tag LOCUS_11050 28457 26745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 29251 28997 gene locus_tag LOCUS_11060 29251 28997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 29838 29272 gene locus_tag LOCUS_11070 29838 29272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 31018 29981 gene locus_tag LOCUS_11080 31018 29981 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389526.1 protein_id gnl|my_center|LOCUS_11080 31548 31715 gene locus_tag LOCUS_11090 31548 31715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 31736 32260 gene locus_tag LOCUS_11100 31736 32260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 32550 32332 gene locus_tag LOCUS_11110 32550 32332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 33128 32547 gene locus_tag LOCUS_11120 33128 32547 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058038.1 protein_id gnl|my_center|LOCUS_11120 33758 33177 gene locus_tag LOCUS_11130 33758 33177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 35110 33758 gene locus_tag LOCUS_11140 35110 33758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 35902 35453 gene locus_tag LOCUS_11150 35902 35453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 36565 36801 gene locus_tag LOCUS_11160 36565 36801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 36843 37448 gene locus_tag LOCUS_11170 36843 37448 CDS product IS607-like element ISSto13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980553.1 protein_id gnl|my_center|LOCUS_11170 37450 38877 gene locus_tag LOCUS_11180 37450 38877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 39263 39562 gene locus_tag LOCUS_11190 39263 39562 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051803.1 protein_id gnl|my_center|LOCUS_11190 39559 40131 gene locus_tag LOCUS_11200 39559 40131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 40319 42463 gene locus_tag LOCUS_11210 gene nrdE 40319 42463 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054636.1 protein_id gnl|my_center|LOCUS_11210 42482 43474 gene locus_tag LOCUS_11220 gene nrdF 42482 43474 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390262.1 protein_id gnl|my_center|LOCUS_11220 44229 43537 gene locus_tag LOCUS_11230 44229 43537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 45153 44401 gene locus_tag LOCUS_11240 45153 44401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068101.1 protein_id gnl|my_center|LOCUS_11240 46877 45150 gene locus_tag LOCUS_11250 46877 45150 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068102.1 protein_id gnl|my_center|LOCUS_11250 47674 46874 gene locus_tag LOCUS_11260 47674 46874 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081892068.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11260 48345 47710 gene locus_tag LOCUS_11270 48345 47710 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054303.1 protein_id gnl|my_center|LOCUS_11270 49137 48889 gene locus_tag LOCUS_11280 49137 48889 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811543.1 protein_id gnl|my_center|LOCUS_11280 49657 49235 gene locus_tag LOCUS_11290 49657 49235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 49732 51318 gene locus_tag LOCUS_11300 49732 51318 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054723.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence018 1592 150 gene locus_tag LOCUS_11310 1592 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1877 2899 gene locus_tag LOCUS_11320 1877 2899 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389470.1 protein_id gnl|my_center|LOCUS_11320 3948 2905 gene locus_tag LOCUS_11330 3948 2905 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_11330 4225 5850 gene locus_tag LOCUS_11340 4225 5850 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_11340 5965 6948 gene locus_tag LOCUS_11350 5965 6948 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_11350 6962 7927 gene locus_tag LOCUS_11360 6962 7927 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_11360 7951 10074 gene locus_tag LOCUS_11370 7951 10074 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_11370 10160 12226 gene locus_tag LOCUS_11380 10160 12226 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036927.1 protein_id gnl|my_center|LOCUS_11380 12329 13609 gene locus_tag LOCUS_11390 12329 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 13735 15594 gene locus_tag LOCUS_11400 13735 15594 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994209.1 protein_id gnl|my_center|LOCUS_11400 16953 15838 gene locus_tag LOCUS_11410 16953 15838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 17999 16950 gene locus_tag LOCUS_11420 17999 16950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 19963 18308 gene locus_tag LOCUS_11430 19963 18308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 20904 19960 gene locus_tag LOCUS_11440 20904 19960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 22803 21304 gene locus_tag LOCUS_11450 22803 21304 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782901.1 protein_id gnl|my_center|LOCUS_11450 23197 23928 gene locus_tag LOCUS_11460 23197 23928 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068849.1 protein_id gnl|my_center|LOCUS_11460 24128 24203 gene locus_tag LOCUS_t00370 24128 24203 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 24461 24673 gene locus_tag LOCUS_11470 gene rpmE 24461 24673 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814855.1 protein_id gnl|my_center|LOCUS_11470 25049 26137 gene locus_tag LOCUS_11480 gene prfA 25049 26137 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052437.1 protein_id gnl|my_center|LOCUS_11480 26333 27229 gene locus_tag LOCUS_11490 gene prmC 26333 27229 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818926.1 protein_id gnl|my_center|LOCUS_11490 27971 27300 gene locus_tag LOCUS_11500 27971 27300 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 protein_id gnl|my_center|LOCUS_11500 28331 28990 gene locus_tag LOCUS_11510 28331 28990 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814862.1 protein_id gnl|my_center|LOCUS_11510 28987 30147 gene locus_tag LOCUS_11520 28987 30147 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814864.1 protein_id gnl|my_center|LOCUS_11520 30230 31780 gene locus_tag LOCUS_11530 gene guaB 30230 31780 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814866.1 protein_id gnl|my_center|LOCUS_11530 31944 32591 gene locus_tag LOCUS_11540 gene orn 31944 32591 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052450.1 protein_id gnl|my_center|LOCUS_11540 32656 34098 gene locus_tag LOCUS_11550 32656 34098 CDS product PIF1 family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068808.1 protein_id gnl|my_center|LOCUS_11550 34159 35943 gene locus_tag LOCUS_11560 34159 35943 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055676.1 protein_id gnl|my_center|LOCUS_11560 36124 37362 gene locus_tag LOCUS_11570 36124 37362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 38750 37488 gene locus_tag LOCUS_11580 38750 37488 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068660.1 protein_id gnl|my_center|LOCUS_11580 38880 39875 gene locus_tag LOCUS_11590 38880 39875 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389548.1 protein_id gnl|my_center|LOCUS_11590 39941 41674 gene locus_tag LOCUS_11600 39941 41674 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100342827.1 protein_id gnl|my_center|LOCUS_11600 41989 42732 gene locus_tag LOCUS_11610 41989 42732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 42787 43080 gene locus_tag LOCUS_11620 42787 43080 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969011.1 protein_id gnl|my_center|LOCUS_11620 43052 43381 gene locus_tag LOCUS_11630 43052 43381 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530252.1 protein_id gnl|my_center|LOCUS_11630 45771 43684 gene locus_tag LOCUS_11640 45771 43684 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390147.1 protein_id gnl|my_center|LOCUS_11640 45950 46864 gene locus_tag LOCUS_11650 45950 46864 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814886.1 protein_id gnl|my_center|LOCUS_11650 46889 47671 gene locus_tag LOCUS_11660 gene map 46889 47671 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052460.1 protein_id gnl|my_center|LOCUS_11660 47841 49133 gene locus_tag LOCUS_11670 47841 49133 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053894.1 protein_id gnl|my_center|LOCUS_11670 49360 50535 gene locus_tag LOCUS_11680 49360 50535 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167582487.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence019 692 1858 gene locus_tag LOCUS_11690 692 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1855 2070 gene locus_tag LOCUS_11700 1855 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3634 2198 gene locus_tag LOCUS_11710 gene glnA 3634 2198 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068284.1 protein_id gnl|my_center|LOCUS_11710 4770 3955 gene locus_tag LOCUS_11720 4770 3955 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819509.1 protein_id gnl|my_center|LOCUS_11720 6382 4844 gene locus_tag LOCUS_11730 6382 4844 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051179.1 protein_id gnl|my_center|LOCUS_11730 7086 6475 gene locus_tag LOCUS_11740 7086 6475 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812622.1 protein_id gnl|my_center|LOCUS_11740 7196 8563 gene locus_tag LOCUS_11750 7196 8563 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389742.1 protein_id gnl|my_center|LOCUS_11750 9260 8604 gene locus_tag LOCUS_11760 9260 8604 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816947.1 protein_id gnl|my_center|LOCUS_11760 10513 9263 gene locus_tag LOCUS_11770 10513 9263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 11266 11844 gene locus_tag LOCUS_11780 11266 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 12203 12958 gene locus_tag LOCUS_11790 12203 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 13410 14483 gene locus_tag LOCUS_11800 13410 14483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389743.1 protein_id gnl|my_center|LOCUS_11800 14480 15136 gene locus_tag LOCUS_11810 14480 15136 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389744.1 protein_id gnl|my_center|LOCUS_11810 15133 16218 gene locus_tag LOCUS_11820 15133 16218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389745.1 protein_id gnl|my_center|LOCUS_11820 16502 17101 gene locus_tag LOCUS_11830 16502 17101 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782764.1 protein_id gnl|my_center|LOCUS_11830 17303 19873 gene locus_tag LOCUS_11840 17303 19873 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116779.1 protein_id gnl|my_center|LOCUS_11840 20306 22123 gene locus_tag LOCUS_11850 20306 22123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 22170 22853 gene locus_tag LOCUS_11860 22170 22853 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986489.1 protein_id gnl|my_center|LOCUS_11860 22987 23871 gene locus_tag LOCUS_11870 22987 23871 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053618.1 protein_id gnl|my_center|LOCUS_11870 24011 25072 gene locus_tag LOCUS_11880 gene pheS 24011 25072 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813536.1 protein_id gnl|my_center|LOCUS_11880 25081 27687 gene locus_tag LOCUS_11890 gene pheT 25081 27687 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053616.1 protein_id gnl|my_center|LOCUS_11890 27790 28506 gene locus_tag LOCUS_11900 27790 28506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782767.1 protein_id gnl|my_center|LOCUS_11900 28650 29744 gene locus_tag LOCUS_11910 gene argC 28650 29744 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068279.1 protein_id gnl|my_center|LOCUS_11910 29741 30913 gene locus_tag LOCUS_11920 gene argJ 29741 30913 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068278.1 protein_id gnl|my_center|LOCUS_11920 31065 32021 gene locus_tag LOCUS_11930 gene argB 31065 32021 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068277.1 protein_id gnl|my_center|LOCUS_11930 32011 33306 gene locus_tag LOCUS_11940 32011 33306 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056889.1 protein_id gnl|my_center|LOCUS_11940 33376 34341 gene locus_tag LOCUS_11950 gene argF 33376 34341 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813521.1 protein_id gnl|my_center|LOCUS_11950 34397 34858 gene locus_tag LOCUS_11960 gene argR 34397 34858 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817270.1 protein_id gnl|my_center|LOCUS_11960 34938 36176 gene locus_tag LOCUS_11970 34938 36176 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068275.1 protein_id gnl|my_center|LOCUS_11970 36344 37837 gene locus_tag LOCUS_11980 gene argH 36344 37837 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363574.1 protein_id gnl|my_center|LOCUS_11980 38074 38883 gene locus_tag LOCUS_11990 gene thiF 38074 38883 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056327.1 protein_id gnl|my_center|LOCUS_11990 39026 40276 gene locus_tag LOCUS_12000 39026 40276 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389602.1 protein_id gnl|my_center|LOCUS_12000 40428 40940 gene locus_tag LOCUS_12010 40428 40940 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390016.1 protein_id gnl|my_center|LOCUS_12010 40944 41807 gene locus_tag LOCUS_12020 40944 41807 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818363.1 protein_id gnl|my_center|LOCUS_12020 41916 43238 gene locus_tag LOCUS_12030 gene tyrS 41916 43238 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813495.1 protein_id gnl|my_center|LOCUS_12030 43345 45411 gene locus_tag LOCUS_12040 43345 45411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 45420 46451 gene locus_tag LOCUS_12050 45420 46451 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390014.1 protein_id gnl|my_center|LOCUS_12050 46533 46712 gene locus_tag LOCUS_12060 46533 46712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 46714 47535 gene locus_tag LOCUS_12070 46714 47535 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051151.1 protein_id gnl|my_center|LOCUS_12070 48330 47677 gene locus_tag LOCUS_12080 48330 47677 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818088.1 protein_id gnl|my_center|LOCUS_12080 49845 48382 gene locus_tag LOCUS_12090 49845 48382 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390013.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence020 243 575 gene locus_tag LOCUS_12100 243 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 551 1750 gene locus_tag LOCUS_12110 551 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2061 1777 gene locus_tag LOCUS_12120 2061 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 3392 2268 gene locus_tag LOCUS_12130 3392 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3837 3673 gene locus_tag LOCUS_12140 3837 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 4319 3834 gene locus_tag LOCUS_12150 4319 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 5242 4457 gene locus_tag LOCUS_12160 5242 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 5649 5239 gene locus_tag LOCUS_12170 5649 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 6179 5571 gene locus_tag LOCUS_12180 6179 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12180 6700 6176 gene locus_tag LOCUS_12190 6700 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 7716 6865 gene locus_tag LOCUS_12200 7716 6865 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389330.1 protein_id gnl|my_center|LOCUS_12200 8950 8057 gene locus_tag LOCUS_12210 8950 8057 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219082261.1 protein_id gnl|my_center|LOCUS_12210 10060 9722 gene locus_tag LOCUS_12220 10060 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 10394 10152 gene locus_tag LOCUS_12230 10394 10152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 12421 11453 gene locus_tag LOCUS_12240 12421 11453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 15632 12738 gene locus_tag LOCUS_12250 15632 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 15822 15697 gene locus_tag LOCUS_12260 15822 15697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 16587 16168 gene locus_tag LOCUS_12270 16587 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12270 17078 16590 gene locus_tag LOCUS_12280 17078 16590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12280 18624 17413 gene locus_tag LOCUS_12290 18624 17413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 19001 18606 gene locus_tag LOCUS_12300 19001 18606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 19246 19650 gene locus_tag LOCUS_12310 19246 19650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 20516 19701 gene locus_tag LOCUS_12320 20516 19701 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582540.1 protein_id gnl|my_center|LOCUS_12320 21575 20649 gene locus_tag LOCUS_12330 21575 20649 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803903.1 protein_id gnl|my_center|LOCUS_12330 21910 22863 gene locus_tag LOCUS_12340 21910 22863 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382199.1 protein_id gnl|my_center|LOCUS_12340 22876 23787 gene locus_tag LOCUS_12350 22876 23787 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_12350 23818 25446 gene locus_tag LOCUS_12360 23818 25446 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 protein_id gnl|my_center|LOCUS_12360 25533 26879 gene locus_tag LOCUS_12370 25533 26879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 26876 27481 gene locus_tag LOCUS_12380 26876 27481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 27564 28277 gene locus_tag LOCUS_12390 27564 28277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 28449 29147 gene locus_tag LOCUS_12400 28449 29147 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820352.1 protein_id gnl|my_center|LOCUS_12400 29412 30773 gene locus_tag LOCUS_12410 29412 30773 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363970.1 protein_id gnl|my_center|LOCUS_12410 30945 31244 gene locus_tag LOCUS_12420 30945 31244 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814192.1 protein_id gnl|my_center|LOCUS_12420 31302 31628 gene locus_tag LOCUS_12430 31302 31628 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390312.1 protein_id gnl|my_center|LOCUS_12430 31662 33098 gene locus_tag LOCUS_12440 31662 33098 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390311.1 protein_id gnl|my_center|LOCUS_12440 33142 33402 gene locus_tag LOCUS_12450 33142 33402 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_12450 33402 35030 gene locus_tag LOCUS_12460 gene ptsP 33402 35030 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_12460 35034 35972 gene locus_tag LOCUS_12470 35034 35972 CDS product chitosanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228755.1 protein_id gnl|my_center|LOCUS_12470 36668 36027 gene locus_tag LOCUS_12480 36668 36027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 36667 37128 gene locus_tag LOCUS_12490 36667 37128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 38428 37736 gene locus_tag LOCUS_12500 38428 37736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 39499 38492 gene locus_tag LOCUS_12510 gene msrB 39499 38492 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055903.1 protein_id gnl|my_center|LOCUS_12510 41009 39552 gene locus_tag LOCUS_12520 41009 39552 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816121.1 protein_id gnl|my_center|LOCUS_12520 41882 41319 gene locus_tag LOCUS_12530 41882 41319 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390315.1 protein_id gnl|my_center|LOCUS_12530 42857 42060 gene locus_tag LOCUS_12540 42857 42060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068491.1 protein_id gnl|my_center|LOCUS_12540 44177 42891 gene locus_tag LOCUS_12550 44177 42891 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068492.1 protein_id gnl|my_center|LOCUS_12550 45529 44222 gene locus_tag LOCUS_12560 45529 44222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814180.1 protein_id gnl|my_center|LOCUS_12560 46825 45548 gene locus_tag LOCUS_12570 46825 45548 CDS product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054710.1 protein_id gnl|my_center|LOCUS_12570 47775 47077 gene locus_tag LOCUS_12580 47775 47077 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390319.1 protein_id gnl|my_center|LOCUS_12580 49660 47831 gene locus_tag LOCUS_12590 49660 47831 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390320.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence021 3019 3882 gene locus_tag LOCUS_12600 3019 3882 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811435.1 protein_id gnl|my_center|LOCUS_12600 6159 3928 gene locus_tag LOCUS_12610 6159 3928 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836501.1 protein_id gnl|my_center|LOCUS_12610 7791 6307 gene locus_tag LOCUS_12620 7791 6307 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068714.1 protein_id gnl|my_center|LOCUS_12620 8896 7898 gene locus_tag LOCUS_12630 gene thrB 8896 7898 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811687.1 protein_id gnl|my_center|LOCUS_12630 10305 8992 gene locus_tag LOCUS_12640 10305 8992 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389478.1 protein_id gnl|my_center|LOCUS_12640 10711 12282 gene locus_tag LOCUS_12650 gene nagE 10711 12282 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815380.1 protein_id gnl|my_center|LOCUS_12650 12279 12791 gene locus_tag LOCUS_12660 12279 12791 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363031.1 protein_id gnl|my_center|LOCUS_12660 14528 12915 gene locus_tag LOCUS_12670 14528 12915 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389477.1 protein_id gnl|my_center|LOCUS_12670 16351 14534 gene locus_tag LOCUS_12680 gene argS 16351 14534 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820794.1 protein_id gnl|my_center|LOCUS_12680 17642 16557 gene locus_tag LOCUS_12690 17642 16557 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143204.1 protein_id gnl|my_center|LOCUS_12690 18426 18037 gene locus_tag LOCUS_12700 18426 18037 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054771.1 protein_id gnl|my_center|LOCUS_12700 19180 19105 gene locus_tag LOCUS_t00380 19180 19105 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19268 19882 gene locus_tag LOCUS_12710 19268 19882 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081633.1 protein_id gnl|my_center|LOCUS_12710 20870 19899 gene locus_tag LOCUS_12720 20870 19899 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389468.1 protein_id gnl|my_center|LOCUS_12720 21995 20991 gene locus_tag LOCUS_12730 21995 20991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051473.1 protein_id gnl|my_center|LOCUS_12730 23401 21992 gene locus_tag LOCUS_12740 23401 21992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 23546 24574 gene locus_tag LOCUS_12750 23546 24574 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389466.1 protein_id gnl|my_center|LOCUS_12750 25442 24663 gene locus_tag LOCUS_12760 gene nucS 25442 24663 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363923.1 protein_id gnl|my_center|LOCUS_12760 25959 25651 gene locus_tag LOCUS_12770 25959 25651 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817785.1 protein_id gnl|my_center|LOCUS_12770 27446 25959 gene locus_tag LOCUS_12780 gene atpD 27446 25959 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814333.1 protein_id gnl|my_center|LOCUS_12780 28377 27451 gene locus_tag LOCUS_12790 28377 27451 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814331.1 protein_id gnl|my_center|LOCUS_12790 30060 28381 gene locus_tag LOCUS_12800 gene atpA 30060 28381 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814328.1 protein_id gnl|my_center|LOCUS_12800 30991 30164 gene locus_tag LOCUS_12810 30991 30164 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819067.1 protein_id gnl|my_center|LOCUS_12810 31578 31054 gene locus_tag LOCUS_12820 31578 31054 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051482.1 protein_id gnl|my_center|LOCUS_12820 31864 31637 gene locus_tag LOCUS_12830 gene atpE 31864 31637 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003831420.1 protein_id gnl|my_center|LOCUS_12830 32806 31994 gene locus_tag LOCUS_12840 gene atpB 32806 31994 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051483.1 protein_id gnl|my_center|LOCUS_12840 34191 33157 gene locus_tag LOCUS_12850 gene metA 34191 33157 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054763.1 protein_id gnl|my_center|LOCUS_12850 34427 34501 gene locus_tag LOCUS_t00390 34427 34501 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 34602 35426 gene locus_tag LOCUS_12860 34602 35426 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219082261.1 protein_id gnl|my_center|LOCUS_12860 35887 35624 gene locus_tag LOCUS_12870 35887 35624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 37159 35900 gene locus_tag LOCUS_12880 37159 35900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 37521 37213 gene locus_tag LOCUS_12890 37521 37213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 38651 37440 gene locus_tag LOCUS_12900 38651 37440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 39473 39045 gene locus_tag LOCUS_12910 39473 39045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 40907 39537 gene locus_tag LOCUS_12920 40907 39537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 42790 40907 gene locus_tag LOCUS_12930 42790 40907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 45341 42801 gene locus_tag LOCUS_12940 45341 42801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 46130 45351 gene locus_tag LOCUS_12950 46130 45351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 <47995 46127 gene locus_tag LOCUS_12960 <47995 46127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003271441.1:phage tail tape measure protein >Feature sequence022 <1 1212 gene locus_tag LOCUS_12970 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068831.