COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..5870232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 28..1530 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401422.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dnaA CDS 1569..2672 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421522.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dnaN CDS 2695..3798 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266123.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene recF CDS 3803..6220 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340175.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene gyrB CDS 6384..8786 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 8947..10446 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(10572..11339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(11529..12299) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266128.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(12360..12905) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103029.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene gmhB CDS complement(12916..14970) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103028.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene glyS CDS complement(14967..15833) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379468.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene glyQ CDS 15994..16545 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103027.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 16584..17471 product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401447.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(17605..18978) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768190.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene trkA CDS complement(18993..20315) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103025.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene rsmB CDS complement(20312..21256) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266132.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene fmt CDS complement(21312..21818) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene def CDS 21948..22973 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103024.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 23098..24267 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266134.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene dprA CDS 24306..24863 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340101.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(24860..25837) product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266135.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 26007..26918 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768167.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene hemF CDS 27070..27894 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene aroE CDS complement(27891..29459) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266137.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(29640..30104) product inhibitor of vertebrate lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(30108..30272) product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096961.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(30331..30612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103100.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 31035..32381 product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380235.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene algB CDS 32392..34179 product KinB sensor domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266285.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(34182..35801) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038952.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(35887..36666) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419056.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(36763..38793) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103104.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(38790..39665) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(39678..40322) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403888.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(40508..41122) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 41611..42249 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341625.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene yihA CDS complement(42455..45217) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266289.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene polA CDS 45292..45576 product DUF2782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380192.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 45613..46563 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266290.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(46633..47568) product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403882.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene znuA CDS 47636..48118 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425978.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 48118..48915 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768460.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene znuC CDS 48908..49696 product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247039.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene znuB CDS 49735..50460 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266294.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(50601..52748) product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266295.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene katE CDS 53060..54067 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010203924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 54067..54741 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105395.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 54796..55569 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768450.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 55969..56940 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096831545.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(57100..57732) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105394.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(57729..58622) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene cyoE CDS complement(58619..59686) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(59699..60280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083738.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(60246..60992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 61067..61270 product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101213.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(61276..62166) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(62180..62737) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(62746..64338) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene ctaD CDS complement(64358..65401) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101203.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene coxB CDS 65844..66494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105393.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(66590..68122) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403858.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(68236..68967) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380033.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(69159..70217) product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266300.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 70496..72133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(72233..72520) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769461.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(72517..74568) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103009.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene prlC CDS 74681..75226 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103010.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 75266..75913 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(75942..76952) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 77098..77511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420384.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(77512..77745) product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379415.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(77888..78319) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340074.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 78518..79519 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266144.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(79695..79919) product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318454.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(80063..80278) product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318455.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 80445..80771 product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(80772..81680) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266143.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 81809..83038 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768143.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene trpB CDS 83035..83847 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene trpA CDS 83971..84456 product anti-virulence regulator CigR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266142.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 84607..85353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 85337..85792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 85816..86505 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793177.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 86484..86801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(86718..87641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(87809..88141) product DOPA 4,5-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738577.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(88193..89143) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266140.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 89259..90764 product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene betC CDS 90839..91729 product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 92277..93608 product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401762.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene gltP CDS 93710..94951 product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266161.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(94956..96137) product DUF5924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266162.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(96219..97598) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102997.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(97656..99308) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102996.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(99568..100875) product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769588.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(101190..102587) product aminoacyl-tRNA deacylase and HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(102674..104749) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene recG CDS complement(104759..105682) product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551493.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(105775..106524) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613236.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(106521..106946) product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613239.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene exbD CDS complement(106950..107906) product tonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246518.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene exbB CDS 108114..108962 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102980.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(109014..109751) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313983.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(109806..110186) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(110211..112316) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769571.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene spoT CDS complement(112377..112640) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003320174.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene rpoZ CDS complement(112788..113423) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene gmk CDS complement(113437..114300) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403997.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 114678..115316 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313989.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene rph CDS 115342..115704 product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(115768..117648) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103402.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 118029..119951 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266704.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 120203..122125 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463739.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(122162..122863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(122963..123193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 123257..124018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 124020..124361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 124381..126390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(126563..130936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(130933..132282) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103412.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(132272..133102) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(133183..134292) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103406.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(134488..135108) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810854.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 134992..135210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 135363..136190 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404814.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 136236..137120 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103398.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 137179..138189 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 138251..138778 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404809.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 138779..140059 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404808.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(140116..140679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266696.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 140990..141598 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404802.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 141598..142248 product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266695.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(142305..143561) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266693.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene aroA CDS complement(143652..144128) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556144.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(144133..145131) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266692.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 145591..146040 product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380356.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 146037..146498 product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770938.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(146538..147713) product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266687.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(147830..149053) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024697807.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 149394..150353 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771489.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(150400..151446) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771491.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene gmd CDS complement(151704..152483) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551505.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 152566..153207 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403990.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene pyrE CDS 153220..153837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769563.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(153915..154169) product DUF6124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269220.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(154645..155550) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene argB CDS complement(155579..158149) product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114359.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(158206..158661) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102984.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene dut CDS complement(158668..159876) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463702.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene coaBC CDS 160011..160685 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene radC CDS 160918..161847 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268857.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(161991..163577) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102986.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 163953..164186 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551514.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene rpmB CDS 164197..164352 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551515.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene rpmG CDS complement(164421..164624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(164697..165068) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769553.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 165312..166811 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419032.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 166920..168068 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403964.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(168065..169642) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403960.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(169710..171131) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266263.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 171307..171543 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403956.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(171545..172846) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266264.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 172954..173307 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403950.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(173475..173963) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004655323.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 174120..175421 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene dadA CDS 175393..175746 product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769531.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 175866..176939 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene alr CDS 177046..177594 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314015.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 177777..178199 product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098270.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 178428..180359 product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266268.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(180367..181191) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102992.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(181184..182437) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266171.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(182466..183350) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266170.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(183416..183985) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378039.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(184040..186049) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401585.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene rep CDS 186252..187916 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266168.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(187938..189338) product NorM family multidrug efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266167.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 189774..190415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 190606..192582 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(192644..193159) product Bro-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402397.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(193712..195205) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413980.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 195851..196846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(196870..197142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 197560..198102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010209025.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(198074..198370) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401798.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 198792..199130 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555808.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene glnK CDS 199164..200501 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739890.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(200489..200983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 201268..201600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(201715..202404) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768510.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(202397..203296) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246535.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene xerC CDS complement(203299..204033) product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266243.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(204047..204877) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401768.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene dapF CDS complement(204882..206129) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene lysA CDS 206503..206835 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318093.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene cyaY CDS 206838..207086 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318094.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 207224..207631 product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246537.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene rnk CDS complement(207711..210566) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266242.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(210790..211038) product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344490.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(211234..211509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266241.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 211669..212361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(212414..213808) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103000.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene argH CDS 213956..215023 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318424.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 215020..215766 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401565.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 215970..216911 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318426.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene hemC CDS 216908..217687 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103002.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 217738..218856 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266159.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 218853..220097 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103004.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 220315..220842 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769478.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 220989..221489 product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738602.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(221549..222223) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266156.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 222440..223453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 note possible pseudo, internal stop codon, frameshifted CDS complement(223450..223914) product TIGR02444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266154.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 223916..225871 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266153.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 225888..226481 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769469.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 226629..227180 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(227257..227994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(227998..228588) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418930.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene lpoB CDS complement(228624..228995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(229009..230403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 230741..232615 product cytochrome c/FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266151.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(232694..233341) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768434.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 233574..234584 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403849.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene hemB CDS 234601..236814 product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768431.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene ppk1 CDS complement(236801..238303) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene ppx CDS complement(238415..239149) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432251.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(239136..239783) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464032.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(239783..240448) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380046.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(240478..241263) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768426.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 241515..242219 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247319.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 242342..242671 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380053.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene trxA CDS 242899..244158 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551560.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene rho CDS 244460..245926 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317344.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene ubiD CDS 245926..246894 product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266307.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 247099..247773 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403249.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(247775..249118) product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403247.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene glpT CDS complement(249415..250293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(250531..251352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007248140.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(251349..251624) product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105385.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(251621..253330) product S-type pyocin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105384.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(253765..254742) product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 254874..255281 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403230.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(255287..255736) product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765622.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 255925..256077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317333.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(256129..256803) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105381.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(257047..257376) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317331.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(257373..257582) product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 257731..258285 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621372.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 258360..259694 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105380.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene pepP CDS 259691..260878 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105379.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene ubiH CDS 260930..262150 product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105378.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 262395..263396 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247176.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 263513..265129 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266271.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 265278..266360 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266272.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene gcvT CDS 266406..266792 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103095.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene gcvH CDS complement(266845..267165) product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551535.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(267331..269115) product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266274.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(269226..269573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236119.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 269695..270171 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(270102..270302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(270299..271228) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268857.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(271461..272828) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763452.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 272989..274137 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419049.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene argE CDS 274264..275562 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763455.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene argA CDS complement(275620..276549) product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401703.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 276823..278127 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103055.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene gabT CDS 278205..278861 product 2-haloalkanoic acid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164989474.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 278908..279396 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555947.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 279546..281039 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103057.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(281043..282626) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266220.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(282628..283650) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103059.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(283650..284717) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739846.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene yejB CDS complement(284719..286602) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463852.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(286750..289548) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032613447.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(289665..290066) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555939.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(290066..290773) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555938.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(290824..291651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 292759..294342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(294356..294637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 295032..295436 product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 295429..295893 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143891478.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 295890..297014 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036848.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 297019..298779 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052039695.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 299067..299945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 299938..300939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(301036..301293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 301441..302658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 tRNA complement(302816..302892) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 303070..303387 product RebB family R body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038031.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 303630..305072 product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367662.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene gabD CDS 305193..306473 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401617.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene gabT CDS 306634..308019 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463817.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(308053..309054) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763415.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(309191..310375) product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266177.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 310533..312467 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 312674..312856 product sulfur starvation response protein OscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551397.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene oscA CDS 313002..314009 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266175.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 314115..314936 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401602.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene cysT CDS 314947..315819 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266174.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene cysW CDS 315823..316812 product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(317016..317540) product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103092.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 317625..318335 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266269.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(318337..319020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768136.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(319264..320256) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247332.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 320654..321235 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105376.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 321333..322265 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765610.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 322487..323269 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105375.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 323464..324360 product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266331.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 324377..325261 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266332.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 325302..326168 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737007.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 326173..327240 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266334.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(327662..327883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(327953..328423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(328528..328998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(329026..329496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(329623..330093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(330090..332417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 332552..332923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(333010..333255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(333415..333885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(333882..336209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(336489..336959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(336956..341929) product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105498.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(341926..342669) product DUF4123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463476.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(342659..344701) product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105496.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene tssI CDS complement(344780..345295) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105495.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 345766..346743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 346849..347967 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 347964..349034 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105357.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 349031..352072 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105356.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(352254..352721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(352758..352964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(352888..353535) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266341.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(353579..354223) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765584.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(354213..355334) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266342.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(355336..356124) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105353.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(356312..357682) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266344.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(357682..358875) product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105351.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(358900..360189) product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105350.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(360520..361245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765571.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(361827..362570) product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245567.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene yecC CDS complement(362574..363242) product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381368.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene tcyL CDS complement(363239..364036) product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765569.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene tcyJ CDS complement(364187..365185) product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266349.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 365382..366335 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010216200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 366609..368606 product choline transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405243.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene betT CDS complement(368674..369720) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103107.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 369938..372205 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 372251..373579 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269247.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 373722..374666 product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103109.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 374716..375753 product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103110.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene mgrA CDS 376036..376980 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771258.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(377039..378475) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555721.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene ntrC CDS complement(378472..379557) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene glnL CDS complement(379861..380463) product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103113.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(380489..381061) product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054994416.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(381081..381638) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103115.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(381726..382148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(382316..383722) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343817.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene glnA CDS 383992..385509 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269243.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene thiI CDS 385650..387470 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405222.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene typA CDS complement(387714..388169) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551717.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(388305..389690) product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269201.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(389683..391062) product DUF2868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763651.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 391166..391678 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402228.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 391889..392944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763647.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(393023..394870) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105291.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene ilvD CDS complement(395138..396334) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393654.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 396525..397391 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402256.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 397437..398249 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372546.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene mutM CDS 398344..398682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402254.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(398715..398966) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316325.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(399055..399537) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348749.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene coaD CDS complement(399696..401105) product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763618.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 401271..401942 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022641646.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 401993..402847 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269212.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(403062..404108) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797805.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(404229..406670) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105330.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 406879..407943 product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105329.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 407943..408515 product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403038.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 408512..409135 product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403037.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene pilO CDS 409132..409659 product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266376.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene pilP CDS 409707..411806 product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765499.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 411838..412329 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245596.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene aroK CDS 412433..413548 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765495.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene aroB CDS 413559..415184 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 415541..419986 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266380.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene gltB CDS 420108..421526 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621194.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 421724..422788 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765484.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene hemE CDS complement(422843..423505) product TIGR02646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105321.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(423502..424770) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(424848..426101) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105319.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 426219..427166 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266388.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(427265..428491) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105318.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(428491..429219) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765466.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene fabG CDS complement(429216..429671) product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105317.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(429668..430864) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765463.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(430861..431343) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765461.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(431340..432074) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463874.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(432071..433318) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266394.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(433305..434474) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010212054.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(434474..436774) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463873.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(436779..437390) product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266396.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(437387..437812) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765450.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(437802..439322) product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245619.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(439330..440274) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105312.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(440271..441005) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(440998..442695) product acyl-CoA synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(442697..443242) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105309.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(443239..443493) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765439.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(443503..443763) product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(443738..444550) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402969.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(444526..445245) product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765435.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 445580..446359 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765433.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(446401..446802) product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 447057..447503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266235.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 447852..448397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(448381..449844) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266437.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(449893..453279) product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463895.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene mscK CDS complement(453319..455061) product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771787.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 455260..457833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105273.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(457830..459632) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(459778..463731) product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419176.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene putA CDS 464112..465674 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440098.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene putP CDS complement(465733..466404) product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266450.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 466715..468841 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762944.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 468883..469410 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404609.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 469437..469733 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762949.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(469746..470204) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620970.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 470461..471213 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266453.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(471179..473374) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244571.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene yccS CDS complement(473499..474629) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266455.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(474770..476149) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153222447.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene dbpA CDS complement(476454..476588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(476676..478073) product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269218.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene mdtD CDS complement(478138..479463) product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103134.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(479463..480905) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763601.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(481170..482876) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402225.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene betA CDS complement(483010..484482) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393629.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene betB CDS complement(484589..485182) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555619.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene betI CDS complement(485393..486571) product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763692.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene choV CDS complement(486568..487413) product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555599.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene choW CDS complement(487478..488425) product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269185.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 489131..490234 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763696.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(490383..491312) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268857.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 491425..491601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(491591..493201) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103145.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 493596..493829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763699.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 493826..494128 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379947.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(494184..495224) product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269215.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 495328..496071 product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103135.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 496323..497537 product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739631.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene alaC CDS complement(497586..497789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 498089..499342 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269187.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 499360..500610 product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763688.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 500627..500923 product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379926.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 500920..503940 product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269189.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 504057..504689 product sarcosine oxidase subunit gamma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103144.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene soxG CDS 504799..505656 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763680.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene purU CDS 505827..507026 product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316157.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene fdhA CDS 507207..507773 product DUF2780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763676.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(507753..508712) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763674.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 508838..509338 product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402218.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(509365..509994) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010205456.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 510287..511231 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771258.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(511271..511435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763669.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(511432..512538) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269198.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(512601..515018) product TonB-dependent ferrichrome receptor FiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113264.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene fiuA CDS complement(515107..516105) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103142.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(516102..516581) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244528.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(516850..517671) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 517823..518662 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101583.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 518674..519072 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405186.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 519153..519596 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110213.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(519767..520168) product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763550.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(520222..521904) product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269232.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene ligB CDS 522090..522710 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269231.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(522718..523137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(523473..524663) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555698.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene metK CDS complement(524684..525679) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763555.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 525936..527933 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244559.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene tkt CDS complement(528074..528334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 528221..529165 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269230.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene epd CDS 529182..530345 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269229.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 530374..530604 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316354.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 530687..530884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 530939..531265 product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382373.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 531381..532445 product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763563.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene fba CDS complement(532660..533073) product DUF3010 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269228.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(533130..533540) product DUF1311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763567.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 533769..534746 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 534832..535362 product DUF5943 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405158.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 535378..537438 product dimethylglycine demethylation protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405157.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene dgcA CDS 537548..539509 product dimethylglycine demethylation protein DgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054992464.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene dgcB CDS 539509..540729 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269226.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 540746..541540 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269225.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(542258..543556) product glycine-betaine demethylase subunit GbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269222.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene gbcA CDS 543880..544980 product glycine-betaine demethylase subunit GbcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763583.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene gbcB CDS complement(545168..545428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269221.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 545791..546759 product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765153.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 546893..547729 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763589.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene rlmJ CDS complement(547827..548474) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763591.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene msrA CDS complement(548564..551257) product GGDEF and EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244549.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(551564..553189) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244575.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene aceF CDS complement(553341..555986) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene aceE CDS 556371..559328 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762959.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene glnE CDS 559550..560584 product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266459.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene waaF CDS 560587..561651 product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266460.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene waaC CDS 561651..562775 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266461.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 562772..563578 product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266462.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene rfaP CDS 563578..564312 product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266463.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 564309..565064 product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266464.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 565064..566497 product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266465.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(566517..572624) product membrane-targeted effector domain-containing toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266466.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 572946..574700 product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431977.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 574693..575589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 575589..576545 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114548.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(576561..577178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114545.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 577239..578999 product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene msbA CDS 578996..579895 product antimicrobial resistance protein Mig-14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266468.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 579910..581337 product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114549.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 581408..582829 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736892.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene hldE CDS complement(582917..583879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377120.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(583916..584731) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266475.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(584728..585903) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266476.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(585952..586284) product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762979.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 586421..587698 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698007.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene waaA CDS complement(587745..589184) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762981.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 589588..591477 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105255.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene thiC CDS complement(591541..592287) product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402864.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 592496..593113 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366260.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 593104..593556 product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551796.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 593689..594462 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266482.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene cpdA CDS 594552..595187 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105248.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 595204..597108 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431952.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene parE CDS 597132..598085 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463655.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 598082..598603 product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054081306.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 598614..600869 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762992.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene parC CDS 601115..601744 product PqiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024661443.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(601924..603462) product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402883.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 603592..604806 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380690.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene serB CDS complement(604855..606639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266488.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(606899..607762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(607811..608626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(608671..610206) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266490.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 610407..611258 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763001.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene motA CDS 611262..612278 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763003.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene motB CDS complement(612334..613365) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366295.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene rsgA CDS 613473..614006 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402903.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene orn CDS 614106..614717 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393544.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(614764..615930) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266491.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene queG CDS 615910..617406 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105241.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 617394..617864 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317192.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene tsaE CDS 617867..619294 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198702760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 619294..621234 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266495.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene mutL CDS 621235..622206 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266496.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene miaA CDS 622299..622559 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551819.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene hfq CDS 622572..623873 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551820.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene hflX CDS 623970..625148 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105238.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene hflK CDS 625148..626017 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366315.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene hflC CDS 626289..627476 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402926.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 627531..628823 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366319.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(629018..629164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 629282..630931 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266498.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 tRNA complement(631050..631136) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(631302..631388) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 631614..634229 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene rnr CDS 634226..634987 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414481.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene rlmB CDS 635272..635697 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551828.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene rpsF CDS 635726..635956 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551829.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene rpsR CDS 635996..636892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620823.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 636913..637359 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317208.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene rplI CDS 637484..638878 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317209.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene dnaB CDS 638998..641307 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266500.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(641459..641770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 641672..644944 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266501.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 645024..647543 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266502.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 647543..648463 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 648825..649271 product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763045.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene azu CDS complement(649424..650251) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317217.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene nadE CDS complement(650279..651502) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427809.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene pncB CDS 652173..653201 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266503.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 653367..654281 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551844.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 654284..655585 product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763054.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene livM CDS 655582..656457 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376366.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 656454..657170 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407872.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 657913..658677 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763057.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(658817..659911) product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763059.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(660059..660859) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763805.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(660878..662557) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763807.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(662737..663780) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918050.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(664083..664544) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383369.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(664556..665566) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763809.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 665735..667006 product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538269.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 667003..668019 product alpha-1,3-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114547.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene wapR CDS complement(668009..669172) product O-antigen ligase WaaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114546.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene waaL CDS complement(669743..670174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 670439..670612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(671225..672595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(673035..673517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(673514..674455) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(674736..675680) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463959.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 tRNA complement(675941..676017) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(676033..679203) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463958.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(679344..681194) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411788.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene rpoD CDS complement(681262..683217) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244455.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene dnaG CDS complement(683687..683902) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551877.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene rpsU CDS 684101..685126 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene tsaD CDS complement(685166..685735) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614129.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene plsY CDS 685849..686163 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316242.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene folB CDS 686154..686669 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269139.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene folK CDS complement(686822..688063) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103183.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(688149..689711) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103184.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(689708..690979) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(691096..693018) product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316247.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(693354..693674) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244448.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene glpE CDS complement(693698..694582) product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103186.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(694582..694962) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316251.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene apaG CDS complement(695080..695886) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269133.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene rsmA CDS complement(695883..696872) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269132.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene pdxA CDS complement(696869..698197) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079997984.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(698172..700943) product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269131.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 701073..702086 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269130.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 702133..702807 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463963.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 702808..703575 product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103191.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(703682..704641) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024667176.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 704748..706760 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269126.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 706757..707386 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768051.