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme 1262 2239 gene locus_tag LOCUS_12980 1262 2239 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143687.1 protein_id gnl|my_center|LOCUS_12980 2675 4384 gene locus_tag LOCUS_12990 2675 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 4384 5052 gene locus_tag LOCUS_13000 4384 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056824.1 protein_id gnl|my_center|LOCUS_13000 5049 6140 gene locus_tag LOCUS_13010 5049 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 6200 7387 gene locus_tag LOCUS_13020 6200 7387 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_13020 7543 8727 gene locus_tag LOCUS_13030 7543 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 9023 10558 gene locus_tag LOCUS_13040 gene gtfA 9023 10558 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068532.1 protein_id gnl|my_center|LOCUS_13040 10825 11526 gene locus_tag LOCUS_13050 10825 11526 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057487.1 protein_id gnl|my_center|LOCUS_13050 13244 11592 gene locus_tag LOCUS_13060 13244 11592 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_13060 14841 13393 gene locus_tag LOCUS_13070 14841 13393 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296810.1 protein_id gnl|my_center|LOCUS_13070 15463 16737 gene locus_tag LOCUS_13080 15463 16737 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582923.1 protein_id gnl|my_center|LOCUS_13080 16818 17696 gene locus_tag LOCUS_13090 16818 17696 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_13090 17696 18556 gene locus_tag LOCUS_13100 17696 18556 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_13100 18709 19818 gene locus_tag LOCUS_13110 18709 19818 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_13110 20885 19938 gene locus_tag LOCUS_13120 20885 19938 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803903.1 protein_id gnl|my_center|LOCUS_13120 21235 22368 gene locus_tag LOCUS_13130 21235 22368 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068530.1 protein_id gnl|my_center|LOCUS_13130 22499 24169 gene locus_tag LOCUS_13140 22499 24169 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389417.1 protein_id gnl|my_center|LOCUS_13140 24702 26048 gene locus_tag LOCUS_13150 24702 26048 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582327.1 protein_id gnl|my_center|LOCUS_13150 26459 27511 gene locus_tag LOCUS_13160 gene ilvC 26459 27511 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811512.1 protein_id gnl|my_center|LOCUS_13160 28094 29146 gene locus_tag LOCUS_13170 gene ilvC 28094 29146 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051650.1 protein_id gnl|my_center|LOCUS_13170 31489 29462 gene locus_tag LOCUS_13180 31489 29462 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_13180 32748 31522 gene locus_tag LOCUS_13190 32748 31522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 32948 34345 gene locus_tag LOCUS_13200 32948 34345 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_13200 34749 36422 gene locus_tag LOCUS_13210 34749 36422 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803788.1 protein_id gnl|my_center|LOCUS_13210 36454 37443 gene locus_tag LOCUS_13220 36454 37443 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_13220 37468 38502 gene locus_tag LOCUS_13230 37468 38502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13230 38499 39080 gene locus_tag LOCUS_13240 38499 39080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13240 39080 39454 gene locus_tag LOCUS_13250 39080 39454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13250 39460 40284 gene locus_tag LOCUS_13260 39460 40284 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803792.1 protein_id gnl|my_center|LOCUS_13260 40361 43201 gene locus_tag LOCUS_13270 40361 43201 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803793.1 protein_id gnl|my_center|LOCUS_13270 43313 44350 gene locus_tag LOCUS_13280 43313 44350 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972694.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence023 <1 1078 gene locus_tag LOCUS_13290 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039046.1:beta-xylosidase 1090 3369 gene locus_tag LOCUS_13300 1090 3369 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_13300 3366 5702 gene locus_tag LOCUS_13310 3366 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 5989 7320 gene locus_tag LOCUS_13320 5989 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 7449 8381 gene locus_tag LOCUS_13330 7449 8381 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_13330 8378 9331 gene locus_tag LOCUS_13340 8378 9331 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192007.1 protein_id gnl|my_center|LOCUS_13340 9335 10039 gene locus_tag LOCUS_13350 9335 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 10102 11154 gene locus_tag LOCUS_13360 10102 11154 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228701.1 protein_id gnl|my_center|LOCUS_13360 11354 12748 gene locus_tag LOCUS_13370 11354 12748 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226064.1 protein_id gnl|my_center|LOCUS_13370 13158 14123 gene locus_tag LOCUS_13380 13158 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032736338.1 protein_id gnl|my_center|LOCUS_13380 14677 15606 gene locus_tag LOCUS_13390 14677 15606 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_13390 15649 16632 gene locus_tag LOCUS_13400 15649 16632 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_13400 17171 18856 gene locus_tag LOCUS_13410 17171 18856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 19010 19735 gene locus_tag LOCUS_13420 19010 19735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 19792 20574 gene locus_tag LOCUS_13430 19792 20574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 20744 21829 gene locus_tag LOCUS_13440 20744 21829 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311957.1 protein_id gnl|my_center|LOCUS_13440 21892 25920 gene locus_tag LOCUS_13450 21892 25920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 26162 27487 gene locus_tag LOCUS_13460 26162 27487 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111886.1 protein_id gnl|my_center|LOCUS_13460 27940 28614 gene locus_tag LOCUS_13470 27940 28614 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_13470 28916 29998 gene locus_tag LOCUS_13480 28916 29998 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027040.1 protein_id gnl|my_center|LOCUS_13480 30715 32061 gene locus_tag LOCUS_13490 30715 32061 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152358733.1 protein_id gnl|my_center|LOCUS_13490 32216 33142 gene locus_tag LOCUS_13500 32216 33142 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775733.1 protein_id gnl|my_center|LOCUS_13500 33139 34125 gene locus_tag LOCUS_13510 33139 34125 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225934.1 protein_id gnl|my_center|LOCUS_13510 34305 35750 gene locus_tag LOCUS_13520 34305 35750 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108267.1 protein_id gnl|my_center|LOCUS_13520 35809 36855 gene locus_tag LOCUS_13530 35809 36855 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582297.1 protein_id gnl|my_center|LOCUS_13530 37319 39019 gene locus_tag LOCUS_13540 37319 39019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 39453 40949 gene locus_tag LOCUS_13550 39453 40949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 41230 42381 gene locus_tag LOCUS_13560 41230 42381 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776873.1 protein_id gnl|my_center|LOCUS_13560 42451 43272 gene locus_tag LOCUS_13570 42451 43272 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529695.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence024 1028 90 gene locus_tag LOCUS_13580 gene lgt 1028 90 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389930.1 protein_id gnl|my_center|LOCUS_13580 2016 1147 gene locus_tag LOCUS_13590 gene trpA 2016 1147 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813197.1 protein_id gnl|my_center|LOCUS_13590 4125 2038 gene locus_tag LOCUS_13600 4125 2038 CDS product bifunctional indole-3-glycerol phosphate synthase/tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068116.1 protein_id gnl|my_center|LOCUS_13600 4619 5425 gene locus_tag LOCUS_13610 4619 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056960.1 protein_id gnl|my_center|LOCUS_13610 6137 5403 gene locus_tag LOCUS_13620 6137 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 7980 6424 gene locus_tag LOCUS_13630 gene trpE 7980 6424 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052763.1 protein_id gnl|my_center|LOCUS_13630 8414 7977 gene locus_tag LOCUS_13640 gene hisI 8414 7977 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052762.1 protein_id gnl|my_center|LOCUS_13640 9276 8506 gene locus_tag LOCUS_13650 gene hisF 9276 8506 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813327.1 protein_id gnl|my_center|LOCUS_13650 10268 9399 gene locus_tag LOCUS_13660 10268 9399 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389950.1 protein_id gnl|my_center|LOCUS_13660 11215 10265 gene locus_tag LOCUS_13670 11215 10265 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056108.1 protein_id gnl|my_center|LOCUS_13670 11574 11317 gene locus_tag LOCUS_13680 gene secG 11574 11317 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813271.1 protein_id gnl|my_center|LOCUS_13680 12513 11716 gene locus_tag LOCUS_13690 gene tpiA 12513 11716 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389952.1 protein_id gnl|my_center|LOCUS_13690 13819 12614 gene locus_tag LOCUS_13700 13819 12614 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032737730.1 protein_id gnl|my_center|LOCUS_13700 14926 13979 gene locus_tag LOCUS_13710 gene whiA 14926 13979 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813277.1 protein_id gnl|my_center|LOCUS_13710 16080 15112 gene locus_tag LOCUS_13720 gene rapZ 16080 15112 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363500.1 protein_id gnl|my_center|LOCUS_13720 17036 16080 gene locus_tag LOCUS_13730 17036 16080 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389953.1 protein_id gnl|my_center|LOCUS_13730 19488 17167 gene locus_tag LOCUS_13740 gene uvrC 19488 17167 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389954.1 protein_id gnl|my_center|LOCUS_13740 22491 19495 gene locus_tag LOCUS_13750 gene uvrA 22491 19495 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813285.1 protein_id gnl|my_center|LOCUS_13750 23514 22882 gene locus_tag LOCUS_13760 23514 22882 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068552.1 protein_id gnl|my_center|LOCUS_13760 23753 25177 gene locus_tag LOCUS_13770 23753 25177 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080642.1 protein_id gnl|my_center|LOCUS_13770 25273 25689 gene locus_tag LOCUS_13780 25273 25689 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813566.1 protein_id gnl|my_center|LOCUS_13780 25824 27203 gene locus_tag LOCUS_13790 25824 27203 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582535.1 protein_id gnl|my_center|LOCUS_13790 27229 27594 gene locus_tag LOCUS_13800 27229 27594 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818305.1 protein_id gnl|my_center|LOCUS_13800 31095 27562 gene locus_tag LOCUS_13810 31095 27562 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389979.1 protein_id gnl|my_center|LOCUS_13810 31816 31097 gene locus_tag LOCUS_13820 31816 31097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 33354 31813 gene locus_tag LOCUS_13830 33354 31813 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389981.1 protein_id gnl|my_center|LOCUS_13830 34675 33440 gene locus_tag LOCUS_13840 34675 33440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214357246.1 protein_id gnl|my_center|LOCUS_13840 35369 34668 gene locus_tag LOCUS_13850 35369 34668 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225402.1 protein_id gnl|my_center|LOCUS_13850 36487 35366 gene locus_tag LOCUS_13860 36487 35366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 37303 36551 gene locus_tag LOCUS_13870 37303 36551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 38321 37530 gene locus_tag LOCUS_13880 38321 37530 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003822863.1 protein_id gnl|my_center|LOCUS_13880 39190 38513 gene locus_tag LOCUS_13890 gene pcp 39190 38513 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390168.1 protein_id gnl|my_center|LOCUS_13890 39417 41018 gene locus_tag LOCUS_13900 39417 41018 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813299.1 protein_id gnl|my_center|LOCUS_13900 41096 42133 gene locus_tag LOCUS_13910 41096 42133 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_13910 42264 43391 gene locus_tag LOCUS_13920 42264 43391 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence025 <1 2935 gene locus_tag LOCUS_13930 <1 2935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582726.1:glycoside hydrolase family 3 protein 2966 4279 gene locus_tag LOCUS_13940 2966 4279 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_13940 4373 4579 gene locus_tag LOCUS_13950 4373 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 5214 4549 gene locus_tag LOCUS_13960 5214 4549 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710135.1 protein_id gnl|my_center|LOCUS_13960 5441 6466 gene locus_tag LOCUS_13970 5441 6466 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_13970 6498 7430 gene locus_tag LOCUS_13980 6498 7430 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_13980 7556 9307 gene locus_tag LOCUS_13990 7556 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 9490 10965 gene locus_tag LOCUS_14000 9490 10965 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_14000 11049 13226 gene locus_tag LOCUS_14010 11049 13226 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_14010 13437 15476 gene locus_tag LOCUS_14020 gene yicI 13437 15476 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254435.1 protein_id gnl|my_center|LOCUS_14020 15580 17139 gene locus_tag LOCUS_14030 15580 17139 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228195.1 protein_id gnl|my_center|LOCUS_14030 17170 19299 gene locus_tag LOCUS_14040 17170 19299 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254470.1 protein_id gnl|my_center|LOCUS_14040 19346 20257 gene locus_tag LOCUS_14050 19346 20257 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964401.1 protein_id gnl|my_center|LOCUS_14050 21048 20254 gene locus_tag LOCUS_14060 21048 20254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 22044 21223 gene locus_tag LOCUS_14070 22044 21223 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_14070 24661 22157 gene locus_tag LOCUS_14080 24661 22157 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583019.1 protein_id gnl|my_center|LOCUS_14080 24809 25813 gene locus_tag LOCUS_14090 gene rsmI 24809 25813 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390356.1 protein_id gnl|my_center|LOCUS_14090 28225 25943 gene locus_tag LOCUS_14100 28225 25943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 28173 28574 gene locus_tag LOCUS_14110 28173 28574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 28723 29976 gene locus_tag LOCUS_14120 28723 29976 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414672.1 protein_id gnl|my_center|LOCUS_14120 30066 33032 gene locus_tag LOCUS_14130 gene topA 30066 33032 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582338.1 protein_id gnl|my_center|LOCUS_14130 33029 33781 gene locus_tag LOCUS_14140 gene tmk 33029 33781 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051604.1 protein_id gnl|my_center|LOCUS_14140 33778 34956 gene locus_tag LOCUS_14150 33778 34956 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390325.1 protein_id gnl|my_center|LOCUS_14150 36024 34960 gene locus_tag LOCUS_14160 36024 34960 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814163.1 protein_id gnl|my_center|LOCUS_14160 36402 36142 gene locus_tag LOCUS_14170 36402 36142 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814166.1 protein_id gnl|my_center|LOCUS_14170 36704 38353 gene locus_tag LOCUS_14180 gene ptsP 36704 38353 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814167.1 protein_id gnl|my_center|LOCUS_14180 38457 39011 gene locus_tag LOCUS_14190 38457 39011 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817572.1 protein_id gnl|my_center|LOCUS_14190 39089 40759 gene locus_tag LOCUS_14200 39089 40759 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389450.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence026 1896 763 gene locus_tag LOCUS_14210 1896 763 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976047.1 protein_id gnl|my_center|LOCUS_14210 2817 1981 gene locus_tag LOCUS_14220 2817 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 3742 2855 gene locus_tag LOCUS_14230 3742 2855 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225934.1 protein_id gnl|my_center|LOCUS_14230 4688 3744 gene locus_tag LOCUS_14240 4688 3744 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051281.1 protein_id gnl|my_center|LOCUS_14240 6174 4828 gene locus_tag LOCUS_14250 6174 4828 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775732.1 protein_id gnl|my_center|LOCUS_14250 6484 7449 gene locus_tag LOCUS_14260 6484 7449 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096700.1 protein_id gnl|my_center|LOCUS_14260 8655 7768 gene locus_tag LOCUS_14270 8655 7768 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224974.1 protein_id gnl|my_center|LOCUS_14270 10336 8669 gene locus_tag LOCUS_14280 10336 8669 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975849.1 protein_id gnl|my_center|LOCUS_14280 12764 10356 gene locus_tag LOCUS_14290 12764 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 14963 12828 gene locus_tag LOCUS_14300 14963 12828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 15196 16293 gene locus_tag LOCUS_14310 15196 16293 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068174.1 protein_id gnl|my_center|LOCUS_14310 17137 16472 gene locus_tag LOCUS_14320 17137 16472 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263803.1 protein_id gnl|my_center|LOCUS_14320 18208 17207 gene locus_tag LOCUS_14330 18208 17207 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963717.1 protein_id gnl|my_center|LOCUS_14330 19418 18408 gene locus_tag LOCUS_14340 19418 18408 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027040.1 protein_id gnl|my_center|LOCUS_14340 20743 19661 gene locus_tag LOCUS_14350 20743 19661 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068286.1 protein_id gnl|my_center|LOCUS_14350 21042 22049 gene locus_tag LOCUS_14360 21042 22049 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_14360 22333 23322 gene locus_tag LOCUS_14370 22333 23322 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101955.1 protein_id gnl|my_center|LOCUS_14370 23986 23414 gene locus_tag LOCUS_14380 23986 23414 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363464.1 protein_id gnl|my_center|LOCUS_14380 26901 24046 gene locus_tag LOCUS_14390 26901 24046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 27617 26916 gene locus_tag LOCUS_14400 27617 26916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068640.1 protein_id gnl|my_center|LOCUS_14400 27924 28595 gene locus_tag LOCUS_14410 27924 28595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 29894 28794 gene locus_tag LOCUS_14420 29894 28794 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094661859.1 protein_id gnl|my_center|LOCUS_14420 30321 31742 gene locus_tag LOCUS_14430 30321 31742 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125979625.1 protein_id gnl|my_center|LOCUS_14430 33252 31747 gene locus_tag LOCUS_14440 gene lmr(B) 33252 31747 CDS product lincomycin efflux MFS transporter Lmr(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886396.1 protein_id gnl|my_center|LOCUS_14440 33869 33336 gene locus_tag LOCUS_14450 33869 33336 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389905.1 protein_id gnl|my_center|LOCUS_14450 34194 34814 gene locus_tag LOCUS_14460 34194 34814 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035107705.1 protein_id gnl|my_center|LOCUS_14460 35306 34908 gene locus_tag LOCUS_14470 35306 34908 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389907.1 protein_id gnl|my_center|LOCUS_14470 35629 36156 gene locus_tag LOCUS_14480 35629 36156 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242788.1 protein_id gnl|my_center|LOCUS_14480 37816 36467 gene locus_tag LOCUS_14490 37816 36467 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208608108.1 protein_id gnl|my_center|LOCUS_14490 37977 38894 gene locus_tag LOCUS_14500 37977 38894 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036667.1 protein_id gnl|my_center|LOCUS_14500 38999 40636 gene locus_tag LOCUS_14510 38999 40636 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068339.1 protein_id gnl|my_center|LOCUS_14510 <41418 40707 gene locus_tag LOCUS_14520 <41418 40707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004118197.1:decarboxylating 6-phosphogluconate dehydrogenase >Feature sequence027 594 232 gene locus_tag LOCUS_14530 594 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 845 591 gene locus_tag LOCUS_14540 845 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1183 848 gene locus_tag LOCUS_14550 1183 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1635 1180 gene locus_tag LOCUS_14560 1635 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2062 1652 gene locus_tag LOCUS_14570 2062 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2973 2062 gene locus_tag LOCUS_14580 2973 2062 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922461.1 protein_id gnl|my_center|LOCUS_14580 3518 3006 gene locus_tag LOCUS_14590 3518 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 3670 3588 gene locus_tag LOCUS_t00400 3670 3588 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5085 3733 gene locus_tag LOCUS_14600 5085 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 6538 5006 gene locus_tag LOCUS_14610 6538 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 7974 6538 gene locus_tag LOCUS_14620 7974 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 8263 7955 gene locus_tag LOCUS_14630 8263 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 8713 8363 gene locus_tag LOCUS_14640 8713 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 8925 8710 gene locus_tag LOCUS_14650 8925 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 9103 8870 gene locus_tag LOCUS_14660 9103 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 9481 9407 gene locus_tag LOCUS_t00410 9481 9407 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9557 9484 gene locus_tag LOCUS_t00420 9557 9484 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10536 9706 gene locus_tag LOCUS_14670 10536 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 10793 10626 gene locus_tag LOCUS_14680 10793 10626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 11008 10793 gene locus_tag LOCUS_14690 11008 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 11238 11029 gene locus_tag LOCUS_14700 11238 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 11768 11238 gene locus_tag LOCUS_14710 11768 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 11949 11761 gene locus_tag LOCUS_14720 11949 11761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 12173 11946 gene locus_tag LOCUS_14730 12173 11946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 12505 12170 gene locus_tag LOCUS_14740 12505 12170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 12685 12515 gene locus_tag LOCUS_14750 12685 12515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 12912 12682 gene locus_tag LOCUS_14760 12912 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 13526 12909 gene locus_tag LOCUS_14770 13526 12909 CDS product oligoribonuclease Orn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820462.1 protein_id gnl|my_center|LOCUS_14770 13924 13523 gene locus_tag LOCUS_14780 13924 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813016.1 protein_id gnl|my_center|LOCUS_14780 14601 13927 gene locus_tag LOCUS_14790 14601 13927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 15647 14661 gene locus_tag LOCUS_14800 15647 14661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 16049 15651 gene locus_tag LOCUS_14810 16049 15651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 16523 16059 gene locus_tag LOCUS_14820 16523 16059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 16924 16523 gene locus_tag LOCUS_14830 16924 16523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 17162 16917 gene locus_tag LOCUS_14840 17162 16917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 17581 17327 gene locus_tag LOCUS_14850 17581 17327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 17682 17924 gene locus_tag LOCUS_14860 17682 17924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 18123 17854 gene locus_tag LOCUS_14870 18123 17854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 18344 18120 gene locus_tag LOCUS_14880 18344 18120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 18604 18341 gene locus_tag LOCUS_14890 18604 18341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 18689 19048 gene locus_tag LOCUS_14900 18689 19048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 21879 19189 gene locus_tag LOCUS_14910 21879 19189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 22162 24429 gene locus_tag LOCUS_14920 22162 24429 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814307.1 protein_id gnl|my_center|LOCUS_14920 24743 25237 gene locus_tag LOCUS_14930 24743 25237 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814306.1 protein_id gnl|my_center|LOCUS_14930 25773 28916 gene locus_tag LOCUS_14940 25773 28916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 30293 29133 gene locus_tag LOCUS_14950 30293 29133 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389462.1 protein_id gnl|my_center|LOCUS_14950 31831 30392 gene locus_tag LOCUS_14960 31831 30392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 32145 32978 gene locus_tag LOCUS_14970 32145 32978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 34904 33372 gene locus_tag LOCUS_14980 34904 33372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 35848 34910 gene locus_tag LOCUS_14990 35848 34910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 35995 36726 gene locus_tag LOCUS_15000 35995 36726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 36726 38633 gene locus_tag LOCUS_15010 36726 38633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence028 99 476 gene locus_tag LOCUS_15020 99 476 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_15020 1716 892 gene locus_tag LOCUS_15030 1716 892 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051288.1 protein_id gnl|my_center|LOCUS_15030 2724 1741 gene locus_tag LOCUS_15040 2724 1741 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053710.1 protein_id gnl|my_center|LOCUS_15040 3723 2791 gene locus_tag LOCUS_15050 3723 2791 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 protein_id gnl|my_center|LOCUS_15050 4823 3849 gene locus_tag LOCUS_15060 4823 3849 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 protein_id gnl|my_center|LOCUS_15060 6096 5752 gene locus_tag LOCUS_15070 6096 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 6605 6126 gene locus_tag LOCUS_15080 gene smpB 6605 6126 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812219.1 protein_id gnl|my_center|LOCUS_15080 8102 6735 gene locus_tag LOCUS_15090 8102 6735 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068336.1 protein_id gnl|my_center|LOCUS_15090 9193 8270 gene locus_tag LOCUS_15100 gene ftsX 9193 8270 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068337.1 protein_id gnl|my_center|LOCUS_15100 10977 9190 gene locus_tag LOCUS_15110 gene ftsE 10977 9190 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389631.1 protein_id gnl|my_center|LOCUS_15110 12179 11049 gene locus_tag LOCUS_15120 gene prfB 12179 11049 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051295.1 protein_id gnl|my_center|LOCUS_15120 12531 12400 gene locus_tag LOCUS_15130 12531 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 13266 12931 gene locus_tag LOCUS_15140 13266 12931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 13441 13533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15131 13662 gene locus_tag LOCUS_15150 15131 13662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 16239 15250 gene locus_tag LOCUS_15160 16239 15250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 17534 16437 gene locus_tag LOCUS_15170 17534 16437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 19587 17776 gene locus_tag LOCUS_15180 19587 17776 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390379.1 protein_id gnl|my_center|LOCUS_15180 22747 19937 gene locus_tag LOCUS_15190 22747 19937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 24135 22726 gene locus_tag LOCUS_15200 24135 22726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 24946 25965 gene locus_tag LOCUS_15210 gene dapD 24946 25965 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815280.1 protein_id gnl|my_center|LOCUS_15210 26825 26628 gene locus_tag LOCUS_15220 26825 26628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 28808 27177 gene locus_tag LOCUS_15230 28808 27177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014807.1 protein_id gnl|my_center|LOCUS_15230 29713 28805 gene locus_tag LOCUS_15240 29713 28805 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284211.1 protein_id gnl|my_center|LOCUS_15240 30644 29706 gene locus_tag LOCUS_15250 30644 29706 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857497.1 protein_id gnl|my_center|LOCUS_15250 32245 30722 gene locus_tag LOCUS_15260 32245 30722 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229918.1 protein_id gnl|my_center|LOCUS_15260 34030 32387 gene locus_tag LOCUS_15270 34030 32387 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_15270 34393 35019 gene locus_tag LOCUS_15280 34393 35019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 35126 36094 gene locus_tag LOCUS_15290 35126 36094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 36215 37582 gene locus_tag LOCUS_15300 36215 37582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence029 3009 1840 gene locus_tag LOCUS_15310 3009 1840 CDS product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057650.1 protein_id gnl|my_center|LOCUS_15310 3538 3128 gene locus_tag LOCUS_15320 gene gcvH 3538 3128 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051338.1 protein_id gnl|my_center|LOCUS_15320 4675 3578 gene locus_tag LOCUS_15330 gene nudC 4675 3578 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389573.1 protein_id gnl|my_center|LOCUS_15330 5623 4709 gene locus_tag LOCUS_15340 5623 4709 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811981.1 protein_id gnl|my_center|LOCUS_15340 6373 5756 gene locus_tag LOCUS_15350 6373 5756 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363143.1 protein_id gnl|my_center|LOCUS_15350 6560 6934 gene locus_tag LOCUS_15360 gene trxA 6560 6934 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821172.1 protein_id gnl|my_center|LOCUS_15360 7054 8082 gene locus_tag LOCUS_15370 7054 8082 CDS product G5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389571.1 protein_id gnl|my_center|LOCUS_15370 8249 8671 gene locus_tag LOCUS_15380 8249 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 8661 8885 gene locus_tag LOCUS_15390 8661 8885 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861845.1 protein_id gnl|my_center|LOCUS_15390 9218 9736 gene locus_tag LOCUS_15400 9218 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 9916 10455 gene locus_tag LOCUS_15410 9916 10455 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068381.1 protein_id gnl|my_center|LOCUS_15410 12163 10667 gene locus_tag LOCUS_15420 12163 10667 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068360.1 protein_id gnl|my_center|LOCUS_15420 12473 13936 gene locus_tag LOCUS_15430 12473 13936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068362.1 protein_id gnl|my_center|LOCUS_15430 13996 14451 gene locus_tag LOCUS_15440 13996 14451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068361.1 protein_id gnl|my_center|LOCUS_15440 16570 14663 gene locus_tag LOCUS_15450 16570 14663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 17282 19564 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggatcatccccgcgtatgcggagcg 20028 19678 gene locus_tag LOCUS_15460 20028 19678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 21137 20025 gene locus_tag LOCUS_15470 gene cas1e 21137 20025 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 protein_id gnl|my_center|LOCUS_15470 21832 21134 gene locus_tag LOCUS_15480 gene cas6e 21832 21134 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229112.1 protein_id gnl|my_center|LOCUS_15480 22560 21829 gene locus_tag LOCUS_15490 gene cas5e 22560 21829 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 protein_id gnl|my_center|LOCUS_15490 23896 22676 gene locus_tag LOCUS_15500 gene cas7e 23896 22676 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_15500 24702 24016 gene locus_tag LOCUS_15510 24702 24016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 26460 24739 gene locus_tag LOCUS_15520 26460 24739 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 protein_id gnl|my_center|LOCUS_15520 29710 26450 gene locus_tag LOCUS_15530 29710 26450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 30943 29717 gene locus_tag LOCUS_15540 30943 29717 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_15540 31307 32935 gene locus_tag LOCUS_15550 31307 32935 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054562.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence030 495 175 gene locus_tag LOCUS_15560 495 175 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814463.1 protein_id gnl|my_center|LOCUS_15560 2111 573 gene locus_tag LOCUS_15570 2111 573 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053015.1 protein_id gnl|my_center|LOCUS_15570 3755 2478 gene locus_tag LOCUS_15580 3755 2478 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390234.1 protein_id gnl|my_center|LOCUS_15580 4022 3852 gene locus_tag LOCUS_15590 gene rpmG 4022 3852 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814458.1 protein_id gnl|my_center|LOCUS_15590 4145 4071 gene locus_tag LOCUS_t00430 4145 4071 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4221 4149 gene locus_tag LOCUS_t00440 4221 4149 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4304 4222 gene locus_tag LOCUS_t00450 4304 4222 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 8746 4553 gene locus_tag LOCUS_15600 8746 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 9901 8942 gene locus_tag LOCUS_15610 9901 8942 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742066.1 protein_id gnl|my_center|LOCUS_15610 10370 10077 gene locus_tag LOCUS_15620 gene groES 10370 10077 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114319.1 protein_id gnl|my_center|LOCUS_15620 11983 10646 gene locus_tag LOCUS_15630 11983 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 12704 12018 gene locus_tag LOCUS_15640 12704 12018 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390238.1 protein_id gnl|my_center|LOCUS_15640 12873 13484 gene locus_tag LOCUS_15650 12873 13484 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814444.1 protein_id gnl|my_center|LOCUS_15650 13656 13847 gene locus_tag LOCUS_15660 13656 13847 CDS product evolved beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815625.1 protein_id gnl|my_center|LOCUS_15660 14081 14722 gene locus_tag LOCUS_15670 14081 14722 CDS product flagella basal body P-ring formation protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814440.1 protein_id gnl|my_center|LOCUS_15670 15071 14832 gene locus_tag LOCUS_15680 15071 14832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363879.1 protein_id gnl|my_center|LOCUS_15680 18748 15071 gene locus_tag LOCUS_15690 18748 15071 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390239.1 protein_id gnl|my_center|LOCUS_15690 20245 18755 gene locus_tag LOCUS_15700 20245 18755 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053003.1 protein_id gnl|my_center|LOCUS_15700 20935 20552 gene locus_tag LOCUS_15710 gene rplL 20935 20552 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814432.1 protein_id gnl|my_center|LOCUS_15710 21568 21047 gene locus_tag LOCUS_15720 gene rplJ 21568 21047 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814430.1 protein_id gnl|my_center|LOCUS_15720 23393 22080 gene locus_tag LOCUS_15730 23393 22080 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815310.1 protein_id gnl|my_center|LOCUS_15730 25133 23739 gene locus_tag LOCUS_15740 25133 23739 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052999.1 protein_id gnl|my_center|LOCUS_15740 25527 26447 gene locus_tag LOCUS_15750 25527 26447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068656.1 protein_id gnl|my_center|LOCUS_15750 27799 27020 gene locus_tag LOCUS_15760 gene pstB 27799 27020 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814420.1 protein_id gnl|my_center|LOCUS_15760 28847 27846 gene locus_tag LOCUS_15770 gene pstA 28847 27846 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782854.1 protein_id gnl|my_center|LOCUS_15770 29800 28844 gene locus_tag LOCUS_15780 gene pstC 29800 28844 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068423.1 protein_id gnl|my_center|LOCUS_15780 31092 29944 gene locus_tag LOCUS_15790 gene pstS 31092 29944 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051436.1 protein_id gnl|my_center|LOCUS_15790 32153 31449 gene locus_tag LOCUS_15800 32153 31449 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051437.1 protein_id gnl|my_center|LOCUS_15800 33702 32329 gene locus_tag LOCUS_15810 33702 32329 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055698.1 protein_id gnl|my_center|LOCUS_15810 34525 33818 gene locus_tag LOCUS_15820 gene mtnN 34525 33818 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814409.1 protein_id gnl|my_center|LOCUS_15820 35820 34558 gene locus_tag LOCUS_15830 35820 34558 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154056107.1 protein_id gnl|my_center|LOCUS_15830 35978 37258 gene locus_tag LOCUS_15840 35978 37258 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068433.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence031 1308 319 gene locus_tag LOCUS_15850 1308 319 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390118.1 protein_id gnl|my_center|LOCUS_15850 2349 1396 gene locus_tag LOCUS_15860 2349 1396 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390109.1 protein_id gnl|my_center|LOCUS_15860 3034 2639 gene locus_tag LOCUS_15870 3034 2639 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390116.1 protein_id gnl|my_center|LOCUS_15870 4152 3169 gene locus_tag LOCUS_15880 4152 3169 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112414.1 protein_id gnl|my_center|LOCUS_15880 5266 4274 gene locus_tag LOCUS_15890 5266 4274 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068827.1 protein_id gnl|my_center|LOCUS_15890 6590 5367 gene locus_tag LOCUS_15900 6590 5367 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_15900 8826 6808 gene locus_tag LOCUS_15910 8826 6808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389613.1 protein_id gnl|my_center|LOCUS_15910 10760 8823 gene locus_tag LOCUS_15920 10760 8823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389612.1 protein_id gnl|my_center|LOCUS_15920 11293 10757 gene locus_tag LOCUS_15930 11293 10757 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363192.1 protein_id gnl|my_center|LOCUS_15930 12133 11432 gene locus_tag LOCUS_15940 12133 11432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 12515 13996 gene locus_tag LOCUS_15950 gene dsdA 12515 13996 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113132.1 protein_id gnl|my_center|LOCUS_15950 14145 14885 gene locus_tag LOCUS_15960 14145 14885 CDS product DUF4391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056866.1 protein_id gnl|my_center|LOCUS_15960 15935 14919 gene locus_tag LOCUS_15970 15935 14919 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 protein_id gnl|my_center|LOCUS_15970 16696 15932 gene locus_tag LOCUS_15980 16696 15932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 17722 16799 gene locus_tag LOCUS_15990 17722 16799 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233833.1 protein_id gnl|my_center|LOCUS_15990 18701 17724 gene locus_tag LOCUS_16000 18701 17724 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582825.1 protein_id gnl|my_center|LOCUS_16000 20207 18894 gene locus_tag LOCUS_16010 20207 18894 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243860.1 protein_id gnl|my_center|LOCUS_16010 21579 20407 gene locus_tag LOCUS_16020 21579 20407 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226270.1 protein_id gnl|my_center|LOCUS_16020 22410 21772 gene locus_tag LOCUS_16030 22410 21772 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965894.1 protein_id gnl|my_center|LOCUS_16030 23238 22432 gene locus_tag LOCUS_16040 23238 22432 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965895.1 protein_id gnl|my_center|LOCUS_16040 24404 23304 gene locus_tag LOCUS_16050 24404 23304 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288261.1 protein_id gnl|my_center|LOCUS_16050 25410 24571 gene locus_tag LOCUS_16060 25410 24571 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288254.1 protein_id gnl|my_center|LOCUS_16060 25919 26866 gene locus_tag LOCUS_16070 25919 26866 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052404.1 protein_id gnl|my_center|LOCUS_16070 29306 26961 gene locus_tag LOCUS_16080 29306 26961 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052488.1 protein_id gnl|my_center|LOCUS_16080 31779 29509 gene locus_tag LOCUS_16090 31779 29509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 33214 31868 gene locus_tag LOCUS_16100 33214 31868 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948839.1 protein_id gnl|my_center|LOCUS_16100 34701 33373 gene locus_tag LOCUS_16110 34701 33373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 35541 34909 gene locus_tag LOCUS_16120 35541 34909 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053909.1 protein_id gnl|my_center|LOCUS_16120 36340 35702 gene locus_tag LOCUS_16130 36340 35702 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053909.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence032 2658 757 gene locus_tag LOCUS_16140 2658 757 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973423.1 protein_id gnl|my_center|LOCUS_16140 4826 2652 gene locus_tag LOCUS_16150 4826 2652 CDS product urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401683.1 protein_id gnl|my_center|LOCUS_16150 5656 4832 gene locus_tag LOCUS_16160 5656 4832 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105454.1 protein_id gnl|my_center|LOCUS_16160 6689 5880 gene locus_tag LOCUS_16170 6689 5880 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105455.1 protein_id gnl|my_center|LOCUS_16170 7069 8028 gene locus_tag LOCUS_16180 7069 8028 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804031.1 protein_id gnl|my_center|LOCUS_16180 8062 9894 gene locus_tag LOCUS_16190 8062 9894 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803973.1 protein_id gnl|my_center|LOCUS_16190 9925 10632 gene locus_tag LOCUS_16200 9925 10632 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978258.1 protein_id gnl|my_center|LOCUS_16200 11524 10658 gene locus_tag LOCUS_16210 11524 10658 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731108.1 protein_id gnl|my_center|LOCUS_16210 13030 11564 gene locus_tag LOCUS_16220 13030 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 13967 13101 gene locus_tag LOCUS_16230 13967 13101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 14845 13967 gene locus_tag LOCUS_16240 14845 13967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_16240 15791 14847 gene locus_tag LOCUS_16250 15791 14847 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867268.1 protein_id gnl|my_center|LOCUS_16250 16801 15788 gene locus_tag LOCUS_16260 16801 15788 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528138.1 protein_id gnl|my_center|LOCUS_16260 18704 17073 gene locus_tag LOCUS_16270 18704 17073 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096544.1 protein_id gnl|my_center|LOCUS_16270 19371 19192 gene locus_tag LOCUS_16280 19371 19192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 20528 19485 gene locus_tag LOCUS_16290 20528 19485 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_16290 21818 20718 gene locus_tag LOCUS_16300 21818 20718 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_16300 22241 23047 gene locus_tag LOCUS_16310 22241 23047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 23049 25931 gene locus_tag LOCUS_16320 23049 25931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 26447 27655 gene locus_tag LOCUS_16330 gene phnW 26447 27655 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326249.1 protein_id gnl|my_center|LOCUS_16330 27882 28661 gene locus_tag LOCUS_16340 gene phnX 27882 28661 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687375.1 protein_id gnl|my_center|LOCUS_16340 30130 29108 gene locus_tag LOCUS_16350 30130 29108 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056457.1 protein_id gnl|my_center|LOCUS_16350 32016 30130 gene locus_tag LOCUS_16360 32016 30130 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056415.1 protein_id gnl|my_center|LOCUS_16360 32841 32203 gene locus_tag LOCUS_16370 gene pdxT 32841 32203 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056414.1 protein_id gnl|my_center|LOCUS_16370 33839 32964 gene locus_tag LOCUS_16380 gene pdxS 33839 32964 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053677.1 protein_id gnl|my_center|LOCUS_16380 34274 35767 gene locus_tag LOCUS_16390 34274 35767 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053727.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence033 126 52 gene locus_tag LOCUS_t00460 126 52 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1700 369 gene locus_tag LOCUS_16400 gene clpX 1700 369 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390063.1 protein_id gnl|my_center|LOCUS_16400 2534 1812 gene locus_tag LOCUS_16410 2534 1812 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816849.1 protein_id gnl|my_center|LOCUS_16410 3157 2540 gene locus_tag LOCUS_16420 3157 2540 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813663.1 protein_id gnl|my_center|LOCUS_16420 4389 3259 gene locus_tag LOCUS_16430 4389 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363811.1 protein_id gnl|my_center|LOCUS_16430 5024 4386 gene locus_tag LOCUS_16440 5024 4386 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814716.1 protein_id gnl|my_center|LOCUS_16440 6031 5036 gene locus_tag LOCUS_16450 6031 5036 CDS product peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236036873.1 protein_id gnl|my_center|LOCUS_16450 6885 6142 gene locus_tag LOCUS_16460 6885 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 7761 8444 gene locus_tag LOCUS_16470 gene liaR 7761 8444 CDS product two-component system response regulator LiaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243201.1 protein_id gnl|my_center|LOCUS_16470 8441 9601 gene locus_tag LOCUS_16480 8441 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 11111 9723 gene locus_tag LOCUS_16490 11111 9723 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068213.1 protein_id gnl|my_center|LOCUS_16490 12680 11280 gene locus_tag LOCUS_16500 gene tig 12680 11280 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068214.1 protein_id gnl|my_center|LOCUS_16500 14020 12734 gene locus_tag LOCUS_16510 14020 12734 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390066.1 protein_id gnl|my_center|LOCUS_16510 14612 14010 gene locus_tag LOCUS_16520 14612 14010 CDS product DUF3000 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068216.1 protein_id gnl|my_center|LOCUS_16520 15631 14750 gene locus_tag LOCUS_16530 gene pflA 15631 14750 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068217.1 protein_id gnl|my_center|LOCUS_16530 18153 15781 gene locus_tag LOCUS_16540 gene pflB 18153 15781 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582507.1 protein_id gnl|my_center|LOCUS_16540 18483 18259 gene locus_tag LOCUS_16550 18483 18259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813675.1 protein_id gnl|my_center|LOCUS_16550 20267 18570 gene locus_tag LOCUS_16560 20267 18570 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390069.1 protein_id gnl|my_center|LOCUS_16560 21492 20344 gene locus_tag LOCUS_16570 21492 20344 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390070.1 protein_id gnl|my_center|LOCUS_16570 21811 22656 gene locus_tag LOCUS_16580 21811 22656 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390072.1 protein_id gnl|my_center|LOCUS_16580 23849 22770 gene locus_tag LOCUS_16590 23849 22770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 24610 24089 gene locus_tag LOCUS_16600 24610 24089 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820289.1 protein_id gnl|my_center|LOCUS_16600 27017 24684 gene locus_tag LOCUS_16610 27017 24684 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390076.1 protein_id gnl|my_center|LOCUS_16610 27576 27097 gene locus_tag LOCUS_16620 gene dut 27576 27097 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055963.1 protein_id gnl|my_center|LOCUS_16620 27869 27576 gene locus_tag LOCUS_16630 27869 27576 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052669.1 protein_id gnl|my_center|LOCUS_16630 28018 29103 gene locus_tag LOCUS_16640 gene sepH 28018 29103 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056777.1 protein_id gnl|my_center|LOCUS_16640 30355 29129 gene locus_tag LOCUS_16650 30355 29129 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054496.1 protein_id gnl|my_center|LOCUS_16650 30560 33283 gene locus_tag LOCUS_16660 30560 33283 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813761.1 protein_id gnl|my_center|LOCUS_16660 34403 33543 gene locus_tag LOCUS_16670 34403 33543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence034 <1 602 gene locus_tag LOCUS_16680 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053845.1:C40 family peptidase 876 1913 gene locus_tag LOCUS_16690 876 1913 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052357.1 protein_id gnl|my_center|LOCUS_16690 2542 2129 gene locus_tag LOCUS_16700 2542 2129 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390191.1 protein_id gnl|my_center|LOCUS_16700 2762 3649 gene locus_tag LOCUS_16710 2762 3649 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390190.1 protein_id gnl|my_center|LOCUS_16710 3734 4402 gene locus_tag LOCUS_16720 3734 4402 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818243.1 protein_id gnl|my_center|LOCUS_16720 4526 5041 gene locus_tag LOCUS_16730 4526 5041 