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 707658..708782 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 708864..709895 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394920.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 709975..711222 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269124.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 711233..712057 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768044.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 712201..712875 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene rpe CDS 712872..713690 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402021.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 713761..715242 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244435.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene trpE CDS complement(715313..716356) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463386.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 716487..717230 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266540.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 717465..718361 product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770085.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(718599..719000) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene cueR CDS complement(718997..721195) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(721265..721645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318651.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 721792..721992 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366461.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 722083..723273 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(723322..724335) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770073.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 724451..725362 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407991.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 725799..726491 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407992.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(726543..727496) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614495.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(727574..728542) product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103268.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(728623..729717) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614499.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(729885..730676) product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266549.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene fecE CDS complement(730681..731649) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103269.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(731646..732635) product iron-dicitrate ABC transporter permease FecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene fecC CDS complement(732636..733556) product Fe(3+) dicitrate ABC transporter substrate-binding protein FecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266552.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 733783..734874 product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245540.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(735050..736408) product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103270.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(736560..736841) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556002.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(736844..737164) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106968.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(737341..738027) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463381.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(738093..738251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(738380..739306) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770049.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(739306..740406) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266556.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(740418..741971) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266557.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(742496..743104) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(743122..743784) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266559.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(743870..745267) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103273.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(745444..746364) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266560.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 746476..747822 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383172.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 747874..749367 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103274.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 749371..749526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 rRNA 749959..751492 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 751558..751634 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 751642..751717 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 rRNA 751959..754848 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 755001..755110 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS 755288..758764 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266563.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene recC CDS 758761..762462 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266564.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene recB CDS 762459..764543 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266565.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene recD CDS complement(764571..765119) product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104051.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 765325..766212 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266572.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene mmsB CDS complement(766217..766423) product DUF3077 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313478.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 766727..768703 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(768830..770197) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769235.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(770194..771000) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769238.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 771191..772918 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103282.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene ggt CDS 772989..773753 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103289.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 773926..774510 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113351.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 774550..775449 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098210.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(775583..777166) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396266.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 777511..778224 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400006.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 778240..779133 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268920.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 779147..779800 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400010.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 779797..780963 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268919.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(781024..782148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 782691..783854 product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368674.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(783929..784747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268917.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(784827..785831) product alpha-xenorhabdolysin family binary toxin subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418487.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(785834..787081) product alpha-xenorhabdolysin family binary toxin subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400026.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 787484..790015 product sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463395.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(790076..791050) product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400031.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(791050..792018) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010436785.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(792029..792940) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243753.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(792952..793962) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769384.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(794033..795628) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769383.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(795714..797093) product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769381.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(797250..798848) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(799115..800737) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105058.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(801002..802603) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105057.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(802888..804441) product heterokaryon incompatibility induction protein PhcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044393109.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(804677..805648) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096831545.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(806073..806786) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 806972..808231 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268907.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 808228..808791 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400057.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 808882..810603 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268906.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 810701..811450 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 811769..812680 product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004411794.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene kdgD CDS 812847..814223 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769363.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 814234..815787 product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene garD CDS complement(815873..816499) product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 816723..816962 product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(816971..817741) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113660.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(817725..818849) product DUF3182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063834.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(818863..819240) product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095492.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 819435..819647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 820324..820923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(820907..821692) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463393.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(821795..823609) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105049.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 823895..824137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(824297..824800) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379656.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 825159..825956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 826087..826446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(826472..827563) product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 827651..828568 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206176.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(828709..829284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(829281..829748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 830111..831121 product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(831171..831524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(831947..832240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(833232..833780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(834528..835229) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087772.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(835226..838552) product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087773.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(838621..839100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(839060..840457) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083500625.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(840450..842945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(843472..843858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 tmRNA complement(844059..844450) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(844569..844856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377470.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(844980..847790) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123510.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(847787..848458) product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(848458..849915) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(849912..850736) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222289.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(850834..852525) product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113903.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 852883..853650 product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(853792..854274) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377471.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene smpB CDS 854503..854937 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620437.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 854930..855244 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(855475..855996) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400155.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 856134..856502 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555142.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene fur CDS complement(856554..858227) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene recN CDS 858499..859062 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313642.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene grpE CDS 859167..861083 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene dnaK CDS 861339..862541 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377482.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene dnaJ CDS 862566..863369 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400159.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene dapB CDS 863583..864719 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene carA CDS 864855..868076 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243709.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene carB CDS 868073..868549 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene greA CDS 868626..868970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113906.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(868991..869299) product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340569.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 869406..870056 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620411.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene rlmE CDS 870241..872151 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105023.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene ftsH CDS 872160..873011 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105022.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene folP CDS 873032..874372 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766449.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene glmM CDS 874472..875194 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739097.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene tpiA CDS 875199..875579 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene secG tRNA 875627..875712 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 875809..875885 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 875997..876473 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620403.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene rimP CDS 876533..878014 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340582.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene nusA CDS 878041..880584 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268881.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene infB CDS 880743..881159 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene rbfA CDS 881163..882080 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766456.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene truB CDS 882231..882500 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555121.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene rpsO CDS 882673..884778 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene pnp CDS 885073..885423 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004656644.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(885563..885889) product DUF2845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268877.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(885895..888846) product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060708255.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(888957..889973) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268875.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(890077..891255) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(891369..892277) product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103368.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(892290..894227) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene acs CDS complement(894392..896056) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266656.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene pgi CDS complement(896233..896613) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(896621..897469) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene panC CDS complement(897466..898266) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770519.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene panB CDS complement(898490..898993) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266659.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene folK CDS complement(898986..900383) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345072.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(901073..902500) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(902523..905471) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017684227.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(905461..905637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552060.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(905740..906627) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406656.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene gluQRS CDS complement(906776..907234) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene dksA CDS 907557..908729 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770507.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 908729..909442 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406665.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene sfsA CDS complement(909435..909776) product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246097.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 910032..910946 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095100.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 910943..911980 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 911980..912747 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095098.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 912880..913662 product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 913782..914561 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266664.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene deoC CDS complement(914848..915192) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246096.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(915288..916823) product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103375.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 917026..919278 product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427455.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene mrcB CDS 919295..920032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217636804.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 920032..920358 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770497.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(920355..920774) product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770496.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 921200..922900 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246092.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 922903..923394 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552075.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene ilvN CDS 923448..924464 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene ilvC CDS 924610..925467 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770492.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene pssA CDS 925531..926544 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406704.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene msrP CDS 926544..927164 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201804.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene msrQ rRNA 927677..929210 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 929334..929410 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 929440..929515 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 rRNA 929774..932663 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 932800..932909 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS complement(932963..933871) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 934005..935060 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612853.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 935153..936490 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766635.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(936518..939340) product Mks condensin complex protein MksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266671.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene mksF CDS complement(939337..940041) product Mks condensin complex protein MksE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380289.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene mksE CDS complement(940031..941311) product Mks condensin complex protein MksB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404706.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene mksB CDS 941456..942262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771509.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 942255..942707 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266673.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene rimI CDS 942808..943443 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345939.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene can CDS complement(943580..945262) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266674.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(945369..946022) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103380.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 946221..946505 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 946630..947073 product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404728.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 947066..947455 product DoxX-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926952.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 947709..948917 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771500.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(948969..949688) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380309.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(949826..951781) product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266678.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(952028..954418) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112989.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 tRNA complement(954828..954904) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 955591..957624 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103405.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(957731..959725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(960054..960944) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103413.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene rfbA CDS complement(960941..961846) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771401.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene rfbD CDS complement(961843..962919) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771402.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene rfbB CDS complement(963019..963330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765119.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(963331..964242) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267046.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 964346..965536 product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105083.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(965644..966744) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768873.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene ychF CDS complement(966766..967350) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103428.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene pth CDS complement(967515..968120) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266730.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(968258..969277) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552145.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 tRNA complement(969246..969320) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(969361..970209) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266731.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene ispE CDS complement(970212..970829) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365627.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene lolB CDS complement(970834..972504) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074907579.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 972789..974066 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266733.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene hemA CDS 974063..975145 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404940.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene prfA CDS 975146..975982 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103431.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene prmC CDS 975976..976728 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365615.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 976725..977540 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404950.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene murI CDS 977714..978175 product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382556.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(978369..978590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(978680..979195) product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(979188..980459) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266739.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(980443..981246) product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768843.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(981243..982490) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(982487..983275) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768839.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(983272..983694) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736559.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(983687..985135) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768836.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene phrB CDS complement(985145..986053) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(986057..987019) product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406942.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(987151..987366) product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406940.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(987363..988349) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768828.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 988785..989555 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 989578..990603 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768824.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene hemH CDS complement(990672..991937) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(991942..992580) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736551.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene upp CDS 992741..993346 product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768820.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 993432..993923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768818.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 993990..994277 product PA4642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768817.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(994409..995239) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266748.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(995236..996057) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266749.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 996168..997064 product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768811.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(997136..998647) product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768808.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene mqo CDS 998837..999028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(999366..999599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 999762..1000346 product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768806.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(1000416..1000622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379241.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(1000743..1001906) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421706.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 1002012..1002194 product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318204.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 1002191..1002454 product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318203.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 1002484..1003110 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736538.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 1003397..1004215 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346150.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(1004272..1004856) product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408669.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(1005104..1006102) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768797.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(1006131..1007096) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 1007180..1007809 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768796.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 1007927..1009609 product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768794.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 1009975..1011912 product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 1011933..1013303 product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004402712.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 1013578..1016310 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103443.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 1016474..1017181 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003319364.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(1017228..1018124) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103454.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(1018207..1020297) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244090.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene pta CDS 1020695..1021180 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736521.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 1021306..1021788 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244088.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(1021825..1023027) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768762.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(1023890..1024393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(1024449..1024733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(1024822..1025007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(1025023..1025748) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408742.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene cysZ CDS 1026145..1027107 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316986.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene trxB CDS complement(1027200..1027541) product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365480.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(1027534..1027830) product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768750.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(1027871..1028569) product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768743.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene folM CDS complement(1028685..1029254) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346204.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(1029404..1030009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103458.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 1030215..1030667 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768738.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 1030835..1031386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266774.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(1031402..1032205) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768735.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 1032374..1033396 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 1033491..1034588 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114486.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene pdhA CDS 1034578..1035564 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114485.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 1035583..1036686 product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114484.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(1036765..1037034) product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 1037292..1037780 product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316964.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(1038072..1038284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397550.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(1038793..1039005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397550.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(1039342..1039674) product DUF3509 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266781.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 1039838..1040386 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103465.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 1040383..1041342 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103466.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(1041410..1041838) product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365451.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(1042106..1044454) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266782.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(1044659..1045636) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764194.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(1045633..1046136) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010205787.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 1046337..1046675 product DUF3649 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244063.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 1046672..1048252 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 1048252..1048584 product DUF3325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103471.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 1048594..1049190 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112642.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 1049187..1050179 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112643.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 1050219..1052621 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112644.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 1052867..1053763 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771258.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(1053867..1054751) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764184.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 1054885..1055835 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266785.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(1055810..1056784) product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266786.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(1056853..1057800) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017277809.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 1058084..1059418 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 1059522..1061660 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266789.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 1061650..1061850 product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365425.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 1061873..1062730 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266790.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(1062831..1063346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 1063725..1063919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(1064057..1065151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044392855.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(1065162..1065917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(1066342..1069761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(1069758..1070630) product DUF4123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(1070637..1072679) product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105496.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene tssI CDS complement(1072758..1073273) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105495.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(1073821..1075776) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267588.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(1076082..1076906) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103477.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(1076917..1077390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266792.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(1077493..1077939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(1078178..1078579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 1078926..1081700 product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103479.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 1082700..1085477 product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267662.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(1085635..1087086) product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415201.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(1087215..1087883) product alginate O-acetyltransferase AlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406768.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(1087896..1089071) product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103480.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(1089082..1090632) product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(1090798..1091931) product mannuronate-specific alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406765.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(1091940..1093379) product alginate biosynthesis protein AlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408874.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(1093394..1094998) product mannuronan 5-epimerase AlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103483.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene algG CDS complement(1095026..1096534) product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615404.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(1096531..1097940) product alginate biosynthesis TPR repeat lipoprotein AlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene algK CDS complement(1097943..1099112) product alginate biosynthesis protein Alg44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764144.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(1099153..1100475) product mannuronan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552255.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene alg8 CDS complement(1100736..1102052) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764140.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(1102850..1103629) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764136.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene yaaA CDS 1103941..1105083 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463297.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 1105419..1106813 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406748.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 1106983..1107468 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341741.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene moaC CDS 1107465..1107710 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764130.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene moaD CDS 1107713..1108162 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266803.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene moaE CDS complement(1108218..1109669) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161632431.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene rhlB CDS complement(1109797..1110456) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 1110937..1111965 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266806.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 1112036..1113217 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266807.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 1113228..1114325 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266808.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 1114336..1115100 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 1115246..1116472 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 1116590..1117081 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764110.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 1117074..1117427 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266813.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(1117417..1121964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 1123101..1124036 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764106.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 1124440..1126644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1126778..1127128) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406715.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(1127134..1128135) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266815.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene yejK CDS 1128263..1128550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 1128526..1128807 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552279.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(1128966..1129928) product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266817.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene rlmF CDS complement(1130144..1132990) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(1133128..1133586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(1133594..1134022) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764092.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(1134080..1135570) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266820.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 1135898..1137019 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316899.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene lptF CDS 1137012..1138073 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406700.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene lptG CDS complement(1138124..1138609) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(1138710..1138922) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365337.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(1139317..1140441) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266821.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene gcvT CDS complement(1140508..1143363) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene gcvP CDS complement(1143374..1143757) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266823.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene gcvH CDS complement(1144174..1145676) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244904.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(1145766..1146122) product DUF5064 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552307.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(1146233..1146694) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375928.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(1146691..1147305) product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266826.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(1147433..1150003) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764059.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(1150128..1151033) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266828.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(1151164..1151682) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764054.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(1151778..1152779) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375919.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene gap CDS 1152999..1154825 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406660.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene edd CDS 1154822..1155787 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266830.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 1155864..1156601 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764051.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(1156557..1156784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1156741..1158054 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197678549.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(1158136..1159455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 1159872..1161158 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736422.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 1161263..1162171 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375907.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1162164..1163009 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406653.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 1163012..1164169 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764049.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 1164289..1165647 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736419.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 1165746..1166618 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764048.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(1166770..1167636) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552324.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 1167843..1169312 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375894.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene zwf CDS 1169299..1170012 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764047.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene pgl CDS 1170030..1170704 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266838.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(1170856..1171089) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341842.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 1171311..1171781 product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314059.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(1171838..1173349) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266839.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1173517..1174881) product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266840.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(1174871..1175548) product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764042.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(1175559..1178660) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266841.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(1178657..1179817) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103503.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1180260..1180457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 1180857..1181441 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 1181461..1182240 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103504.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1182386..1184950 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187598562.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1184947..1185687 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266846.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 1185689..1186687 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244881.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 1186697..1187014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(1187021..1187773) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764030.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(1187875..1188189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(1188228..1188689) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266849.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(1188755..1189654) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408993.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 1190252..1190761 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406623.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1191279..1192169 product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266850.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene cyoA CDS 1192173..1194185 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266851.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene cyoB CDS 1194272..1194817 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615570.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 1194818..1195150 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375849.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene cyoD CDS 1195161..1196048 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375846.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene cyoE CDS 1196191..1197210 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314085.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(1197279..1198241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266855.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(1198359..1199147) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 1199310..1200320 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365244.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(1200343..1201002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 repeat_region 1201526..1202873 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttcactgccgtataggcagctcagaaa CDS complement(1202933..1203496) product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene cas6f CDS complement(1203500..1204522) product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene csy3 CDS complement(1204555..1205535) product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene csy2 CDS complement(1205528..1206874) product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene csy1 CDS complement(1206978..1210340) product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene cas3f CDS complement(1210337..1211314) product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene cas1f repeat_region 1211553..1212540 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttctgagctgcctacacggcagtgaag repeat_region 1213169..1213436 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttcactgccgtgtaggcagctcagaga CDS 1213656..1214498 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091026.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 1214549..1215115 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114018.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(1215118..1215513) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104644.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(1215503..1216636) product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104643.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 1216733..1217614 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765268.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1217724..1218479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1218544..1218774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103403.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 1218949..1222479 product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344102.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(1222531..1223382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(1223427..1224218) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216541.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(1224301..1225380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(1225919..1227520) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267901.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 1227859..1230150 product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104993.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 1230147..1231751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104994.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 1231748..1232701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 1232853..1233794 product DUF1911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206346.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(1233862..1235124) product DUF1835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112344.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1235380..1236687) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965836.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(1236741..1237157) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065002.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(1237442..1237963) product Bro-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1238437..1238886) product Bro-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 repeat_region 1239315..1240243 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctacacggcagtgaag tRNA complement(1240602..1240686) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 1240804..1241868 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771042.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene queA CDS 1241865..1242998 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420264.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene tgt CDS 1243052..1243387 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552468.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene yajC CDS 1243450..1245318 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266904.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene secD CDS 1245328..1246239 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666079.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene secF CDS 1246405..1246947 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421912.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(1247070..1247885) product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene suhB CDS 1248078..1248839 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene trmJ CDS 1248839..1249615 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266905.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene cysE CDS 1249813..1250265 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene iscR CDS 1250310..1251524 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365095.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 1251608..1251994 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene iscU CDS 1252040..1252363 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380604.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene iscA CDS 1252375..1252896 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771027.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene hscB CDS 1252941..1254803 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266907.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene hscA CDS 1254807..1255148 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615771.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene fdx CDS 1255163..1255363 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092814.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene iscX CDS 1255457..1255882 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552482.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene ndk CDS 1255915..1257063 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771021.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene rlmN CDS 1257078..1257836 product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771019.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene pilW CDS 1257836..1258855 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266909.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 1258859..1259968 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406481.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene ispG CDS 1259991..1261280 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103548.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene hisS CDS 1261320..1261961 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552488.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 1261954..1263105 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428301.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene bamB CDS 1263245..1264714 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380618.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene der CDS 1264836..1265984 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771011.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1265972..1266763 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103550.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 1266822..1267259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771009.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(1267490..1268359) product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406462.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(1268720..1270390) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406457.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene leuA CDS complement(1270748..1271572) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771007.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(1271580..1272959) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797807.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene xseA CDS 1273057..1273824 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113815.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 1273902..1274450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771002.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 1274546..1276015 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314194.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene guaB CDS 1276136..1277713 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene guaA CDS 1278092..1280170 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538222.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 1280163..1281917 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368616.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 1282263..1282439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 1282553..1282882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 1282882..1284396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(1284882..1286795) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267909.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1287181..1287558) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315823.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 1287660..1288784 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919990.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(1288907..1291153) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1291439..1292404) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390126.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(1292452..1292949) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084762.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 1292911..1293153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1293150..1295990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 1296219..1297592 product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406430.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 1297592..1298080 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266922.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene tadA CDS complement(1298087..1299505) product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080546580.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene mltF CDS 1299740..1303681 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266924.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene purL CDS 1303688..1303999 product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266925.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(1304116..1304679) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266926.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(1304716..1305267) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421963.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 1305418..1306014 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 1306072..1306596 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615845.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1306596..1306805 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771683.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1306967..1307434 product preQ0 transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391204.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1307537..1308718 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene purT CDS complement(1308788..1310098) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032615959.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 1309998..1310246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(1310385..1311629) product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266931.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(1311642..1312454) product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765867.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene ccsA CDS 1312664..1314040 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406399.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene ffh CDS 1314289..1314546 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377687.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene rpsP CDS 1314552..1315091 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406396.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene rimM CDS 1315097..1315849 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene trmD CDS 1315894..1316244 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552524.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene rplS CDS 1316348..1317244 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266933.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene xerD CDS 1317377..1318117 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406382.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene dsbC CDS 1318256..1319560 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765880.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 1319667..1321076 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314231.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene thrC CDS 1321197..1324811 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463398.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 1324897..1326174 product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797770.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1326147..1326809) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 1327093..1327371 product DUF3509 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245377.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1327558..1328442) product TIGR02285 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054080745.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 1328691..1329233 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314240.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1329294..1331009 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266941.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene recJ CDS 1331101..1332207 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103575.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(1332226..1334295) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266943.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 1334609..1335349 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266944.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 1335670..1337232 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266946.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 1337242..1337778 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266947.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 1337775..1339061 product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103578.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 1339058..1339747 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 1339744..1342152 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266949.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 1342149..1343159 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765912.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 1343205..1344212 product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765914.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 1344506..1345420 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096102164.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene prfB note possible pseudo, frameshifted CDS 1345515..1347017 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266952.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene lysS CDS 1347304..1348029 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245388.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 1348055..1348600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103725.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 1348634..1349911 product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765921.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 1350047..1350955 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245391.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 1350952..1351281 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103581.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1351336..1352118) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266956.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(1352178..1352591) product DUF4398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409265.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 1353005..1355641 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266958.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene ppc CDS 1355900..1356547 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406317.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene adk CDS 1356638..1357321 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765933.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene tsaB CDS 1357529..1357852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554750.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 1357855..1358718 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245396.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1358684..1358866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1358869..1359558 product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765937.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(1359555..1360178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 1360275..1361057 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266962.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1361054..1361686) product efflux system transcriptional repressor MexL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene mexL CDS 1361778..1362878 product multidrug efflux RND transporter periplasmic adaptor subunit MexJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene mexJ CDS 1362885..1365959 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(1366124..1366813) product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765949.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(1366911..1369397) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266965.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene plsB CDS complement(1369523..1369900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765957.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1369919..1370728) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615949.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(1370728..1371879) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene dapE CDS complement(1371994..1373421) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930755.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 1373720..1374550 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103587.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene tcdA CDS complement(1374541..1374948) product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103588.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(1374945..1376150) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103589.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(1376210..1377244) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266969.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene dapD CDS complement(1377280..1377627) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377785.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1377624..1377947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1378420..1380951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(1380953..1381843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(1382459..1382830) product DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105154.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 1383577..1383849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1384317..1385186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(1385297..1386490) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103591.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene dapC CDS complement(1386530..1389229) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245412.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(1389294..1390076) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765976.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene map CDS 1390398..1391141 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615972.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene rpsB CDS 1391332..1392201 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765978.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene tsf CDS 1392405..1393148 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554728.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene pyrH CDS 1393145..1393702 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765982.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene frr CDS 1393719..1394474 product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314296.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene uppS CDS 1394474..1395289 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 1395286..1396473 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene ispC CDS 1396575..1397927 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406254.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene rseP CDS 1398003..1400375 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266976.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene bamA CDS 1400420..1400923 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554721.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1400927..1401982 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765994.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene lpxD CDS 1402093..1402533 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554719.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene fabZ CDS 1402530..1403306 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314305.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene lpxA CDS 1403309..1404448 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103595.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene lpxB CDS 1404460..1405110 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420273.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene rnhB CDS 1405177..1408698 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene dnaE CDS 1408814..1409761 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene accA CDS complement(1410065..1410307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1410200..1411417 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390753.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene tilS CDS 1411681..1413312 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364819.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 1413328..1414173 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266982.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene kdsA CDS 1414316..1415605 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339565.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene eno CDS 1415791..1416069 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314315.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene ftsB CDS 1416066..1416773 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766007.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene ispD CDS complement(1416770..1417666) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377838.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 1417772..1418884 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266984.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 1418983..1419828 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406217.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene fghA CDS 1419902..1420375 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766012.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene ispF CDS 1420372..1421430 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266986.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene truD CDS 1421418..1422167 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406214.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene surE CDS 1422167..1422844 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406213.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 1423037..1423915 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766016.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 1424018..1425028 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616022.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene rpoS CDS complement(1425586..1425909) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314327.