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390189.1 protein_id gnl|my_center|LOCUS_16730 5129 6031 gene locus_tag LOCUS_16740 gene trmB 5129 6031 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068780.1 protein_id gnl|my_center|LOCUS_16740 6241 6314 gene locus_tag LOCUS_t00470 6241 6314 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6865 7116 gene locus_tag LOCUS_16750 6865 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 7204 7377 gene locus_tag LOCUS_16760 7204 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 7571 8782 gene locus_tag LOCUS_16770 7571 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 8779 9228 gene locus_tag LOCUS_16780 8779 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 9364 9960 gene locus_tag LOCUS_16790 9364 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 9965 10204 gene locus_tag LOCUS_16800 9965 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 10337 10744 gene locus_tag LOCUS_16810 10337 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 10879 11208 gene locus_tag LOCUS_16820 10879 11208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 13379 12615 gene locus_tag LOCUS_16830 13379 12615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068694.1 protein_id gnl|my_center|LOCUS_16830 14859 13372 gene locus_tag LOCUS_16840 14859 13372 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068695.1 protein_id gnl|my_center|LOCUS_16840 15210 19505 gene locus_tag LOCUS_16850 15210 19505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 21159 19678 gene locus_tag LOCUS_16860 21159 19678 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814741.1 protein_id gnl|my_center|LOCUS_16860 21522 24683 gene locus_tag LOCUS_16870 21522 24683 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390183.1 protein_id gnl|my_center|LOCUS_16870 24780 25592 gene locus_tag LOCUS_16880 gene nagB 24780 25592 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052563.1 protein_id gnl|my_center|LOCUS_16880 25667 26980 gene locus_tag LOCUS_16890 25667 26980 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067999.1 protein_id gnl|my_center|LOCUS_16890 28033 27032 gene locus_tag LOCUS_16900 28033 27032 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814729.1 protein_id gnl|my_center|LOCUS_16900 28559 28765 gene locus_tag LOCUS_16910 28559 28765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 28784 29629 gene locus_tag LOCUS_16920 28784 29629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 29672 30052 gene locus_tag LOCUS_16930 29672 30052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 30045 32441 gene locus_tag LOCUS_16940 30045 32441 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_16940 32957 34030 gene locus_tag LOCUS_16950 32957 34030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence035 78 1874 gene locus_tag LOCUS_16960 gene aspS 78 1874 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816387.1 protein_id gnl|my_center|LOCUS_16960 2115 2690 gene locus_tag LOCUS_16970 2115 2690 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389905.1 protein_id gnl|my_center|LOCUS_16970 2870 3367 gene locus_tag LOCUS_16980 gene purE 2870 3367 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813948.1 protein_id gnl|my_center|LOCUS_16980 3351 4520 gene locus_tag LOCUS_16990 gene purK 3351 4520 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813946.1 protein_id gnl|my_center|LOCUS_16990 4918 8250 gene locus_tag LOCUS_17000 gene ileS 4918 8250 CDS product mupirocin-resistant isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390135.1 protein_id gnl|my_center|LOCUS_17000 9210 10886 gene locus_tag LOCUS_17010 9210 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 11059 12702 gene locus_tag LOCUS_17020 gene cas8c 11059 12702 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092684710.1 protein_id gnl|my_center|LOCUS_17020 12695 13627 gene locus_tag LOCUS_17030 gene cas7c 12695 13627 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_17030 14176 15960 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctccctcctcacggagggagcggattgaaat 16320 16036 gene locus_tag LOCUS_17040 16320 16036 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057517.1 protein_id gnl|my_center|LOCUS_17040 16615 18681 gene locus_tag LOCUS_17050 16615 18681 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_17050 18794 19846 gene locus_tag LOCUS_17060 18794 19846 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659770.1 protein_id gnl|my_center|LOCUS_17060 20620 19943 gene locus_tag LOCUS_17070 20620 19943 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_17070 20846 20634 gene locus_tag LOCUS_17080 20846 20634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 21105 22166 gene locus_tag LOCUS_17090 21105 22166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 22185 22466 gene locus_tag LOCUS_17100 22185 22466 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389908.1 protein_id gnl|my_center|LOCUS_17100 22466 23620 gene locus_tag LOCUS_17110 22466 23620 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_17110 27728 23988 gene locus_tag LOCUS_17120 27728 23988 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_17120 28568 27819 gene locus_tag LOCUS_17130 28568 27819 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051209.1 protein_id gnl|my_center|LOCUS_17130 29224 28739 gene locus_tag LOCUS_17140 29224 28739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 30779 29463 gene locus_tag LOCUS_17150 gene purT 30779 29463 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390100.1 protein_id gnl|my_center|LOCUS_17150 30923 32113 gene locus_tag LOCUS_17160 30923 32113 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390098.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence036 97 1344 gene locus_tag LOCUS_17170 97 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1431 3353 gene locus_tag LOCUS_17180 1431 3353 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082107836.1 protein_id gnl|my_center|LOCUS_17180 3444 3719 gene locus_tag LOCUS_17190 3444 3719 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812680.1 protein_id gnl|my_center|LOCUS_17190 5350 3863 gene locus_tag LOCUS_17200 5350 3863 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051898.1 protein_id gnl|my_center|LOCUS_17200 5545 6450 gene locus_tag LOCUS_17210 5545 6450 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389762.1 protein_id gnl|my_center|LOCUS_17210 7134 6655 gene locus_tag LOCUS_17220 7134 6655 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812673.1 protein_id gnl|my_center|LOCUS_17220 7634 7230 gene locus_tag LOCUS_17230 7634 7230 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051894.1 protein_id gnl|my_center|LOCUS_17230 8332 7766 gene locus_tag LOCUS_17240 8332 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817844.1 protein_id gnl|my_center|LOCUS_17240 8567 8487 gene locus_tag LOCUS_t00480 8567 8487 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11659 8705 gene locus_tag LOCUS_17250 11659 8705 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363681.1 protein_id gnl|my_center|LOCUS_17250 11743 12531 gene locus_tag LOCUS_17260 11743 12531 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390090.1 protein_id gnl|my_center|LOCUS_17260 13659 12634 gene locus_tag LOCUS_17270 gene miaA 13659 12634 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390091.1 protein_id gnl|my_center|LOCUS_17270 15106 13646 gene locus_tag LOCUS_17280 gene miaB 15106 13646 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021648605.1 protein_id gnl|my_center|LOCUS_17280 15229 15957 gene locus_tag LOCUS_17290 15229 15957 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815463.1 protein_id gnl|my_center|LOCUS_17290 16924 15965 gene locus_tag LOCUS_17300 16924 15965 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052632.1 protein_id gnl|my_center|LOCUS_17300 17890 17057 gene locus_tag LOCUS_17310 17890 17057 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815467.1 protein_id gnl|my_center|LOCUS_17310 18632 18039 gene locus_tag LOCUS_17320 18632 18039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 18947 20344 gene locus_tag LOCUS_17330 18947 20344 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820672.1 protein_id gnl|my_center|LOCUS_17330 20341 21117 gene locus_tag LOCUS_17340 20341 21117 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813814.1 protein_id gnl|my_center|LOCUS_17340 21262 23376 gene locus_tag LOCUS_17350 21262 23376 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390093.1 protein_id gnl|my_center|LOCUS_17350 26161 23462 gene locus_tag LOCUS_17360 gene acnA 26161 23462 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363285.1 protein_id gnl|my_center|LOCUS_17360 28746 26215 gene locus_tag LOCUS_17370 28746 26215 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389700.1 protein_id gnl|my_center|LOCUS_17370 29458 28844 gene locus_tag LOCUS_17380 29458 28844 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389699.1 protein_id gnl|my_center|LOCUS_17380 30726 29455 gene locus_tag LOCUS_17390 30726 29455 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389698.1 protein_id gnl|my_center|LOCUS_17390 31595 30855 gene locus_tag LOCUS_17400 31595 30855 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783114.1 protein_id gnl|my_center|LOCUS_17400 <32427 31624 gene locus_tag LOCUS_17410 <32427 31624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068026.1:DUF3710 domain-containing protein >Feature sequence037 457 2373 gene locus_tag LOCUS_17420 457 2373 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036927.1 protein_id gnl|my_center|LOCUS_17420 2424 4808 gene locus_tag LOCUS_17430 2424 4808 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_17430 4853 5986 gene locus_tag LOCUS_17440 4853 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 6029 7720 gene locus_tag LOCUS_17450 6029 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 7767 9797 gene locus_tag LOCUS_17460 gene aguA 7767 9797 CDS product xylan alpha-(1->2)-glucuronosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082543.1 protein_id gnl|my_center|LOCUS_17460 9841 11478 gene locus_tag LOCUS_17470 9841 11478 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_17470 11530 13557 gene locus_tag LOCUS_17480 11530 13557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 13845 15758 gene locus_tag LOCUS_17490 13845 15758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 15783 18077 gene locus_tag LOCUS_17500 15783 18077 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_17500 18087 20495 gene locus_tag LOCUS_17510 18087 20495 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202630.1 protein_id gnl|my_center|LOCUS_17510 20595 20753 gene locus_tag LOCUS_17520 20595 20753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 20732 20935 gene locus_tag LOCUS_17530 20732 20935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 21034 21573 gene locus_tag LOCUS_17540 21034 21573 CDS product histone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068319.1 protein_id gnl|my_center|LOCUS_17540 23446 22025 gene locus_tag LOCUS_17550 23446 22025 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051261.1 protein_id gnl|my_center|LOCUS_17550 23721 25079 gene locus_tag LOCUS_17560 gene alr 23721 25079 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813965.1 protein_id gnl|my_center|LOCUS_17560 25191 26474 gene locus_tag LOCUS_17570 25191 26474 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390121.1 protein_id gnl|my_center|LOCUS_17570 27517 26492 gene locus_tag LOCUS_17580 27517 26492 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053353.1 protein_id gnl|my_center|LOCUS_17580 28967 27747 gene locus_tag LOCUS_17590 28967 27747 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086200.1 protein_id gnl|my_center|LOCUS_17590 29323 31476 gene locus_tag LOCUS_17600 gene dnaG 29323 31476 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817922.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence038 166 381 gene locus_tag LOCUS_17610 166 381 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389868.1 protein_id gnl|my_center|LOCUS_17610 378 791 gene locus_tag LOCUS_17620 378 791 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813029.1 protein_id gnl|my_center|LOCUS_17620 1135 866 gene locus_tag LOCUS_17630 1135 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2522 1389 gene locus_tag LOCUS_17640 2522 1389 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_17640 3156 2500 gene locus_tag LOCUS_17650 3156 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3285 3683 gene locus_tag LOCUS_17660 3285 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 3680 3970 gene locus_tag LOCUS_17670 3680 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 4100 4276 gene locus_tag LOCUS_17680 4100 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 4320 5810 gene locus_tag LOCUS_17690 4320 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 5828 6067 gene locus_tag LOCUS_17700 5828 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 6097 6348 gene locus_tag LOCUS_17710 6097 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 6371 6910 gene locus_tag LOCUS_17720 6371 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 6913 7314 gene locus_tag LOCUS_17730 6913 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 7326 7829 gene locus_tag LOCUS_17740 7326 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 7974 8810 gene locus_tag LOCUS_17750 7974 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 9557 9484 gene locus_tag LOCUS_t00490 9557 9484 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9770 9681 gene locus_tag LOCUS_t00500 9770 9681 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10109 10786 gene locus_tag LOCUS_17760 10109 10786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143587.1 protein_id gnl|my_center|LOCUS_17760 11070 11339 gene locus_tag LOCUS_17770 gene rpsO 11070 11339 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_17770 11729 14425 gene locus_tag LOCUS_17780 11729 14425 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390266.1 protein_id gnl|my_center|LOCUS_17780 14765 15331 gene locus_tag LOCUS_17790 14765 15331 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814370.1 protein_id gnl|my_center|LOCUS_17790 15331 17616 gene locus_tag LOCUS_17800 15331 17616 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390263.1 protein_id gnl|my_center|LOCUS_17800 17789 18649 gene locus_tag LOCUS_17810 17789 18649 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051430.1 protein_id gnl|my_center|LOCUS_17810 20370 18742 gene locus_tag LOCUS_17820 20370 18742 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389538.1 protein_id gnl|my_center|LOCUS_17820 20649 21389 gene locus_tag LOCUS_17830 20649 21389 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389539.1 protein_id gnl|my_center|LOCUS_17830 23418 21637 gene locus_tag LOCUS_17840 23418 21637 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582363.1 protein_id gnl|my_center|LOCUS_17840 23610 24617 gene locus_tag LOCUS_17850 23610 24617 CDS product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068427.1 protein_id gnl|my_center|LOCUS_17850 24738 25772 gene locus_tag LOCUS_17860 24738 25772 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068426.1 protein_id gnl|my_center|LOCUS_17860 25894 26577 gene locus_tag LOCUS_17870 25894 26577 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051445.1 protein_id gnl|my_center|LOCUS_17870 26794 28173 gene locus_tag LOCUS_17880 26794 28173 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068425.1 protein_id gnl|my_center|LOCUS_17880 28452 29798 gene locus_tag LOCUS_17890 28452 29798 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055726.1 protein_id gnl|my_center|LOCUS_17890 30186 31316 gene locus_tag LOCUS_17900 30186 31316 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390252.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence039 1876 332 gene locus_tag LOCUS_17910 1876 332 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068308.1 protein_id gnl|my_center|LOCUS_17910 3252 1894 gene locus_tag LOCUS_17920 3252 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 4055 3315 gene locus_tag LOCUS_17930 4055 3315 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051244.1 protein_id gnl|my_center|LOCUS_17930 4322 4492 gene locus_tag LOCUS_17940 4322 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 4625 4990 gene locus_tag LOCUS_17950 4625 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 4995 5381 gene locus_tag LOCUS_17960 4995 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389480.1 protein_id gnl|my_center|LOCUS_17960 5671 6834 gene locus_tag LOCUS_17970 5671 6834 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056552.1 protein_id gnl|my_center|LOCUS_17970 7537 6836 gene locus_tag LOCUS_17980 7537 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 8522 7566 gene locus_tag LOCUS_17990 8522 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 10116 8758 gene locus_tag LOCUS_18000 10116 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 11425 10307 gene locus_tag LOCUS_18010 11425 10307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 12250 11480 gene locus_tag LOCUS_18020 12250 11480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 14236 12581 gene locus_tag LOCUS_18030 14236 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 18761 14583 gene locus_tag LOCUS_18040 18761 14583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 19608 19435 gene locus_tag LOCUS_18050 19608 19435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 20973 20899 gene locus_tag LOCUS_t00510 20973 20899 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22008 21040 gene locus_tag LOCUS_18060 22008 21040 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994499.1 protein_id gnl|my_center|LOCUS_18060 22595 24040 gene locus_tag LOCUS_18070 22595 24040 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390136.1 protein_id gnl|my_center|LOCUS_18070 24651 24055 gene locus_tag LOCUS_18080 24651 24055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 26058 24862 gene locus_tag LOCUS_18090 26058 24862 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_18090 28684 26465 gene locus_tag LOCUS_18100 28684 26465 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507576.1 protein_id gnl|my_center|LOCUS_18100 29041 29910 gene locus_tag LOCUS_18110 29041 29910 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068311.1 protein_id gnl|my_center|LOCUS_18110 30897 30061 gene locus_tag LOCUS_18120 30897 30061 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064572.1 protein_id gnl|my_center|LOCUS_18120 31114 30881 gene locus_tag LOCUS_18130 31114 30881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 >Feature sequence040 293 1234 gene locus_tag LOCUS_18140 293 1234 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068269.1 protein_id gnl|my_center|LOCUS_18140 1234 3114 gene locus_tag LOCUS_18150 gene recN 1234 3114 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813477.1 protein_id gnl|my_center|LOCUS_18150 3231 3893 gene locus_tag LOCUS_18160 3231 3893 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390012.1 protein_id gnl|my_center|LOCUS_18160 5670 3910 gene locus_tag LOCUS_18170 5670 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 5846 6340 gene locus_tag LOCUS_18180 5846 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 6337 7452 gene locus_tag LOCUS_18190 6337 7452 CDS product DUF5808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026961331.1 protein_id gnl|my_center|LOCUS_18190 7613 7846 gene locus_tag LOCUS_18200 7613 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 8100 7879 gene locus_tag LOCUS_18210 8100 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 9666 8179 gene locus_tag LOCUS_18220 gene thrC 9666 8179 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390008.1 protein_id gnl|my_center|LOCUS_18220 9984 11291 gene locus_tag LOCUS_18230 gene glyA 9984 11291 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 protein_id gnl|my_center|LOCUS_18230 11645 12952 gene locus_tag LOCUS_18240 11645 12952 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051136.1 protein_id gnl|my_center|LOCUS_18240 13034 13681 gene locus_tag LOCUS_18250 13034 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053591.1 protein_id gnl|my_center|LOCUS_18250 13678 14373 gene locus_tag LOCUS_18260 gene nadD 13678 14373 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390005.1 protein_id gnl|my_center|LOCUS_18260 14501 15523 gene locus_tag LOCUS_18270 14501 15523 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052033.1 protein_id gnl|my_center|LOCUS_18270 15678 15749 gene locus_tag LOCUS_t00520 15678 15749 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15873 17255 gene locus_tag LOCUS_18280 gene glmU 15873 17255 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390003.1 protein_id gnl|my_center|LOCUS_18280 17356 17790 gene locus_tag LOCUS_18290 gene rsfS 17356 17790 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052031.1 protein_id gnl|my_center|LOCUS_18290 17927 18637 gene locus_tag LOCUS_18300 17927 18637 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813453.1 protein_id gnl|my_center|LOCUS_18300 18780 20045 gene locus_tag LOCUS_18310 18780 20045 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821341.1 protein_id gnl|my_center|LOCUS_18310 20130 21623 gene locus_tag LOCUS_18320 20130 21623 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068127.1 protein_id gnl|my_center|LOCUS_18320 21921 23576 gene locus_tag LOCUS_18330 gene amrB 21921 23576 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052452.1 protein_id gnl|my_center|LOCUS_18330 23663 24775 gene locus_tag LOCUS_18340 gene amrS 23663 24775 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052453.1 protein_id gnl|my_center|LOCUS_18340 24943 26262 gene locus_tag LOCUS_18350 24943 26262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 26419 26492 gene locus_tag LOCUS_t00530 26419 26492 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 27293 26592 gene locus_tag LOCUS_18360 27293 26592 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813444.1 protein_id gnl|my_center|LOCUS_18360 27474 27878 gene locus_tag LOCUS_18370 27474 27878 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389998.1 protein_id gnl|my_center|LOCUS_18370 28890 28018 gene locus_tag LOCUS_18380 28890 28018 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389997.1 protein_id gnl|my_center|LOCUS_18380 29082 29921 gene locus_tag LOCUS_18390 29082 29921 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068056.1 protein_id gnl|my_center|LOCUS_18390 30047 30994 gene locus_tag LOCUS_18400 30047 30994 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054371.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence041 1671 514 gene locus_tag LOCUS_18410 1671 514 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837095.1 protein_id gnl|my_center|LOCUS_18410 1916 2560 gene locus_tag LOCUS_18420 1916 2560 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666641.1 protein_id gnl|my_center|LOCUS_18420 3774 4256 gene locus_tag LOCUS_18430 3774 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 4322 4789 gene locus_tag LOCUS_18440 4322 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 7074 5014 gene locus_tag LOCUS_18450 7074 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143596.1 protein_id gnl|my_center|LOCUS_18450 7849 7409 gene locus_tag LOCUS_18460 7849 7409 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814292.1 protein_id gnl|my_center|LOCUS_18460 8368 7925 gene locus_tag LOCUS_18470 8368 7925 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051756.1 protein_id gnl|my_center|LOCUS_18470 8640 10001 gene locus_tag LOCUS_18480 8640 10001 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390286.1 protein_id gnl|my_center|LOCUS_18480 12184 10085 gene locus_tag LOCUS_18490 gene rho 12184 10085 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390287.1 protein_id gnl|my_center|LOCUS_18490 13969 12380 gene locus_tag LOCUS_18500 13969 12380 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_18500 14551 14237 gene locus_tag LOCUS_18510 14551 14237 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105898.1 protein_id gnl|my_center|LOCUS_18510 15604 14561 gene locus_tag LOCUS_18520 15604 14561 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820016.1 protein_id gnl|my_center|LOCUS_18520 17401 15902 gene locus_tag LOCUS_18530 gene gatB 17401 15902 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363939.1 protein_id gnl|my_center|LOCUS_18530 18967 17429 gene locus_tag LOCUS_18540 gene gatA 18967 17429 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814276.1 protein_id gnl|my_center|LOCUS_18540 19242 18976 gene locus_tag LOCUS_18550 gene gatC 19242 18976 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068473.1 protein_id gnl|my_center|LOCUS_18550 20243 19377 gene locus_tag LOCUS_18560 20243 19377 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390290.1 protein_id gnl|my_center|LOCUS_18560 21008 20337 gene locus_tag LOCUS_18570 21008 20337 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814265.1 protein_id gnl|my_center|LOCUS_18570 22441 21092 gene locus_tag LOCUS_18580 22441 21092 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390292.1 protein_id gnl|my_center|LOCUS_18580 22881 22600 gene locus_tag LOCUS_18590 22881 22600 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051538.1 protein_id gnl|my_center|LOCUS_18590 23076 26021 gene locus_tag LOCUS_18600 23076 26021 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068474.1 protein_id gnl|my_center|LOCUS_18600 28788 26131 gene locus_tag LOCUS_18610 gene clpB 28788 26131 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389508.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence042 1212 2498 gene locus_tag LOCUS_18620 1212 2498 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811495.1 protein_id gnl|my_center|LOCUS_18620 2653 3939 gene locus_tag LOCUS_18630 2653 3939 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389413.1 protein_id gnl|my_center|LOCUS_18630 3936 4319 gene locus_tag LOCUS_18640 3936 4319 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389414.1 protein_id gnl|my_center|LOCUS_18640 4458 4655 gene locus_tag LOCUS_18650 4458 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 4645 4833 gene locus_tag LOCUS_18660 4645 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 4773 5150 gene locus_tag LOCUS_18670 4773 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 5697 7148 gene locus_tag LOCUS_18680 5697 7148 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_18680 7500 8963 gene locus_tag LOCUS_18690 7500 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 8970 9953 gene locus_tag LOCUS_18700 8970 9953 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_18700 9946 11049 gene locus_tag LOCUS_18710 9946 11049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 11046 11879 gene locus_tag LOCUS_18720 11046 11879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_18720 12396 13730 gene locus_tag LOCUS_18730 12396 13730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 16497 14155 gene locus_tag LOCUS_18740 gene malQ 16497 14155 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068527.1 protein_id gnl|my_center|LOCUS_18740 18885 16993 gene locus_tag LOCUS_18750 18885 16993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 19165 20475 gene locus_tag LOCUS_18760 19165 20475 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_18760 20903 22261 gene locus_tag LOCUS_18770 20903 22261 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 protein_id gnl|my_center|LOCUS_18770 22258 23154 gene locus_tag LOCUS_18780 22258 23154 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113786.1 protein_id gnl|my_center|LOCUS_18780 23396 25432 gene locus_tag LOCUS_18790 gene pulA 23396 25432 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994410.1 protein_id gnl|my_center|LOCUS_18790 25515 26327 gene locus_tag LOCUS_18800 25515 26327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 26396 27199 gene locus_tag LOCUS_18810 26396 27199 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993522.1 protein_id gnl|my_center|LOCUS_18810 28537 27506 gene locus_tag LOCUS_18820 28537 27506 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390364.1 protein_id gnl|my_center|LOCUS_18820 >Feature sequence043 <1 1816 gene locus_tag LOCUS_18830 <1 1816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147766534.1:heparinase II/III family protein 4157 1974 gene locus_tag LOCUS_18840 4157 1974 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068042.1 protein_id gnl|my_center|LOCUS_18840 5318 4257 gene locus_tag LOCUS_18850 5318 4257 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055156.1 protein_id gnl|my_center|LOCUS_18850 5685 6449 gene locus_tag LOCUS_18860 5685 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 6600 7994 gene locus_tag LOCUS_18870 6600 7994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 8209 10488 gene locus_tag LOCUS_18880 8209 10488 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813771.1 protein_id gnl|my_center|LOCUS_18880 12050 10602 gene locus_tag LOCUS_18890 12050 10602 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815424.1 protein_id gnl|my_center|LOCUS_18890 12314 13525 gene locus_tag LOCUS_18900 12314 13525 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_18900 13658 14227 gene locus_tag LOCUS_18910 13658 14227 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229282.1 protein_id gnl|my_center|LOCUS_18910 14227 14469 gene locus_tag LOCUS_18920 14227 14469 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829211.1 protein_id gnl|my_center|LOCUS_18920 14563 19434 gene locus_tag LOCUS_18930 14563 19434 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143498.1 protein_id gnl|my_center|LOCUS_18930 20574 19666 gene locus_tag LOCUS_18940 20574 19666 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225055.1 protein_id gnl|my_center|LOCUS_18940 21503 20571 gene locus_tag LOCUS_18950 21503 20571 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804057.1 protein_id gnl|my_center|LOCUS_18950 22804 21500 gene locus_tag LOCUS_18960 22804 21500 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225936.1 protein_id gnl|my_center|LOCUS_18960 25407 22960 gene locus_tag LOCUS_18970 25407 22960 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_18970 27390 25495 gene locus_tag LOCUS_18980 27390 25495 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845818.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence044 240 488 gene locus_tag LOCUS_18990 240 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815980.1 protein_id gnl|my_center|LOCUS_18990 492 2180 gene locus_tag LOCUS_19000 492 2180 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143601.1 protein_id gnl|my_center|LOCUS_19000 3356 2208 gene locus_tag LOCUS_19010 3356 2208 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054733.1 protein_id gnl|my_center|LOCUS_19010 3555 5555 gene locus_tag LOCUS_19020 gene hypBA1 3555 5555 CDS product beta-L-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068480.1 protein_id gnl|my_center|LOCUS_19020 5600 7015 gene locus_tag LOCUS_19030 5600 7015 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989104.1 protein_id gnl|my_center|LOCUS_19030 8506 7220 gene locus_tag LOCUS_19040 8506 7220 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113947.1 protein_id gnl|my_center|LOCUS_19040 9175 8663 gene locus_tag LOCUS_19050 9175 8663 CDS product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775190.1 protein_id gnl|my_center|LOCUS_19050 9554 11167 gene locus_tag LOCUS_19060 9554 11167 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775818.1 protein_id gnl|my_center|LOCUS_19060 11326 14190 gene locus_tag LOCUS_19070 11326 14190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 15295 14180 gene locus_tag LOCUS_19080 15295 14180 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054733.1 protein_id gnl|my_center|LOCUS_19080 15510 16556 gene locus_tag LOCUS_19090 15510 16556 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057441.1 protein_id gnl|my_center|LOCUS_19090 16896 17849 gene locus_tag LOCUS_19100 16896 17849 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573809.1 protein_id gnl|my_center|LOCUS_19100 17846 18805 gene locus_tag LOCUS_19110 17846 18805 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963750.1 protein_id gnl|my_center|LOCUS_19110 18857 20224 gene locus_tag LOCUS_19120 18857 20224 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963751.1 protein_id gnl|my_center|LOCUS_19120 20933 20307 gene locus_tag LOCUS_19130 gene upp 20933 20307 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811535.1 protein_id gnl|my_center|LOCUS_19130 21679 21101 gene locus_tag LOCUS_19140 21679 21101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 21964 22350 gene locus_tag LOCUS_19150 21964 22350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 22466 22783 gene locus_tag LOCUS_19160 22466 22783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 22734 23033 gene locus_tag LOCUS_19170 22734 23033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 23142 23468 gene locus_tag LOCUS_19180 23142 23468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 23455 23652 gene locus_tag LOCUS_19190 23455 23652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 23630 23821 gene locus_tag LOCUS_19200 23630 23821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 23833 24030 gene locus_tag LOCUS_19210 23833 24030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 24119 25450 gene locus_tag LOCUS_19220 24119 25450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 26741 25695 gene locus_tag LOCUS_19230 26741 25695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence045 394 1983 gene locus_tag LOCUS_19240 394 1983 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_19240 3725 2112 gene locus_tag LOCUS_19250 3725 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4951 3722 gene locus_tag LOCUS_19260 4951 3722 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730485.1 protein_id gnl|my_center|LOCUS_19260 6359 5016 gene locus_tag LOCUS_19270 gene allB 6359 5016 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972680.1 protein_id gnl|my_center|LOCUS_19270 7668 6361 gene locus_tag LOCUS_19280 7668 6361 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208729.1 protein_id gnl|my_center|LOCUS_19280 9018 7756 gene locus_tag LOCUS_19290 9018 7756 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705409.1 protein_id gnl|my_center|LOCUS_19290 9952 9221 gene locus_tag LOCUS_19300 9952 9221 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057383.1 protein_id gnl|my_center|LOCUS_19300 11644 10058 gene locus_tag LOCUS_19310 11644 10058 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730746.1 protein_id gnl|my_center|LOCUS_19310 11941 12888 gene locus_tag LOCUS_19320 11941 12888 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208736.1 protein_id gnl|my_center|LOCUS_19320 14141 13092 gene locus_tag LOCUS_19330 14141 13092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 14421 17198 gene locus_tag LOCUS_19340 14421 17198 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776802.1 protein_id gnl|my_center|LOCUS_19340 18706 17516 gene locus_tag LOCUS_19350 18706 17516 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068660.1 protein_id gnl|my_center|LOCUS_19350 18996 20399 gene locus_tag LOCUS_19360 18996 20399 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068661.1 protein_id gnl|my_center|LOCUS_19360 20434 22896 gene locus_tag LOCUS_19370 20434 22896 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033493356.1 protein_id gnl|my_center|LOCUS_19370 23067 24722 gene locus_tag LOCUS_19380 23067 24722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 25642 24701 gene locus_tag LOCUS_19390 gene rarD 25642 24701 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224293.1 protein_id gnl|my_center|LOCUS_19390 25915 25721 gene locus_tag LOCUS_19400 25915 25721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence046 1075 617 gene locus_tag LOCUS_19410 1075 617 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_19410 1513 2841 gene locus_tag LOCUS_19420 gene urtA 1513 2841 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860043.1 protein_id gnl|my_center|LOCUS_19420 2863 3747 gene locus_tag LOCUS_19430 gene urtB 2863 3747 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894361.1 protein_id gnl|my_center|LOCUS_19430 3789 4967 gene locus_tag LOCUS_19440 gene urtC 3789 4967 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728737.1 protein_id gnl|my_center|LOCUS_19440 5008 5934 gene locus_tag LOCUS_19450 gene urtD 5008 5934 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894359.1 protein_id gnl|my_center|LOCUS_19450 5937 6638 gene locus_tag LOCUS_19460 gene urtE 5937 6638 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894358.1 protein_id gnl|my_center|LOCUS_19460 6753 7433 gene locus_tag LOCUS_19470 gene ureA 6753 7433 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779223.1 protein_id gnl|my_center|LOCUS_19470 7452 9176 gene locus_tag LOCUS_19480 gene ureC 7452 9176 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269033.1 protein_id gnl|my_center|LOCUS_19480 9300 9494 gene locus_tag LOCUS_19490 9300 9494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 10512 9481 gene locus_tag LOCUS_19500 10512 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 11195 10587 gene locus_tag LOCUS_19510 gene ureG 11195 10587 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664465.1 protein_id gnl|my_center|LOCUS_19510 12265 11534 gene locus_tag LOCUS_19520 12265 11534 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694141.1 protein_id gnl|my_center|LOCUS_19520 13051 12287 gene locus_tag LOCUS_19530 13051 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 13511 14656 gene locus_tag LOCUS_19540 gene cbiM 13511 14656 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964089.1 protein_id gnl|my_center|LOCUS_19540 14735 15625 gene locus_tag LOCUS_19550 14735 15625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 15742 16488 gene locus_tag LOCUS_19560 15742 16488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542058.1 protein_id gnl|my_center|LOCUS_19560 17639 16899 gene locus_tag LOCUS_19570 17639 16899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364002.1 protein_id gnl|my_center|LOCUS_19570 18825 17629 gene locus_tag LOCUS_19580 18825 17629 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507753.1 protein_id gnl|my_center|LOCUS_19580 21321 19084 gene locus_tag LOCUS_19590 21321 19084 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814112.1 protein_id gnl|my_center|LOCUS_19590 22554 23249 gene locus_tag LOCUS_19600 22554 23249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 23405 24505 gene locus_tag LOCUS_19610 23405 24505 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051629.1 protein_id gnl|my_center|LOCUS_19610 24676 25350 gene locus_tag LOCUS_19620 gene tadB 24676 25350 CDS product Flp pilus assembly protein TadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054679.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence047 208 1470 gene locus_tag LOCUS_19630 208 1470 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814403.1 protein_id gnl|my_center|LOCUS_19630 2778 2098 gene locus_tag LOCUS_19640 2778 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814794.1 protein_id gnl|my_center|LOCUS_19640 3246 2935 gene locus_tag LOCUS_19650 3246 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 3444 3262 gene locus_tag LOCUS_19660 3444 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 4894 3719 gene locus_tag LOCUS_19670 4894 3719 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118109.1 protein_id gnl|my_center|LOCUS_19670 5571 4891 gene locus_tag LOCUS_19680 5571 4891 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994083.1 protein_id gnl|my_center|LOCUS_19680 6290 5568 gene locus_tag LOCUS_19690 6290 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 6967 6452 gene locus_tag LOCUS_19700 6967 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 7105 7791 gene locus_tag LOCUS_19710 7105 7791 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816947.1 protein_id gnl|my_center|LOCUS_19710 7767 8915 gene locus_tag LOCUS_19720 7767 8915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 9214 8912 gene locus_tag LOCUS_19730 9214 8912 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265672.1 protein_id gnl|my_center|LOCUS_19730 9653 9207 gene locus_tag LOCUS_19740 9653 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 11763 9922 gene locus_tag LOCUS_19750 11763 9922 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164514635.1 protein_id gnl|my_center|LOCUS_19750 12830 11766 gene locus_tag LOCUS_19760 12830 11766 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_19760 14675 13338 gene locus_tag LOCUS_19770 14675 13338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 15373 14654 gene locus_tag LOCUS_19780 15373 14654 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113741.1 protein_id gnl|my_center|LOCUS_19780 15682 16299 gene locus_tag LOCUS_19790 15682 16299 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_19790 16363 16719 gene locus_tag LOCUS_19800 16363 16719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 16821 17309 gene locus_tag LOCUS_19810 16821 17309 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363541.1 protein_id gnl|my_center|LOCUS_19810 17369 18082 gene locus_tag LOCUS_19820 17369 18082 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389990.1 protein_id gnl|my_center|LOCUS_19820 19720 18119 gene locus_tag LOCUS_19830 19720 18119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 20957 19650 gene locus_tag LOCUS_19840 20957 19650 CDS product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224063203.1 protein_id gnl|my_center|LOCUS_19840 22885 20957 gene locus_tag LOCUS_19850 22885 20957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_19850 24813 22885 gene locus_tag LOCUS_19860 24813 22885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_19860 <25752 25110 gene locus_tag LOCUS_19870 <25752 25110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813143.1:LysR family transcriptional regulator >Feature sequence048 1632 337 gene locus_tag LOCUS_19880 1632 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 1838 3199 gene locus_tag LOCUS_19890 1838 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 3348 5885 gene locus_tag LOCUS_19900 3348 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 9036 5950 gene locus_tag LOCUS_19910 9036 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 10359 9094 gene locus_tag LOCUS_19920 10359 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 11181 11822 gene locus_tag LOCUS_19930 11181 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 12855 11824 gene locus_tag LOCUS_19940 12855 11824 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_19940 14506 12941 gene locus_tag LOCUS_19950 14506 12941 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765774.1 protein_id gnl|my_center|LOCUS_19950 15509 14595 gene locus_tag LOCUS_19960 15509 14595 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331295.1 protein_id gnl|my_center|LOCUS_19960 17496 15613 gene locus_tag LOCUS_19970 17496 15613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 17594 18424 gene locus_tag LOCUS_19980 17594 18424 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025301480.1 protein_id gnl|my_center|LOCUS_19980 18424 19767 gene locus_tag LOCUS_19990 18424 19767 CDS product polysaccharide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389374.1 protein_id gnl|my_center|LOCUS_19990 19872 20768 gene locus_tag LOCUS_20000 gene rfbA 19872 20768 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112125.1 protein_id gnl|my_center|LOCUS_20000 20890 21150 gene locus_tag LOCUS_20010 20890 21150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 21147 21527 gene locus_tag LOCUS_20020 21147 21527 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042073.1 protein_id gnl|my_center|LOCUS_20020 23699 21777 gene locus_tag LOCUS_20030 23699 21777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 25120 23876 gene locus_tag LOCUS_20040 gene ugd 25120 23876 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706040.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence049 2212 1307 gene locus_tag LOCUS_20050 2212 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3118 4488 gene locus_tag LOCUS_20060 3118 4488 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033503612.1 protein_id gnl|my_center|LOCUS_20060 4941 6314 gene locus_tag LOCUS_20070 4941 6314 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_20070 8529 6460 gene locus_tag LOCUS_20080 8529 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 9493 8609 gene locus_tag LOCUS_20090 9493 8609 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067937.1 protein_id gnl|my_center|LOCUS_20090 10431 9490 gene locus_tag LOCUS_20100 10431 9490 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994218.1 protein_id gnl|my_center|LOCUS_20100 11822 10518 gene locus_tag LOCUS_20110 11822 10518 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994219.1 protein_id gnl|my_center|LOCUS_20110 13229 11973 gene locus_tag LOCUS_20120 13229 11973 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223849864.1 protein_id gnl|my_center|LOCUS_20120 15993 13807 gene locus_tag LOCUS_20130 15993 13807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 17027 16242 gene locus_tag LOCUS_20140 17027 16242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 18105 17110 gene locus_tag LOCUS_20150 18105 17110 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068614.1 protein_id gnl|my_center|LOCUS_20150 20156 18402 gene locus_tag LOCUS_20160 20156 18402 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390379.1 protein_id gnl|my_center|LOCUS_20160 25486 20480 gene locus_tag LOCUS_20170 25486 20480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence050 1358 87 gene locus_tag LOCUS_20180 gene purD 1358 87 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813917.1 protein_id gnl|my_center|LOCUS_20180 2602 1565 gene locus_tag LOCUS_20190 gene purM 2602 1565 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813914.1 protein_id gnl|my_center|LOCUS_20190 4269 2761 gene locus_tag LOCUS_20200 gene purF 4269 2761 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390105.1 protein_id gnl|my_center|LOCUS_20200 4619 5968 gene locus_tag LOCUS_20210 4619 5968 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776865.1 protein_id gnl|my_center|LOCUS_20210 6198 6947 gene locus_tag LOCUS_20220 6198 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20220 6886 7134 gene locus_tag LOCUS_20230 6886 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20230 7136 8038 gene locus_tag LOCUS_20240 7136 8038 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776867.1 protein_id gnl|my_center|LOCUS_20240 8166 9185 gene locus_tag LOCUS_20250 8166 9185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 10183 9287 gene locus_tag LOCUS_20260 10183 9287 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389847.1 protein_id gnl|my_center|LOCUS_20260 10366 11022 gene locus_tag LOCUS_20270 10366 11022 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390042.1 protein_id gnl|my_center|LOCUS_20270 11603 11019 gene locus_tag LOCUS_20280 11603 11019 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811539.1 protein_id gnl|my_center|LOCUS_20280 12095 11688 gene locus_tag LOCUS_20290 12095 11688 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 protein_id gnl|my_center|LOCUS_20290 13693 12380 gene locus_tag LOCUS_20300 13693 12380 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033495719.1 protein_id gnl|my_center|LOCUS_20300 14573 13959 gene locus_tag LOCUS_20310 14573 13959 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053629.1 protein_id gnl|my_center|LOCUS_20310 15152 14772 gene locus_tag LOCUS_20320 15152 14772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 15647 15333 gene locus_tag LOCUS_20330 15647 15333 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116156.1 protein_id gnl|my_center|LOCUS_20330 16286 17329 gene locus_tag LOCUS_20340 16286 17329 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582428.1 protein_id gnl|my_center|LOCUS_20340 17425 18621 gene locus_tag LOCUS_20350 17425 18621 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390124.1 protein_id gnl|my_center|LOCUS_20350 18902 20995 gene locus_tag LOCUS_20360 18902 20995 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390123.1 protein_id gnl|my_center|LOCUS_20360 21284 21766 gene locus_tag LOCUS_20370 21284 21766 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390122.1 protein_id gnl|my_center|LOCUS_20370 22742 21858 gene locus_tag LOCUS_20380 22742 21858 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891775.1 protein_id gnl|my_center|LOCUS_20380 22929 24341 gene locus_tag LOCUS_20390 22929 24341 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223067.1 protein_id gnl|my_center|LOCUS_20390 24495 25049 gene locus_tag LOCUS_20400 24495 25049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence051 1397 252 gene locus_tag LOCUS_20410 1397 252 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_20410 1746 2141 gene locus_tag LOCUS_20420 1746 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2180 3193 gene locus_tag LOCUS_20430 2180 3193 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053235.1 protein_id gnl|my_center|LOCUS_20430 3374 4156 gene locus_tag LOCUS_20440 3374 4156 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053236.1 protein_id gnl|my_center|LOCUS_20440 5601 4159 gene locus_tag LOCUS_20450 5601 4159 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054058.1 protein_id gnl|my_center|LOCUS_20450 6884 5598 gene locus_tag LOCUS_20460 6884 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 7124 8098 gene locus_tag LOCUS_20470 7124 8098 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114254.1 protein_id gnl|my_center|LOCUS_20470 8129 9868 gene locus_tag LOCUS_20480 8129 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 11358 9973 gene locus_tag LOCUS_20490 11358 9973 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067963.1 protein_id gnl|my_center|LOCUS_20490 12079 11711 gene locus_tag LOCUS_20500 12079 11711 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053312.1 protein_id gnl|my_center|LOCUS_20500 12988 12128 gene locus_tag LOCUS_20510 12988 12128 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812154.1 protein_id gnl|my_center|LOCUS_20510 15715 13070 gene locus_tag LOCUS_20520 gene thiC 15715 13070 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067965.1 protein_id gnl|my_center|LOCUS_20520 16777 15863 gene locus_tag LOCUS_20530 16777 15863 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817328.1 protein_id gnl|my_center|LOCUS_20530 17068 18543 gene locus_tag LOCUS_20540 17068 18543 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067967.1 protein_id gnl|my_center|LOCUS_20540 18717 19970 gene locus_tag LOCUS_20550 gene dusB 18717 19970 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812184.1 protein_id gnl|my_center|LOCUS_20550 20088 21473 gene locus_tag LOCUS_20560 20088 21473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 21500 21991 gene locus_tag LOCUS_20570 21500 21991 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812187.1 protein_id gnl|my_center|LOCUS_20570 22097 22378 gene locus_tag LOCUS_20580 22097 22378 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812190.1 protein_id gnl|my_center|LOCUS_20580 22499 23827 gene locus_tag LOCUS_20590 22499 23827 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812192.