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(1425924..1426106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(1426148..1428640) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162234442.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene mutS CDS 1428780..1429115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 1429116..1429688 product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766018.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 1429783..1430847 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397594.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene recA CDS 1430901..1431323 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406202.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene recX CDS complement(1431344..1432420) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766024.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(1432646..1433065) product quorum-sensing-regulated virulence factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397588.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 1433288..1433998 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406193.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 1434176..1434823 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003319664.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1434896..1435264 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364775.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1435270..1436139) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 1436320..1437099 product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554680.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene fpr CDS complement(1437147..1437854) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766043.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene tsaA CDS complement(1437858..1438319) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409371.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1438386..1439096) product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397570.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1439237..1439668) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266993.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1439766..1441112) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266994.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene rimO CDS complement(1441279..1441566) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948599.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 1441977..1443872 product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406174.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(1443943..1445280) product virulence factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104820.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(1445280..1447922) product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene mprF tRNA complement(1448365..1448441) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(1448594..1448670) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 1448918..1449979 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104818.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene dinB CDS complement(1450009..1450971) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245435.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(1451039..1452754) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004418668.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(1452929..1454263) product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104816.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 1455182..1455607 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406157.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 1455604..1455816 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364741.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(1455882..1456472) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1456932..1457405 product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314356.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 1457743..1458084 product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406139.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 1458350..1460125 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554661.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene aspS CDS 1460243..1460989 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 1461120..1461644 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene ruvC CDS 1461760..1462368 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406125.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene ruvA CDS 1462369..1463427 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409396.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene ruvB CDS 1463564..1464031 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406122.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene ybgC CDS 1464021..1464716 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene tolQ CDS 1464731..1465195 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554654.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene tolR CDS 1465195..1466247 product cell envelope integrity protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616090.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene tolA CDS 1466322..1467545 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339472.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene tolB CDS 1467598..1468095 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554651.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene pal CDS 1468294..1468917 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104810.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene ybgF CDS 1469080..1469736 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104809.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene queE CDS 1469754..1470428 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463447.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene queC tRNA 1470492..1470567 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(1470815..1471330) product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401379.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1471562..1472326 product OBAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698597.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 1472619..1473893 product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103336.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(1473919..1475547) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797801.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(1475579..1476202) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769977.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 1476403..1478004 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103339.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(1478245..1479138) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035540.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 1479430..1480446 product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525879.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1480491..1481411) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088296.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 1481590..1482003 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314723.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene arfB CDS complement(1482000..1483211) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268523.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(1483351..1483530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314725.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(1483926..1484282) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268522.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(1484297..1485100) product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767729.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene phhA CDS 1485313..1487268 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245081.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene acs CDS 1487825..1488601 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 1488686..1489375 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740602.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 1489372..1490070 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103715.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 1490072..1491184 product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767739.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1491207..1491971 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103716.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 1492104..1493096 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164989785.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene argR CDS 1493334..1494551 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103718.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 1494687..1495718 product arginine/ornithine succinyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616608.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene aruF CDS 1495789..1496814 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene astA CDS 1496814..1498280 product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene astD CDS 1498327..1499673 product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103720.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene astB CDS 1499737..1500021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314741.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 1500036..1501052 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404084.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene astE CDS complement(1501090..1501602) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406469.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 1502106..1503110 product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406468.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene ltaE CDS 1503255..1505879 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024642718.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene alaS CDS 1505973..1507205 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731386.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 1507378..1507566 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554426.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene csrA tRNA 1507629..1507719 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 1507829..1507905 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 1507993..1508069 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(1508113..1508592) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245069.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene bamE CDS 1508915..1510357 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412626.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene mgtE CDS complement(1510422..1511501) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762461.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1511672..1511989) product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554423.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 1512304..1512468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(1512443..1512628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443210.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(1512665..1512904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204340.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 tRNA 1513207..1513283 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 1513695..1514828 product polymorphic toxin type 44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104705.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 1514854..1515201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 1515322..1515594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(1515693..1516781) product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene sfnG CDS complement(1516945..1517847) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215638.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 1517961..1518389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 1518386..1518973 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 1519195..1519725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(1519795..1520472) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(1520715..1522346) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104615.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 1522537..1524246 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768708.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 rRNA 1524673..1526206 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 tRNA 1526272..1526348 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 1526356..1526431 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 rRNA 1526691..1529580 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 rRNA 1529717..1529826 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 CDS complement(1529933..1530682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1531042..1532214 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463768.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(1532230..1533135) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268491.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 1533242..1534006 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694542.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene cysE CDS 1534025..1534915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 1534930..1535820 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406412.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 1535824..1537341 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268490.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 1537347..1538504 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268489.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(1538591..1539967) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 1540095..1541012 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(1541073..1542401) product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268487.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 1542748..1543638 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085908.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 1543763..1546441 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528828.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene acnA CDS 1546815..1547867 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817270.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 1547926..1549248 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089309.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 1549267..1549989 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(1549992..1551341) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268483.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(1551384..1552634) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767839.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(1552962..1553852) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095575.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 1553998..1555488 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406390.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 1555548..1556834 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268481.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 1557116..1558504 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206843.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(1558635..1560020) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103754.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(1560017..1560679) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103755.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 1560850..1561116 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 1561116..1561667 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245030.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 1561709..1563010 product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268479.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 1563007..1563600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268478.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 1563771..1565804 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 1566189..1566800 product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268476.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 1566797..1569031 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268475.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1569311..1569829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(1569882..1570793) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087264598.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 1570932..1571678 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269309.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 1572333..1572551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(1572653..1573582) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268857.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(1573849..1574634) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(1574839..1576011) product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764391.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 1576183..1577499 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400879.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene xylA CDS 1577649..1578650 product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764395.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene xylF CDS 1578717..1580273 product D-xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268061.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene xylG CDS 1580274..1581410 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400873.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene gguB CDS 1581483..1582109 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405948.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(1582162..1583265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(1583262..1583633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(1583745..1583975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 1583907..1584584 product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463553.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(1584621..1585541) product aromatic alcohol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729024.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 1585626..1586096 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266811.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 1586431..1587474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 1587476..1588654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789323.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 1588651..1589337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 1589685..1591175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 1591664..1592197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 1592908..1593444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 1594084..1594386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 1594454..1594834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 1595016..1595342 product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537736.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(1595665..1595952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 1596090..1596398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(1596435..1596803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 1596874..1597215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 1597517..1598887 product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406603.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1598939..1599835) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268178.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 1599938..1600801 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400541.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 1600890..1603085 product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1603263..1604798) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054081814.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(1604972..1606321) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966539.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(1606371..1607291) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966538.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 1607567..1608295 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113797.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(1608278..1609195) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085064.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(1609245..1610576) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206856.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(1610654..1611631) product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206855.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 1611862..1612539 product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872391.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 1612896..1613435 product Bro-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402397.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 1613910..1614449 product Bro-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402397.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 1614697..1615173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010208159.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 1615225..1616517 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(1616573..1616941) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 1617179..1618762 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267533.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 1618994..1619530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 1619693..1619977 product DUF5629 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463335.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 1620071..1621243 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423190.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 1621428..1621610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 1621887..1622066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(1622143..1625787) product exonuclease SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267196.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(1625784..1627028) product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104710.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(1627126..1628775) product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267197.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(1628772..1630487) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267198.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1630484..1631542) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769151.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(1631535..1632029) product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104708.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1632026..1632970) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376303.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(1632975..1633934) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554476.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(1634262..1635035) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104707.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 1635330..1640156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 1640280..1641206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 1641199..1645773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1645766..1646122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406543.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 1646543..1651399 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 1651576..1652751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 1652748..1653470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1653525..1654619) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267903.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene galE CDS 1654877..1656046 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038780.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 1656034..1657236 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243881.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene glf CDS 1657223..1658371 product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401106.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 1658368..1660122 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038783.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(1660133..1660297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 1660506..1660847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 1660967..1661407 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764689.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1661465..1661869) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097827.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 1662012..1662932 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024697938.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(1662948..1663370) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918284.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(1663360..1664238) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086558.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1664390..1666990) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218961313.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene acnB CDS 1667486..1667860 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404500.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(1667992..1668852) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087881.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 1669003..1669614 product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368536.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene miaE CDS 1669800..1670249 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740056.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 1670323..1671528 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267203.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 1671592..1673121 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010435770.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(1673213..1673959) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267205.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene lpxH CDS complement(1673956..1674459) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740060.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 1674668..1676362 product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044393841.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 1676373..1677755 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769192.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene cysS CDS complement(1677889..1679742) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769193.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 1680042..1681136 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740065.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 1681136..1682245 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267209.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 1682242..1683105 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552729.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 1683115..1683915 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267210.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 1683927..1684199 product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376264.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 1684275..1686047 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267212.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1686106..1686960) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404473.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene folD tRNA 1687258..1687334 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 1687394..1687469 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 1687534..1687618 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 1687990..1689300 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267215.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene tig CDS 1689383..1690033 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene clpP CDS 1690140..1691423 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene clpX CDS 1691769..1694165 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770753.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene lon CDS 1694312..1694584 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552737.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 1694790..1696673 product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267217.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(1696774..1698138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 1698611..1700347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(1700549..1701439) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974579.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 1701543..1702556 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974578.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(1702644..1703438) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368564.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene fabI CDS complement(1703457..1705067) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267220.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(1705069..1706088) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315267.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(1706090..1707163) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552742.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(1707165..1709012) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267221.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(1709009..1710910) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267222.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 1710910..1711098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(1711145..1712725) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267223.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(1712824..1713603) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267224.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene gloB CDS 1713684..1714442 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 1714489..1714941 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368579.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene rnhA CDS 1715009..1715785 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267225.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene dnaQ CDS 1715819..1716376 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770773.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 1716544..1721691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267226.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 1721847..1726955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104687.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 1727099..1732252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104687.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 1732398..1737599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104687.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1737724..1737936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404447.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 1738352..1743550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267226.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 1743701..1744264 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404446.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 1744400..1749586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267226.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(1749596..1750747) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770780.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(1750751..1751845) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104686.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 1752053..1753720 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202254.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 1753717..1754901 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404437.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(1755043..1756059) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(1756170..1756991) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619515.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(1757072..1758712) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104682.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(1759199..1759804) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010429686.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(1760007..1761023) product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376162.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 1761177..1761683 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(1761690..1762169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1762397..1763305 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419793.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(1763235..1764071) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(1764122..1764811) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(1764961..1765746) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423373.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(1766149..1767441) product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267250.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1767490..1767993) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415815.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(1768185..1769180) product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267251.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene alc CDS complement(1769233..1769748) product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267252.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene uraD CDS complement(1769745..1770668) product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765316.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene puuE CDS 1771035..1771388 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415819.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene uraH CDS 1771479..1772243 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267254.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 1772409..1773317 product halovibrin HvnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263909.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(1773323..1774636) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104657.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene guaD CDS complement(1774644..1775483) product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267256.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene xdhC CDS complement(1775586..1777943) product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267257.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene xdhB CDS complement(1777936..1779390) product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene xdhA CDS 1779665..1780324 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 1780329..1783817 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267260.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene smc CDS 1784069..1784911 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405868.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene zipA CDS 1785056..1787419 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267261.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene ligA CDS 1787624..1788766 product putative zinc-binding peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104652.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(1788926..1789198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 1790079..1792958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(1793228..1793908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(1794061..1794483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(1794573..1795319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(1795322..1795819) product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413692.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 1796053..1796535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1796606..1797103) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064082132.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(1797209..1798891) product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(1799002..1799754) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765281.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(1799956..1801113) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186143.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(1801153..1804068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 1804785..1806899 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267265.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene dnaX CDS 1806961..1807287 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552818.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 1807561..1808163 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408165.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene recR CDS complement(1808227..1808775) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766964.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(1808838..1809572) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408100.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene fnr CDS 1809724..1810188 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408101.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(1810193..1811575) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268430.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene hemN CDS complement(1811682..1812365) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412360.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(1812358..1812579) product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087273.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene ccoS CDS complement(1812558..1815023) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766952.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(1815075..1815506) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268427.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(1815615..1817030) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene ccoG CDS complement(1817221..1817673) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(1817673..1817924) product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370228.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(1818071..1819048) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766943.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene ccoP CDS complement(1819045..1819227) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766941.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(1819245..1819853) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene ccoO CDS complement(1819853..1821295) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103797.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene ccoN CDS complement(1821654..1822604) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087292.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene ccoP CDS complement(1822601..1822804) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087314.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1822808..1823416) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene ccoO CDS complement(1823427..1824851) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene ccoN CDS 1824942..1825628 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010207888.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(1825629..1826087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408129.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(1826175..1828076) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103800.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(1828113..1829999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103801.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 1830598..1832601 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463456.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(1832651..1833019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 1833679..1834239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(1834317..1835882) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268416.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(1835991..1836779) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463454.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(1836850..1839594) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268414.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene acnA CDS 1839635..1840825 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268413.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene rlmM CDS 1840880..1841134 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371482.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene tusA CDS 1841200..1842339 product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267266.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene pdxB CDS complement(1842406..1842582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427136.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 1842782..1844560 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766911.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(1844604..1844885) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378666.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(1844969..1845511) product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766910.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 1845812..1846615 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443274.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(1846619..1846786) product DUF2897 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766904.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(1846899..1848263) product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766903.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene eat CDS 1848518..1849252 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024667462.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene pyrF CDS complement(1849301..1850305) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 1850460..1851437 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032710620.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 1851702..1853633 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114601.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(1853636..1854829) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267275.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(1854880..1855419) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405819.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 1855418..1856584 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267276.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 1856622..1857224 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343108.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 1857251..1857637 product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267277.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(1857656..1858027) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405811.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(1858099..1858644) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616969.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene folE CDS complement(1859101..1859658) product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378641.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(1859704..1860024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378639.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(1860161..1860751) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378637.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 1860952..1861860 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405794.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene prmB CDS complement(1861899..1862699) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103815.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(1862815..1863810) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267282.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 1863954..1865045 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene aroC CDS 1865077..1866249 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 1866246..1866860 product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405783.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 1866950..1867495 product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267284.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 1867564..1868247 product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267285.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene mtnC CDS 1869070..1869741 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378621.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1869849..1870127) product DUF3509 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315128.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 1870428..1870958 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103819.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 1871045..1871569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103820.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(1871566..1872492) product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267287.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 1872621..1872812 product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552853.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 1873037..1873897 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371548.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene speE CDS 1874172..1876265 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267288.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 1876406..1876642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405762.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 1876887..1877228 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617305.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 1877687..1879096 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371557.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 1879109..1880065 product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378609.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 1880062..1880859 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378608.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(1880930..1881301) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267291.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 1881917..1882645 product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267292.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(1882692..1883663) product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405754.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(1883773..1884462) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738376.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(1884693..1885373) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211262.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(1885404..1885697) product DUF6388 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738377.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(1885837..1886715) product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269424.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(1886939..1887448) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113674.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 1887668..1889428 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104447.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 1889453..1903582 product deaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210043352.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 1903591..1903938 product immunity 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218298.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 1904139..1905131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 1905128..1905484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 1905872..1906096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 1906122..1906391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 1906875..1907438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1907495..1907899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405745.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 1908040..1908204 product DUF6021 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(1908220..1908588) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103824.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 tRNA complement(1908675..1908764) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(1908940..1909689) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771315.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 1909983..1910540 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103847.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(1910543..1911256) product DUF3142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(1911263..1913437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114102.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1913687..1914226) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104590.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(1914316..1914768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 1914938..1915723 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204659.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 1915720..1916982 product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765031.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene clsB CDS 1916979..1917959 product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268326.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1918091..1919320) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105438.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1919711..1920619) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619235.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 1920914..1922851 product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104589.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene iolC CDS 1922897..1923796 product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245360.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene iolE CDS 1923811..1924620 product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765020.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene iolB CDS 1924646..1926148 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268322.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 1926182..1927009 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765016.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 1927221..1929137 product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268320.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene iolD CDS 1929180..1930190 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268319.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 1930229..1931245 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765006.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 1931725..1932666 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246965.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 1932728..1934311 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268315.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 1934351..1935382 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380853.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 1935676..1936080 product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554078.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 1936460..1937890 product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268313.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1937901..1938137) product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397146.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 1938502..1938969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397144.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1939029..1939409) product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771168.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(1939406..1939684) product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771169.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(1939681..1940172) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771170.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(1940169..1941854) product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771172.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1941851..1942195) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268310.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(1942195..1945137) product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268309.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(1945272..1946198) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104575.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 1946294..1946875 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771176.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 1946914..1948341 product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268306.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(1948330..1949436) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(1949436..1950575) product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268305.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene ssuD CDS 1950934..1951818 product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268304.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 1951840..1954365 product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104572.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene ligD CDS 1954362..1955336 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926674.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(1955409..1956752) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104571.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene pssA CDS complement(1956887..1958041) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390357.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1958170..1958622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(1958619..1959047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 1959294..1960226 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268300.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 1960349..1961083 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 1961080..1961415 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104566.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 1961511..1962011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(1961981..1963405) product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407630.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1963456..1964112) product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104565.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(1964178..1964879) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407626.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 1964994..1965902 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407625.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 1965971..1966252 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348622.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 1966387..1966995 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(1967103..1967684) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771200.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene ssuE CDS complement(1967912..1969000) product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268296.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(1969164..1970576) product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771203.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(1970589..1971815) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268294.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(1971893..1973008) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268293.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(1973212..1974495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105556.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(1974602..1975837) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104562.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1975834..1976835) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104561.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(1977069..1977578) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005760598.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene rfaH CDS complement(1977583..1978371) product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096013.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(1978425..1980641) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104560.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(1980642..1981094) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268288.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(1981084..1982016) product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010216700.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(1982020..1983543) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268286.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(1983543..1984664) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104557.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(1984727..1985512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 1986329..1987507 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104556.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 1987562..1989361 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268285.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1989386..1989700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315720.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(1989724..1989882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1989895..1990779) product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268284.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene rhtA rRNA 1991432..1992965 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 tRNA 1993089..1993165 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 1993195..1993270 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 rRNA 1993512..1996401 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 rRNA 1996557..1996666 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS complement(1996859..1997215) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene queD CDS 1997412..1997720 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090497.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 1997720..1998028 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317989.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 1998028..1998696 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246025.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 1998693..2000015 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 2000133..2001812 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104517.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(2002038..2003501) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268278.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene nuoN CDS complement(2003509..2005041) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554022.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene nuoM CDS complement(2005081..2006934) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405115.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene nuoL CDS complement(2006931..2007239) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380111.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene nuoK CDS complement(2007236..2007745) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317979.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene nuoJ CDS complement(2007756..2008304) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405112.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene nuoI CDS complement(2008316..2009323) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411662.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene nuoH CDS complement(2009320..2012034) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246028.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene nuoG CDS complement(2012168..2013523) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405108.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene nuoF CDS complement(2013520..2014017) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371730.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene nuoE CDS complement(2014020..2015801) product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268276.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene nuoC CDS complement(2015874..2016548) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554012.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(2016559..2016972) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554011.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(2017428..2018753) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268275.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene aceA CDS complement(2019261..2020001) product secretin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104512.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 2020000..2020179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(2020189..2020611) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405100.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(2020604..2021770) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(2021832..2023202) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380132.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene purB CDS complement(2023334..2023954) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767416.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene hflD CDS complement(2023954..2025084) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268273.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene mnmA CDS complement(2025145..2025591) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268272.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(2025844..2028069) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104510.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 2028512..2029768 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene icd CDS complement(2029849..2030121) product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090435.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene cspD CDS 2030347..2030709 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380148.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene clpS CDS 2030740..2033013 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene clpA CDS complement(2033106..2033324) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553999.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene infA CDS complement(2033426..2034133) product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268269.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(2034183..2034872) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene aat CDS 2035365..2037767 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405080.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene ftsK CDS 2037837..2038460 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405079.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene lolA CDS 2038480..2039802 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405078.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 2039802..2040176 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268268.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene crcB CDS 2040193..2041473 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317946.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene serS CDS 2041474..2042868 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005618952.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene cysG CDS complement(2042990..2044000) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767387.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(2044108..2045109) product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104504.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(2045106..2045441) product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268265.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(2045438..2045737) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268264.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene tusB CDS complement(2045737..2046099) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104502.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene tusC CDS complement(2046101..2046493) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268263.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene tusD CDS complement(2046596..2047267) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 tRNA 2047390..2047477 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(2047817..2048131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 2048024..2048884 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200388.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 2048885..2049232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(2049320..2049565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397550.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 2050038..2052155 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765172.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(2052374..2053579) product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene chrA CDS 2053834..2055459 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268376.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 2055691..2056377 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809856.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 2056465..2057271 product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479656.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 2057283..2058053 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727772.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 2058055..2058852 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 2058846..2060456 product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112648.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(2061166..2062341) product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104498.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene solA CDS complement(2062721..2063407) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113694.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(2063410..2064150) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089046.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(2064218..2065024) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089047.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 2065562..2066500 product transcriptional regulator HrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103533.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene hrpR CDS 2066618..2066824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 2066894..2067862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 2067898..2068266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 2068277..2069062 product type III secretion inner membrane ring lipoprotein SctJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763897.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene sctJ CDS 2069059..2069682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763896.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 2069648..2070226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 2070297..2070518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 2070505..2070918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 2070911..2072929 product type III secretion system outer membrane ring subunit SctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266883.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene sctC CDS 2073055..2073246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 2073239..2073592 product HrpRS complex negative regulator HrpV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244826.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene hrpV CDS 2073696..2074094 product type III secretion system chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763915.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 2074241..2075881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 2075883..2076212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(2076724..2077332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(2077443..2082899) product type III secretion system effector AvrE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103532.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene avrE1 CDS 2083307..2084053 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266848.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(2084087..2084743) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104623.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(2084750..2085937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(2085934..2086848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(2086857..2087453) product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540486.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene nudK CDS complement(2087450..2088358) product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337020.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(2088355..2089467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(2089469..2090167) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(2090164..2091534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141950.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(2091515..2092603) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(2092600..2093112) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762309.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(2093113..2094222) product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392273.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(2094261..2095271) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339517.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(2095420..2095674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(2095934..2097019) product type III secretion system export apparatus subunit SctU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406538.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene sctU CDS complement(2097044..2097841) product type III secretion system export apparatus subunit SctT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763879.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene sctT CDS complement(2097843..2098103) product type III secretion system export apparatus subunit SctS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375712.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene sctS CDS complement(2098118..2098771) product type III secretion system export apparatus subunit SctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406534.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene sctR CDS complement(2098768..2099832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(2099834..2100397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(2100394..2100858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(2100845..2102200) product type III secretion system ATPase HrcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763862.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene hrcN CDS complement(2102200..2103186) product type III secretion system inner membrane ring subunit SctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266892.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene sctD CDS complement(2103197..2105302) product type III secretion system export apparatus subunit SctV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244820.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene sctV CDS complement(2105299..2106288) product type III secretion system gatekeeper subunit SctW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409091.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene sctW CDS 2106679..2107233 product RNA polymerase sigma factor HrpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266895.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene hrpL CDS 2107233..2107814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(2108022..2109605) product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767359.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(2109764..2110642) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104496.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 2110749..2111288 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104495.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 2111295..2112461 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024699157.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 2112615..2113688 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705148.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 2113675..2114673 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705149.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 2114667..2115458 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089193.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 2115539..2116183 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405030.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(2116585..2119326) product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268254.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 2119818..2120027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017278752.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 2120124..2121848 product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666356.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene gspE CDS 2121845..2123047 product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767347.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene gspF CDS 2123063..2123503 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317918.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene gspG CDS 2123513..2123947 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411575.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 2123947..2124318 product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268251.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 2124315..2124947 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 2124944..2125678 product general secretion pathway protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405013.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 2125675..2126730 product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104492.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 2126705..2127316 product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381177.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene gspM CDS 2127313..2127843 product general secretion pathway protein GspN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405008.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 2127843..2130143 product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268249.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene gspD CDS 2130218..2130934 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268248.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(2130994..2132181) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268247.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(2132489..2132929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(2132941..2133669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 2134022..2134753 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235372.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 2134800..2136086 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268244.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 2136143..2136988 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268243.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(2136997..2140038) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104487.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(2140035..2141126) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104486.