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence052 1083 172 gene locus_tag LOCUS_20600 1083 172 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820246.1 protein_id gnl|my_center|LOCUS_20600 1543 1124 gene locus_tag LOCUS_20610 1543 1124 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383777.1 protein_id gnl|my_center|LOCUS_20610 2344 1580 gene locus_tag LOCUS_20620 2344 1580 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 protein_id gnl|my_center|LOCUS_20620 2507 2806 gene locus_tag LOCUS_20630 2507 2806 CDS product DUF2316 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721436.1 protein_id gnl|my_center|LOCUS_20630 4039 2834 gene locus_tag LOCUS_20640 4039 2834 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_20640 5509 4217 gene locus_tag LOCUS_20650 5509 4217 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363808.1 protein_id gnl|my_center|LOCUS_20650 6186 5506 gene locus_tag LOCUS_20660 6186 5506 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_20660 6357 6989 gene locus_tag LOCUS_20670 6357 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390184.1 protein_id gnl|my_center|LOCUS_20670 7001 8101 gene locus_tag LOCUS_20680 7001 8101 CDS product peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236036873.1 protein_id gnl|my_center|LOCUS_20680 8091 8693 gene locus_tag LOCUS_20690 8091 8693 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814716.1 protein_id gnl|my_center|LOCUS_20690 8690 9790 gene locus_tag LOCUS_20700 8690 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363811.1 protein_id gnl|my_center|LOCUS_20700 10497 10081 gene locus_tag LOCUS_20710 10497 10081 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059892.1 protein_id gnl|my_center|LOCUS_20710 11774 10578 gene locus_tag LOCUS_20720 11774 10578 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389958.1 protein_id gnl|my_center|LOCUS_20720 12514 11852 gene locus_tag LOCUS_20730 12514 11852 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813292.1 protein_id gnl|my_center|LOCUS_20730 12703 13107 gene locus_tag LOCUS_20740 12703 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 13313 13077 gene locus_tag LOCUS_20750 13313 13077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 13312 13833 gene locus_tag LOCUS_20760 13312 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 13846 14940 gene locus_tag LOCUS_20770 13846 14940 CDS product peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236036873.1 protein_id gnl|my_center|LOCUS_20770 14950 15687 gene locus_tag LOCUS_20780 14950 15687 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814716.1 protein_id gnl|my_center|LOCUS_20780 15684 16799 gene locus_tag LOCUS_20790 15684 16799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363811.1 protein_id gnl|my_center|LOCUS_20790 17066 17359 gene locus_tag LOCUS_20800 17066 17359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 17515 17363 gene locus_tag LOCUS_20810 17515 17363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 17474 17749 gene locus_tag LOCUS_20820 17474 17749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 18089 17889 gene locus_tag LOCUS_20830 18089 17889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 18046 18873 gene locus_tag LOCUS_20840 18046 18873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 19067 19468 gene locus_tag LOCUS_20850 19067 19468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 20201 19560 gene locus_tag LOCUS_20860 20201 19560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 22408 20261 gene locus_tag LOCUS_20870 22408 20261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 23122 22634 gene locus_tag LOCUS_20880 23122 22634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence053 863 2539 gene locus_tag LOCUS_20890 gene ettA 863 2539 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814786.1 protein_id gnl|my_center|LOCUS_20890 3649 4554 gene locus_tag LOCUS_20900 3649 4554 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363792.1 protein_id gnl|my_center|LOCUS_20900 5148 4609 gene locus_tag LOCUS_20910 5148 4609 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814779.1 protein_id gnl|my_center|LOCUS_20910 5894 5145 gene locus_tag LOCUS_20920 5894 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 8100 6016 gene locus_tag LOCUS_20930 gene ftsH 8100 6016 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363794.1 protein_id gnl|my_center|LOCUS_20930 8660 8097 gene locus_tag LOCUS_20940 gene hpt 8660 8097 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057761.1 protein_id gnl|my_center|LOCUS_20940 9783 8647 gene locus_tag LOCUS_20950 gene tilS 9783 8647 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390178.1 protein_id gnl|my_center|LOCUS_20950 11298 9844 gene locus_tag LOCUS_20960 gene dacB 11298 9844 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068787.1 protein_id gnl|my_center|LOCUS_20960 13100 11436 gene locus_tag LOCUS_20970 13100 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068786.1 protein_id gnl|my_center|LOCUS_20970 13999 13097 gene locus_tag LOCUS_20980 13999 13097 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582910.1 protein_id gnl|my_center|LOCUS_20980 15316 14393 gene locus_tag LOCUS_20990 15316 14393 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068782.1 protein_id gnl|my_center|LOCUS_20990 15404 16870 gene locus_tag LOCUS_21000 15404 16870 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390181.1 protein_id gnl|my_center|LOCUS_21000 16870 18096 gene locus_tag LOCUS_21010 16870 18096 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 protein_id gnl|my_center|LOCUS_21010 19427 18276 gene locus_tag LOCUS_21020 gene fucO 19427 18276 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052368.1 protein_id gnl|my_center|LOCUS_21020 20680 19826 gene locus_tag LOCUS_21030 20680 19826 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507544.1 protein_id gnl|my_center|LOCUS_21030 20958 21725 gene locus_tag LOCUS_21040 20958 21725 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814936.1 protein_id gnl|my_center|LOCUS_21040 <22821 21933 gene locus_tag LOCUS_21050 <22821 21933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032682473.1:sugar ABC transporter substrate-binding protein >Feature sequence054 285 1112 gene locus_tag LOCUS_21060 285 1112 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363915.1 protein_id gnl|my_center|LOCUS_21060 1191 1571 gene locus_tag LOCUS_21070 1191 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 1662 2609 gene locus_tag LOCUS_21080 1662 2609 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582939.1 protein_id gnl|my_center|LOCUS_21080 3282 2671 gene locus_tag LOCUS_21090 3282 2671 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052980.1 protein_id gnl|my_center|LOCUS_21090 3487 5403 gene locus_tag LOCUS_21100 3487 5403 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390271.1 protein_id gnl|my_center|LOCUS_21100 5400 7109 gene locus_tag LOCUS_21110 5400 7109 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390270.1 protein_id gnl|my_center|LOCUS_21110 7532 17236 gene locus_tag LOCUS_21120 7532 17236 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068722.1 protein_id gnl|my_center|LOCUS_21120 17401 17844 gene locus_tag LOCUS_21130 17401 17844 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390268.1 protein_id gnl|my_center|LOCUS_21130 18057 19871 gene locus_tag LOCUS_21140 18057 19871 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 protein_id gnl|my_center|LOCUS_21140 20005 20256 gene locus_tag LOCUS_21150 20005 20256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 20918 20469 gene locus_tag LOCUS_21160 20918 20469 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051407.1 protein_id gnl|my_center|LOCUS_21160 21039 22262 gene locus_tag LOCUS_21170 21039 22262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence055 606 893 gene locus_tag LOCUS_21180 606 893 CDS product DUF4244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051627.1 protein_id gnl|my_center|LOCUS_21180 890 1282 gene locus_tag LOCUS_21190 890 1282 CDS product TadE family type IV pilus minor pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814125.1 protein_id gnl|my_center|LOCUS_21190 1279 1821 gene locus_tag LOCUS_21200 1279 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1853 2197 gene locus_tag LOCUS_21210 1853 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2113 2487 gene locus_tag LOCUS_21220 2113 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 2711 3946 gene locus_tag LOCUS_21230 2711 3946 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814128.1 protein_id gnl|my_center|LOCUS_21230 4887 3934 gene locus_tag LOCUS_21240 4887 3934 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092846703.1 protein_id gnl|my_center|LOCUS_21240 5806 5009 gene locus_tag LOCUS_21250 5806 5009 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404822.1 protein_id gnl|my_center|LOCUS_21250 6007 7233 gene locus_tag LOCUS_21260 gene rhmD 6007 7233 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319848.1 protein_id gnl|my_center|LOCUS_21260 7258 8052 gene locus_tag LOCUS_21270 gene hpaI 7258 8052 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889550.1 protein_id gnl|my_center|LOCUS_21270 8057 8836 gene locus_tag LOCUS_21280 8057 8836 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731092.1 protein_id gnl|my_center|LOCUS_21280 10249 8939 gene locus_tag LOCUS_21290 10249 8939 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054178.1 protein_id gnl|my_center|LOCUS_21290 10535 13549 gene locus_tag LOCUS_21300 10535 13549 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157437265.1 protein_id gnl|my_center|LOCUS_21300 14171 13560 gene locus_tag LOCUS_21310 14171 13560 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051623.1 protein_id gnl|my_center|LOCUS_21310 14317 17301 gene locus_tag LOCUS_21320 14317 17301 CDS product DNA polymerase III subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068519.1 protein_id gnl|my_center|LOCUS_21320 17678 18976 gene locus_tag LOCUS_21330 17678 18976 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_21330 19111 19713 gene locus_tag LOCUS_21340 gene recR 19111 19713 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814133.1 protein_id gnl|my_center|LOCUS_21340 19929 21626 gene locus_tag LOCUS_21350 19929 21626 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104379.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence056 1059 223 gene locus_tag LOCUS_21360 1059 223 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765762.1 protein_id gnl|my_center|LOCUS_21360 1326 1616 gene locus_tag LOCUS_21370 1326 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 1930 1712 gene locus_tag LOCUS_21380 1930 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1887 2312 gene locus_tag LOCUS_21390 1887 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2462 3205 gene locus_tag LOCUS_21400 2462 3205 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389822.1 protein_id gnl|my_center|LOCUS_21400 3589 3329 gene locus_tag LOCUS_21410 gene rpsT 3589 3329 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052167.1 protein_id gnl|my_center|LOCUS_21410 3836 5716 gene locus_tag LOCUS_21420 gene lepA 3836 5716 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363424.1 protein_id gnl|my_center|LOCUS_21420 5822 7135 gene locus_tag LOCUS_21430 gene hemW 5822 7135 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783712.1 protein_id gnl|my_center|LOCUS_21430 7784 7164 gene locus_tag LOCUS_21440 7784 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 7898 8167 gene locus_tag LOCUS_21450 7898 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 8762 8106 gene locus_tag LOCUS_21460 8762 8106 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762312.1 protein_id gnl|my_center|LOCUS_21460 9455 8886 gene locus_tag LOCUS_21470 9455 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 9703 10623 gene locus_tag LOCUS_21480 9703 10623 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_21480 10952 11536 gene locus_tag LOCUS_21490 10952 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 11577 12251 gene locus_tag LOCUS_21500 11577 12251 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286323.1 protein_id gnl|my_center|LOCUS_21500 12375 13481 gene locus_tag LOCUS_21510 12375 13481 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_21510 13481 14200 gene locus_tag LOCUS_21520 13481 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 14418 15059 gene locus_tag LOCUS_21530 14418 15059 CDS product IS607-like element ISSto13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980553.1 protein_id gnl|my_center|LOCUS_21530 15046 16665 gene locus_tag LOCUS_21540 15046 16665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 16844 17452 gene locus_tag LOCUS_21550 16844 17452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 17519 18814 gene locus_tag LOCUS_21560 17519 18814 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203068.1 protein_id gnl|my_center|LOCUS_21560 19205 19714 gene locus_tag LOCUS_21570 19205 19714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 19699 19926 gene locus_tag LOCUS_21580 19699 19926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 20400 21005 gene locus_tag LOCUS_21590 20400 21005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence057 1351 488 gene locus_tag LOCUS_21600 1351 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819920.1 protein_id gnl|my_center|LOCUS_21600 3572 2097 gene locus_tag LOCUS_21610 3572 2097 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193349417.1 protein_id gnl|my_center|LOCUS_21610 4158 4859 gene locus_tag LOCUS_21620 4158 4859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811528.1 protein_id gnl|my_center|LOCUS_21620 4868 9199 gene locus_tag LOCUS_21630 4868 9199 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740909.1 protein_id gnl|my_center|LOCUS_21630 9382 10887 gene locus_tag LOCUS_21640 9382 10887 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068642.1 protein_id gnl|my_center|LOCUS_21640 11913 11032 gene locus_tag LOCUS_21650 11913 11032 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390344.1 protein_id gnl|my_center|LOCUS_21650 12308 12114 gene locus_tag LOCUS_21660 gene thiS 12308 12114 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814099.1 protein_id gnl|my_center|LOCUS_21660 12917 14008 gene locus_tag LOCUS_21670 12917 14008 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143196.1 protein_id gnl|my_center|LOCUS_21670 15073 15561 gene locus_tag LOCUS_21680 15073 15561 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811587.1 protein_id gnl|my_center|LOCUS_21680 15865 17757 gene locus_tag LOCUS_21690 15865 17757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068647.1 protein_id gnl|my_center|LOCUS_21690 17782 19650 gene locus_tag LOCUS_21700 17782 19650 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068648.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence058 2040 76 gene locus_tag LOCUS_21710 2040 76 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068161.1 protein_id gnl|my_center|LOCUS_21710 3323 2289 gene locus_tag LOCUS_21720 3323 2289 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390299.1 protein_id gnl|my_center|LOCUS_21720 4099 3398 gene locus_tag LOCUS_21730 4099 3398 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054725.1 protein_id gnl|my_center|LOCUS_21730 4172 5536 gene locus_tag LOCUS_21740 4172 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 5842 7125 gene locus_tag LOCUS_21750 5842 7125 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054727.1 protein_id gnl|my_center|LOCUS_21750 7127 7465 gene locus_tag LOCUS_21760 7127 7465 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814240.1 protein_id gnl|my_center|LOCUS_21760 7604 9433 gene locus_tag LOCUS_21770 7604 9433 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390296.1 protein_id gnl|my_center|LOCUS_21770 10837 9473 gene locus_tag LOCUS_21780 10837 9473 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051563.1 protein_id gnl|my_center|LOCUS_21780 11309 11821 gene locus_tag LOCUS_21790 11309 11821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 12301 13131 gene locus_tag LOCUS_21800 gene pnuC 12301 13131 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640894.1 protein_id gnl|my_center|LOCUS_21800 13138 14268 gene locus_tag LOCUS_21810 13138 14268 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906251.1 protein_id gnl|my_center|LOCUS_21810 14457 15884 gene locus_tag LOCUS_21820 gene dnaB 14457 15884 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054729.1 protein_id gnl|my_center|LOCUS_21820 15886 17301 gene locus_tag LOCUS_21830 15886 17301 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068484.1 protein_id gnl|my_center|LOCUS_21830 17314 18066 gene locus_tag LOCUS_21840 17314 18066 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051560.1 protein_id gnl|my_center|LOCUS_21840 18604 18531 gene locus_tag LOCUS_t00540 18604 18531 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 19467 18697 gene locus_tag LOCUS_21850 19467 18697 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051631.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence059 493 1617 gene locus_tag LOCUS_21860 gene dnaN 493 1617 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815931.1 protein_id gnl|my_center|LOCUS_21860 1853 3184 gene locus_tag LOCUS_21870 1853 3184 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054593.1 protein_id gnl|my_center|LOCUS_21870 3181 3672 gene locus_tag LOCUS_21880 3181 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21880 3929 6064 gene locus_tag LOCUS_21890 gene gyrB 3929 6064 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815936.1 protein_id gnl|my_center|LOCUS_21890 6321 8963 gene locus_tag LOCUS_21900 gene gyrA 6321 8963 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819394.1 protein_id gnl|my_center|LOCUS_21900 9167 9802 gene locus_tag LOCUS_21910 9167 9802 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051760.1 protein_id gnl|my_center|LOCUS_21910 11402 10056 gene locus_tag LOCUS_21920 gene gdhA 11402 10056 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815054.1 protein_id gnl|my_center|LOCUS_21920 11790 12053 gene locus_tag LOCUS_21930 11790 12053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 12223 12867 gene locus_tag LOCUS_21940 12223 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 13860 12898 gene locus_tag LOCUS_21950 13860 12898 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642839.1 protein_id gnl|my_center|LOCUS_21950 14925 14050 gene locus_tag LOCUS_21960 14925 14050 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819623.1 protein_id gnl|my_center|LOCUS_21960 15682 17175 gene locus_tag LOCUS_21970 15682 17175 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945999.1 protein_id gnl|my_center|LOCUS_21970 18491 17283 gene locus_tag LOCUS_21980 18491 17283 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053838.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence060 243 740 gene locus_tag LOCUS_21990 243 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 773 1204 gene locus_tag LOCUS_22000 773 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2249 1338 gene locus_tag LOCUS_22010 2249 1338 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767582.1 protein_id gnl|my_center|LOCUS_22010 2355 3392 gene locus_tag LOCUS_22020 2355 3392 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064504886.1 protein_id gnl|my_center|LOCUS_22020 4952 3441 gene locus_tag LOCUS_22030 4952 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 6105 4993 gene locus_tag LOCUS_22040 6105 4993 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107235.1 protein_id gnl|my_center|LOCUS_22040 7123 6131 gene locus_tag LOCUS_22050 7123 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 8203 7136 gene locus_tag LOCUS_22060 8203 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 9365 8217 gene locus_tag LOCUS_22070 9365 8217 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_22070 10050 9382 gene locus_tag LOCUS_22080 10050 9382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 11854 10610 gene locus_tag LOCUS_22090 11854 10610 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_22090 12804 11890 gene locus_tag LOCUS_22100 12804 11890 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836799.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22100 14030 13743 gene locus_tag LOCUS_22110 14030 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 15123 14461 gene locus_tag LOCUS_22120 15123 14461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 16325 15123 gene locus_tag LOCUS_22130 16325 15123 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_22130 17330 16428 gene locus_tag LOCUS_22140 gene rfbA 17330 16428 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_22140 18816 17359 gene locus_tag LOCUS_22150 18816 17359 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068371.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence061 3880 2195 gene locus_tag LOCUS_22160 3880 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 6834 4327 gene locus_tag LOCUS_22170 6834 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 8077 6980 gene locus_tag LOCUS_22180 gene galS 8077 6980 CDS product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628627.1 protein_id gnl|my_center|LOCUS_22180 9051 8356 gene locus_tag LOCUS_22190 9051 8356 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068041.1 protein_id gnl|my_center|LOCUS_22190 9103 9666 gene locus_tag LOCUS_22200 9103 9666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390083.1 protein_id gnl|my_center|LOCUS_22200 10819 9770 gene locus_tag LOCUS_22210 gene trpD 10819 9770 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390084.1 protein_id gnl|my_center|LOCUS_22210 13962 11005 gene locus_tag LOCUS_22220 gene secA 13962 11005 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390085.1 protein_id gnl|my_center|LOCUS_22220 14802 14143 gene locus_tag LOCUS_22230 gene raiA 14802 14143 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052648.1 protein_id gnl|my_center|LOCUS_22230 16074 15475 gene locus_tag LOCUS_22240 16074 15475 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390086.1 protein_id gnl|my_center|LOCUS_22240 17245 16085 gene locus_tag LOCUS_22250 gene recA 17245 16085 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820771.1 protein_id gnl|my_center|LOCUS_22250 17884 17510 gene locus_tag LOCUS_22260 17884 17510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 18445 17930 gene locus_tag LOCUS_22270 18445 17930 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815448.1 protein_id gnl|my_center|LOCUS_22270 19067 18513 gene locus_tag LOCUS_22280 19067 18513 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068035.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence062 494 2080 gene locus_tag LOCUS_22290 494 2080 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_22290 2269 2739 gene locus_tag LOCUS_22300 2269 2739 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051407.1 protein_id gnl|my_center|LOCUS_22300 2949 4250 gene locus_tag LOCUS_22310 2949 4250 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767248.1 protein_id gnl|my_center|LOCUS_22310 5233 4262 gene locus_tag LOCUS_22320 5233 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 5561 6550 gene locus_tag LOCUS_22330 5561 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 6629 8194 gene locus_tag LOCUS_22340 6629 8194 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_22340 10581 8299 gene locus_tag LOCUS_22350 10581 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 10813 13032 gene locus_tag LOCUS_22360 10813 13032 CDS product DUF5695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007753560.1 protein_id gnl|my_center|LOCUS_22360 13324 14553 gene locus_tag LOCUS_22370 13324 14553 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_22370 15066 17369 gene locus_tag LOCUS_22380 15066 17369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 <18305 17399 gene locus_tag LOCUS_22390 <18305 17399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013410313.1:LacI family DNA-binding transcriptional regulator >Feature sequence063 413 778 gene locus_tag LOCUS_22400 413 778 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813907.1 protein_id gnl|my_center|LOCUS_22400 2021 864 gene locus_tag LOCUS_22410 2021 864 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389526.1 protein_id gnl|my_center|LOCUS_22410 3109 2186 gene locus_tag LOCUS_22420 3109 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 3265 4167 gene locus_tag LOCUS_22430 3265 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 4417 4344 gene locus_tag LOCUS_t00550 4417 4344 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4524 4451 gene locus_tag LOCUS_t00560 4524 4451 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4638 4566 gene locus_tag LOCUS_t00570 4638 4566 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4759 4686 gene locus_tag LOCUS_t00580 4759 4686 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6050 4860 gene locus_tag LOCUS_22440 6050 4860 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811798.1 protein_id gnl|my_center|LOCUS_22440 6250 7455 gene locus_tag LOCUS_22450 6250 7455 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051458.1 protein_id gnl|my_center|LOCUS_22450 7635 8279 gene locus_tag LOCUS_22460 7635 8279 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051459.1 protein_id gnl|my_center|LOCUS_22460 9622 8312 gene locus_tag LOCUS_22470 9622 8312 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054224.1 protein_id gnl|my_center|LOCUS_22470 9838 10644 gene locus_tag LOCUS_22480 9838 10644 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389509.1 protein_id gnl|my_center|LOCUS_22480 11856 10648 gene locus_tag LOCUS_22490 11856 10648 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068437.1 protein_id gnl|my_center|LOCUS_22490 12768 11860 gene locus_tag LOCUS_22500 12768 11860 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782830.1 protein_id gnl|my_center|LOCUS_22500 13685 12759 gene locus_tag LOCUS_22510 13685 12759 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068438.1 protein_id gnl|my_center|LOCUS_22510 14895 13729 gene locus_tag LOCUS_22520 14895 13729 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051466.1 protein_id gnl|my_center|LOCUS_22520 15107 15364 gene locus_tag LOCUS_22530 15107 15364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 16455 15319 gene locus_tag LOCUS_22540 16455 15319 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389489.