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(2141123..2142127) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104485.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(2142388..2143257) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010205407.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(2143525..2143725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(2143752..2145149) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404984.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(2145127..2145810) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381155.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(2145921..2146835) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767320.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(2146918..2147565) product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268238.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene pncA CDS 2147760..2149886 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104482.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(2149932..2150888) product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104476.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(2150917..2151570) product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246082.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(2151699..2153036) product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene gudD CDS complement(2153071..2154417) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246084.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 2154866..2155597 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268232.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 2155718..2156809 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104474.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 2156921..2158057 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268229.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 2158165..2159205 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(2159192..2160202) product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene cytR CDS 2160391..2161569 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919503.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 2161566..2162639 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919504.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 2162705..2163931 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858692.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 2163959..2164828 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973789.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 2165018..2166643 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767285.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 2166754..2167998 product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268227.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(2168005..2169096) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463326.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 2169211..2170119 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767282.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 2170215..2170433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(2170580..2171077) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104468.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 2171237..2172889 product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104467.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 2173245..2174264 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407468.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene pstS CDS 2174349..2175344 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371940.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene pstC CDS 2175341..2176225 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407464.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene pstA CDS 2176225..2177004 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553918.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene pstB CDS complement(2176985..2177932) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268222.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 2178100..2179104 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268221.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(2179288..2180112) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032609424.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 2180645..2182537 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104030.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 2182675..2183241 product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403600.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene phnN CDS 2183399..2184220 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529955.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 2184482..2185777 product nitrate regulatory protein NasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705088.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene nasR CDS 2186066..2187400 product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085587.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 2187428..2188303 product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085588.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene ntrB CDS 2188315..2189124 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397937.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(2189177..2190076) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400555.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(2190129..2191649) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267548.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(2191862..2193028) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104091.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(2193025..2194452) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762889.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(2194449..2195435) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762887.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(2195432..2196433) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267552.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(2196450..2197358) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762883.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(2197367..2198269) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348343.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(2198363..2199883) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738493.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 2200071..2200979 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408081.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 2201127..2202032 product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104093.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene folE2 CDS 2202044..2202604 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617714.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 2202726..2203892 product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408090.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(2204071..2204799) product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267525.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(2204822..2206945) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771258.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(2207111..2208607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(2208618..2209868) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114420.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 2210127..2211053 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(2211064..2213937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(2213934..2215727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057917422.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(2215714..2216154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(2216160..2217281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(2218142..2220100) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104028.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(2220220..2220606) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104465.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene nirD CDS complement(2220606..2223164) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268219.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene nirB CDS 2223620..2224114 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268218.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(2224138..2225388) product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(2225475..2226779) product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246029.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(2226893..2228203) product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080139272.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene dctA CDS complement(2228281..2229363) product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704356.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 2229531..2230421 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089835.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(2230570..2231361) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268216.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(2231358..2232380) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032710978.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(2232377..2233390) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268214.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(2233746..2234462) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 2234573..2235298 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770837.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(2235447..2236169) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770839.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(2236303..2237061) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104460.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(2237078..2237917) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104459.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(2237937..2238842) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245922.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(2238842..2239879) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010220797.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(2239911..2241533) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104458.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(2241610..2242764) product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010210634.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(2243087..2244772) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161803513.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(2244769..2247588) product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815400.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(2247635..2250469) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084281.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(2250624..2251661) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104456.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(2251670..2252584) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104455.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 2252980..2255496 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104454.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 2255538..2257466 product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104453.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 2257553..2258263 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245914.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene tolQ CDS 2258274..2258720 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770871.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene tolR CDS 2258717..2259511 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463904.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(2259532..2260569) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390149.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(2260646..2261158) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390150.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(2261317..2262942) product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087273407.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 tRNA 2263104..2263179 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 2263374..2264111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(2264202..2265545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(2266095..2267159) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704143.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(2267281..2269560) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103229.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(2269619..2270023) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010438282.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(2270025..2270726) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768984.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(2270735..2271490) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269058.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(2271583..2272395) product DUF1868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(2272588..2272752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 note possible pseudo, internal stop codon, frameshifted CDS complement(2272749..2272919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 note possible pseudo, internal stop codon, frameshifted CDS 2273323..2274702 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103225.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 2274699..2275592 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768962.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 2275589..2276482 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768960.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 2276479..2277585 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269078.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene ugpC CDS 2277801..2278169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 note possible pseudo, internal stop codon, frameshifted CDS complement(2278750..2278950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(2279359..2279541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 2280182..2280772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 2280784..2281158 product DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247160.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 2281347..2281661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 2281904..2283544 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237256.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 2283605..2284105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 note possible pseudo, internal stop codon, frameshifted CDS 2284145..2284339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 note possible pseudo, internal stop codon, frameshifted CDS 2284368..2284907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 2284795..2285286 product DUF4189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038400.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 2285464..2286000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 2286143..2286355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 note possible pseudo, internal stop codon, frameshifted CDS 2286604..2286984 product DUF2269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245243.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(2286989..2288212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 2288425..2288886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(2288944..2289423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 2289562..2289783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 2290005..2291354 product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434862.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 2291597..2292721 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267808.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 2292962..2294161 product efflux RND transporter periplasmic adaptor BpeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197561.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene bpeA CDS 2294253..2297351 product efflux RND transporter permease BpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene bpeB CDS complement(2297731..2298669) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967285.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(2298858..2299382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 2299923..2300783 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243022.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 2300892..2302127 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050813472.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 2302203..2303030 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(2303114..2304109) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267240.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 2304301..2305191 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(2305608..2306351) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644758.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 2306512..2307294 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552531.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(2307516..2308505) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967019.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(2308610..2309512) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705466.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(2309512..2309706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 2309798..2310799 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268098.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 2311656..2312819 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104940.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 2313100..2313474 product DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105154.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(2313586..2313954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 2314305..2314970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768136.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 2315341..2316579 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407872.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(2316713..2318335) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267488.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 2319048..2319326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(2319413..2320285) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770888.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 2320422..2320847 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770885.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(2320939..2322585) product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044309634.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene mqo CDS 2323510..2323812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(2323819..2324313) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187998.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 2324456..2325406 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387968.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 2325621..2326109 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530542.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(2326110..2326709) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267648.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 2326933..2327547 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267492.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 2327664..2328737 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267493.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 2328734..2331814 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267494.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 2331855..2333147 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895556.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene fabF CDS 2333238..2333822 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267649.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(2334027..2335418) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267650.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 2335521..2336390 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762697.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 2336456..2337202 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090105.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(2337336..2338253) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206048.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 2338440..2339189 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206049.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 2339284..2340588 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206050.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 2340606..2341466 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935658.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 2341463..2342482 product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206051.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(2342536..2342871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407971.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(2343086..2346223) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037812.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(2346239..2347318) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037813.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 2347583..2348245 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037814.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 2348400..2352137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963924.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 2352168..2352416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(2352741..2353577) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782017.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(2353579..2354811) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393073.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(2354826..2355146) product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393075.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(2355184..2356281) product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528359.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 2356460..2357518 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244167.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 2358257..2358739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 2358802..2358933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(2359060..2359332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(2359629..2359841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397550.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(2360201..2360578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(2360595..2361374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 2361776..2363239 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054081814.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(2363371..2366487) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104100.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(2366521..2367681) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104101.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 2367860..2368414 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104102.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(2368552..2369922) product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104103.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(2369919..2370242) product isochorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762840.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(2370257..2371828) product yersiniabactin biosynthesis salycil-AMP ligase YbtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104104.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene ybtE CDS complement(2371841..2372605) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463300.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(2372610..2373692) product thiazolinyl imide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245945.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(2373689..2383222) product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104106.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(2383209..2384438) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762833.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(2384435..2390608) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104107.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(2390669..2392414) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762826.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(2392411..2394195) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762824.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(2394342..2396345) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044389891.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 2396491..2397435 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762820.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(2397451..2399946) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762818.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 2400333..2400671 product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267889.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 2400764..2401369 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424002.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 2401369..2401872 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797763.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 2402094..2402906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 2402992..2403714 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010203861.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 2403716..2404117 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771285.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(2404269..2405423) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762690.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(2405420..2406235) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405538.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(2406239..2407177) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762686.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(2407180..2408205) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405534.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(2408514..2409623) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene ribBA CDS 2409717..2410013 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762682.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(2410145..2410708) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762680.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(2410710..2411462) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405525.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(2411634..2412119) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382778.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(2412134..2413615) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267658.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(2413612..2414445) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246008.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(2414486..2415076) product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762667.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 2415296..2416153 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267661.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 2416324..2417754 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104140.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(2417839..2418777) product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267664.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene pbpG CDS 2419036..2419596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405490.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(2419693..2419875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737770.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(2420047..2420400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410180.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(2420658..2421320) product DUF480 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267665.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 2421244..2421456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 2421478..2421987 product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762644.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(2421990..2422886) product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene nhaR CDS 2423019..2423261 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104145.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 2423294..2424052 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267668.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(2424127..2424291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104147.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 2424595..2425200 product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104148.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(2425253..2426536) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246020.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 tRNA 2426719..2426795 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(2426937..2427182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 tRNA 2427454..2427530 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(2427615..2427980) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762628.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(2428198..2428566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(2428810..2429919) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410204.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 2430219..2433032 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024697407.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 2433175..2433729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(2433790..2434728) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762619.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(2434753..2436222) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267678.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene xylB CDS complement(2436232..2437713) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762615.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(2437734..2438834) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267680.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene ugpC CDS complement(2438867..2439700) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369336.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(2439711..2440643) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267681.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(2440718..2442040) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382856.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2442280..2443185) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434154.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 2443305..2444060 product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267684.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene cobF CDS complement(2444062..2445384) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417625.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(2445377..2445736) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369350.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 2446083..2449592 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267686.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 2449633..2450454 product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025991008.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 2450451..2451065 product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104154.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 2451059..2452240 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104155.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 2452549..2452926 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382842.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(2452939..2454969) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267690.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(2454966..2456450) product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267691.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 2456651..2457463 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104157.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 2457476..2458312 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267693.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene nudC CDS complement(2458280..2459059) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010433827.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(2459160..2460302) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104158.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(2460518..2461285) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267696.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(2461310..2462377) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267697.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(2462567..2462884) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382829.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(2462940..2463650) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267698.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 2463856..2464884 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762574.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene sohB CDS complement(2464946..2465440) product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267699.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(2465424..2467082) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267700.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 2467653..2468756 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762569.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(2468738..2468974) product DUF2970 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098182.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(2469080..2472799) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104161.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene metH CDS 2473121..2475253 product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032606839.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 2475484..2476443 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402782.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 2476513..2477106 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553665.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene nfuA CDS complement(2477175..2477921) product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268159.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene cobM CDS complement(2477936..2478397) product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400608.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(2478378..2479082) product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104406.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(2479094..2479279) product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766274.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 2479957..2481069 product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268157.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene cobW CDS 2481073..2484837 product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268156.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene cobN CDS 2484837..2485856 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268155.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 2485979..2486518 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245851.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(2486567..2486833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315350.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 2487208..2488533 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268154.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(2488477..2489055) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268153.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(2489052..2489615) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400615.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene pnuC CDS 2489815..2490681 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400617.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 2490678..2491148 product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246312.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(2491113..2491457) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246311.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 2491575..2492366 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268150.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene pcaD CDS 2492430..2493389 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268149.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 2493463..2494074 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246309.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 2494379..2495458 product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268147.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(2495413..2496087) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104399.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(2496084..2496683) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246306.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(2496680..2497459) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268144.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(2497441..2498451) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766234.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(2498448..2500631) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766232.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene glgX CDS complement(2500793..2501146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(2501164..2503947) product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268140.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(2503944..2506022) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104396.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene malQ CDS complement(2506012..2507694) product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268138.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene treZ CDS complement(2507844..2509436) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766223.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene glgA CDS 2510037..2510528 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766220.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(2510595..2510768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 2511086..2512060 product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766216.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene gnd CDS 2512060..2513592 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268136.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene zwf CDS 2513585..2514403 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766212.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 2514452..2516275 product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268134.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(2516383..2516562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380430.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(2516579..2516884) product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380432.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 2517056..2517406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400692.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(2517414..2517800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 2517879..2519240 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113510.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 2519285..2520124 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364457.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene galU CDS 2520227..2521591 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268131.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene gorA CDS 2521789..2522607 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267567.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 2522709..2523617 product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267568.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene glsB CDS 2523669..2524742 product DUF1615 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104033.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(2524748..2525179) product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407498.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 2525269..2527080 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246686.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 2527216..2528253 product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267571.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 2528644..2531031 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246690.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(2531127..2532155) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104032.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(2532301..2533308) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766198.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 2533484..2534443 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268128.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 2534545..2535108 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553298.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene ahpC CDS 2535233..2536795 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315309.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene ahpF CDS complement(2537002..2537523) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268127.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene gloA CDS complement(2537599..2537811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 2537702..2538220 product DUF4946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463773.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(2538793..2539158) product DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553302.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(2539564..2540580) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268125.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(2540807..2542204) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268124.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(2542204..2545395) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380455.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(2545408..2546649) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411228.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(2546903..2548843) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267518.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(2548995..2549789) product pca regulon transcriptional regulator PcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363842.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene pcaR CDS complement(2549796..2550347) product sarcosine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267519.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(2550350..2553256) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104013.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(2553253..2553558) product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104014.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(2553572..2554813) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246879.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(2554795..2555700) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104015.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene folD CDS complement(2555697..2556563) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407853.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene purU CDS complement(2556821..2557426) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762869.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 2557714..2559048 product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene glnT CDS 2559202..2560089 product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762867.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 2560101..2560784 product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762866.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 2560800..2562122 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762863.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 2562336..2563661 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104096.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(2563732..2564769) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762859.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(2564954..2566396) product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267574.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(2566435..2567175) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267576.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 2567594..2569144 product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene norR CDS 2569270..2569494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316018.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 2569590..2571044 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267581.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(2571034..2571258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(2571375..2571569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367271.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(2571640..2572110) product DUF3828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010205558.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(2572257..2572877) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406576.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 2573043..2573525 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(2573546..2573842) product RcnB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407540.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(2573914..2574213) product RcnB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407540.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(2574312..2575169) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104045.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 2575336..2575683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 2575819..2577708 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267586.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene mrdA CDS complement(2577715..2578977) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946287.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 2579278..2580198 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347707.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 2580316..2580930 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368006.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 2580935..2582914 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114380.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 2582971..2583594 product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771485.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene ycaC CDS 2584114..2584434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617613.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 2584872..2598971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(2599265..2599417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(2599539..2600108) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096934.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 2600295..2601245 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235611.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 2601458..2602918 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243944.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 2602915..2603889 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267757.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 2603886..2604791 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762406.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 2604788..2605786 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267759.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 2605776..2606783 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267760.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 2606841..2608406 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104209.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 2608493..2609017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267762.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 2609014..2609601 product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267763.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 2609788..2610297 product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267595.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(2610351..2611349) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104052.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene moaA CDS complement(2611439..2612791) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267596.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(2612961..2614013) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267597.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(2614010..2615194) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104055.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(2615191..2616570) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267599.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(2616567..2616857) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246655.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(2616882..2617676) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383453.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(2617680..2618552) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267600.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(2618549..2619577) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267601.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 2619823..2620656 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267602.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 2620747..2621127 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105171.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(2621256..2622452) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(2622527..2624050) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267440.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(2624438..2625805) product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269233.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(2625802..2626476) product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405189.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 2626790..2628025 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269234.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 2628082..2629368 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269235.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 2629393..2632527 product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269236.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 2632693..2633022 product DUF2790 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767301.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 2633222..2633554 product DUF2790 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003373363.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(2633641..2634603) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267603.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(2634683..2635387) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267604.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(2635438..2635665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317903.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(2635799..2636140) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236587.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(2636262..2636543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407574.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 2637178..2638752 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104064.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 2638913..2639185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(2639191..2639766) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267607.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(2639851..2641863) product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105496.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene tssI CDS complement(2641948..2642460) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083317.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 2643006..2644553 product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105494.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene tssA CDS 2644587..2645093 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114607.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene tssB CDS 2645120..2646595 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104072.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene tssC CDS 2646683..2647030 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097809.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene tssE CDS 2647144..2648943 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464013.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene tssF CDS 2648907..2649908 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105487.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene tssG CDS 2649921..2652500 product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105486.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene tssH CDS 2652500..2654005 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105485.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 2654216..2654977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 2654983..2655477 product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105482.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene tssJ CDS 2655470..2656804 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010213774.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene tssK CDS 2656801..2657682 product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087622.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene icmH CDS 2657679..2661176 product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114614.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene tssM CDS complement(2661186..2662103) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405623.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 2662208..2663410 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104111.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 2663538..2664068 product DUF4174 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762784.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(2664125..2664565) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405616.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(2664827..2667331) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103467.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(2667531..2667785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 2667693..2669888 product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267622.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(2669885..2670712) product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267623.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(2670889..2671722) product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267625.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(2671719..2672939) product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405604.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(2673008..2673880) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762770.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 2674128..2674967 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104115.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 2675189..2676028 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104115.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 2676025..2677446 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 2677443..2678660 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388890.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 2678657..2679391 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104116.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 2679381..2680169 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762766.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 2680156..2680992 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104117.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 2681133..2681726 product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104118.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 2681769..2684528 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104119.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene metC CDS 2684815..2685564 product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104120.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene aztA CDS 2685561..2686430 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376994.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 2686443..2687336 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267627.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(2687478..2688626) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405591.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 2688837..2689709 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104122.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 2689739..2690557 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527760.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 2690681..2691676 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245978.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 2691728..2693254 product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267630.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene araG CDS 2693296..2694261 product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377005.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene araH CDS 2694443..2694964 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406891.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 2694961..2695935 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267791.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 2696167..2698602 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267792.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(2698668..2699105) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104417.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(2699424..2700047) product PqiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766332.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(2700044..2701660) product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400549.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(2701713..2702327) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315385.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(2702324..2702953) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428234.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 2703335..2703691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245871.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(2703739..2704056) product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245870.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 2704406..2704660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315380.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(2704663..2705559) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347707.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 2705652..2706578 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064421.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(2706582..2707061) product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766304.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 2707213..2708418 product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268168.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 2708498..2709271 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104412.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(2709258..2711204) product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268166.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene tssI CDS 2711519..2712223 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766298.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(2712243..2713547) product leucine-rich repeat-containing protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463315.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(2713672..2714808) product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268162.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(2714887..2715432) product DUF4880 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268161.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 2715561..2715710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(2715888..2717852) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267704.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(2717849..2718670) product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104164.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(2718682..2720289) product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762555.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(2720305..2721468) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044389757.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(2722173..2723072) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267708.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(2723123..2723503) product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318521.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(2723649..2724587) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402775.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 2724756..2725967 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104167.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(2725986..2727308) product phosphate ABC transporter substrate-binding/OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267709.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(2727449..2728261) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402772.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene xthA CDS 2728651..2730375 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402770.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 2730372..2734061 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463502.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 2734331..2734831 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402767.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene tpx CDS 2734982..2736298 product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762525.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 2736295..2739393 product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267713.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 2739390..2742494 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267714.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 2742491..2743951 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104175.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 2744131..2746314 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104176.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 2746367..2747113 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762514.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(2747117..2748544) product GntR family transcriptional regulator MpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113004.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene mapR CDS complement(2748706..2748981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(2749081..2750052) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096831545.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 2750736..2752766 product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243982.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 2752784..2756113 product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104178.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene treS CDS 2756110..2758341 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104179.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene glgB CDS complement(2758454..2761120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(2761314..2762474) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666071.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 2762692..2763804 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267724.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(2764013..2765602) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666072.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 2766006..2766614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 2767083..2767415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 2767793..2769718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 2769892..2770089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(2770308..2771669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 2771861..2772484 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267729.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS 2772527..2772952 product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762487.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 2773008..2773358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005743630.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 2773483..2774688 product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267732.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 2774813..2777296 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463504.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(2777330..2777587) product DUF1652 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762465.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(2777606..2777830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 2777923..2779002 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762461.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 2779239..2780864 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103145.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 2781295..2781975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666082.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 2782058..2782927 product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698836.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 2783120..2784019 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267748.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(2784034..2785296) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267749.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(2785293..2786603) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267750.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(2786781..2787677) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267751.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(2787690..2788568) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267752.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 2788764..2791802 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267753.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(2791994..2792881) product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene yghX CDS complement(2792972..2795050) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226992700.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(2795160..2795540) product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103730.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 2795858..2797147 product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267173.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 2797375..2798913 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164830060.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 2798906..2799931 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456749.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 2799959..2801014 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532920.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 2801336..2803723 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038194.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(2803769..2804251) product DUF3574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104385.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(2804429..2805745) product diaminobutyrate--2-oxoglutarate transaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267828.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 2805965..2807398 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267829.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 2807395..2808507 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 2808504..2811554 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267831.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 2811608..2812213 product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267813.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(2812387..2812593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 2812908..2841905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 2841902..2854960 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090208471.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 2855184..2886038 product syringopeptin non-ribosomal peptide synthetase SypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267825.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene sypC CDS 2886120..2887295 product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267826.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene macA CDS 2887292..2889256 product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267827.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(2889403..2890245) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267810.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(2890882..2891613) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104759.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(2892170..2893627) product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768689.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(2893673..2894464) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010437030.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 2894800..2896008 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267812.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 2896177..2896605 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765365.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 2896602..2897894 product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267237.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 2898044..2899621 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592279.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 2899666..2900652 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815472.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 2900649..2901503 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175294.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 2901493..2902341 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132443.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 2902338..2903099 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209297.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 2903132..2904319 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106206.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 2904397..2904801 product DUF2251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225853.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(2905146..2905541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 note possible pseudo, internal stop codon CDS complement(2905542..2906669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 note possible pseudo, internal stop codon CDS 2907080..2908513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 2908716..2909117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(2909146..2909460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268497.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(2909624..2910568) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435534.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 2910762..2911706 product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268082.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 2911786..2912673 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268083.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 2912751..2913716 product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268084.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 2913798..2914274 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268085.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(2914319..2915599) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113854.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 2915959..2916462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103337.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(2916561..2916722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(2917111..2917521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(2917518..2917901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 2918058..2919773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 2919854..2920282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 2920335..2920763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 2920824..2921042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(2921060..2921926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(2922103..2922543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 2922906..2923115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(2923207..2924334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(2924370..2925389) product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105475.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(2925461..2926231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(2926438..2927169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(2927169..2930264) product N-acetylmuramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152745183.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(2930269..2930739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(2930749..2932785) product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236928.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene tssI CDS complement(2932807..2933814) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464012.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(2933811..2934539) product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105478.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(2934539..2938066) product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464016.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene tssM CDS complement(2938080..2938955) product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105480.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene icmH CDS complement(2938961..2940292) product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105481.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene tssK CDS complement(2940295..2940795) product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105482.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene tssJ CDS complement(2940801..2941997) product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105483.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene tagH CDS complement(2942015..2942155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017702037.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(2942243..2943760) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105485.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(2943771..2946425) product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105486.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene tssH CDS complement(2946439..2947446) product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105487.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene tssG CDS complement(2947410..2949197) product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464013.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene tssF CDS complement(2949574..2949966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(2949963..2950814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(2950819..2951325) product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413692.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(2951336..2951743) product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105491.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene tssE CDS complement(2951754..2953229) product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087596.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene tssC CDS complement(2953258..2953761) product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105493.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene tssB CDS complement(2953794..2955350) product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105494.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene tssA CDS complement(2955962..2956966) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463280.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(2957040..2958536) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537726.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(2958526..2961645) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067600.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(2961645..2962802) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706712.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 2962967..2963656 product two-component system response regulator BprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523775.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene bprR CDS 2963710..2965017 product two-component system sensor histidine kinase BprS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527959.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene bprS CDS complement(2965036..2966466) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089638.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(2966504..2966719) product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304661.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 2966923..2967651 product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268602.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene fhuF CDS complement(2967652..2969295) product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(2969292..2973089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(2973086..2982115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(2982118..2991510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(2991625..2996433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(2996500..2997489) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267343.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(2997609..2998517) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106346642.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(2998575..2999624) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259663.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(2999621..3000562) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259661.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(3000601..3001404) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 3001684..3003900 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814468.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(3004065..3005243) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419961.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 3005440..3006474 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037078874.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 3006629..3008005 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769363.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 3008032..3009387 product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene gudD CDS 3009774..3010442 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648407.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(3010472..3012478) product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104221.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(3012481..3013632) product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010216538.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene macA CDS complement(3013751..3021004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 note possible pseudo, frameshifted CDS 3021491..3025180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 3025397..3027175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 3027374..3028663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 3029048..3029413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 3029474..3030451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 3030473..3031225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 3031355..3031525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(3031486..3040983) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104219.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 3041330..3042124 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762368.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(3042140..3042826) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268213.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 3043162..3043836 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 3044121..3045308 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104714.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 3045321..3046427 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115336.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 3046629..3047624 product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267737.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 3047624..3048466 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104191.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 3048463..3049203 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267736.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(3049277..3050488) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729543.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(3050503..3052224) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729789.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(3052221..3053084) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729788.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(3053081..3054085) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729787.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(3054070..3055716) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495702.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(3055895..3057307) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266344.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(3057329..3058594) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933604.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(3058626..3060740) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 3061246..3063360 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 3063589..3064413 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246274.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(3064481..3067111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(3067098..3069713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(3070021..3073092) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969410.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(3073096..3073983) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054081054.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS complement(3074247..3075083) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268202.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(3075080..3076438) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268203.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 3076686..3077375 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096847.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 3077453..3078565 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268205.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(3078911..3079999) product GNAT family N-acetyltransferase/peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 3080093..3081673 product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420659.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 3081700..3082635 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267746.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(3082704..3084398) product cyclic peptide syringomycin export ABC transporter SyrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267822.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene syrD CDS complement(3084557..3085618) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267821.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 3085940..3088027 product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267820.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 3088046..3088990 product chlorinating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267819.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 3089205..3090413 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267818.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(3090688..3091305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 3091623..3106217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 3106219..3119814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 3119888..3120262 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113301.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(3120311..3121336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267900.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(3121855..3122856) product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104216.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(3122853..3123992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615347.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(3123989..3125143) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(3125131..3126489) product adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368570.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(3126479..3127333) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037580.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(3127330..3128337) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837707.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(3128337..3129356) product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275332.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(3129445..3129834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 3130107..3132881 product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 3132899..3134257 product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420243.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 3134295..3135029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(3135566..3135961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(3135979..3137598) product DUF2300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003455629.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(3137600..3142174) product alpha-2-macroglobulin MagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112866.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene magD CDS complement(3142171..3142773) product DUF1175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112865.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(3142806..3144605) product DUF2138 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112864.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(3144618..3145388) product YfaP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094417.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(3145468..3146010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 3146444..3148075 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104379.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 3148072..3149022 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104380.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 3149027..3149944 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104381.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 3149941..3151587 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104382.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(3151602..3152477) product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463316.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 3153043..3153294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204398.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 3153291..3156047 product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463317.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(3156064..3156639) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268171.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(3156859..3157065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268983.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(3157169..3159160) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104349.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 3159358..3160374 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104350.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 3160371..3161162 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764492.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 3161252..3162169 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764495.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(3162248..3162877) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966328.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 3162982..3163710 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 3163844..3164827 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 3164831..3167905 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328246.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 3168287..3170104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 3170101..3170985 product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176762490.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 3170982..3171737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 3171791..3172675 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028849.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 3172672..3173898 product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene eboE CDS 3173888..3175327 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 3175306..3176469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 3176474..3178882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 3178942..3179880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 3179899..3181191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918445.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 3181195..3183003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 3183033..3184097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 3184299..3186458 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840061.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(3186495..3187043) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344936.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(3187158..3187913) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267905.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 3188038..3188931 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104265.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(3189082..3189693) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969187.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(3189719..3190507) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098249.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 3190630..3191631 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087717.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(3191752..3193026) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380966.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(3193120..3195204) product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104294.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene treS CDS complement(3195291..3195809) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082100673.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(3195902..3196162) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400996.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(3196455..3197111) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010430079.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 3197159..3198112 product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267929.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene ftrA CDS complement(3198206..3199396) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267930.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(3199400..3200554) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267931.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(3200586..3201230) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764543.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(3201271..3203055) product FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199726868.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(3203061..3205070) product 2,3-diaminopropionate biosynthesis protein SbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267934.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene sbnB CDS complement(3205081..3206397) product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104299.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(3206454..3207440) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267936.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(3207437..3208579) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267937.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(3208594..3210093) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267938.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(3210086..3210478) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400967.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(3210534..3210752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 3211018..3211470 product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104303.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 3211470..3211949 product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169553.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(3211910..3212893) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(3212940..3213575) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 3213705..3214781 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267942.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 3214891..3215658 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463409.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene modA CDS 3215659..3216339 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739341.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene modB CDS 3216343..3217431 product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104308.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene modC CDS 3217494..3218549 product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267946.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 tRNA 3218732..3218817 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(3218956..3219213) product DUF1652 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617091.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 3219603..3219848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 3220437..3220598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(3220965..3221150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 tRNA complement(3221712..3221785) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(3221990..3223204) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403753.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 3223436..3223954 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388638.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 3223951..3224895 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969652.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 3224999..3227359 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275481.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(3227480..3228877) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268044.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(3228874..3232017) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268045.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(3232020..3233201) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268046.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 3233352..3234740 product sensor histidine kinase efflux regulator BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400907.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene baeS CDS 3234744..3235421 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943739.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 3235493..3236779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 3236912..3238090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 3238236..3239555 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105560.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene yegQ CDS complement(3239647..3241452) product (7S,10S)-hydroperoxide diol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114856.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 3241800..3242852 product NADPH-dependent aldehyde reductase YahK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692764.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene yahK CDS 3243074..3243562 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967781.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 3243666..3245933 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967780.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 3245930..3247324 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(3247468..3248433) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097601.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 3248667..3249626 product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246890.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 3249802..3251949 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 3252283..3252927 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766154.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 3252957..3253466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 3253841..3254650 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250769.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(3254647..3256140) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729267.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(3256143..3257165) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 3257277..3258014 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 3258105..3260609 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764409.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 3260615..3261958 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531968.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 3261979..3263163 product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105351.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 3263179..3264525 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(3264630..3265856) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104023.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 3266129..3266824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 3266867..3268216 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267510.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(3268292..3269617) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103567.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(3269614..3270285) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(3270376..3270612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 3272463..3273143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 3273179..3274240 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 tRNA complement(3274347..3274422) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(3274484..3275044) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737927.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene pgsA CDS complement(3275077..3276900) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764425.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene uvrC CDS complement(3276903..3277379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 3277329..3277535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(3277817..3278182) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246451.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 3278265..3278498 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764430.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 3279204..3280283 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104335.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 3280367..3280648 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553340.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 3280828..3282696 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104337.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 3282697..3283761 product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104338.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 3283761..3284783 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993901.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 3284849..3286426 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400838.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 3286479..3287891 product sigma-54-dependent transcriptional regulator HbcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113503.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene hbcR CDS 3288131..3289522 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113502.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 3289533..3290294 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113501.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene bdhA CDS complement(3290426..3291589) product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044389985.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 3291722..3291997 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400836.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(3292052..3293698) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104341.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene pgm CDS complement(3293801..3296113) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268078.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(3296344..3297750) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400832.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS complement(3297847..3299349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268079.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(3299936..3300958) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104344.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 3301192..3302184 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347707.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 3302697..3303824 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303808.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(3304000..3305091) product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267490.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 3305151..3305486 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770289.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(3305540..3306694) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268657.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 3306939..3307265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(3307229..3308350) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079396.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(3308610..3308906) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767500.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(3308997..3309803) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463536.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 3310154..3311167 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104858.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 3311252..3311833 product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104860.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 3312063..3312461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267515.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 3312500..3312985 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246884.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 3313130..3313660 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114876.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 3313657..3314595 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114875.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 3314677..3317082 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814468.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 3317236..3318168 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261970.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 3318279..3319064 product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930607.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(3319158..3320489) product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104277.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(3320541..3322091) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463481.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(3322101..3323309) product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104275.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 3323598..3324512 product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764287.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene nac CDS 3324618..3325049 product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764289.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 3325079..3326431 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104273.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene accC CDS 3326428..3327099 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764295.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene pxpB CDS 3327096..3328067 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764297.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 3328078..3328503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764299.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 3328500..3329267 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104272.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 3329536..3330321 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104271.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 3330428..3331129 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104270.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 3331136..3331879 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104269.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 3331893..3332630 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379556.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 3332686..3333519 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379555.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 3333597..3333854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(3333951..3336212) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268890.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene katG CDS complement(3336527..3338950) product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046033636.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(3339376..3339558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 3339821..3340225 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524104.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 3340235..3341368 product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242132.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(3341420..3342736) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267805.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(3342920..3343180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(3343383..3343625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(3344288..3344539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(3345595..3346350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(3346352..3348154) product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974286.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 3349883..3352900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 tRNA complement(3353979..3354055) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(3354143..3354499) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408375.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(3354480..3354782) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene ihfA CDS complement(3354786..3357164) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267471.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene pheT CDS complement(3357201..3358217) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367019.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene pheS CDS complement(3358321..3358677) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553161.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene rplT CDS complement(3358706..3358900) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553160.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene rpmI CDS complement(3358961..3359494) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170846037.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene infC CDS complement(3359512..3361434) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267470.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene thrS CDS 3361795..3362103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765633.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 3362399..3362611 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315566.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(3362678..3362848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 3363285..3363479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080898792.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(3363491..3364516) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267466.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(3364542..3364946) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267465.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene rbsD CDS complement(3364943..3365863) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246357.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene rbsK CDS complement(3365888..3366910) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267463.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(3366912..3367895) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103970.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(3367892..3369445) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103969.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(3369499..3370455) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765644.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 3370730..3371017 product DUF1654 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416220.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 3371022..3371723 product endonuclease I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765647.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(3372039..3372287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(3372366..3373157) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346035.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene map CDS complement(3373154..3373396) product ParD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617470.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(3373476..3373664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(3373765..3374799) product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267458.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 3375019..3376044 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103965.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 3376309..3376692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765654.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(3376726..3376914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393013.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 3377132..3378943 product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765656.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(3379120..3380061) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765657.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(3380151..3381359) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(3381366..3381905) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617455.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene moaB CDS 3382048..3382584 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267454.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene mobA CDS 3382658..3382882 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315600.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(3383138..3384028) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103962.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 3384236..3385090 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765662.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(3385094..3385765) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246371.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(3385866..3387773) product bifunctional sugar phosphate isomerase/epimerase/4-hydroxyphenylpyruvate dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738807.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 3388382..3389710 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267450.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(3389806..3390690) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464003.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 3390935..3392191 product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267448.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(3392242..3392640) product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737978.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene pcaC CDS complement(3392637..3393998) product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765672.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(3394019..3395368) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267446.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(3395441..3396043) product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103958.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene pcaG CDS complement(3396056..3396775) product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366939.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene pcaH CDS complement(3396905..3397834) product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765677.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene pcaQ CDS complement(3397991..3398230) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(3398320..3399402) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103955.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 3399828..3400103 product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003373339.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 3400108..3400500 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003373338.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 3400497..3400838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103249.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 3400936..3402096 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579450.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 3402163..3403494 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408510.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 3403689..3404087 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408512.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(3404270..3404440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 3404421..3405047 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423744.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 3405056..3408700 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267442.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 3408764..3409108 product 50S ribosome-binding protein YggL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346101.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 3409415..3410884 product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408519.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene dacB CDS complement(3411081..3413477) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054090913.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(3413554..3415806) product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267439.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene rlmKL CDS 3416354..3416569 product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553055.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(3416694..3417719) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406732.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 3418086..3419315 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433036.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 3419306..3422032 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463439.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(3422104..3423144) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382460.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(3423252..3423842) product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406744.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene sigX CDS complement(3423929..3424753) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315687.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(3424756..3425004) product crfX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406745.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(3425081..3426076) product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382467.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(3426088..3426576) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267431.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene rraA CDS complement(3426674..3427663) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267430.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(3427848..3430223) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103934.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene ppsA CDS 3430413..3431231 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382474.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(3431355..3432539) product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267429.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene prpF CDS complement(3432737..3435325) product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267428.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene acnD CDS complement(3435394..3436521) product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267427.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene prpC CDS complement(3436722..3437615) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267426.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene prpB CDS complement(3437612..3438319) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267425.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 3438598..3439134 product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267424.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 3439139..3440677 product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765727.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 3440674..3441645 product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797774.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(3441689..3446461) product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103907.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(3446513..3447019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 3447308..3449710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 3449778..3453074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 note possible pseudo, internal stop codon, frameshifted CDS 3453144..3458072 product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267393.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(3458118..3459566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(3459655..3461664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267388.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(3462010..3464190) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103898.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 3464801..3466066 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765730.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene pabB CDS complement(3466230..3466847) product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765732.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene thrH CDS 3466999..3467733 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617365.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(3467812..3468786) product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382487.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene cysB CDS complement(3468932..3469432) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103929.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(3469523..3470428) product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617359.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(3470450..3471406) product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406773.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 3471689..3472765 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315709.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(3472829..3473110) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382493.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 3473723..3473974 product Lpp/OprI family alanine-zipper lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347084.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(3474094..3475059) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267417.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(3475156..3475437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315714.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(3475494..3476099) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440639.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 3476110..3476793 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 3476793..3479300 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267415.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(3479484..3479957) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316622.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene greB CDS complement(3480079..3481995) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105562.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 3481957..3482160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(3482469..3482777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267414.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(3483011..3483445) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765767.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(3483550..3484977) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267412.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 3485143..3485976 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103918.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 3486222..3487697 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267410.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 3487794..3488159 product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101677.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(3488166..3488963) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(3489076..3489837) product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103916.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(3489862..3491862) product DUF3488 and DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463435.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(3491859..3492815) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417868.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(3492812..3493729) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(3493917..3494195) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316607.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 3494335..3495387 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087542.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(3495531..3496220) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103914.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(3496276..3498930) product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267402.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(3498947..3499522) product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032609430.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene kdpC CDS complement(3499700..3501766) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103911.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene kdpB CDS complement(3501777..3503471) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267399.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene kdpA CDS 3503930..3504679 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244755.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 3504676..3505716 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765836.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 3505830..3506579 product XopAW family type III secretion system calcium-binding effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267385.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene xopAW CDS complement(3506621..3507673) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765838.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(3507720..3508538) product DUF4892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054081893.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(3508678..3509532) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765844.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(3509529..3510338) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103894.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(3510460..3510903) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406128.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(3510995..3511450) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769602.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene sixA CDS complement(3511447..3511791) product DUF4389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103893.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(3511817..3512842) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769608.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 3513148..3515046 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267381.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 3515272..3515787 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316569.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 gene fabA CDS 3515798..3517018 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769613.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 gene fabB CDS 3517118..3517861 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037844.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 note possible pseudo, internal stop codon CDS complement(3518038..3518766) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769615.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(3518849..3520756) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406139.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene htpG CDS 3521113..3521370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(3521480..3522793) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769618.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene brnQ CDS complement(3523307..3524191) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087428.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene sucD CDS complement(3524191..3525357) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552981.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene sucC CDS complement(3525566..3527002) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382001.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene lpdA CDS complement(3527172..3528398) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267377.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene odhB CDS complement(3528440..3531256) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769626.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(3531531..3532244) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316554.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(3532247..3534019) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394562.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene sdhA CDS complement(3534023..3534391) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382006.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene sdhD CDS complement(3534385..3534642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 3535124..3536413 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366698.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene gltA CDS complement(3536478..3537083) product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769634.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(3537169..3537360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(3537517..3537864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(3538267..3539706) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366691.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(3539925..3540740) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769641.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(3540737..3541090) product DUF4398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409835.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(3541101..3541931) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267373.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(3542036..3542965) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769647.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(3542966..3543715) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267372.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 3544235..3545890 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406170.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(3546029..3547447) product IS1182-like element ISPsy6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923171.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(3547546..3548451) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267371.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 3548629..3549681 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244776.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(3549752..3550561) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103889.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(3550627..3551937) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769658.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(3552031..3553179) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267367.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene dgoD CDS complement(3553228..3553848) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267366.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(3553850..3554746) product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103887.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 3555141..3556307 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532210.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(3556366..3557478) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552957.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene asd CDS complement(3557554..3558636) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769662.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene leuB CDS complement(3558706..3559470) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115017.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(3559542..3560183) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103886.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene leuD CDS complement(3560194..3561618) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406190.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene leuC CDS 3561768..3562637 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345646.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 3562771..3564918 product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267362.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(3564960..3565403) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316521.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(3565515..3566474) product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267361.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(3566504..3566962) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397383.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(3567016..3567555) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115025.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 tRNA complement(3567756..3567831) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(3567877..3567952) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(3568005..3568080) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(3568166..3568241) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(3568421..3569902) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738107.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene gltX CDS complement(3570215..3572230) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345654.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene uvrB CDS 3572586..3573782 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103882.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 3573973..3574389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 3574525..3575529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 3575709..3576833 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769683.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 3576834..3578801 product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267356.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 3578809..3580200 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463311.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(3580392..3582035) product twin-arginine translocation signal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103878.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 3582217..3583560 product pyoverdine-tailoring dipeptidase-like protein PvdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267353.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene pvdM CDS 3583603..3584883 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103877.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 3584924..3585784 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267351.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 3585977..3587641 product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103875.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(3587837..3588058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 3587949..3590387 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769699.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 3590665..3593016 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463309.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(3593103..3601730) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103873.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(3601732..3608187) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267346.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(3608202..3616016) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103871.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(3616013..3619426) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267344.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 3619793..3621865 product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114027.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 3621862..3625104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114029.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 3625101..3626345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120367.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 3626342..3627571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120367.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 3627568..3628788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120367.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(3628808..3629791) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103869.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 3630096..3631316 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267342.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 3631313..3631855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406929.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 3631852..3632190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406932.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 3632187..3632759 product DUF6162 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267341.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 3632795..3633724 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204647.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 3633721..3634482 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267339.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 3634482..3635381 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406943.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 3635382..3636299 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406946.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(3636365..3637309) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771258.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(3637618..3637845) product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770699.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(3637927..3639408) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770701.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(3639505..3652509) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103865.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(3652608..3653366) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122219211.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(3653363..3653590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 3653684..3654214 product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003319375.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(3654291..3654812) product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617103.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(3655023..3655544) product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406965.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 3655740..3656924 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267335.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 3656921..3657589 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617102.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 3657592..3659913 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464039.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 3659910..3660374 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382984.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(3660381..3660812) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770721.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(3661007..3661945) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267331.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene dusA CDS 3661969..3662178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 3662222..3663199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(3663552..3663707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 3663793..3664719 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771350.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene tal CDS complement(3664799..3665284) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315067.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(3665281..3666510) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407019.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 3666731..3667030 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407020.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(3667107..3667808) product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382959.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 3667998..3668603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407024.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 3668710..3668973 product DUF4404 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407026.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(3669199..3670029) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267308.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene queF CDS complement(3670156..3671400) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771340.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(3671464..3672162) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172452211.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene lolD CDS complement(3672155..3673405) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315078.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 3673508..3674092 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405698.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 3674153..3674875 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405702.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(3674918..3676312) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436620.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene sthA CDS complement(3676457..3677476) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426771.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(3677473..3682047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 3682338..3683630 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405709.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(3683691..3684956) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103851.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(3685052..3686500) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315085.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 3686731..3690183 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267304.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene mfd CDS 3690195..3690719 product CsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103849.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 3690787..3693522 product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103848.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(3693676..3694416) product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765040.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(3694426..3695436) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268330.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene nagZ CDS complement(3695526..3696242) product transcriptional regulator PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403692.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene psrA CDS 3696459..3697067 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554100.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene lexA CDS 3697077..3697547 product SulA-like leucine-rich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403697.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(3697559..3697822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315798.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(3697856..3698377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024638388.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(3698503..3701115) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268332.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene topA CDS complement(3701229..3701465) product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380890.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(3701597..3702772) product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268334.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene fadA CDS complement(3702795..3704942) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268335.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene fadB CDS complement(3705514..3705825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 3706207..3706647 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268338.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(3706763..3708673) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268339.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 3708880..3710808 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104597.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(3710863..3711672) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104598.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(3711755..3712687) product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378076.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 3713181..3713591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765087.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 3713928..3714752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 3714749..3715408 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765089.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(3715392..3716309) product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765091.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene yegS CDS 3716791..3718227 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403725.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 3718227..3719681 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268344.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 3719969..3720745 product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403729.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 3720762..3722753 product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104600.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 3722753..3723931 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104601.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 3723933..3725252 product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104602.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 3725255..3726478 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403736.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 3726462..3727562 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765101.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 3727562..3728977 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268349.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 3728974..3729795 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268350.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 3729807..3731222 product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765108.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(3731677..3733317) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104616.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(3733490..3734425) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268357.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(3734568..3735668) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765125.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 3735862..3736482 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765127.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(3736466..3737143) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540175.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 3737255..3738235 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529113.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(3738429..3739733) product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765129.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene fahA CDS complement(3739733..3741037) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104606.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene hmgA CDS 3741167..3741943 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268362.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(3742043..3743119) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010438666.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene hppD CDS complement(3743265..3743930) product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765137.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene maiA CDS complement(3744015..3744782) product transcriptional regulator GlcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115387.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene glcC CDS 3744924..3746504 product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene glcD CDS 3746504..3747565 product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104608.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene glcE CDS 3747568..3748800 product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268367.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene glcF CDS 3748821..3749228 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765145.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 3749441..3751618 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765147.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(3751798..3752814) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765154.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 3753074..3753565 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024638672.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 3753690..3755042 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765159.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 3755645..3755833 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554157.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene csrA CDS 3756082..3756732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 3756732..3757145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 3757142..3757948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(3758010..3758246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(3758308..3759744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104612.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(3760383..3760664) product DUF1652 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765163.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(3761131..3761613) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765165.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 3761902..3762792 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417992.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(3762833..3763411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(3763422..3764030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(3764337..3764864) product DUF3237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403786.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 3765156..3765587 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268377.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(3765612..3766454) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010206379.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(3766632..3767447) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245058.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(3767458..3768249) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103737.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(3768326..3769420) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315813.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 3769589..3770164 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104282.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(3770161..3770898) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268379.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 3771289..3772767 product catalase KatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463487.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene katB CDS 3772821..3773354 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104619.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(3773502..3775145) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104672.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(3775313..3777412) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237227.