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence064 406 1056 gene locus_tag LOCUS_22550 406 1056 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053738.1 protein_id gnl|my_center|LOCUS_22550 1073 2035 gene locus_tag LOCUS_22560 1073 2035 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812023.1 protein_id gnl|my_center|LOCUS_22560 2175 2813 gene locus_tag LOCUS_22570 2175 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 2924 3592 gene locus_tag LOCUS_22580 2924 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057770.1 protein_id gnl|my_center|LOCUS_22580 3620 4942 gene locus_tag LOCUS_22590 3620 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 5178 8432 gene locus_tag LOCUS_22600 5178 8432 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 protein_id gnl|my_center|LOCUS_22600 8649 10391 gene locus_tag LOCUS_22610 8649 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 10394 11026 gene locus_tag LOCUS_22620 10394 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 11083 12219 gene locus_tag LOCUS_22630 gene cas7e 11083 12219 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_22630 12222 12980 gene locus_tag LOCUS_22640 gene cas5e 12222 12980 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 protein_id gnl|my_center|LOCUS_22640 12991 13695 gene locus_tag LOCUS_22650 gene cas6e 12991 13695 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229112.1 protein_id gnl|my_center|LOCUS_22650 13692 14699 gene locus_tag LOCUS_22660 gene cas1e 13692 14699 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 protein_id gnl|my_center|LOCUS_22660 14759 15115 gene locus_tag LOCUS_22670 14759 15115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 15319 15836 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgcatgcggggatgatcc 16344 15799 gene locus_tag LOCUS_22680 16344 15799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence065 1433 69 gene locus_tag LOCUS_22690 1433 69 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_22690 1737 1465 gene locus_tag LOCUS_22700 1737 1465 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_22700 3497 1905 gene locus_tag LOCUS_22710 3497 1905 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674808.1 protein_id gnl|my_center|LOCUS_22710 4916 3657 gene locus_tag LOCUS_22720 gene galK 4916 3657 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057651.1 protein_id gnl|my_center|LOCUS_22720 6220 4961 gene locus_tag LOCUS_22730 gene galT 6220 4961 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055169.1 protein_id gnl|my_center|LOCUS_22730 7020 6217 gene locus_tag LOCUS_22740 7020 6217 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023658105.1 protein_id gnl|my_center|LOCUS_22740 7133 8326 gene locus_tag LOCUS_22750 7133 8326 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811998.1 protein_id gnl|my_center|LOCUS_22750 9636 8485 gene locus_tag LOCUS_22760 9636 8485 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389578.1 protein_id gnl|my_center|LOCUS_22760 12286 9821 gene locus_tag LOCUS_22770 12286 9821 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051332.1 protein_id gnl|my_center|LOCUS_22770 13134 12415 gene locus_tag LOCUS_22780 13134 12415 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051333.1 protein_id gnl|my_center|LOCUS_22780 14459 13311 gene locus_tag LOCUS_22790 14459 13311 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051334.1 protein_id gnl|my_center|LOCUS_22790 15587 14556 gene locus_tag LOCUS_22800 15587 14556 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811990.1 protein_id gnl|my_center|LOCUS_22800 <16541 15662 gene locus_tag LOCUS_22810 <16541 15662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389575.1:S9 family peptidase >Feature sequence066 710 102 gene locus_tag LOCUS_22820 710 102 CDS product DUF4125 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814656.1 protein_id gnl|my_center|LOCUS_22820 3221 972 gene locus_tag LOCUS_22830 3221 972 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390200.1 protein_id gnl|my_center|LOCUS_22830 4520 3333 gene locus_tag LOCUS_22840 4520 3333 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053838.1 protein_id gnl|my_center|LOCUS_22840 4766 4692 gene locus_tag LOCUS_t00590 4766 4692 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4881 6560 gene locus_tag LOCUS_22850 gene lysS 4881 6560 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053839.1 protein_id gnl|my_center|LOCUS_22850 6844 8100 gene locus_tag LOCUS_22860 6844 8100 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389667.1 protein_id gnl|my_center|LOCUS_22860 8269 9303 gene locus_tag LOCUS_22870 gene menA 8269 9303 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068774.1 protein_id gnl|my_center|LOCUS_22870 9548 10288 gene locus_tag LOCUS_22880 9548 10288 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052347.1 protein_id gnl|my_center|LOCUS_22880 11316 10636 gene locus_tag LOCUS_22890 gene phoU 11316 10636 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363821.1 protein_id gnl|my_center|LOCUS_22890 11590 12966 gene locus_tag LOCUS_22900 11590 12966 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055303.1 protein_id gnl|my_center|LOCUS_22900 13337 13074 gene locus_tag LOCUS_22910 13337 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814675.1 protein_id gnl|my_center|LOCUS_22910 14508 13360 gene locus_tag LOCUS_22920 gene serC 14508 13360 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052351.1 protein_id gnl|my_center|LOCUS_22920 14731 15750 gene locus_tag LOCUS_22930 14731 15750 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052353.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence067 3095 330 gene locus_tag LOCUS_22940 3095 330 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390053.1 protein_id gnl|my_center|LOCUS_22940 3904 3128 gene locus_tag LOCUS_22950 3904 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22950 4062 4244 gene locus_tag LOCUS_22960 4062 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 4241 6019 gene locus_tag LOCUS_22970 4241 6019 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114980.1 protein_id gnl|my_center|LOCUS_22970 6977 6117 gene locus_tag LOCUS_22980 6977 6117 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567501.1 protein_id gnl|my_center|LOCUS_22980 8644 6974 gene locus_tag LOCUS_22990 8644 6974 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_22990 9403 8867 gene locus_tag LOCUS_23000 9403 8867 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837488.1 protein_id gnl|my_center|LOCUS_23000 10955 9639 gene locus_tag LOCUS_23010 10955 9639 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363634.1 protein_id gnl|my_center|LOCUS_23010 11323 12237 gene locus_tag LOCUS_23020 11323 12237 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813634.1 protein_id gnl|my_center|LOCUS_23020 12491 12415 gene locus_tag LOCUS_t00600 12491 12415 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 14472 12661 gene locus_tag LOCUS_23030 14472 12661 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389968.1 protein_id gnl|my_center|LOCUS_23030 15145 14558 gene locus_tag LOCUS_23040 15145 14558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 15541 15468 gene locus_tag LOCUS_t00610 15541 15468 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 15661 15588 gene locus_tag LOCUS_t00620 15661 15588 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 15760 15687 gene locus_tag LOCUS_t00630 15760 15687 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence068 <1 970 gene locus_tag LOCUS_23050 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389721.1:DUF3027 domain-containing protein 2091 1132 gene locus_tag LOCUS_23060 2091 1132 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053195.1 protein_id gnl|my_center|LOCUS_23060 2232 4799 gene locus_tag LOCUS_23070 2232 4799 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067907.1 protein_id gnl|my_center|LOCUS_23070 4922 6475 gene locus_tag LOCUS_23080 4922 6475 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_23080 6677 7753 gene locus_tag LOCUS_23090 6677 7753 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198708.1 protein_id gnl|my_center|LOCUS_23090 7750 8811 gene locus_tag LOCUS_23100 7750 8811 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162829286.1 protein_id gnl|my_center|LOCUS_23100 8813 9862 gene locus_tag LOCUS_23110 8813 9862 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339289.1 protein_id gnl|my_center|LOCUS_23110 9859 10704 gene locus_tag LOCUS_23120 9859 10704 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967921.1 protein_id gnl|my_center|LOCUS_23120 10809 11777 gene locus_tag LOCUS_23130 10809 11777 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013801.1 protein_id gnl|my_center|LOCUS_23130 13371 11917 gene locus_tag LOCUS_23140 13371 11917 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053980.1 protein_id gnl|my_center|LOCUS_23140 13533 14879 gene locus_tag LOCUS_23150 gene hisS 13533 14879 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812547.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence069 913 623 gene locus_tag LOCUS_23160 913 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 893 1291 gene locus_tag LOCUS_23170 893 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2099 1617 gene locus_tag LOCUS_23180 gene ispF 2099 1617 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068243.1 protein_id gnl|my_center|LOCUS_23180 2876 2280 gene locus_tag LOCUS_23190 2876 2280 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068244.1 protein_id gnl|my_center|LOCUS_23190 3014 5269 gene locus_tag LOCUS_23200 gene glgB 3014 5269 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812706.1 protein_id gnl|my_center|LOCUS_23200 5284 6003 gene locus_tag LOCUS_23210 5284 6003 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812704.1 protein_id gnl|my_center|LOCUS_23210 6021 7103 gene locus_tag LOCUS_23220 6021 7103 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389772.1 protein_id gnl|my_center|LOCUS_23220 7868 7089 gene locus_tag LOCUS_23230 7868 7089 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143341.1 protein_id gnl|my_center|LOCUS_23230 8737 7865 gene locus_tag LOCUS_23240 8737 7865 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389769.1 protein_id gnl|my_center|LOCUS_23240 8858 9286 gene locus_tag LOCUS_23250 8858 9286 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080545171.1 protein_id gnl|my_center|LOCUS_23250 10828 9302 gene locus_tag LOCUS_23260 10828 9302 CDS product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053571.1 protein_id gnl|my_center|LOCUS_23260 13947 10825 gene locus_tag LOCUS_23270 13947 10825 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389766.1 protein_id gnl|my_center|LOCUS_23270 14280 13981 gene locus_tag LOCUS_23280 14280 13981 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051901.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence070 1353 325 gene locus_tag LOCUS_23290 1353 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 1757 2143 gene locus_tag LOCUS_23300 1757 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3447 2176 gene locus_tag LOCUS_23310 3447 2176 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821099.1 protein_id gnl|my_center|LOCUS_23310 4162 3515 gene locus_tag LOCUS_23320 4162 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 5501 4515 gene locus_tag LOCUS_23330 5501 4515 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_23330 6545 5532 gene locus_tag LOCUS_23340 6545 5532 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775210.1 protein_id gnl|my_center|LOCUS_23340 8295 6667 gene locus_tag LOCUS_23350 8295 6667 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_23350 10560 8584 gene locus_tag LOCUS_23360 10560 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 10864 12423 gene locus_tag LOCUS_23370 10864 12423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 <14809 12451 gene locus_tag LOCUS_23380 <14809 12451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068820.1:acyl-CoA dehydratase activase-related protein >Feature sequence071 1313 75 gene locus_tag LOCUS_23390 1313 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821051.1 protein_id gnl|my_center|LOCUS_23390 3302 1416 gene locus_tag LOCUS_23400 3302 1416 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390201.1 protein_id gnl|my_center|LOCUS_23400 3427 4845 gene locus_tag LOCUS_23410 3427 4845 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143562.1 protein_id gnl|my_center|LOCUS_23410 4842 5696 gene locus_tag LOCUS_23420 4842 5696 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814649.1 protein_id gnl|my_center|LOCUS_23420 6387 5728 gene locus_tag LOCUS_23430 6387 5728 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363467.1 protein_id gnl|my_center|LOCUS_23430 6681 6596 gene locus_tag LOCUS_t00640 6681 6596 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8141 6855 gene locus_tag LOCUS_23440 gene serS 8141 6855 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052327.1 protein_id gnl|my_center|LOCUS_23440 8304 9437 gene locus_tag LOCUS_23450 8304 9437 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143567.1 protein_id gnl|my_center|LOCUS_23450 10413 9538 gene locus_tag LOCUS_23460 10413 9538 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363838.1 protein_id gnl|my_center|LOCUS_23460 12552 10447 gene locus_tag LOCUS_23470 12552 10447 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390207.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence072 2013 280 gene locus_tag LOCUS_23480 2013 280 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811972.1 protein_id gnl|my_center|LOCUS_23480 2368 4017 gene locus_tag LOCUS_23490 2368 4017 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217063484.1 protein_id gnl|my_center|LOCUS_23490 4262 6139 gene locus_tag LOCUS_23500 4262 6139 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053633.1 protein_id gnl|my_center|LOCUS_23500 6132 7583 gene locus_tag LOCUS_23510 6132 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068362.1 protein_id gnl|my_center|LOCUS_23510 7974 9350 gene locus_tag LOCUS_23520 7974 9350 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250265.1 protein_id gnl|my_center|LOCUS_23520 9452 10138 gene locus_tag LOCUS_23530 9452 10138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 10237 10830 gene locus_tag LOCUS_23540 10237 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 10839 11186 gene locus_tag LOCUS_23550 10839 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 11689 11288 gene locus_tag LOCUS_23560 11689 11288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 12192 12878 gene locus_tag LOCUS_23570 12192 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 12885 13388 gene locus_tag LOCUS_23580 12885 13388 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970310.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence073 125 52 gene locus_tag LOCUS_t00650 125 52 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1294 251 gene locus_tag LOCUS_23590 gene tsaD 1294 251 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363525.1 protein_id gnl|my_center|LOCUS_23590 1884 1291 gene locus_tag LOCUS_23600 gene rimI 1884 1291 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389970.1 protein_id gnl|my_center|LOCUS_23600 2777 1884 gene locus_tag LOCUS_23610 gene tsaB 2777 1884 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389971.1 protein_id gnl|my_center|LOCUS_23610 3504 2905 gene locus_tag LOCUS_23620 gene tsaE 3504 2905 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047289290.1 protein_id gnl|my_center|LOCUS_23620 4478 3501 gene locus_tag LOCUS_23630 gene holA 4478 3501 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057620.1 protein_id gnl|my_center|LOCUS_23630 5815 4736 gene locus_tag LOCUS_23640 5815 4736 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031334.1 protein_id gnl|my_center|LOCUS_23640 5851 6294 gene locus_tag LOCUS_23650 5851 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 8247 6346 gene locus_tag LOCUS_23660 8247 6346 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389974.1 protein_id gnl|my_center|LOCUS_23660 8840 8244 gene locus_tag LOCUS_23670 8840 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 12375 9397 gene locus_tag LOCUS_23680 gene leuS 12375 9397 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389976.1 protein_id gnl|my_center|LOCUS_23680 13330 12455 gene locus_tag LOCUS_23690 13330 12455 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389977.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence074 296 1438 gene locus_tag LOCUS_23700 296 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1652 2347 gene locus_tag LOCUS_23710 1652 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 4859 2415 gene locus_tag LOCUS_23720 4859 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 6128 4959 gene locus_tag LOCUS_23730 6128 4959 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_23730 6299 7843 gene locus_tag LOCUS_23740 6299 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 9715 7895 gene locus_tag LOCUS_23750 9715 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 9955 11286 gene locus_tag LOCUS_23760 9955 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence075 1128 484 gene locus_tag LOCUS_23770 1128 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 1326 2300 gene locus_tag LOCUS_23780 1326 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032736338.1 protein_id gnl|my_center|LOCUS_23780 5237 2904 gene locus_tag LOCUS_23790 5237 2904 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068631.1 protein_id gnl|my_center|LOCUS_23790 7966 5234 gene locus_tag LOCUS_23800 7966 5234 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068632.1 protein_id gnl|my_center|LOCUS_23800 10638 8242 gene locus_tag LOCUS_23810 10638 8242 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068565.1 protein_id gnl|my_center|LOCUS_23810 10793 11497 gene locus_tag LOCUS_23820 10793 11497 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_23820 11518 12054 gene locus_tag LOCUS_23830 11518 12054 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811415.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence076 241 1236 gene locus_tag LOCUS_23840 241 1236 CDS product DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390253.1 protein_id gnl|my_center|LOCUS_23840 1381 2115 gene locus_tag LOCUS_23850 1381 2115 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 protein_id gnl|my_center|LOCUS_23850 2935 2210 gene locus_tag LOCUS_23860 2935 2210 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052787970.1 protein_id gnl|my_center|LOCUS_23860 3444 2992 gene locus_tag LOCUS_23870 3444 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 3551 5584 gene locus_tag LOCUS_23880 3551 5584 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399551.1 protein_id gnl|my_center|LOCUS_23880 5775 6737 gene locus_tag LOCUS_23890 gene pyrB 5775 6737 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054218.1 protein_id gnl|my_center|LOCUS_23890 6737 7171 gene locus_tag LOCUS_23900 6737 7171 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816669.1 protein_id gnl|my_center|LOCUS_23900 7171 8607 gene locus_tag LOCUS_23910 7171 8607 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389893.1 protein_id gnl|my_center|LOCUS_23910 8738 9718 gene locus_tag LOCUS_23920 gene pyrF 8738 9718 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_23920 9853 10683 gene locus_tag LOCUS_23930 9853 10683 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389895.1 protein_id gnl|my_center|LOCUS_23930 10687 11643 gene locus_tag LOCUS_23940 10687 11643 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813106.1 protein_id gnl|my_center|LOCUS_23940 11673 12371 gene locus_tag LOCUS_23950 gene pyrE 11673 12371 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389897.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence077 459 82 gene locus_tag LOCUS_23960 459 82 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_23960 1261 848 gene locus_tag LOCUS_23970 1261 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2218 1448 gene locus_tag LOCUS_23980 2218 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 2545 3345 gene locus_tag LOCUS_23990 2545 3345 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814301.1 protein_id gnl|my_center|LOCUS_23990 3352 4017 gene locus_tag LOCUS_24000 gene nth 3352 4017 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051520.1 protein_id gnl|my_center|LOCUS_24000 5292 4198 gene locus_tag LOCUS_24010 5292 4198 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068660.1 protein_id gnl|my_center|LOCUS_24010 5658 7280 gene locus_tag LOCUS_24020 5658 7280 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_24020 7641 8630 gene locus_tag LOCUS_24030 7641 8630 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_24030 8663 9619 gene locus_tag LOCUS_24040 8663 9619 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_24040 10004 10915 gene locus_tag LOCUS_24050 10004 10915 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389324.1 protein_id gnl|my_center|LOCUS_24050 11366 12775 gene locus_tag LOCUS_24060 11366 12775 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767248.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence078 4229 3522 gene locus_tag LOCUS_24070 gene nrdG 4229 3522 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389607.1 protein_id gnl|my_center|LOCUS_24070 6851 4455 gene locus_tag LOCUS_24080 gene nrdD 6851 4455 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812105.1 protein_id gnl|my_center|LOCUS_24080 7159 8505 gene locus_tag LOCUS_24090 gene xseA 7159 8505 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389606.1 protein_id gnl|my_center|LOCUS_24090 8562 8858 gene locus_tag LOCUS_24100 8562 8858 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812098.1 protein_id gnl|my_center|LOCUS_24100 9915 8962 gene locus_tag LOCUS_24110 9915 8962 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068814.1 protein_id gnl|my_center|LOCUS_24110 9944 10384 gene locus_tag LOCUS_24120 9944 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 10375 10449 gene locus_tag LOCUS_t00660 10375 10449 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10693 10842 gene locus_tag LOCUS_24130 10693 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 10959 12083 gene locus_tag LOCUS_24140 10959 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence079 <1 1259 gene locus_tag LOCUS_24150 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050077963.1:MFS transporter 1565 3124 gene locus_tag LOCUS_24160 1565 3124 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208870.1 protein_id gnl|my_center|LOCUS_24160 3879 3226 gene locus_tag LOCUS_24170 3879 3226 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530472.1 protein_id gnl|my_center|LOCUS_24170 4106 5110 gene locus_tag LOCUS_24180 4106 5110 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582297.1 protein_id gnl|my_center|LOCUS_24180 5372 6517 gene locus_tag LOCUS_24190 5372 6517 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056552.1 protein_id gnl|my_center|LOCUS_24190 9529 6773 gene locus_tag LOCUS_24200 9529 6773 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362858.1 protein_id gnl|my_center|LOCUS_24200 9823 11922 gene locus_tag LOCUS_24210 9823 11922 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362859.