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(3777614..3777844) product DUF6434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268383.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 3777789..3777995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 3778196..3778975 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263858.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 3780011..3781096 product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086613793.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(3781280..3781627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 3781874..3783976 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(3784230..3784706) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096727.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(3784977..3785522) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(3785894..3786076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 3786681..3787052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(3787229..3787597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737305.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(3787902..3788399) product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815953.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(3788492..3790906) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268707.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(3790994..3791926) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113764.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(3791926..3792432) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092999.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(3792610..3793101) product DUF2269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245243.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(3793105..3794232) product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104670.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(3795149..3796024) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403808.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS 3796124..3796615 product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403809.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 3796693..3797526 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104622.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(3797533..3798684) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619360.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 3798920..3799804 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268385.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene rarD CDS complement(3799817..3800932) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765211.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene zapE CDS 3801107..3802552 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765213.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 3802656..3803819 product class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268387.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene ampC CDS 3804102..3804950 product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765220.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 3804959..3806167 product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268391.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene efeO CDS 3806190..3807500 product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765224.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene efeB CDS 3807530..3808354 product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370329.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene efeO CDS complement(3808446..3809216) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245290.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(3809209..3809832) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268393.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(3810038..3810643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378210.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 3810845..3811540 product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554192.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 3811513..3812904 product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104627.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(3812901..3813569) product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268396.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(3814097..3815443) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102481.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 3815652..3817049 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120048.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 3817216..3817629 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104633.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS 3817626..3819713 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407383.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 3819710..3819919 product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378219.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 3819916..3820800 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104635.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 3820797..3822239 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268398.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 3822833..3824248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 3824323..3826308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 3826416..3827249 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619395.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 3827352..3828350 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104637.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 3828761..3828973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397550.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(3829212..3829613) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104638.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(3829624..3830811) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268399.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene ccmI CDS complement(3830808..3831278) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268400.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(3831275..3831811) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765251.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(3831808..3833781) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268402.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(3833785..3834252) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268403.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene ccmE CDS complement(3834249..3834425) product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765257.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene ccmD CDS complement(3834422..3835216) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765259.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(3835289..3835960) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268405.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene ccmB CDS complement(3835957..3836598) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895571.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 gene ccmA CDS 3836788..3838368 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268407.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS 3838368..3838688 product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383046.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(3838801..3839205) product DUF2802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412376.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(3839206..3839685) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370201.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(3839743..3840615) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244357.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(3840718..3841506) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766970.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS complement(3841553..3842440) product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103791.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene motD CDS complement(3842447..3843187) product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436124.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS complement(3843187..3844341) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268432.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS complement(3844393..3846675) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268433.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(3846709..3847494) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766975.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(3847514..3847900) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244361.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(3848146..3848865) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378731.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene fliA CDS complement(3848883..3849716) product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412391.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene fleN CDS complement(3849832..3851163) product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766980.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene flhF CDS complement(3851175..3853304) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412395.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene flhA CDS complement(3853636..3854772) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766982.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene flhB CDS complement(3854774..3855559) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268436.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene fliR CDS complement(3855566..3855835) product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554277.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(3855861..3856613) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316820.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene fliP CDS complement(3856613..3857059) product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343990.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene fliO CDS complement(3857060..3857521) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316817.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene fliN CDS complement(3857583..3858551) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422170.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene fliM CDS complement(3858561..3859061) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244365.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene fliL CDS complement(3859311..3860654) product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268437.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(3860740..3861102) product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268438.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(3861137..3862843) product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103785.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS complement(3862849..3863154) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408073.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(3863210..3863659) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554288.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene fliJ CDS complement(3863666..3865024) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268440.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene fliI CDS complement(3865014..3865820) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767003.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene fliH CDS complement(3865836..3866852) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890098.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 gene fliG CDS complement(3866845..3868641) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244370.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene fliF CDS complement(3868657..3868938) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344011.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene fliE CDS complement(3869226..3870632) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103783.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(3870632..3871846) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390087.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(3871969..3873444) product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382141.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene fleQ CDS complement(3873622..3873918) product flagellar protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554297.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene fliT CDS complement(3873945..3874331) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268446.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene fliS CDS complement(3874449..3875900) product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103781.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene fliD CDS complement(3875983..3876363) product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767009.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(3876435..3877283) product flagellin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767010.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(3877616..3878542) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316797.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(3878823..3881723) product TIGR00180 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767013.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(3881851..3885429) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268452.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(3885518..3887110) product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103779.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(3887124..3889187) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767017.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene flgK CDS complement(3889198..3890424) product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268455.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene flgJ CDS complement(3890435..3891544) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268456.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(3891558..3892337) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268457.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 gene flgH CDS complement(3892345..3893133) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412455.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 gene flgG CDS complement(3893180..3893920) product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316785.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 3894201..3894392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(3894630..3895967) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767033.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene flgE CDS complement(3895996..3896676) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404333.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene flgD CDS complement(3896692..3897132) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554316.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene flgC CDS complement(3897136..3897543) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370068.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 gene flgB CDS complement(3897773..3899053) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112807.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(3899046..3900425) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103137.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(3900514..3901728) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112805.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(3901721..3902476) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112804.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(3903524..3904384) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382687.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene cheR CDS complement(3904399..3905331) product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771567.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 3905471..3906169 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032608868.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene flgA CDS 3906281..3906649 product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404324.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene flgM CDS 3906700..3907167 product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404322.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 3907250..3907996 product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771573.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(3908089..3909459) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268463.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(3909514..3910857) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797788.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 3911138..3912253 product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244389.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene vioA CDS 3912256..3912981 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771583.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 3913055..3916576 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103771.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(3916811..3917830) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024667998.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(3917836..3918471) product dTDP-4-amino-4,6-dideoxy-D-glucose acetyltransferase VioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382700.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene vioB CDS complement(3918474..3919235) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(3919439..3919645) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382703.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(3919874..3920566) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268467.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(3920563..3922164) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268468.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(3922444..3923115) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244400.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 3923450..3924823 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024682821.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene ppnN CDS complement(3924860..3925729) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244403.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 3925881..3927065 product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268471.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene pobA CDS 3927323..3928651 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103763.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 3929427..3930305 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene dapA CDS 3930321..3931490 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870021.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 3931487..3932746 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392247.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 3932739..3933761 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene pdxA CDS 3933829..3935244 product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096620.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 3935231..3936355 product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096621.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(3936410..3936718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 3936602..3937087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 3937124..3937900 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224211.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(3937901..3938893) product GguC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267192.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene gguC CDS complement(3938906..3940222) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769128.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 3940379..3942121 product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318618.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 3942221..3942937 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554489.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(3943128..3945521) product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104717.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(3945549..3946589) product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104718.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(3946871..3948028) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406507.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(3948041..3948781) product DUF1190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267181.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(3948809..3949234) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382929.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(3949248..3949901) product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104723.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(3949898..3950923) product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769107.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(3951010..3951717) product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104724.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(3951744..3952397) product YjfI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769102.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(3952749..3955409) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104725.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene pepN CDS complement(3955420..3956256) product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010208878.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(3956253..3956540) product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382943.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(3956543..3957415) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463338.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(3957412..3958383) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406489.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(3958383..3959273) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382947.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 3959465..3960448 product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267174.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(3960449..3961657) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769084.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(3961818..3963152) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267168.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(3963257..3964165) product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267167.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(3964366..3966402) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104734.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 3966604..3967749 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267165.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS 3967752..3968873 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769073.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 3969298..3970821 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082100891.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene ilvA CDS complement(3970934..3971698) product DUF2242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267162.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(3971849..3972751) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810537.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS 3972858..3973736 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267516.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 tRNA complement(3973870..3973946) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(3974069..3974145) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(3974201..3974276) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(3974455..3975537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(3975964..3976728) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161633151.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(3976740..3977951) product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(3977971..3979479) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347797.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene purF CDS complement(3979492..3980079) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318487.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(3980166..3980861) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267160.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(3980845..3982152) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267159.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene folC CDS complement(3982149..3983069) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318491.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene accD CDS complement(3983309..3983929) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS complement(3983990..3984844) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368434.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene truA CDS complement(3984969..3987827) product FimV/HubP family polar landmark protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104738.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(3987936..3988946) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104739.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(3989030..3989590) product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408288.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(3989600..3990202) product DUF4823 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770603.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 3990240..3990431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(3990444..3991097) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770607.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS complement(3991219..3991869) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104741.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(3992224..3992826) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104742.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 3992710..3993039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(3993027..3993383) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409617.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(3993417..3994403) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267154.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(3994396..3995028) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770616.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene tmk CDS complement(3995048..3996175) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770618.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene mltG CDS complement(3996179..3996994) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene pabC CDS complement(3996994..3998238) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390862.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene fabF CDS complement(3998348..3998584) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381096.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene acpP CDS complement(3998776..3999519) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318510.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene fabG CDS complement(3999535..4000419) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245842.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene fabD CDS complement(4000591..4001613) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054091481.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene plsX CDS complement(4001618..4001800) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552688.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene rpmF CDS complement(4001813..4002340) product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS 4002447..4003025 product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024661285.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(4003243..4004244) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267147.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene sppA CDS complement(4004270..4004932) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408320.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(4004922..4005878) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619727.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene rluC CDS 4006601..4009765 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419707.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene rne CDS complement(4009841..4010860) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770641.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene murB CDS complement(4010895..4011653) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317470.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene kdsB CDS complement(4011656..4011841) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381112.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(4011859..4012854) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267144.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene lpxK CDS complement(4012854..4013285) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770645.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(4013282..4013956) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(4014038..4016254) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267142.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(4016521..4017309) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421319.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(4017306..4018250) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267141.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(4018402..4019025) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267140.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 4019185..4021632 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104757.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 4021708..4022118 product PA2817 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267138.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(4022398..4024620) product FimV/HubP family polar landmark protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268620.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(4024661..4025095) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363288.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS complement(4025187..4027316) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402551.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene recQ CDS 4027494..4028081 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268621.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 4028092..4028493 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103644.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(4028497..4031079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS 4031499..4032854 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 4033010..4035166 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS 4035178..4036518 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 4036845..4037297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 4037456..4037899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 4038118..4039323 product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533246.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 4039329..4040003 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533247.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(4040467..4041729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(4041891..4042511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(4042519..4043412) product glycine zipper family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936261.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(4043409..4043939) product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413692.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 4044121..4044477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112487.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(4044650..4045009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112487.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(4045024..4045650) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268091.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 4045762..4046967 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766116.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS 4047111..4047581 product aegerolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101225.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(4047799..4048155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112487.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(4048140..4048922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(4048933..4049478) product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105093.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(4049671..4050009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103252.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 4050132..4050407 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103251.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 4050960..4052084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261676.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 4052154..4052633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 4052921..4053343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(4053743..4054609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(4054648..4054821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(4054919..4056415) product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268623.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene pap CDS complement(4056555..4057136) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269425.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS 4057396..4058619 product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767816.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 4058638..4058862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(4059013..4059744) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406417.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 4060117..4061568 product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268495.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 4061676..4063658 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268624.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene mnmC CDS 4063892..4064560 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103641.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 4064562..4067042 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268626.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS 4067032..4068108 product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402542.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS 4068328..4069260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 note possible pseudo, frameshifted CDS 4069293..4069577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 note possible pseudo, frameshifted CDS 4069502..4070098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 note possible pseudo, frameshifted CDS 4070102..4071487 product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767614.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene ngg note possible pseudo, frameshifted CDS 4071505..4071714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 note possible pseudo, frameshifted CDS 4072058..4073074 product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767612.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 note possible pseudo, frameshifted CDS 4073328..4073555 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004879420.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(4073552..4073755) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402536.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene csrA CDS complement(4073923..4074255) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393231.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(4074347..4074637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 note possible pseudo, frameshifted CDS complement(4074519..4075163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33590 note possible pseudo, frameshifted CDS complement(4075257..4075634) product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420339.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 4075945..4076103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(4076174..4077832) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202721.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(4077829..4078140) product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314526.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(4078352..4079206) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268630.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS 4080377..4081675 product serine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245694.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS 4081668..4082480 product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402525.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 4082604..4083413 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266520.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(4083568..4085715) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103249.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(4086450..4086809) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS 4087101..4087955 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(4088133..4089317) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245819.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(4089351..4090283) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245818.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 4090405..4091145 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368369.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene minC CDS 4091376..4092188 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091579.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene minD CDS 4092189..4092449 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552653.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene minE CDS complement(4092369..4092557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS 4092541..4093176 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770474.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS 4093287..4094576 product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267127.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS 4094843..4095175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS 4095317..4095658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(4095682..4096503) product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104765.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 4096854..4097921 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104766.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 4098013..4098819 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267123.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 4098816..4099658 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770467.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 4099645..4100442 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770465.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS 4100444..4101433 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267122.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS 4101572..4102225 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382736.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS 4102394..4107451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS 4107524..4109134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS 4109177..4110760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 4110830..4112674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS complement(4112715..4114964) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103898.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(4115272..4117290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(4117416..4118720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(4118853..4119815) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739770.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS 4120125..4121969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS 4122359..4124473 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104769.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 4124590..4126362 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(4126527..4126892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430937.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(4126889..4127230) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267116.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(4127332..4127784) product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770452.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(4128142..4128891) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346532.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(4129051..4130457) product DUF4329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267115.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(4130552..4130986) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764401.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(4131011..4132594) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764404.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(4132617..4133564) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268064.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(4133594..4134379) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268065.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(4134372..4135424) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104330.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(4135421..4137826) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268067.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 tRNA complement(4138579..4138655) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(4138677..4138752) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 4138914..4139834 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770437.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene rdgC CDS 4139916..4140881 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770435.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(4140927..4142801) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770433.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(4142927..4143925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS 4145007..4148480 product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770431.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(4148658..4150367) product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112397.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 gene aceK CDS 4150577..4152202 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269183.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(4152356..4153294) product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383332.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(4153412..4154386) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245803.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene cysK CDS 4154564..4155583 product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104774.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 4155740..4156585 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407249.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 4156625..4157803 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245801.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS 4157990..4158709 product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267107.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(4158903..4159427) product DUF2937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104777.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(4159456..4160241) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619831.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(4160294..4160764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770416.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 4160906..4162954 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104778.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS 4163030..4163506 product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267105.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS 4163575..4163946 product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552611.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 4164067..4165821 product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267104.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 4165832..4166704 product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174518718.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 4166826..4167245 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317406.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS 4167323..4167700 product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104782.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(4167706..4168155) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407229.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 4168371..4168964 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267101.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(4169097..4170029) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267100.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS complement(4170137..4170430) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379038.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(4170427..4171560) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267099.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene rnd CDS complement(4171744..4173393) product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236756.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS complement(4173637..4175328) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317398.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 4175613..4176260 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529016.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(4176316..4176783) product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770393.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(4176933..4177787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34420 tRNA complement(4178832..4178924) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(4179272..4179361) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(4179454..4180164) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379028.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS complement(4180193..4180951) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267088.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS complement(4180952..4182067) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245782.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene bamC CDS complement(4182086..4182964) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379025.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene dapA CDS 4183291..4183854 product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379024.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 4183864..4184337 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104801.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS complement(4184383..4185453) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267087.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS complement(4185487..4185738) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317380.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 4185887..4187320 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409438.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS complement(4187507..4188565) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267086.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene nadA CDS complement(4188718..4189938) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314721.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene rluB CDS complement(4190124..4190315) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314720.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS complement(4190368..4191132) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404130.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 gene scpB CDS complement(4191148..4191966) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404131.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(4191966..4192595) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268524.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(4192609..4193472) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767709.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS 4193501..4194139 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210436297.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 4194141..4194440 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767703.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS 4194578..4194991 product translation initiation factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767701.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS 4194999..4195676 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396544.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 4195818..4196279 product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767699.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS 4196358..4197698 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103711.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS complement(4197732..4198292) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767695.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 4198455..4199909 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268527.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 4199952..4200278 product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767692.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(4200285..4201106) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268528.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(4201206..4201508) product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268529.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS 4201916..4202797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 4202790..4206173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923175.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 4206350..4206880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104066.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 4207649..4208095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS 4208276..4209364 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103708.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(4209425..4210330) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767686.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS 4210560..4211168 product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103707.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 4211165..4212748 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268535.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 4213123..4214475 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103996.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS 4214472..4215650 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766812.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS 4216158..4217249 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770011.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS 4217283..4217648 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553206.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS 4217653..4217970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS 4217974..4220046 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266629.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 4220074..4221702 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037458.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS 4221718..4222236 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403299.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS 4222256..4223050 product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770000.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS 4223041..4223559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS 4223556..4224611 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437834.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 4224768..4225430 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765089.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(4225433..4227703) product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268538.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(4227765..4228739) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236235.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(4228917..4229810) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245106.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS 4229961..4230983 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103700.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 4231250..4231696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 4231795..4234569 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210267578.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(4234549..4236018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS complement(4237656..4237943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS complement(4237921..4238169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS complement(4238291..4239241) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090405.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS 4239445..4240167 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766806.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 tRNA complement(4240283..4240358) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(4240361..4240436) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(4240541..4240616) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(4240621..4240696) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS 4240994..4241740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032621400.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(4241792..4242274) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268542.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(4242271..4243161) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268543.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 4243294..4245609 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766801.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(4245602..4246087) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397843.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(4246251..4246646) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766799.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene msrB CDS 4246838..4248049 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004657364.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS 4248290..4249177 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397849.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 gene htpX CDS 4249348..4250115 product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268548.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(4250188..4251858) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245115.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(4252309..4253070) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404195.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 4253232..4254578 product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766790.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(4254733..4255935) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114757.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS complement(4256001..4256732) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268552.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 4256940..4257413 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268553.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 4257657..4258076 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766782.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS 4258100..4259119 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103700.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(4259187..4259756) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003373297.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(4259856..4260989) product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766776.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 gene earP CDS 4261107..4261493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766774.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS 4261497..4261979 product elongation factor GreAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404212.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS 4262090..4262296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554553.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 4262552..4263091 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095346.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(4263173..4264450) product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268556.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(4264656..4266146) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815196.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS 4266402..4266938 product pyoverdine signaling pathway sigma factor PvdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113068.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 gene pvdS CDS 4267163..4267729 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766763.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(4267818..4268150) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766760.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(4268325..4270328) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103697.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(4270431..4271357) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103696.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(4271639..4273000) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766752.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(4273491..4273733) product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404230.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(4273758..4274054) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554561.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene ihfB CDS complement(4274376..4276061) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554562.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 gene rpsA CDS complement(4276184..4276873) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616463.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene cmk CDS complement(4276870..4278855) product bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207213.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 4278742..4279092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS complement(4279207..4280301) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 gene pheA CDS complement(4280301..4281386) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393775.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 gene serC CDS complement(4281522..4284302) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091448.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 gene gyrA CDS complement(4284538..4285614) product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766742.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 gene mtnA CDS 4285738..4287066 product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268564.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS 4287136..4287834 product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766737.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS 4287838..4288509 product N-acetylmuramic acid 6-phosphate phosphatase MupP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268565.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene mupP CDS 4288539..4289279 product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS 4289495..4290421 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766730.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(4290516..4291301) product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268568.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(4291298..4293796) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268569.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS complement(4293938..4295755) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268570.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS complement(4295748..4296380) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103690.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(4296384..4297337) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766720.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS complement(4297483..4297776) product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404250.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS complement(4297792..4298319) product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314637.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS 4298500..4299894 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766716.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 4299887..4300498 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268572.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(4300508..4301464) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766711.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(4301745..4302341) product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268574.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 4302505..4302765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268575.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS complement(4303173..4304651) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024699212.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS 4305244..4305435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 4305555..4305782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378914.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS 4306045..4306563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082640.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS 4306676..4307959 product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054987912.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS complement(4308048..4308599) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314628.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS complement(4308779..4309987) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268578.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS complement(4310288..4311028) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103682.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(4311030..4311602) product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404266.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS complement(4311599..4312651) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268579.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 gene cobT CDS complement(4312648..4313169) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766684.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 gene cobU CDS complement(4313171..4314631) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766682.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS complement(4314628..4315629) product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103681.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 gene cobD CDS complement(4315622..4316545) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103680.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 gene cbiB CDS complement(4316527..4317177) product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404272.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene bluB CDS complement(4317174..4318469) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766673.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(4318480..4319091) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766671.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene cobO CDS 4319510..4320829 product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766669.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS complement(4320904..4321452) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369637.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS complement(4321537..4322061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS complement(4322290..4323054) product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766661.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS complement(4323048..4323752) product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381589.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene hda CDS complement(4323958..4325007) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS complement(4325081..4326157) product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268587.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 4326484..4327542 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381585.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 gene purM CDS 4327542..4328192 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766657.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 gene purN CDS 4328201..4328914 product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369623.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS 4329248..4329427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554613.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(4329486..4330025) product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616372.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(4330056..4330889) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268591.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene mazG CDS complement(4330986..4333226) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247360.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 gene relA CDS complement(4333385..4334740) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103674.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene rlmD CDS complement(4334740..4335708) product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554618.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene cysM CDS 4335885..4338638 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103673.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 4338809..4339810 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112591.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 4339837..4340274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407729.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 4340271..4340675 product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407731.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS complement(4340748..4341215) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739010.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS 4341103..4341315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS 4341334..4341687 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314592.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 gene arsC CDS 4341684..4342289 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363251.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene wrbA CDS 4342282..4342698 product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086072.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS 4342843..4343514 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314590.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS complement(4343522..4344346) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268597.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene ttcA CDS 4344574..4345173 product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 4345296..4345790 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268598.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(4345861..4347204) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766635.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(4347649..4348992) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268599.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(4348989..4349666) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381559.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(4349677..4350027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407754.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS 4350200..4350988 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766631.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS 4351200..4351856 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907615.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(4351858..4352544) product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268602.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 gene fhuF CDS complement(4352541..4354151) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463925.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(4354155..4354892) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766623.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 4355575..4358487 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766620.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS complement(4358721..4359599) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767508.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS 4359699..4360868 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767507.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 4360962..4362269 product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104856.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 gene dctA CDS complement(4362416..4363006) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767504.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 4363107..4363865 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245738.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 4364561..4365808 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393710.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(4365978..4366193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS complement(4366718..4368319) product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112428.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS complement(4368316..4369833) product amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315104.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS complement(4369988..4370785) product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS complement(4370818..4371855) product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827578.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS complement(4371852..4372712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS complement(4372798..4373757) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082966.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 gene speB CDS 4373948..4374838 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082969.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS 4375377..4376330 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693270.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS 4376568..4377374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(4377652..4378914) product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268608.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(4378911..4380464) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103652.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS 4380817..4381389 product Bro-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103651.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 4381563..4382045 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354621.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 4382050..4382760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(4383957..4385522) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268619.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 4386382..4386969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402523.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS complement(4387050..4387955) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103634.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 4388058..4389272 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402522.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 4389598..4390674 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103632.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(4390693..4391412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402519.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(4391680..4391928) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797814.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS complement(4392394..4392834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS complement(4393113..4394426) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402517.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS complement(4394626..4396797) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103628.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 4397061..4397366 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402515.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS complement(4397434..4398606) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103627.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(4398657..4398971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103626.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS complement(4399270..4400439) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268637.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS complement(4400429..4401250) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268638.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS complement(4401333..4401758) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393272.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS complement(4401806..4402312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103623.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS 4402442..4402888 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103697259.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(4402890..4403429) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245711.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 gene def CDS complement(4403476..4404438) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268643.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(4404623..4404814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 4405035..4405415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363371.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS complement(4405421..4405822) product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268644.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(4405837..4406673) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268646.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 4406980..4407159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109112.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 4407324..4407827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363378.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS 4407972..4408700 product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268648.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 4408809..4409693 product DUF6279 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425465.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(4409681..4410070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091614.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(4410257..4411621) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245717.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(4411979..4412854) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764980.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(4413045..4413644) product FMN-dependent NADH-azoreductase AzoR3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114814.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 gene azoR3 CDS complement(4413784..4414098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764975.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS 4414163..4415086 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402385.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 4415102..4415890 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS 4416008..4416577 product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764969.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 4416686..4418518 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268676.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS complement(4418661..4419782) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247022.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 4420054..4421319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(4421439..4422560) product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS complement(4422881..4426792) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268680.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 gene hrpA CDS complement(4427088..4428779) product long-chain-fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268682.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene fadD1 CDS 4429089..4430171 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 4430212..4430682 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740134.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(4431076..4431234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268687.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS complement(4431316..4431654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268688.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS complement(4431542..4431871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 4431870..4434716 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764946.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene rapA CDS complement(4434850..4435779) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268857.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS 4435892..4436074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS complement(4436167..4437504) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764944.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS 4437826..4440138 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463431.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS complement(4440195..4440500) product DUF2288 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268691.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 4440833..4441960 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268692.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS 4442224..4443153 product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086391.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene livH CDS 4443150..4444406 product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268694.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS 4444403..4445170 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381484.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 gene livG CDS 4445171..4445872 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393371.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS 4446079..4446771 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268696.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 4446868..4448475 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402342.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS complement(4448622..4449716) product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112514.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS 4449969..4451141 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220711.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 gene nhaA CDS complement(4451197..4451661) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314430.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS complement(4451990..4452637) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268697.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene pdxH CDS complement(4452716..4453789) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268698.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(4453947..4455095) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764919.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS complement(4455186..4457330) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764917.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 gene dinG CDS 4457438..4457902 product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619982.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(4457971..4458729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381499.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(4458722..4458997) product DUF1145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764909.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(4459122..4460069) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(4460097..4461194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS complement(4461194..4462375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(4462372..4463583) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444960.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS complement(4463598..4464188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 4464123..4464344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS complement(4464510..4465187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS 4465917..4466414 product DUF6231 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381502.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 4466517..4466891 product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268706.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS complement(4466975..4467493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764901.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 4467595..4468092 product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764898.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS complement(4468243..4468509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 4468606..4469250 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112525.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 4469429..4471906 product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104884.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS 4472205..4472987 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381525.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 4473071..4473799 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363567.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 4473796..4474506 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764880.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 4474522..4475640 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764877.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 4475650..4476414 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246637.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(4476461..4476673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS complement(4476788..4477354) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554836.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene dcd CDS 4477670..4477879 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554837.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS complement(4478069..4479163) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268717.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene apbC CDS 4479324..4481366 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764864.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 gene metG CDS 4481490..4482068 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302262.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 gene rsxA CDS 4482065..4483072 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268719.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 gene rsxB CDS 4483059..4484039 product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092045.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 4484051..4484590 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene rsxG CDS 4484599..4485156 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289628.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 4485153..4485791 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739136.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 gene nth CDS 4485898..4486080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268720.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(4486191..4486817) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554843.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 4488212..4488649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764857.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS complement(4488942..4490159) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363593.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS complement(4490289..4491197) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764856.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS 4491411..4492391 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764852.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 gene pyrC CDS 4492388..4493065 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412908.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 gene rnt CDS 4493233..4493451 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003350768.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 4493653..4494123 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554851.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 gene bfr CDS complement(4494202..4494528) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268724.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 gene grxD CDS complement(4494616..4496724) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268725.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS complement(4496844..4497137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246626.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 4497552..4498472 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104892.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene argF CDS 4498469..4499542 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390643.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS complement(4499593..4500081) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764836.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 gene ybaK CDS 4500413..4501264 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396504.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS 4501293..4502798 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405430.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 gene glpK CDS 4502891..4503646 product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011169330.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS 4503921..4505447 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405428.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 gene glpD CDS 4505776..4506690 product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004664079.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS 4506883..4507629 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268727.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS 4507629..4508294 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246619.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 4508291..4509025 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104895.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 4509094..4510989 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246618.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 4510986..4512326 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268730.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 4512346..4512684 product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119370.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS complement(4512806..4513471) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105452.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 4513724..4514956 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105453.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS 4514977..4515735 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266440.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 4515744..4517348 product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266442.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS 4517345..4519084 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266443.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 4519234..4520475 product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113624.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS 4520660..4522543 product methyl-accepting chemotaxis protein PctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148125.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene pctA CDS complement(4522849..4523403) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 note possible pseudo, internal stop codon CDS complement(4523411..4524403) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268732.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(4524530..4526839) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764814.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene metE CDS 4526946..4527863 product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405405.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene metR CDS complement(4528037..4528444) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764810.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS complement(4528441..4529532) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764809.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 gene ddlA CDS complement(4529688..4529966) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764807.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS 4530288..4530653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 4530780..4530977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS 4531135..4532748 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 4532911..4534047 product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268737.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS complement(4534108..4534866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463415.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 4535341..4536027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104902.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 4536186..4536872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104902.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS 4537031..4537717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104902.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(4537776..4538678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463415.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(4538804..4538983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS 4539102..4542089 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420345.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS 4542170..4542757 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405381.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS 4542754..4543524 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268742.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(4543554..4544216) product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764790.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS complement(4544255..4544482) product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187599223.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS 4544727..4546766 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS 4547113..4549533 product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268745.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(4549604..4550134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770446.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(4550641..4551063) product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS complement(4551063..4551866) product DUF3034 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764776.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS complement(4551929..4554283) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764775.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS complement(4554283..4554954) product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104910.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 4555214..4557631 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405352.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene lon CDS complement(4557681..4559678) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404223.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(4559829..4560797) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103695.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS complement(4560794..4561993) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(4562065..4563195) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734455.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene wecB CDS complement(4563219..4564337) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261048.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(4564340..4565374) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261047.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS 4566121..4566513 product protease inhibitor I42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764773.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS 4566614..4567357 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764772.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 gene cmoA CDS 4567354..4568313 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764771.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 gene cmoB CDS complement(4568366..4569106) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764769.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 gene pdxJ CDS complement(4569157..4569840) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405347.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 gene recO CDS complement(4569906..4570808) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363707.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 gene era CDS complement(4570801..4571478) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554906.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 gene rnc CDS complement(4571487..4571864) product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405344.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS complement(4571981..4572835) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363711.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 gene lepB CDS complement(4572845..4574641) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413009.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 gene lepA CDS complement(4574813..4576240) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363717.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(4576548..4577426) product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268755.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(4577513..4578103) product anti sigma-E factor RseA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246812.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(4578136..4578717) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554912.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 gene rpoE CDS 4579304..4580920 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405338.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 gene nadB CDS complement(4580889..4581353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104913.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(4581337..4581591) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378499.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS 4581728..4582675 product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032622187.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS 4582786..4583607 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764752.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(4583601..4584986) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268758.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(4584979..4585650) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739198.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 4586089..4587069 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170846027.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 4587135..4587593 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268760.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS 4587595..4589109 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405319.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS 4589102..4590127 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764742.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(4590213..4590902) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378513.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 gene ung CDS 4591026..4592135 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(4592357..4592782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 4593344..4594417 product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268762.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 4594445..4595260 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS 4595257..4596021 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246818.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS 4596036..4596761 product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764729.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 4596774..4597388 product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405298.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS 4597503..4601111 product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104917.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 gene uca CDS 4601148..4602962 product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104918.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 gene atzF CDS 4603044..4606373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104919.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS 4606437..4607957 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS 4607954..4608184 product cysteine-rich CWC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268768.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(4608118..4608342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS 4608364..4608918 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268769.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 4609225..4610106 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268770.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 tRNA 4610265..4610338 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 4610576..4611931 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985735.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS complement(4612336..4612596) product DUF6429 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105375144.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS complement(4612745..4612906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(4612927..4614282) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551357.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS 4614288..4615262 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395766.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS complement(4615331..4615885) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105173.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS complement(4616108..4616233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315538.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS 4616412..4617473 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267673.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS complement(4617586..4618650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS complement(4618737..4620137) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237212.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS complement(4620366..4620689) product DUF2025 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082265.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS complement(4620700..4621848) product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104943.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene yiaY CDS 4622086..4622985 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186089.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS complement(4622978..4624195) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS complement(4624396..4625013) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381663.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS complement(4625027..4625740) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032609151.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS 4625998..4628304 product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246181.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene bglX CDS 4628382..4630151 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246182.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS 4630145..4631467 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268780.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS 4631678..4633372 product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104950.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS 4633378..4634982 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768708.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS 4635166..4636494 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395916.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 4636850..4637203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768704.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS 4637311..4637934 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406312.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS complement(4637935..4638174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406313.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS 4638339..4638509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS 4638650..4640098 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406314.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(4640102..4641232) product DUF3396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104953.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS complement(4641702..4642334) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768695.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS 4642572..4643732 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406318.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS 4643736..4646870 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268787.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 4646867..4648327 product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768689.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS complement(4648386..4649690) product MFS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268789.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(4649847..4651046) product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172679551.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 gene pcaF CDS complement(4651046..4651825) product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246196.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS complement(4651825..4652682) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406329.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS complement(4652834..4653676) product pca regulon transcriptional regulator PcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363842.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 gene pcaR CDS 4654472..4654669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554967.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 4654880..4656352 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363847.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(4656398..4657876) product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114975.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(4657988..4658164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768677.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS complement(4658234..4659085) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363851.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 gene purU CDS 4659434..4659811 product DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554971.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(4659891..4661327) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268791.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 gene sbcB CDS 4661456..4662181 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268792.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS 4662178..4663158 product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS 4663145..4664734 product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268794.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS 4664731..4665960 product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268795.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 4666116..4667303 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113387.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 gene hmpA CDS 4667365..4668486 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114723.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 gene nmoA CDS 4668599..4669699 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268796.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS 4669726..4671039 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104968.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(4671050..4671331) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768657.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS complement(4671609..4671983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463668.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS 4672162..4673613 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363893.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 gene pyk CDS 4673812..4675107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS 4675462..4676733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS complement(4676861..4677799) product iron-sulfur-binding ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246206.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 4677986..4679509 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268799.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS complement(4679635..4679865) product DUF3077 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313478.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS 4680399..4683434 product Tc toxin subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236980.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS 4683482..4688338 product neuraminidase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104971.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS 4688413..4693242 product neuraminidase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104971.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS 4693261..4697571 product SpvB/TcaC N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268804.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS 4697571..4700462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 4700662..4703418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS 4703503..4706130 product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268806.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 4706127..4708928 product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104970.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS complement(4708980..4710137) product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268810.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS complement(4710276..4710614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104977.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS complement(4710611..4711750) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010218977.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS 4712083..4712838 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768625.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS 4712838..4713629 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268813.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS complement(4713587..4714186) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405918.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS 4714344..4714658 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104978.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS 4714685..4715851 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104979.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS 4715873..4716922 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268815.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS complement(4716986..4717747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS complement(4717982..4718836) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268817.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS complement(4718903..4719901) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463422.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS complement(4719938..4720837) product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268819.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 4720934..4721536 product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768608.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 4721741..4722322 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380941.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 gene sodB CDS 4722567..4723673 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113323.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 4724000..4726051 product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044310414.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 4726393..4727745 product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246223.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS 4727971..4729398 product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104986.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS 4729429..4730493 product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268824.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS 4730508..4731608 product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104988.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS 4731717..4732868 product multidrug efflux RND transporter periplasmic adaptor subunit MexV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115243.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 gene mexV CDS 4732883..4735939 product multidrug efflux RND transporter permease subunit MexW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112762.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 gene mexW CDS complement(4735993..4736220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268826.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(4736220..4736915) product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104989.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS complement(4736949..4737629) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405955.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS complement(4737762..4739048) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268827.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS complement(4739038..4739721) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 4739883..4740623 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768589.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS complement(4740620..4741705) product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605880.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 gene uvsE CDS complement(4741807..4743453) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010439729.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 gene groL CDS complement(4743502..4743795) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304675.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS complement(4744049..4744540) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768585.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 gene fxsA CDS complement(4744608..4745339) product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS 4745465..4746223 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104991.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(4746274..4747281) product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620274.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS 4747414..4747770 product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268830.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS 4747825..4749378 product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268831.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(4749414..4749941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS complement(4750215..4750667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS complement(4750922..4754305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923175.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS complement(4754655..4755485) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766595.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS complement(4755608..4756087) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380977.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS 4756259..4757179 product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268838.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 4757224..4759263 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405989.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS 4759279..4759863 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268839.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS complement(4760004..4760948) product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268840.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS complement(4760945..4761577) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405997.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(4761756..4762973) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268841.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 gene argJ CDS complement(4763085..4765826) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766579.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 gene secA CDS 4766134..4766589 product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377653.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS complement(4766593..4767267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(4767264..4767701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS complement(4767698..4768813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS complement(4768810..4769400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(4769397..4769762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS complement(4769759..4770208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS complement(4770211..4770648) product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262830.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 gene gspG CDS complement(4770667..4771869) product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173152.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 gene gspF CDS complement(4771873..4773333) product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070564.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 gene gspE CDS complement(4773327..4775273) product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 gene xcpQ CDS complement(4775277..4775705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS complement(4775702..4777255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS 4777587..4779617 product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479992.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS complement(4779721..4780650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 4781095..4781640 product Bro-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024668283.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS complement(4781913..4782824) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555040.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 gene lpxC CDS complement(4782936..4784126) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766576.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 gene ftsZ CDS complement(4784200..4785456) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364017.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 gene ftsA CDS complement(4785471..4786337) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766574.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(4786340..4787299) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268844.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS complement(4787296..4788756) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268845.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 gene murC CDS complement(4788749..4789819) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766568.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 gene murG CDS complement(4789809..4791023) product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406017.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 gene ftsW CDS complement(4791020..4792360) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766566.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 gene murD CDS complement(4792372..4793457) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313553.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 gene mraY CDS complement(4793457..4794824) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268847.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS complement(4794817..4796280) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766562.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS complement(4796280..4798013) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427469.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS complement(4798010..4798303) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739040.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene ftsL CDS complement(4798300..4799241) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243678.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 gene rsmH CDS complement(4799244..4799699) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406034.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 gene mraZ CDS complement(4800452..4801324) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243679.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 gene rsmI CDS 4801602..4803416 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766553.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS 4803413..4803787 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024665649.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS 4803948..4804541 product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418801.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS 4804538..4805116 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766550.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS complement(4805163..4805579) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS complement(4805597..4806214) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766548.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS complement(4806446..4807228) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094157.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS complement(4807228..4808439) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS complement(4808439..4809032) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100631.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 gene petA CDS complement(4809285..4809677) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555064.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 gene rpsI CDS complement(4809692..4810120) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555065.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 gene rplM CDS 4810484..4811479 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161937917.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS complement(4811578..4812597) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766543.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 gene zapE CDS complement(4812736..4814082) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268853.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS complement(4814110..4814739) product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236477.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS 4814884..4815321 product DUF1043 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620321.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS complement(4815439..4817337) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105005.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 gene cysN CDS complement(4817391..4817732) product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340660.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS complement(4817833..4818750) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313577.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 gene cysD CDS complement(4818910..4819668) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377592.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS 4819779..4820942 product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340656.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 gene algW CDS complement(4820996..4822048) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766530.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 gene hisC CDS complement(4822045..4823394) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268859.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 gene hisD CDS complement(4823518..4824153) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739058.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 gene hisG CDS complement(4824303..4825568) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555078.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 gene murA CDS complement(4825591..4825830) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377577.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS complement(4825945..4826250) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766523.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS complement(4826247..4826900) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766521.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS complement(4826911..4827378) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313587.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 gene mlaD CDS complement(4827378..4828175) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105008.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 gene mlaE CDS complement(4828175..4828984) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313589.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS 4829301..4830275 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766516.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS 4830405..4830977 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400249.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 gene lptC CDS 4830964..4831509 product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424523.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 gene lptA CDS 4831510..4832235 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 gene lptB CDS 4832462..4833913 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377556.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS 4833990..4834298 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377554.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 gene raiA CDS 4834310..4834774 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766506.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 gene ptsN CDS 4834777..4835634 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377550.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 gene rapZ CDS 4835650..4835922 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377548.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS complement(4835962..4836363) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499744.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS complement(4836512..4836694) product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689143.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS complement(4836793..4837680) product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120918.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS complement(4837708..4838319) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268863.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS complement(4838321..4838782) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766501.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS complement(4838807..4840183) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105011.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS complement(4840176..4840571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105012.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS complement(4840746..4842092) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243694.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 gene pmbA CDS 4842200..4842721 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377535.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 gene yjgA CDS complement(4842767..4844206) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268865.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 gene tldD CDS complement(4844209..4845054) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268866.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS complement(4845100..4848915) product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105014.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS complement(4849087..4850544) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364105.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 gene rng CDS complement(4850541..4851140) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS complement(4851204..4851695) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377527.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 gene mreD CDS complement(4851688..4852758) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766482.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 gene mreC CDS complement(4852998..4854035) product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 gene mreB CDS 4854243..4854530 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 gene gatC CDS 4854545..4855996 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766477.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 gene gatA CDS 4856010..4857455 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313612.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 gene gatB CDS 4857668..4858036 product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003307318.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS 4858090..4859121 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268872.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS complement(4859129..4860070) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766467.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS complement(4860921..4862477) product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105019.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS complement(4862556..4864298) product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266653.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS complement(4864311..4865252) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246110.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 gene pfkB CDS complement(4865252..4868116) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266652.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 gene ptsP CDS 4868455..4869450 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406606.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 gene cra CDS 4869457..4870242 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235485.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS complement(4870392..4871228) product regulatory signaling modulator protein AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412346.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 gene ampE CDS complement(4871244..4871792) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103362.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 gene ampD CDS complement(4871936..4874191) product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266649.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS 4874481..4875386 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 gene nadC CDS 4875421..4876491 product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770547.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS 4876537..4877769 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103359.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS complement(4877996..4878574) product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383244.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS complement(4878614..4879189) product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383243.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS complement(4879217..4880251) product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383242.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS complement(4880281..4880730) product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371299.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS complement(4880783..4881979) product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266646.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS complement(4881976..4882569) product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770558.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS complement(4882617..4883321) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266644.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS complement(4883322..4884272) product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770562.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS complement(4884272..4885366) product tellurite-like stress resistance cysteine protease StiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103356.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS complement(4885359..4886117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266641.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS complement(4886110..4887171) product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103355.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(4887311..4888441) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266639.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(4888494..4889492) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266638.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS 4889741..4890163 product DUF1523 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383227.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS complement(4890288..4891559) product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838686.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS complement(4891754..4892143) product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223804324.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 4892370..4894067 product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103350.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 gene pilB CDS 4894070..4895287 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS 4895289..4896161 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770019.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS 4896158..4896781 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770017.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 gene coaE CDS 4896778..4896987 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552020.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 gene yacG CDS complement(4896981..4897448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074809182.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS complement(4897636..4899519) product methyl-accepting chemotaxis protein Mlp37 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672477.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 gene mlp37 CDS 4899806..4900000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS complement(4900144..4900635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS complement(4901158..4901337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS complement(4901479..4918125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS complement(4918258..4919679) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS complement(4919672..4921834) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS complement(4921985..4923391) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032606785.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 4923591..4924220 product DUF1780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266631.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS 4924217..4924726 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406554.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS 4924763..4924936 product DUF3094 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094672.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS 4925003..4926301 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392712.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS complement(4926448..4927347) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250748.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 tRNA complement(4927535..4927611) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(4927707..4927782) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(4927788..4927864) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(4927894..4927969) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS complement(4928270..4930834) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614629.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 gene clpB CDS complement(4930981..4931709) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103303.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 gene pgeF CDS complement(4931706..4932668) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381266.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 gene rluD CDS 4932818..4933840 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769279.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS 4934092..4934316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41110 note possible pseudo, frameshifted CDS 4934306..4935898 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769277.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS 4935901..4937241 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103301.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS complement(4937238..4938377) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266588.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 gene thiO CDS complement(4938405..4938803) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266587.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS complement(4938816..4941989) product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266586.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS complement(4941976..4942431) product PilX N-terminal domain-containing pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103294.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS complement(4942500..4943204) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266584.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS complement(4943201..4943719) product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103292.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 gene pilV CDS complement(4943719..4944189) product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246769.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS 4944323..4944823 product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769263.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS complement(4944826..4945773) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318785.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 gene ispH CDS complement(4945832..4946299) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381292.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS complement(4946292..4946810) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266581.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 gene lspA CDS complement(4946803..4949634) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103291.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 gene ileS CDS complement(4949631..4950581) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769259.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 gene ribF CDS complement(4950714..4952252) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403539.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 gene murJ CDS 4952503..4952781 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344603.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 gene rpsT CDS complement(4952900..4953370) product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403541.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS complement(4953397..4954518) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381304.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 gene proB CDS complement(4954614..4955837) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551973.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 gene cgtA CDS complement(4956049..4956324) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551972.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 gene rpmA CDS complement(4956357..4956668) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551971.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 gene rplU CDS 4956909..4957877 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS 4958033..4958275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555214.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS complement(4958354..4958971) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736691.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS complement(4959094..4959402) product DUF6482 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268921.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS complement(4959540..4960034) product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313787.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS complement(4960149..4960388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS complement(4960772..4963192) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771663.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS 4963514..4964002 product DUF3015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555221.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS 4964065..4965918 product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268924.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS 4966175..4966528 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770159.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS 4966601..4967113 product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268925.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS complement(4967173..4968837) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399986.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 gene ettA CDS 4969300..4973028 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105092.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS 4973247..4974500 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243779.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS complement(4974642..4975511) product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764420.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS complement(4975544..4976479) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS 4976582..4977457 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764422.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 4978517..4978702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS complement(4979266..4980246) product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268931.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 gene yjiA CDS complement(4980407..4980604) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105096.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS complement(4980632..4982686) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268932.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS 4982985..4983353 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770186.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 CDS complement(4983435..4984802) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555235.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 gene radA CDS 4984988..4985434 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399960.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 gene mscL CDS complement(4985516..4986292) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268934.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS 4986634..4986867 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340758.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 CDS 4986998..4988125 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268935.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS complement(4988205..4988372) product DUF2474 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555239.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS complement(4988385..4989392) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105098.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 gene cydB CDS complement(4989396..4990835) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399952.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS 4991255..4992550 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396212.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS 4992547..4993632 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268939.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 gene trmA CDS 4993825..4995102 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024649113.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS 4995184..4996068 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397257.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS 4996073..4997062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399936.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS complement(4997114..4997707) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463348.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS complement(4997704..4998573) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268943.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 gene tesB CDS complement(4998662..4999231) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105108.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS 4999352..5000281 product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399927.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS complement(5000270..5000554) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104666.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS complement(5000544..5000819) product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740683.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS 5000991..5002211 product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907611.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(5002287..5003615) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268945.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(5003702..5004316) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368734.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS complement(5004343..5004819) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426725.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS complement(5004961..5005647) product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463346.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS 5006035..5006685 product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268949.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS 5006773..5007894 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268950.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS complement(5007917..5008957) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327675.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS 5009109..5009591 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195428.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS complement(5009643..5010662) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314085.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS complement(5010696..5011946) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS complement(5011948..5012889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS complement(5012886..5014091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS complement(5014078..5014638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS complement(5015122..5015964) product DUF6279 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477260.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS complement(5016053..5017177) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267808.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS complement(5017181..5018278) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097452.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS 5018445..5019041 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081691.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS complement(5019019..5019315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(5019562..5019825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS complement(5020271..5020681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025261928.1 transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS complement(5020678..5023425) product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267592.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS complement(5023422..5024810) product DUF6531 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267590.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS complement(5025052..5026530) product DUF6531 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267590.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS complement(5026921..5029455) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057417846.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 gene hrpB CDS 5029734..5030153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376614.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS 5030176..5031084 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399832.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS complement(5031077..5031904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763292.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS 5031815..5032165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS 5032588..5033067 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376607.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS 5033092..5033298 product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS 5033342..5033527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 5033659..5034630 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096831545.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS complement(5034757..5035383) product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763288.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS complement(5035450..5036913) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399822.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 gene amn CDS complement(5036966..5038615) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268974.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS complement(5038712..5040700) product 7TM diverse intracellular signaling domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763284.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 CDS 5041135..5041863 product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427216.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS 5041887..5042510 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763279.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 gene thiE CDS complement(5042598..5043119) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226746.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS complement(5043116..5044450) product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143598.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS 5044754..5046037 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 gene hemL CDS 5046227..5046775 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376593.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS complement(5046809..5047135) product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313868.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS 5047266..5048594 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368786.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 gene miaB CDS 5048751..5049773 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS 5049766..5050266 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105185.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 gene ybeY CDS 5050272..5051114 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243836.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS 5051132..5052652 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105186.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 gene lnt CDS complement(5052754..5053512) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268978.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS complement(5053598..5053969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105188.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS 5054285..5056891 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105190.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 gene leuS CDS 5056980..5057585 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268981.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 gene lptE CDS 5057627..5058664 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 gene holA CDS 5058821..5058976 product alternative ribosome rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555325.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 gene arfA CDS 5059064..5060392 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268984.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS complement(5060462..5061469) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555327.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 gene lipA CDS complement(5061471..5062118) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244676.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 gene lipB CDS complement(5062118..5062429) product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340907.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS complement(5062483..5063643) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376558.1 transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS complement(5063878..5064894) product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268986.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS complement(5064894..5065901) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736753.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 gene mltB CDS complement(5065919..5067064) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244673.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 gene rodA CDS complement(5067054..5068949) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105194.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 gene mrdA CDS complement(5068978..5069445) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313894.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 gene rlmH CDS complement(5069455..5069841) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555337.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 gene rsfS CDS complement(5069902..5070582) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 gene nadD CDS complement(5070584..5071855) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268988.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS 5072130..5072801 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268989.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS 5072805..5074121 product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244669.