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence080 <1 568 gene locus_tag LOCUS_24220 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389484.1:Rne/Rng family ribonuclease 730 1038 gene locus_tag LOCUS_24230 gene rplU 730 1038 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811712.1 protein_id gnl|my_center|LOCUS_24230 1081 1332 gene locus_tag LOCUS_24240 gene rpmA 1081 1332 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053061.1 protein_id gnl|my_center|LOCUS_24240 1626 3305 gene locus_tag LOCUS_24250 gene obgE 1626 3305 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815401.1 protein_id gnl|my_center|LOCUS_24250 3334 4461 gene locus_tag LOCUS_24260 gene proB 3334 4461 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811720.1 protein_id gnl|my_center|LOCUS_24260 4537 5745 gene locus_tag LOCUS_24270 4537 5745 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055070.1 protein_id gnl|my_center|LOCUS_24270 6029 6104 gene locus_tag LOCUS_t00670 6029 6104 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 6141 6368 gene locus_tag LOCUS_24280 gene secE 6141 6368 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053057.1 protein_id gnl|my_center|LOCUS_24280 6403 7305 gene locus_tag LOCUS_24290 gene nusG 6403 7305 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055071.1 protein_id gnl|my_center|LOCUS_24290 7666 8097 gene locus_tag LOCUS_24300 gene rplK 7666 8097 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053055.1 protein_id gnl|my_center|LOCUS_24300 8115 8807 gene locus_tag LOCUS_24310 gene rplA 8115 8807 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829786.1 protein_id gnl|my_center|LOCUS_24310 9786 8956 gene locus_tag LOCUS_24320 9786 8956 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053763.1 protein_id gnl|my_center|LOCUS_24320 12003 9856 gene locus_tag LOCUS_24330 12003 9856 CDS product DUF6020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390273.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence081 3274 1744 gene locus_tag LOCUS_r00010 3274 1744 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5001 4006 gene locus_tag LOCUS_24340 5001 4006 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811732.1 protein_id gnl|my_center|LOCUS_24340 5930 5028 gene locus_tag LOCUS_24350 5930 5028 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389488.1 protein_id gnl|my_center|LOCUS_24350 6190 6843 gene locus_tag LOCUS_24360 6190 6843 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389464.1 protein_id gnl|my_center|LOCUS_24360 7183 8505 gene locus_tag LOCUS_24370 7183 8505 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015512063.1 protein_id gnl|my_center|LOCUS_24370 9951 8623 gene locus_tag LOCUS_24380 gene murA 9951 8623 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056295.1 protein_id gnl|my_center|LOCUS_24380 10251 10811 gene locus_tag LOCUS_24390 10251 10811 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390280.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence082 2899 824 gene locus_tag LOCUS_24400 2899 824 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053701.1 protein_id gnl|my_center|LOCUS_24400 3097 4119 gene locus_tag LOCUS_24410 3097 4119 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814924.1 protein_id gnl|my_center|LOCUS_24410 5128 4277 gene locus_tag LOCUS_24420 5128 4277 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389633.1 protein_id gnl|my_center|LOCUS_24420 5666 6445 gene locus_tag LOCUS_24430 5666 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 8342 6480 gene locus_tag LOCUS_24440 gene glmS 8342 6480 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051287.1 protein_id gnl|my_center|LOCUS_24440 8859 8458 gene locus_tag LOCUS_24450 8859 8458 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052491.1 protein_id gnl|my_center|LOCUS_24450 9151 8846 gene locus_tag LOCUS_24460 9151 8846 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052490.1 protein_id gnl|my_center|LOCUS_24460 9353 11107 gene locus_tag LOCUS_24470 9353 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence083 1770 1102 gene locus_tag LOCUS_24480 1770 1102 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389340.1 protein_id gnl|my_center|LOCUS_24480 2080 2643 gene locus_tag LOCUS_24490 gene ahpC 2080 2643 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817384.1 protein_id gnl|my_center|LOCUS_24490 3122 4993 gene locus_tag LOCUS_24500 3122 4993 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056574.1 protein_id gnl|my_center|LOCUS_24500 10398 5185 gene locus_tag LOCUS_24510 10398 5185 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152209156.1 protein_id gnl|my_center|LOCUS_24510 10722 10642 gene locus_tag LOCUS_t00680 10722 10642 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence084 746 2422 gene locus_tag LOCUS_24520 gene kdpA 746 2422 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029188.1 protein_id gnl|my_center|LOCUS_24520 2424 4598 gene locus_tag LOCUS_24530 gene kdpB 2424 4598 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730505.1 protein_id gnl|my_center|LOCUS_24530 4630 5262 gene locus_tag LOCUS_24540 4630 5262 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029186.1 protein_id gnl|my_center|LOCUS_24540 5459 8428 gene locus_tag LOCUS_24550 5459 8428 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_24550 8425 9138 gene locus_tag LOCUS_24560 8425 9138 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081527.1 protein_id gnl|my_center|LOCUS_24560 9917 9195 gene locus_tag LOCUS_24570 9917 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence085 346 125 gene locus_tag LOCUS_24580 346 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 359 1252 gene locus_tag LOCUS_24590 359 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 1894 1685 gene locus_tag LOCUS_24600 1894 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2657 2905 gene locus_tag LOCUS_24610 2657 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 3890 2949 gene locus_tag LOCUS_24620 3890 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 4238 4447 gene locus_tag LOCUS_24630 4238 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 5543 5334 gene locus_tag LOCUS_24640 5543 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 5891 6832 gene locus_tag LOCUS_24650 5891 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 7124 6876 gene locus_tag LOCUS_24660 7124 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 7887 8096 gene locus_tag LOCUS_24670 7887 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 9422 8529 gene locus_tag LOCUS_24680 9422 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 9435 9656 gene locus_tag LOCUS_24690 9435 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence086 1299 199 gene locus_tag LOCUS_24700 gene trpS 1299 199 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815099.1 protein_id gnl|my_center|LOCUS_24700 1444 1839 gene locus_tag LOCUS_24710 1444 1839 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054547.1 protein_id gnl|my_center|LOCUS_24710 2650 2117 gene locus_tag LOCUS_24720 2650 2117 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022527180.1 protein_id gnl|my_center|LOCUS_24720 2758 3564 gene locus_tag LOCUS_24730 2758 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 3613 4437 gene locus_tag LOCUS_24740 3613 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 4799 7255 gene locus_tag LOCUS_24750 4799 7255 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389382.1 protein_id gnl|my_center|LOCUS_24750 7912 7664 gene locus_tag LOCUS_24760 7912 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 8033 8821 gene locus_tag LOCUS_24770 8033 8821 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362938.1 protein_id gnl|my_center|LOCUS_24770 >Feature sequence087 1618 104 gene locus_tag LOCUS_24780 1618 104 CDS product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582935.1 protein_id gnl|my_center|LOCUS_24780 2890 1655 gene locus_tag LOCUS_24790 2890 1655 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_24790 4714 3065 gene locus_tag LOCUS_24800 4714 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 4784 6448 gene locus_tag LOCUS_24810 4784 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 6623 7858 gene locus_tag LOCUS_24820 6623 7858 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_24820 7895 9409 gene locus_tag LOCUS_24830 7895 9409 CDS product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582935.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence088 360 5708 gene locus_tag LOCUS_24840 gene pulA 360 5708 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947102.1 protein_id gnl|my_center|LOCUS_24840 6131 8020 gene locus_tag LOCUS_24850 gene dnaK 6131 8020 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814044.1 protein_id gnl|my_center|LOCUS_24850 8032 8733 gene locus_tag LOCUS_24860 gene grpE 8032 8733 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390362.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence089 2228 33 gene locus_tag LOCUS_24870 2228 33 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014760479.1 protein_id gnl|my_center|LOCUS_24870 2468 3856 gene locus_tag LOCUS_24880 2468 3856 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390107.1 protein_id gnl|my_center|LOCUS_24880 3853 6531 gene locus_tag LOCUS_24890 3853 6531 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390108.1 protein_id gnl|my_center|LOCUS_24890 6717 8753 gene locus_tag LOCUS_24900 6717 8753 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390119.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence090 735 22 gene locus_tag LOCUS_24910 735 22 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053184.1 protein_id gnl|my_center|LOCUS_24910 917 1684 gene locus_tag LOCUS_24920 917 1684 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055622.1 protein_id gnl|my_center|LOCUS_24920 1890 2099 gene locus_tag LOCUS_24930 1890 2099 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816407.1 protein_id gnl|my_center|LOCUS_24930 2392 3966 gene locus_tag LOCUS_24940 gene groL 2392 3966 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053188.1 protein_id gnl|my_center|LOCUS_24940 4367 4080 gene locus_tag LOCUS_24950 4367 4080 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812525.1 protein_id gnl|my_center|LOCUS_24950 4534 5277 gene locus_tag LOCUS_24960 4534 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 5381 6136 gene locus_tag LOCUS_24970 5381 6136 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389720.1 protein_id gnl|my_center|LOCUS_24970 6133 8049 gene locus_tag LOCUS_24980 6133 8049 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812532.1 protein_id gnl|my_center|LOCUS_24980 8164 8538 gene locus_tag LOCUS_24990 8164 8538 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812533.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence091 404 1117 gene locus_tag LOCUS_25000 404 1117 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813164.1 protein_id gnl|my_center|LOCUS_25000 1357 1611 gene locus_tag LOCUS_25010 1357 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 2246 1875 gene locus_tag LOCUS_25020 2246 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 2952 2257 gene locus_tag LOCUS_25030 2952 2257 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052293.1 protein_id gnl|my_center|LOCUS_25030 3466 3029 gene locus_tag LOCUS_25040 3466 3029 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052292.1 protein_id gnl|my_center|LOCUS_25040 4391 3567 gene locus_tag LOCUS_25050 4391 3567 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389926.1 protein_id gnl|my_center|LOCUS_25050 4727 4395 gene locus_tag LOCUS_25060 4727 4395 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813185.1 protein_id gnl|my_center|LOCUS_25060 5739 4729 gene locus_tag LOCUS_25070 5739 4729 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729941.1 protein_id gnl|my_center|LOCUS_25070 6338 5736 gene locus_tag LOCUS_25080 6338 5736 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389928.1 protein_id gnl|my_center|LOCUS_25080 7203 6352 gene locus_tag LOCUS_25090 gene hisG 7203 6352 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389929.1 protein_id gnl|my_center|LOCUS_25090 7541 7278 gene locus_tag LOCUS_25100 7541 7278 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813192.1 protein_id gnl|my_center|LOCUS_25100 8237 7572 gene locus_tag LOCUS_25110 gene rpe 8237 7572 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055745.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence092 156 3605 gene locus_tag LOCUS_25120 156 3605 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203068.1 protein_id gnl|my_center|LOCUS_25120 4315 3686 gene locus_tag LOCUS_25130 4315 3686 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363467.1 protein_id gnl|my_center|LOCUS_25130 6292 4439 gene locus_tag LOCUS_25140 6292 4439 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813148.1 protein_id gnl|my_center|LOCUS_25140 6633 7109 gene locus_tag LOCUS_25150 6633 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 7238 8008 gene locus_tag LOCUS_25160 7238 8008 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence093 203 1267 gene locus_tag LOCUS_25170 203 1267 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811640.1 protein_id gnl|my_center|LOCUS_25170 1310 2908 gene locus_tag LOCUS_25180 1310 2908 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014759708.1 protein_id gnl|my_center|LOCUS_25180 3584 3102 gene locus_tag LOCUS_25190 gene crgA 3584 3102 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389385.1 protein_id gnl|my_center|LOCUS_25190 3723 4535 gene locus_tag LOCUS_25200 3723 4535 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816156.1 protein_id gnl|my_center|LOCUS_25200 4657 5940 gene locus_tag LOCUS_25210 4657 5940 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068569.1 protein_id gnl|my_center|LOCUS_25210 6252 6896 gene locus_tag LOCUS_25220 6252 6896 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811402.1 protein_id gnl|my_center|LOCUS_25220 6929 7249 gene locus_tag LOCUS_25230 6929 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence094 <1 1754 gene locus_tag LOCUS_25240 <1 1754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109145.1:beta-galactosidase 1980 2114 gene locus_tag LOCUS_25250 1980 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 3287 2346 gene locus_tag LOCUS_25260 3287 2346 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053065.1 protein_id gnl|my_center|LOCUS_25260 3747 4688 gene locus_tag LOCUS_25270 3747 4688 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053065.1 protein_id gnl|my_center|LOCUS_25270 5054 4920 gene locus_tag LOCUS_25280 5054 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 <7033 5280 gene locus_tag LOCUS_25290 <7033 5280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109145.1:beta-galactosidase >Feature sequence095 2149 1304 gene locus_tag LOCUS_25300 2149 1304 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027953.1 protein_id gnl|my_center|LOCUS_25300 3707 2484 gene locus_tag LOCUS_25310 3707 2484 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_25310 5200 3704 gene locus_tag LOCUS_25320 gene glcD 5200 3704 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890752.1 protein_id gnl|my_center|LOCUS_25320 <6425 5237 gene locus_tag LOCUS_25330 <6425 5237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804199.1:ABC transporter ATP-binding protein >Feature sequence096 1547 708 gene locus_tag LOCUS_25340 1547 708 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582354.1 protein_id gnl|my_center|LOCUS_25340 1863 4070 gene locus_tag LOCUS_25350 1863 4070 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225431655.1 protein_id gnl|my_center|LOCUS_25350 5916 4459 gene locus_tag LOCUS_25360 5916 4459 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068371.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence097 2710 1628 gene locus_tag LOCUS_25370 2710 1628 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811405.1 protein_id gnl|my_center|LOCUS_25370 4173 2707 gene locus_tag LOCUS_25380 4173 2707 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389388.1 protein_id gnl|my_center|LOCUS_25380 5552 4170 gene locus_tag LOCUS_25390 5552 4170 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056849.1 protein_id gnl|my_center|LOCUS_25390 6022 5549 gene locus_tag LOCUS_25400 6022 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence098 1834 1908 gene locus_tag LOCUS_t00690 1834 1908 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2641 2267 gene locus_tag LOCUS_25410 2641 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 2967 2653 gene locus_tag LOCUS_25420 2967 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 3372 3037 gene locus_tag LOCUS_25430 3372 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 4062 3385 gene locus_tag LOCUS_25440 4062 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 4267 4073 gene locus_tag LOCUS_25450 4267 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 5021 4269 gene locus_tag LOCUS_25460 5021 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 5237 5022 gene locus_tag LOCUS_25470 5237 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 <6012 5237 gene locus_tag LOCUS_25480 <6012 5237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010922456.1:tail protein >Feature sequence099 700 98 gene locus_tag LOCUS_25490 700 98 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389535.1 protein_id gnl|my_center|LOCUS_25490 1482 841 gene locus_tag LOCUS_25500 1482 841 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811847.1 protein_id gnl|my_center|LOCUS_25500 4030 1538 gene locus_tag LOCUS_25510 4030 1538 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068431.1 protein_id gnl|my_center|LOCUS_25510 4510 4316 gene locus_tag LOCUS_25520 gene rpmB 4510 4316 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811837.1 protein_id gnl|my_center|LOCUS_25520 4835 5908 gene locus_tag LOCUS_25530 4835 5908 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811834.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence100 215 1591 gene locus_tag LOCUS_25540 215 1591 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_25540 1572 1760 gene locus_tag LOCUS_25550 1572 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 1892 2059 gene locus_tag LOCUS_25560 1892 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 2080 2604 gene locus_tag LOCUS_25570 2080 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 3946 2651 gene locus_tag LOCUS_25580 3946 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 4088 4249 gene locus_tag LOCUS_25590 4088 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 4452 4631 gene locus_tag LOCUS_25600 4452 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 4628 5374 gene locus_tag LOCUS_25610 4628 5374 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618489.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence101 1154 117 gene locus_tag LOCUS_25620 1154 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 1371 5468 gene locus_tag LOCUS_25630 1371 5468 CDS product evolved beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389421.1 protein_id gnl|my_center|LOCUS_25630 >Feature sequence102 267 2387 gene locus_tag LOCUS_25640 267 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 2528 4129 gene locus_tag LOCUS_25650 2528 4129 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence103 153 1685 gene locus_tag LOCUS_25660 153 1685 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057703.1 protein_id gnl|my_center|LOCUS_25660 1748 4516 gene locus_tag LOCUS_25670 gene valS 1748 4516 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054756.1 protein_id gnl|my_center|LOCUS_25670 >Feature sequence104 >Feature sequence105 506 276 gene locus_tag LOCUS_25680 506 276 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 protein_id gnl|my_center|LOCUS_25680 1170 523 gene locus_tag LOCUS_25690 1170 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 3790 1373 gene locus_tag LOCUS_25700 3790 1373 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014760479.1 protein_id gnl|my_center|LOCUS_25700 4106 4438 gene locus_tag LOCUS_25710 4106 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence106 1243 62 gene locus_tag LOCUS_25720 1243 62 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678909.1 protein_id gnl|my_center|LOCUS_25720 1423 1548 gene locus_tag LOCUS_25730 1423 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 1659 1949 gene locus_tag LOCUS_25740 1659 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 3274 2114 gene locus_tag LOCUS_25750 3274 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 3670 3287 gene locus_tag LOCUS_25760 3670 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389855.1 protein_id gnl|my_center|LOCUS_25760 3926 3690 gene locus_tag LOCUS_25770 3926 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence107 962 615 gene locus_tag LOCUS_25780 962 615 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051599.1 protein_id gnl|my_center|LOCUS_25780 1051 1611 gene locus_tag LOCUS_25790 1051 1611 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051598.1 protein_id gnl|my_center|LOCUS_25790 3054 1615 gene locus_tag LOCUS_25800 3054 1615 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811607.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence108 435 1196 gene locus_tag LOCUS_25810 435 1196 CDS product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414678.1 protein_id gnl|my_center|LOCUS_25810 3350 2085 gene locus_tag LOCUS_25820 gene ilvA 3350 2085 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051833.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence109 256 1530 gene locus_tag LOCUS_25830 gene dapE 256 1530 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811704.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence110 1957 527 gene locus_tag LOCUS_25840 1957 527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068650.1 protein_id gnl|my_center|LOCUS_25840 3383 2295 gene locus_tag LOCUS_25850 gene fbaA 3383 2295 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389412.1 protein_id gnl|my_center|LOCUS_25850 >Feature sequence111 592 107 gene locus_tag LOCUS_25860 592 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 790 864 gene locus_tag LOCUS_t00700 790 864 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 927 1000 gene locus_tag LOCUS_t00710 927 1000 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1416 2705 gene locus_tag LOCUS_25870 1416 2705 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053725.1 protein_id gnl|my_center|LOCUS_25870 <3259 2751 gene locus_tag LOCUS_25880 <3259 2751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027638.1:LacI family DNA-binding transcriptional regulator >Feature sequence112 >Feature sequence113 453 2594 gene locus_tag LOCUS_25890 453 2594 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence114 1161 418 gene locus_tag LOCUS_25900 1161 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 2516 1158 gene locus_tag LOCUS_25910 2516 1158 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence115 243 680 gene locus_tag LOCUS_25920 243 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 1196 768 gene locus_tag LOCUS_25930 1196 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25930 1591 1298 gene locus_tag LOCUS_25940 1591 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25940 >Feature sequence116 1 1014 gene locus_tag LOCUS_25950 1 1014 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390361.1 protein_id gnl|my_center|LOCUS_25950 1099 1659 gene locus_tag LOCUS_25960 1099 1659 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364026.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence117 845 1027 gene locus_tag LOCUS_25970 845 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 1107 2156 gene locus_tag LOCUS_25980 1107 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence118 3388 352 gene locus_tag LOCUS_r00020 3388 352 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5337 3807 gene locus_tag LOCUS_r00030 5337 3807 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence119 154 684 gene locus_tag LOCUS_25990 154 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 812 1861 gene locus_tag LOCUS_26000 812 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence120 133 297 gene locus_tag LOCUS_26010 133 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 1142 663 gene locus_tag LOCUS_26020 1142 663 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815072.1 protein_id gnl|my_center|LOCUS_26020 <1970 1391 gene locus_tag LOCUS_26030 <1970 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815077.1:hemolysin family protein >Feature sequence121 1324 608 gene locus_tag LOCUS_26040 1324 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 >Feature sequence122 >Feature sequence123 641 1678 gene locus_tag LOCUS_26050 641 1678 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390097.1 protein_id gnl|my_center|LOCUS_26050 >Feature sequence124 >Feature sequence125 1025 54 gene locus_tag LOCUS_26060 1025 54 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400747.1 protein_id gnl|my_center|LOCUS_26060 1708 1022 gene locus_tag LOCUS_26070 1708 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence126 868 1332 gene locus_tag LOCUS_26080 868 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence127 988 1293 gene locus_tag LOCUS_26090 988 1293 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776996.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence128 111 1403 gene locus_tag LOCUS_26100 111 1403 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911958.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence129 1318 50 gene locus_tag LOCUS_26110 1318 50 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223849864.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence130 1045 245 gene locus_tag LOCUS_26120 1045 245 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815189.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence131 <1 939 gene locus_tag LOCUS_26130 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389392.1:alpha/beta hydrolase >Feature sequence132 56 376 gene locus_tag LOCUS_26140 56 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26140 373 1305 gene locus_tag LOCUS_26150 373 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26150 >Feature sequence133