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS complement(5074279..5074869) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103257.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS complement(5074882..5075598) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770108.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS complement(5075595..5075957) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407954.1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS 5076163..5076618 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266530.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 CDS 5076747..5078471 product C13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770114.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 CDS 5078499..5079140 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770116.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS complement(5079196..5079480) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770118.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS complement(5079473..5080102) product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379089.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 gene ubiX CDS complement(5080099..5081448) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770120.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 gene mpl CDS 5081641..5083161 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103256.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 CDS 5083466..5084860 product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407936.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS 5084872..5085696 product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266524.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 gene eutC CDS 5085781..5086233 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024667238.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS 5086443..5087090 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407930.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS 5087094..5087906 product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266523.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 CDS 5088011..5088538 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317259.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 gene ppa CDS 5089011..5089616 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266522.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS complement(5089873..5090175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS 5090299..5090544 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103251.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS complement(5090879..5091196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS complement(5091193..5092512) product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073057.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 CDS complement(5092747..5092959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS 5093111..5093314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS complement(5093269..5103309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS complement(5103366..5103743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS 5104056..5104952 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817235.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 CDS 5105024..5105863 product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769036.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 gene yghU CDS complement(5106042..5107088) product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS 5107232..5108404 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407878.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 gene metC CDS 5108494..5108736 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551852.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS 5108733..5109620 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS 5109770..5111662 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103240.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 gene dxs CDS complement(5111737..5112156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769026.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS complement(5112153..5112770) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379129.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 gene ribA CDS complement(5112875..5113384) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS complement(5113381..5114346) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269044.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 gene thiL CDS complement(5114365..5114862) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269045.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 gene nusB CDS complement(5114859..5115335) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555427.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 gene ribE CDS complement(5115466..5116557) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103237.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 gene ribBA CDS complement(5116575..5117237) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317049.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS complement(5117285..5118430) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103235.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 gene ribD CDS complement(5118427..5118933) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317051.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 gene nrdR CDS 5119085..5119534 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379143.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS 5119531..5120184 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103234.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS 5120279..5121151 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379146.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 gene trxA CDS complement(5121192..5121551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269049.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS complement(5121594..5122010) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614373.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS complement(5122023..5122961) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS complement(5122964..5124019) product 1,3,6,8-tetrahydroxynaphthalene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027653.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS 5124229..5124816 product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400340.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS 5124898..5125608 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 CDS 5125610..5126875 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400343.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS 5126887..5127408 product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412093.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS 5127513..5128199 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS complement(5128255..5128710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS complement(5128916..5129845) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400349.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS complement(5129838..5130707) product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032621927.1 transl_table 11 codon_start 1 locus_tag LOCUS_43010 CDS complement(5130845..5133037) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768994.1 transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS 5133836..5134639 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807817.1 transl_table 11 codon_start 1 locus_tag LOCUS_43030 tRNA 5134651..5134740 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS 5134752..5135942 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191282.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS 5135939..5136877 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807822.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS 5136983..5138317 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531968.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(5138702..5139247) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269089.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 CDS complement(5139257..5140651) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768949.1 transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS 5140792..5143626 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085990813.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 gene uvrA CDS complement(5143711..5144175) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269091.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 gene bfr CDS complement(5144331..5145779) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269092.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS complement(5145944..5146330) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317096.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 gene rplQ CDS complement(5146373..5147374) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 gene rpoA CDS complement(5147397..5148017) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555465.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 gene rpsD CDS complement(5148036..5148425) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555466.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 gene rpsK CDS complement(5148456..5148812) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555467.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 gene rpsM CDS complement(5149088..5150422) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555469.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 gene secY CDS complement(5150423..5150857) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555470.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 gene rplO CDS complement(5150861..5151037) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555471.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 gene rpmD CDS complement(5151040..5151540) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317099.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 gene rpsE CDS complement(5151544..5151894) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555473.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 gene rplR CDS complement(5151905..5152438) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768939.1 transl_table 11 codon_start 1 locus_tag LOCUS_43220 gene rplF CDS complement(5152451..5152843) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555475.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 gene rpsH CDS complement(5153057..5153362) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555476.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 gene rpsN CDS complement(5153376..5153915) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555477.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 gene rplE CDS complement(5153936..5154250) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555478.1 transl_table 11 codon_start 1 locus_tag LOCUS_43260 gene rplX CDS complement(5154262..5154630) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555479.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 gene rplN CDS complement(5154654..5154920) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555480.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 gene rpsQ CDS complement(5154923..5155114) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555481.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 gene rpmC CDS complement(5155114..5155527) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555482.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 gene rplP CDS complement(5155540..5156226) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003176422.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 gene rpsC CDS complement(5156240..5156572) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555485.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 gene rplV CDS complement(5156586..5156861) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004883670.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 gene rpsS CDS complement(5156878..5157702) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317104.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 gene rplB CDS complement(5157717..5158016) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555488.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 gene rplW CDS complement(5158013..5158615) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555489.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 gene rplD CDS complement(5158628..5159296) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397052.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 gene rplC CDS complement(5159345..5159656) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103876.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 gene rpsJ CDS complement(5159797..5160990) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245455.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 gene tuf CDS complement(5161022..5163124) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768927.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 gene fusA CDS complement(5163155..5163625) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397077.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 gene rpsG CDS complement(5163748..5164119) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555494.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 gene rpsL CDS complement(5164317..5168516) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431814.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 gene rpoC CDS complement(5168581..5172654) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269095.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 gene rpoB CDS complement(5172874..5173239) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555497.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 gene rplL CDS complement(5173318..5173818) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397081.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 gene rplJ CDS complement(5174012..5174707) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400443.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 gene rplA CDS complement(5174707..5175138) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555500.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 gene rplK CDS complement(5175257..5175790) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317113.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 gene nusG CDS complement(5175800..5176168) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555502.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 gene secE tRNA complement(5176215..5176290) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA complement(5176462..5176537) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA complement(5176564..5176637) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA complement(5176662..5176746) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 CDS complement(5176889..5177317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768916.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS complement(5177325..5177627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS 5177661..5178092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS complement(5178064..5178717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS 5178787..5179011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43550 rRNA complement(5179160..5179269) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 rRNA complement(5179406..5182295) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 tRNA complement(5182556..5182631) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA complement(5182639..5182715) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 rRNA complement(5182781..5184314) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 CDS complement(5184833..5186032) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269097.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 gene tyrS CDS 5186235..5187653 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401947.1 transl_table 11 codon_start 1 locus_tag LOCUS_43570 CDS 5187657..5188751 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614195.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS complement(5188809..5189159) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 transl_table 11 codon_start 1 locus_tag LOCUS_43590 gene erpA CDS complement(5189316..5190350) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 gene argC CDS 5190484..5190912 product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377457.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 gene hemJ CDS 5190990..5191898 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269100.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS 5191964..5192740 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269101.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS 5192833..5193171 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269102.1 transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS 5193309..5193956 product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767884.1 transl_table 11 codon_start 1 locus_tag LOCUS_43650 gene coq7 CDS complement(5194015..5194809) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551946.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 gene speD CDS complement(5195050..5195472) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767887.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS 5195681..5196325 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401959.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 gene crp CDS complement(5196338..5197033) product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269104.1 transl_table 11 codon_start 1 locus_tag LOCUS_43690 CDS complement(5197044..5197880) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269105.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 gene trpC CDS complement(5197877..5198938) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103215.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 gene trpD CDS complement(5198935..5199543) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767895.1 transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS complement(5199974..5200483) product lysis system i-spanin subunit Rz inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269107.1 transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS complement(5200480..5201025) product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269108.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS complement(5201092..5201682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS complement(5201700..5203442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS complement(5203454..5204053) product DUF2313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010439013.1 transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS complement(5204041..5205081) product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401993.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS complement(5205071..5205469) product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269111.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS complement(5205469..5205978) product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372720.1 transl_table 11 codon_start 1 locus_tag LOCUS_43800 CDS complement(5206024..5207073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401994.1 transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS complement(5207078..5208427) product DNA circularization N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269112.1 transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS complement(5208411..5210570) product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269113.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS complement(5210701..5210997) product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316280.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS complement(5210994..5211341) product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269114.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS complement(5211402..5212898) product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103203.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 CDS complement(5212917..5213099) product DUF2635 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401999.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS complement(5213096..5213686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768024.1 transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS complement(5213720..5214058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768026.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS complement(5214039..5214428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411734.1 transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS complement(5214964..5215422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269120.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS 5215548..5216192 product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768035.1 transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS 5216348..5216614 product DUF1654 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402012.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 CDS 5216780..5217022 product pyocin activator PrtN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463953.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS 5217302..5219152 product autotransporter domain-containing SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103197.1 transl_table 11 codon_start 1 locus_tag LOCUS_43950 CDS complement(5219196..5220473) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103263.1 transl_table 11 codon_start 1 locus_tag LOCUS_43960 CDS 5220594..5221949 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103262.1 transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS 5221978..5222829 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419249.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 CDS 5222900..5223205 product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770099.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS 5223202..5223951 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407968.1 transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS 5223970..5224596 product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266533.1 transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS 5224615..5225178 product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103258.1 transl_table 11 codon_start 1 locus_tag LOCUS_44020 CDS 5225424..5227469 product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105196.1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS complement(5227466..5230201) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236179.1 transl_table 11 codon_start 1 locus_tag LOCUS_44040 CDS complement(5230224..5230691) product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763217.1 transl_table 11 codon_start 1 locus_tag LOCUS_44050 CDS 5230755..5231225 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763215.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 CDS 5231350..5232090 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763213.1 transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS complement(5232128..5232403) product DUF3613 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399719.1 transl_table 11 codon_start 1 locus_tag LOCUS_44080 CDS complement(5232400..5233113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269004.1 transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS complement(5233142..5234029) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763178.1 transl_table 11 codon_start 1 locus_tag LOCUS_44100 CDS complement(5234031..5234915) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269003.1 transl_table 11 codon_start 1 locus_tag LOCUS_44110 CDS complement(5234937..5236193) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313926.1 transl_table 11 codon_start 1 locus_tag LOCUS_44120 CDS complement(5236193..5237383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244656.1 transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS complement(5237380..5238651) product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269002.1 transl_table 11 codon_start 1 locus_tag LOCUS_44140 CDS complement(5238671..5239627) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105205.1 transl_table 11 codon_start 1 locus_tag LOCUS_44150 gene cpaB CDS 5239919..5240125 product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763190.1 transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS 5240188..5240595 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399734.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 CDS 5240679..5240972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555356.1 transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS 5241145..5242485 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244661.1 transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS complement(5242479..5243879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS 5243823..5244014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS complement(5244060..5245973) product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763203.1 transl_table 11 codon_start 1 locus_tag LOCUS_44220 gene speA CDS complement(5246062..5246433) product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313912.1 transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS complement(5246609..5247154) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399749.1 transl_table 11 codon_start 1 locus_tag LOCUS_44240 CDS complement(5247154..5248233) product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105200.1 transl_table 11 codon_start 1 locus_tag LOCUS_44250 CDS 5248533..5250197 product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105198.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS 5250298..5252070 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105207.1 transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS 5252199..5252651 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555369.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 gene aroQ CDS 5252731..5253186 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555370.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 gene accB CDS 5253204..5254547 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399697.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 gene accC CDS 5254674..5255552 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244650.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 gene prmA CDS 5255577..5256902 product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269007.1 transl_table 11 codon_start 1 locus_tag LOCUS_44320 CDS 5257347..5258231 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399694.1 transl_table 11 codon_start 1 locus_tag LOCUS_44330 gene dusB CDS 5258228..5258548 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555375.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 gene fis CDS 5258635..5260236 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105209.1 transl_table 11 codon_start 1 locus_tag LOCUS_44350 gene purH CDS 5260408..5261703 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399692.1 transl_table 11 codon_start 1 locus_tag LOCUS_44360 gene purD CDS 5261852..5264581 product hybrid sensor histidine kinase/response regulator RetS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399691.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 gene retS CDS 5264621..5265217 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269009.1 transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS complement(5265231..5265890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269011.1 transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS complement(5265887..5266609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269012.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 CDS complement(5266668..5267459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269013.1 transl_table 11 codon_start 1 locus_tag LOCUS_44410 CDS complement(5267770..5268417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105211.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 CDS complement(5268615..5270318) product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105215.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 gene cobJ CDS complement(5270318..5271052) product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763136.1 transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS complement(5271049..5271675) product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763134.1 transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS complement(5271672..5273012) product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193383855.1 transl_table 11 codon_start 1 locus_tag LOCUS_44460 gene cobG CDS 5273136..5274344 product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763130.1 transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS 5274344..5275441 product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244641.1 transl_table 11 codon_start 1 locus_tag LOCUS_44480 CDS 5275438..5276202 product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763127.1 transl_table 11 codon_start 1 locus_tag LOCUS_44490 CDS 5276398..5276775 product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105383.1 transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS 5276849..5277292 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763123.1 transl_table 11 codon_start 1 locus_tag LOCUS_44510 CDS 5277297..5277731 product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105217.1 transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS 5277833..5279206 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763119.1 transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS 5279525..5280790 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105219.1 transl_table 11 codon_start 1 locus_tag LOCUS_44540 gene urtA CDS 5281032..5281961 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268857.1 transl_table 11 codon_start 1 locus_tag LOCUS_44550 CDS 5282118..5283707 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269026.1 transl_table 11 codon_start 1 locus_tag LOCUS_44560 gene urtB CDS 5283707..5284786 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105220.1 transl_table 11 codon_start 1 locus_tag LOCUS_44570 gene urtC CDS 5284783..5285643 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376420.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 gene urtD CDS 5285793..5286491 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763108.1 transl_table 11 codon_start 1 locus_tag LOCUS_44590 gene urtE CDS 5286540..5287385 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763106.1 transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS 5287319..5287543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS 5287534..5287836 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317023.1 transl_table 11 codon_start 1 locus_tag LOCUS_44620 gene ureA CDS 5287849..5288391 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269031.1 transl_table 11 codon_start 1 locus_tag LOCUS_44630 CDS 5288402..5288935 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269032.1 transl_table 11 codon_start 1 locus_tag LOCUS_44640 CDS 5288932..5289237 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391866.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS 5289372..5291072 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 gene ureC CDS complement(5291112..5291438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS 5291668..5292789 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105223.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS complement(5292829..5293779) product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763092.1 transl_table 11 codon_start 1 locus_tag LOCUS_44690 gene cbpA CDS complement(5294083..5295747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44700 CDS 5295903..5297168 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376398.1 transl_table 11 codon_start 1 locus_tag LOCUS_44710 CDS complement(5297299..5298309) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419507.1 transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS complement(5298498..5298788) product PsiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105225.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 CDS 5298923..5299801 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105226.1 transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS complement(5299798..5300688) product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170261.1 transl_table 11 codon_start 1 locus_tag LOCUS_44750 CDS 5300925..5301263 product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317036.1 transl_table 11 codon_start 1 locus_tag LOCUS_44760 gene osmE CDS complement(5301313..5301840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44770 CDS complement(5302116..5302706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103761.1 transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS complement(5302917..5303363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS complement(5303720..5304421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103761.1 transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS complement(5304499..5304750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44810 note possible pseudo, frameshifted CDS complement(5304782..5305270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44820 CDS complement(5305493..5308876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923175.1 transl_table 11 codon_start 1 locus_tag LOCUS_44830 CDS 5309512..5310045 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317037.1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 CDS complement(5310139..5312205) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105228.1 transl_table 11 codon_start 1 locus_tag LOCUS_44850 CDS 5312432..5313064 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555418.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS 5313246..5313746 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244624.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 gene ureE CDS 5313743..5314417 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763065.1 transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS 5314435..5315052 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376376.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 gene ureG CDS 5315079..5315651 product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105229.1 transl_table 11 codon_start 1 locus_tag LOCUS_44900 CDS 5315880..5318147 product pyrroloquinoline quinone biosynthesis protein PqqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443183.1 transl_table 11 codon_start 1 locus_tag LOCUS_44910 gene pqqF CDS 5318485..5319396 product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763801.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 gene pqqB CDS 5319405..5320157 product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402120.1 transl_table 11 codon_start 1 locus_tag LOCUS_44930 gene pqqC CDS 5320154..5320429 product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614032.1 transl_table 11 codon_start 1 locus_tag LOCUS_44940 gene pqqD CDS 5320422..5321588 product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269165.1 transl_table 11 codon_start 1 locus_tag LOCUS_44950 gene pqqE CDS 5321554..5323380 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763797.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS complement(5323468..5323629) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555565.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS complement(5323953..5325731) product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103167.1 transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS 5325730..5325879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS complement(5325958..5327256) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269168.1 transl_table 11 codon_start 1 locus_tag LOCUS_45000 CDS complement(5327495..5329300) product phenylacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103162.1 transl_table 11 codon_start 1 locus_tag LOCUS_45010 CDS complement(5329623..5329919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382340.1 transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS complement(5330082..5330762) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269170.1 transl_table 11 codon_start 1 locus_tag LOCUS_45030 gene bioD CDS complement(5330794..5331603) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103161.1 transl_table 11 codon_start 1 locus_tag LOCUS_45040 gene bioC CDS complement(5331596..5332327) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763768.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS complement(5332320..5333510) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269172.1 transl_table 11 codon_start 1 locus_tag LOCUS_45060 gene bioF CDS complement(5333577..5334635) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372416.1 transl_table 11 codon_start 1 locus_tag LOCUS_45070 gene bioB CDS 5334728..5335462 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763760.1 transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS 5335525..5336289 product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269173.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 CDS 5336369..5338273 product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103159.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 CDS complement(5338441..5339274) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763753.1 transl_table 11 codon_start 1 locus_tag LOCUS_45110 CDS complement(5339299..5340330) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269175.1 transl_table 11 codon_start 1 locus_tag LOCUS_45120 CDS complement(5340327..5341121) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316181.1 transl_table 11 codon_start 1 locus_tag LOCUS_45130 CDS complement(5341118..5341987) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402154.1 transl_table 11 codon_start 1 locus_tag LOCUS_45140 CDS complement(5341987..5342988) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402156.1 transl_table 11 codon_start 1 locus_tag LOCUS_45150 CDS complement(5342972..5343991) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269176.1 transl_table 11 codon_start 1 locus_tag LOCUS_45160 CDS 5344174..5345148 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763737.1 transl_table 11 codon_start 1 locus_tag LOCUS_45170 CDS 5345182..5346069 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269178.1 transl_table 11 codon_start 1 locus_tag LOCUS_45180 gene rarD CDS complement(5346343..5346618) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325581.1 transl_table 11 codon_start 1 locus_tag LOCUS_45190 CDS complement(5346618..5346890) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532247.1 transl_table 11 codon_start 1 locus_tag LOCUS_45200 CDS complement(5347076..5347594) product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763732.1 transl_table 11 codon_start 1 locus_tag LOCUS_45210 CDS 5347915..5350089 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269180.1 transl_table 11 codon_start 1 locus_tag LOCUS_45220 CDS complement(5350151..5350597) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402175.1 transl_table 11 codon_start 1 locus_tag LOCUS_45230 CDS 5350798..5352765 product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763703.1 transl_table 11 codon_start 1 locus_tag LOCUS_45240 CDS 5352762..5353475 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269182.1 transl_table 11 codon_start 1 locus_tag LOCUS_45250 CDS 5353720..5354625 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316718.1 transl_table 11 codon_start 1 locus_tag LOCUS_45260 CDS 5354636..5355925 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266421.1 transl_table 11 codon_start 1 locus_tag LOCUS_45270 CDS 5355925..5356563 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765392.1 transl_table 11 codon_start 1 locus_tag LOCUS_45280 CDS 5356725..5358182 product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266419.1 transl_table 11 codon_start 1 locus_tag LOCUS_45290 CDS 5358204..5358983 product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266418.1 transl_table 11 codon_start 1 locus_tag LOCUS_45300 CDS complement(5359028..5359426) product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551711.1 transl_table 11 codon_start 1 locus_tag LOCUS_45310 CDS 5359721..5361130 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765398.1 transl_table 11 codon_start 1 locus_tag LOCUS_45320 gene ahcY CDS 5361295..5362164 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765400.1 transl_table 11 codon_start 1 locus_tag LOCUS_45330 gene metF CDS 5362531..5364423 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266416.1 transl_table 11 codon_start 1 locus_tag LOCUS_45340 CDS complement(5364531..5365109) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551707.1 transl_table 11 codon_start 1 locus_tag LOCUS_45350 CDS complement(5365137..5365685) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266415.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 CDS complement(5366021..5367841) product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105298.1 transl_table 11 codon_start 1 locus_tag LOCUS_45370 CDS 5368030..5369436 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266413.1 transl_table 11 codon_start 1 locus_tag LOCUS_45380 CDS 5369578..5370297 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105300.1 transl_table 11 codon_start 1 locus_tag LOCUS_45390 CDS complement(5370384..5370998) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266412.1 transl_table 11 codon_start 1 locus_tag LOCUS_45400 CDS 5371065..5372063 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105301.1 transl_table 11 codon_start 1 locus_tag LOCUS_45410 CDS complement(5372150..5372914) product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402947.1 transl_table 11 codon_start 1 locus_tag LOCUS_45420 gene madM CDS complement(5372916..5373332) product malonate transporter subunit MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765417.1 transl_table 11 codon_start 1 locus_tag LOCUS_45430 gene madL CDS complement(5373403..5374362) product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105302.1 transl_table 11 codon_start 1 locus_tag LOCUS_45440 gene mdcH CDS complement(5374335..5374967) product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266410.1 transl_table 11 codon_start 1 locus_tag LOCUS_45450 CDS complement(5374967..5375767) product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266409.1 transl_table 11 codon_start 1 locus_tag LOCUS_45460 gene mdcE CDS complement(5375764..5376615) product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266408.1 transl_table 11 codon_start 1 locus_tag LOCUS_45470 CDS complement(5376608..5376907) product malonate decarboxylase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378783.1 transl_table 11 codon_start 1 locus_tag LOCUS_45480 CDS complement(5376910..5377785) product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105305.1 transl_table 11 codon_start 1 locus_tag LOCUS_45490 CDS complement(5377785..5379461) product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266405.1 transl_table 11 codon_start 1 locus_tag LOCUS_45500 gene mdcA CDS 5380454..5381659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45510 CDS complement(5381708..5382055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45520 CDS complement(5382398..5382664) product DUF3077 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313478.1 transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS complement(5383186..5384325) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113218.1 transl_table 11 codon_start 1 locus_tag LOCUS_45540 CDS complement(5384496..5392985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45550 CDS complement(5392985..5393770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS complement(5393857..5394810) product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070577.1 transl_table 11 codon_start 1 locus_tag LOCUS_45570 CDS complement(5394798..5395586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45580 CDS complement(5395593..5397113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45590 CDS complement(5397187..5403453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45600 CDS complement(5403599..5404435) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 transl_table 11 codon_start 1 locus_tag LOCUS_45610 CDS 5404849..5405442 product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 transl_table 11 codon_start 1 locus_tag LOCUS_45620 CDS 5405490..5405801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS complement(5405802..5406299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS complement(5406333..5408429) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 transl_table 11 codon_start 1 locus_tag LOCUS_45650 CDS complement(5408430..5409752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45660 CDS complement(5409749..5410534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45670 CDS complement(5410959..5411429) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266436.1 transl_table 11 codon_start 1 locus_tag LOCUS_45680 CDS complement(5411422..5417400) product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266435.1 transl_table 11 codon_start 1 locus_tag LOCUS_45690 CDS complement(5417445..5419487) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621029.1 transl_table 11 codon_start 1 locus_tag LOCUS_45700 CDS complement(5419567..5420106) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266433.1 transl_table 11 codon_start 1 locus_tag LOCUS_45710 CDS complement(5420121..5420486) product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377196.1 transl_table 11 codon_start 1 locus_tag LOCUS_45720 gene pilH CDS complement(5420529..5420939) product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551738.1 transl_table 11 codon_start 1 locus_tag LOCUS_45730 gene pilG CDS 5421169..5422122 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316740.1 transl_table 11 codon_start 1 locus_tag LOCUS_45740 gene gshB CDS 5422417..5423310 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736950.1 transl_table 11 codon_start 1 locus_tag LOCUS_45750 CDS 5423386..5423955 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769417.1 transl_table 11 codon_start 1 locus_tag LOCUS_45760 CDS 5423955..5424398 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377205.1 transl_table 11 codon_start 1 locus_tag LOCUS_45770 gene ruvX CDS 5424499..5425017 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266430.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 gene pyrR CDS 5425030..5426034 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736952.1 transl_table 11 codon_start 1 locus_tag LOCUS_45790 CDS 5426031..5427302 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266429.1 transl_table 11 codon_start 1 locus_tag LOCUS_45800 CDS complement(5427468..5427872) product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769424.1 transl_table 11 codon_start 1 locus_tag LOCUS_45810 CDS 5428123..5428806 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080269995.1 transl_table 11 codon_start 1 locus_tag LOCUS_45820 CDS complement(5428844..5429878) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404551.1 transl_table 11 codon_start 1 locus_tag LOCUS_45830 CDS 5429934..5430620 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105285.1 transl_table 11 codon_start 1 locus_tag LOCUS_45840 CDS 5430643..5431461 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769432.1 transl_table 11 codon_start 1 locus_tag LOCUS_45850 gene proC CDS 5431488..5432078 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377215.1 transl_table 11 codon_start 1 locus_tag LOCUS_45860 CDS 5432212..5433351 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266425.1 transl_table 11 codon_start 1 locus_tag LOCUS_45870 CDS 5433359..5433979 product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377217.1 transl_table 11 codon_start 1 locus_tag LOCUS_45880 gene metW CDS 5434006..5434440 product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233674.1 transl_table 11 codon_start 1 locus_tag LOCUS_45890 CDS 5434437..5435033 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266424.1 transl_table 11 codon_start 1 locus_tag LOCUS_45900 gene rdgB CDS 5435030..5436244 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 transl_table 11 codon_start 1 locus_tag LOCUS_45910 gene hemW CDS 5436254..5436577 product DUF3392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551720.1 transl_table 11 codon_start 1 locus_tag LOCUS_45920 CDS complement(5436643..5437377) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411920.1 transl_table 11 codon_start 1 locus_tag LOCUS_45930 gene trmB CDS complement(5437388..5438182) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304387.1 transl_table 11 codon_start 1 locus_tag LOCUS_45940 CDS complement(5438229..5438429) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379876.1 transl_table 11 codon_start 1 locus_tag LOCUS_45950 gene thiS CDS complement(5438529..5438894) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269203.1 transl_table 11 codon_start 1 locus_tag LOCUS_45960 CDS 5438994..5439704 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402232.1 transl_table 11 codon_start 1 locus_tag LOCUS_45970 gene mtgA CDS complement(5439788..5440642) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379873.1 transl_table 11 codon_start 1 locus_tag LOCUS_45980 gene rpoH CDS complement(5440757..5441788) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393643.1 transl_table 11 codon_start 1 locus_tag LOCUS_45990 gene ftsX CDS complement(5441785..5442456) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555631.1 transl_table 11 codon_start 1 locus_tag LOCUS_46000 gene ftsE CDS complement(5442453..5443922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46010 CDS 5444180..5445532 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763634.1 transl_table 11 codon_start 1 locus_tag LOCUS_46020 CDS 5445529..5447022 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 transl_table 11 codon_start 1 locus_tag LOCUS_46030 CDS 5447022..5447606 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763630.1 transl_table 11 codon_start 1 locus_tag LOCUS_46040 gene rsmD CDS complement(5447885..5449153) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266374.1 transl_table 11 codon_start 1 locus_tag LOCUS_46050 CDS complement(5449338..5450165) product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105331.1 transl_table 11 codon_start 1 locus_tag LOCUS_46060 CDS complement(5450165..5450386) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378857.1 transl_table 11 codon_start 1 locus_tag LOCUS_46070 gene rpmE CDS 5450552..5452771 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266372.1 transl_table 11 codon_start 1 locus_tag LOCUS_46080 CDS 5452926..5454662 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105333.1 transl_table 11 codon_start 1 locus_tag LOCUS_46090 gene argS CDS 5454664..5455359 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403056.1 transl_table 11 codon_start 1 locus_tag LOCUS_46100 CDS 5455596..5456126 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378861.1 transl_table 11 codon_start 1 locus_tag LOCUS_46110 gene hslV CDS 5456172..5457509 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765516.1 transl_table 11 codon_start 1 locus_tag LOCUS_46120 gene hslU CDS 5457609..5457986 product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403059.1 transl_table 11 codon_start 1 locus_tag LOCUS_46130 CDS 5458409..5460088 product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095864.1 transl_table 11 codon_start 1 locus_tag LOCUS_46140 gene phaC CDS 5460236..5461093 product poly(3-hydroxyalkanoate) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739559.1 transl_table 11 codon_start 1 locus_tag LOCUS_46150 gene phaZ CDS 5461255..5462940 product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105335.1 transl_table 11 codon_start 1 locus_tag LOCUS_46160 gene phaC CDS 5463076..5463690 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105336.1 transl_table 11 codon_start 1 locus_tag LOCUS_46170 CDS complement(5463734..5464510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46180 CDS complement(5464521..5464994) product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765531.1 transl_table 11 codon_start 1 locus_tag LOCUS_46190 CDS 5465183..5465446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46200 CDS 5465938..5466471 product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105093.1 transl_table 11 codon_start 1 locus_tag LOCUS_46210 CDS 5466477..5467190 product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105094.1 transl_table 11 codon_start 1 locus_tag LOCUS_46220 CDS 5467256..5467474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46230 CDS 5467689..5468381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46240 CDS complement(5468436..5468714) product polyhydroxyalkanoic acid system family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378882.1 transl_table 11 codon_start 1 locus_tag LOCUS_46250 CDS 5468859..5469629 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378884.1 transl_table 11 codon_start 1 locus_tag LOCUS_46260 gene ubiE CDS 5469629..5470252 product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403066.1 transl_table 11 codon_start 1 locus_tag LOCUS_46270 CDS 5470249..5471868 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245582.1 transl_table 11 codon_start 1 locus_tag LOCUS_46280 gene ubiB CDS 5471939..5472331 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403068.1 transl_table 11 codon_start 1 locus_tag LOCUS_46290 gene hisI CDS 5472334..5472666 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105340.1 transl_table 11 codon_start 1 locus_tag LOCUS_46300 CDS 5472709..5472984 product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316632.1 transl_table 11 codon_start 1 locus_tag LOCUS_46310 CDS 5472988..5473422 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266365.1 transl_table 11 codon_start 1 locus_tag LOCUS_46320 gene tatB CDS 5473419..5474216 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765541.1 transl_table 11 codon_start 1 locus_tag LOCUS_46330 gene tatC CDS 5474213..5474920 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105341.1 transl_table 11 codon_start 1 locus_tag LOCUS_46340 CDS 5475101..5476927 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105342.1 transl_table 11 codon_start 1 locus_tag LOCUS_46350 CDS 5477133..5479076 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105343.1 transl_table 11 codon_start 1 locus_tag LOCUS_46360 CDS complement(5479156..5481738) product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266360.1 transl_table 11 codon_start 1 locus_tag LOCUS_46370 gene mdoH CDS complement(5481731..5483530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46380 CDS complement(5483941..5484378) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266358.1 transl_table 11 codon_start 1 locus_tag LOCUS_46390 gene dtd CDS complement(5484505..5485476) product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414210.1 transl_table 11 codon_start 1 locus_tag LOCUS_46400 gene pip CDS 5485754..5488204 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765552.1 transl_table 11 codon_start 1 locus_tag LOCUS_46410 CDS 5488466..5489833 product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765555.1 transl_table 11 codon_start 1 locus_tag LOCUS_46420 CDS 5489980..5490990 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381390.1 transl_table 11 codon_start 1 locus_tag LOCUS_46430 CDS 5490995..5491597 product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101790.1 transl_table 11 codon_start 1 locus_tag LOCUS_46440 CDS 5491786..5492040 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403102.1 transl_table 11 codon_start 1 locus_tag LOCUS_46450 gene bamE CDS 5492044..5492613 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304589.1 transl_table 11 codon_start 1 locus_tag LOCUS_46460 CDS complement(5492680..5494044) product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266356.1 transl_table 11 codon_start 1 locus_tag LOCUS_46470 CDS 5494191..5494940 product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161420743.1 transl_table 11 codon_start 1 locus_tag LOCUS_46480 gene hutC CDS 5494937..5495533 product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266354.1 transl_table 11 codon_start 1 locus_tag LOCUS_46490 CDS 5495650..5496735 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266353.1 transl_table 11 codon_start 1 locus_tag LOCUS_46500 gene nhaA CDS 5496842..5497375 product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266352.1 transl_table 11 codon_start 1 locus_tag LOCUS_46510 CDS 5497480..5498046 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266351.1 transl_table 11 codon_start 1 locus_tag LOCUS_46520 CDS 5498043..5498744 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266350.1 transl_table 11 codon_start 1 locus_tag LOCUS_46530 CDS complement(5498765..5499778) product cyanate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268358.1 transl_table 11 codon_start 1 locus_tag LOCUS_46540 CDS 5499660..5499926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46550 CDS complement(5500067..5501329) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 transl_table 11 codon_start 1 locus_tag LOCUS_46560 CDS complement(5501322..5501636) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083182810.1 transl_table 11 codon_start 1 locus_tag LOCUS_46570 CDS 5502051..5503748 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269249.1 transl_table 11 codon_start 1 locus_tag LOCUS_46580 gene hutU CDS 5503880..5504845 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010218951.1 transl_table 11 codon_start 1 locus_tag LOCUS_46590 CDS 5504917..5505768 product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343849.1 transl_table 11 codon_start 1 locus_tag LOCUS_46600 CDS 5505768..5506595 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247035.1 transl_table 11 codon_start 1 locus_tag LOCUS_46610 CDS 5506607..5508148 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105399.1 transl_table 11 codon_start 1 locus_tag LOCUS_46620 CDS 5508218..5509765 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105400.1 transl_table 11 codon_start 1 locus_tag LOCUS_46630 gene hutH CDS 5509870..5511246 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105401.1 transl_table 11 codon_start 1 locus_tag LOCUS_46640 CDS 5511263..5512468 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269253.1 transl_table 11 codon_start 1 locus_tag LOCUS_46650 gene hutI CDS 5512480..5513280 product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269254.1 transl_table 11 codon_start 1 locus_tag LOCUS_46660 gene hutG CDS complement(5513344..5514288) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771258.1 transl_table 11 codon_start 1 locus_tag LOCUS_46670 CDS complement(5514529..5516757) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269255.1 transl_table 11 codon_start 1 locus_tag LOCUS_46680 CDS 5516840..5517286 product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768479.1 transl_table 11 codon_start 1 locus_tag LOCUS_46690 gene cadR CDS complement(5517344..5518315) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105406.1 transl_table 11 codon_start 1 locus_tag LOCUS_46700 CDS complement(5518512..5519321) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405275.1 transl_table 11 codon_start 1 locus_tag LOCUS_46710 gene lgt CDS complement(5519677..5521956) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382074.1 transl_table 11 codon_start 1 locus_tag LOCUS_46720 gene ptsP CDS complement(5521978..5522457) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555745.1 transl_table 11 codon_start 1 locus_tag LOCUS_46730 CDS 5522600..5523256 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 transl_table 11 codon_start 1 locus_tag LOCUS_46740 CDS complement(5523266..5523661) product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269259.1 transl_table 11 codon_start 1 locus_tag LOCUS_46750 CDS complement(5523826..5525340) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269260.1 transl_table 11 codon_start 1 locus_tag LOCUS_46760 gene ilvA CDS 5525485..5526156 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247432.1 transl_table 11 codon_start 1 locus_tag LOCUS_46770 gene rpiA CDS complement(5526211..5527104) product SdiA-regulated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767052.1 transl_table 11 codon_start 1 locus_tag LOCUS_46780 CDS complement(5527190..5528110) product SdiA-regulated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269263.1 transl_table 11 codon_start 1 locus_tag LOCUS_46790 CDS complement(5528322..5528987) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382082.1 transl_table 11 codon_start 1 locus_tag LOCUS_46800 CDS complement(5529042..5530436) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029571842.1 transl_table 11 codon_start 1 locus_tag LOCUS_46810 CDS complement(5530414..5530626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46820 CDS 5530598..5531827 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382085.1 transl_table 11 codon_start 1 locus_tag LOCUS_46830 gene serA CDS complement(5531916..5532353) product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767059.1 transl_table 11 codon_start 1 locus_tag LOCUS_46840 CDS complement(5532487..5533122) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666025.1 transl_table 11 codon_start 1 locus_tag LOCUS_46850 CDS 5533265..5534023 product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420191.1 transl_table 11 codon_start 1 locus_tag LOCUS_46860 CDS complement(5534047..5534988) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767067.1 transl_table 11 codon_start 1 locus_tag LOCUS_46870 CDS 5535092..5535661 product DUF6436 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352065.1 transl_table 11 codon_start 1 locus_tag LOCUS_46880 CDS complement(5535773..5536717) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771258.1 transl_table 11 codon_start 1 locus_tag LOCUS_46890 CDS 5537002..5539389 product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269269.1 transl_table 11 codon_start 1 locus_tag LOCUS_46900 CDS complement(5539474..5540337) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407356.1 transl_table 11 codon_start 1 locus_tag LOCUS_46910 CDS complement(5540334..5541254) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372160.1 transl_table 11 codon_start 1 locus_tag LOCUS_46920 CDS complement(5541251..5542393) product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737104.1 transl_table 11 codon_start 1 locus_tag LOCUS_46930 gene potA CDS complement(5542450..5543517) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269272.1 transl_table 11 codon_start 1 locus_tag LOCUS_46940 CDS complement(5543758..5544855) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767078.1 transl_table 11 codon_start 1 locus_tag LOCUS_46950 CDS complement(5545042..5546400) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269274.1 transl_table 11 codon_start 1 locus_tag LOCUS_46960 CDS complement(5546468..5547826) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555767.1 transl_table 11 codon_start 1 locus_tag LOCUS_46970 CDS 5548463..5549839 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382104.1 transl_table 11 codon_start 1 locus_tag LOCUS_46980 CDS 5550017..5550655 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024642508.1 transl_table 11 codon_start 1 locus_tag LOCUS_46990 CDS complement(5550714..5550929) product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555770.1 transl_table 11 codon_start 1 locus_tag LOCUS_47000 CDS complement(5550958..5551770) product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105420.1 transl_table 11 codon_start 1 locus_tag LOCUS_47010 gene ssuB CDS complement(5551767..5552564) product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407339.1 transl_table 11 codon_start 1 locus_tag LOCUS_47020 gene ssuC CDS complement(5552593..5553558) product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767090.1 transl_table 11 codon_start 1 locus_tag LOCUS_47030 CDS complement(5553761..5554399) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397208.1 transl_table 11 codon_start 1 locus_tag LOCUS_47040 CDS complement(5554577..5555047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267524.1 transl_table 11 codon_start 1 locus_tag LOCUS_47050 CDS 5555208..5555399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47060 CDS 5555506..5556441 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767531.1 transl_table 11 codon_start 1 locus_tag LOCUS_47070 CDS 5556441..5557145 product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767529.1 transl_table 11 codon_start 1 locus_tag LOCUS_47080 CDS complement(5557229..5558590) product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269280.1 transl_table 11 codon_start 1 locus_tag LOCUS_47090 CDS 5559119..5559943 product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103995.1 transl_table 11 codon_start 1 locus_tag LOCUS_47100 CDS 5560238..5561215 product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105422.1 transl_table 11 codon_start 1 locus_tag LOCUS_47110 gene tauA CDS 5561245..5562036 product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767098.1 transl_table 11 codon_start 1 locus_tag LOCUS_47120 gene tauB CDS 5562033..5562863 product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105423.1 transl_table 11 codon_start 1 locus_tag LOCUS_47130 gene tauC CDS complement(5563123..5563476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105424.1 transl_table 11 codon_start 1 locus_tag LOCUS_47140 CDS 5563562..5564017 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407330.1 transl_table 11 codon_start 1 locus_tag LOCUS_47150 CDS complement(5564100..5565413) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763465.1 transl_table 11 codon_start 1 locus_tag LOCUS_47160 CDS complement(5565573..5566313) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318889.1 transl_table 11 codon_start 1 locus_tag LOCUS_47170 gene ompR CDS 5566615..5568936 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266280.1 transl_table 11 codon_start 1 locus_tag LOCUS_47180 CDS 5568936..5569319 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403909.1 transl_table 11 codon_start 1 locus_tag LOCUS_47190 CDS 5569554..5571143 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763456.1 transl_table 11 codon_start 1 locus_tag LOCUS_47200 gene gshA CDS complement(5571267..5572433) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073564.1 transl_table 11 codon_start 1 locus_tag LOCUS_47210 CDS complement(5572704..5574161) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266225.1 transl_table 11 codon_start 1 locus_tag LOCUS_47220 CDS complement(5574276..5575433) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266226.1 transl_table 11 codon_start 1 locus_tag LOCUS_47230 gene argE CDS complement(5575430..5576584) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266227.1 transl_table 11 codon_start 1 locus_tag LOCUS_47240 CDS complement(5576581..5577987) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247117.1 transl_table 11 codon_start 1 locus_tag LOCUS_47250 CDS complement(5577969..5578277) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266229.1 transl_table 11 codon_start 1 locus_tag LOCUS_47260 CDS complement(5578274..5580115) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103050.1 transl_table 11 codon_start 1 locus_tag LOCUS_47270 CDS complement(5580117..5580977) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771077.1 transl_table 11 codon_start 1 locus_tag LOCUS_47280 CDS complement(5580989..5581945) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771075.1 transl_table 11 codon_start 1 locus_tag LOCUS_47290 CDS complement(5581978..5583615) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401719.1 transl_table 11 codon_start 1 locus_tag LOCUS_47300 CDS complement(5583709..5584983) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103048.1 transl_table 11 codon_start 1 locus_tag LOCUS_47310 CDS complement(5585031..5585699) product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771069.1 transl_table 11 codon_start 1 locus_tag LOCUS_47320 CDS complement(5586112..5587581) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973008.1 transl_table 11 codon_start 1 locus_tag LOCUS_47330 CDS 5587799..5588656 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266233.1 transl_table 11 codon_start 1 locus_tag LOCUS_47340 CDS 5588678..5589391 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266234.1 transl_table 11 codon_start 1 locus_tag LOCUS_47350 CDS 5589735..5590181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266235.1 transl_table 11 codon_start 1 locus_tag LOCUS_47360 CDS 5590308..5591030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463848.1 transl_table 11 codon_start 1 locus_tag LOCUS_47370 CDS 5591159..5591890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266236.1 transl_table 11 codon_start 1 locus_tag LOCUS_47380 CDS complement(5591910..5592950) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405090.1 transl_table 11 codon_start 1 locus_tag LOCUS_47390 CDS 5593066..5593968 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268271.1 transl_table 11 codon_start 1 locus_tag LOCUS_47400 CDS complement(5594032..5594238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397550.1 transl_table 11 codon_start 1 locus_tag LOCUS_47410 CDS complement(5595323..5596867) product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367573.1 transl_table 11 codon_start 1 locus_tag LOCUS_47420 CDS complement(5597047..5597949) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613652.1 transl_table 11 codon_start 1 locus_tag LOCUS_47430 gene hslO CDS complement(5598098..5598508) product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377907.1 transl_table 11 codon_start 1 locus_tag LOCUS_47440 CDS 5598685..5599467 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768488.1 transl_table 11 codon_start 1 locus_tag LOCUS_47450 CDS 5599484..5599960 product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186005924.1 transl_table 11 codon_start 1 locus_tag LOCUS_47460 CDS 5599957..5600862 product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318100.1 transl_table 11 codon_start 1 locus_tag LOCUS_47470 gene rimK CDS complement(5600972..5601457) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372189.1 transl_table 11 codon_start 1 locus_tag LOCUS_47480 gene secB CDS complement(5601495..5601749) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269283.1 transl_table 11 codon_start 1 locus_tag LOCUS_47490 gene grxC CDS complement(5601751..5602164) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269284.1 transl_table 11 codon_start 1 locus_tag LOCUS_47500 CDS 5602311..5603843 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105426.1 transl_table 11 codon_start 1 locus_tag LOCUS_47510 gene gpmI CDS 5603996..5605291 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269286.1 transl_table 11 codon_start 1 locus_tag LOCUS_47520 CDS 5605325..5606653 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413541.1 transl_table 11 codon_start 1 locus_tag LOCUS_47530 CDS 5606657..5607442 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407320.1 transl_table 11 codon_start 1 locus_tag LOCUS_47540 CDS 5607585..5609075 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463717.1 transl_table 11 codon_start 1 locus_tag LOCUS_47550 CDS complement(5609080..5609853) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463718.1 transl_table 11 codon_start 1 locus_tag LOCUS_47560 CDS complement(5609956..5610726) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551458.1 transl_table 11 codon_start 1 locus_tag LOCUS_47570 gene hisF CDS complement(5610850..5611587) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246848.1 transl_table 11 codon_start 1 locus_tag LOCUS_47580 gene hisA CDS complement(5611671..5611934) product DUF2164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397145.1 transl_table 11 codon_start 1 locus_tag LOCUS_47590 CDS complement(5611940..5612578) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767120.1 transl_table 11 codon_start 1 locus_tag LOCUS_47600 gene hisH CDS complement(5612578..5613171) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551454.1 transl_table 11 codon_start 1 locus_tag LOCUS_47610 gene hisB CDS complement(5613347..5614558) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105431.1 transl_table 11 codon_start 1 locus_tag LOCUS_47620 CDS complement(5614586..5615209) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970933.1 transl_table 11 codon_start 1 locus_tag LOCUS_47630 CDS complement(5615421..5615885) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967454.1 transl_table 11 codon_start 1 locus_tag LOCUS_47640 CDS 5616075..5617460 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523917.1 transl_table 11 codon_start 1 locus_tag LOCUS_47650 CDS complement(5617521..5619182) product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105432.1 transl_table 11 codon_start 1 locus_tag LOCUS_47660 CDS 5619440..5619844 product acetyl-CoA sensor PanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112623.1 transl_table 11 codon_start 1 locus_tag LOCUS_47670 CDS 5619943..5622168 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269293.1 transl_table 11 codon_start 1 locus_tag LOCUS_47680 CDS 5622183..5623250 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767127.1 transl_table 11 codon_start 1 locus_tag LOCUS_47690 gene mutY CDS 5623247..5623519 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555777.1 transl_table 11 codon_start 1 locus_tag LOCUS_47700 tRNA 5623622..5623697 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 CDS 5623912..5624172 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669263.1 transl_table 11 codon_start 1 locus_tag LOCUS_47710 CDS 5624156..5624482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47720 CDS complement(5624484..5624690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47730 CDS 5624841..5625077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073161698.1 transl_table 11 codon_start 1 locus_tag LOCUS_47740 CDS 5625345..5625830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269299.1 transl_table 11 codon_start 1 locus_tag LOCUS_47750 CDS 5625998..5627623 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764624.1 transl_table 11 codon_start 1 locus_tag LOCUS_47760 CDS complement(5627704..5628042) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943076.1 transl_table 11 codon_start 1 locus_tag LOCUS_47770 CDS complement(5628011..5628280) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172325.1 transl_table 11 codon_start 1 locus_tag LOCUS_47780 CDS complement(5628475..5629866) product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407279.1 transl_table 11 codon_start 1 locus_tag LOCUS_47790 gene gabP CDS 5630395..5631168 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737152.1 transl_table 11 codon_start 1 locus_tag LOCUS_47800 CDS 5631182..5631946 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105442.1 transl_table 11 codon_start 1 locus_tag LOCUS_47810 CDS 5632064..5632708 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105443.1 transl_table 11 codon_start 1 locus_tag LOCUS_47820 CDS 5632705..5633394 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383265.1 transl_table 11 codon_start 1 locus_tag LOCUS_47830 CDS 5633464..5634663 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269302.1 transl_table 11 codon_start 1 locus_tag LOCUS_47840 CDS complement(5634996..5635319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269303.1 transl_table 11 codon_start 1 locus_tag LOCUS_47850 CDS complement(5635776..5636105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316621.1 transl_table 11 codon_start 1 locus_tag LOCUS_47860 CDS complement(5636263..5637516) product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267913.1 transl_table 11 codon_start 1 locus_tag LOCUS_47870 CDS complement(5637559..5638905) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267912.1 transl_table 11 codon_start 1 locus_tag LOCUS_47880 CDS 5639012..5639923 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267910.1 transl_table 11 codon_start 1 locus_tag LOCUS_47890 CDS 5640128..5640961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47900 CDS 5640987..5641790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47910 CDS complement(5641806..5642816) product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105445.1 transl_table 11 codon_start 1 locus_tag LOCUS_47920 tRNA 5643469..5643544 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 CDS 5643956..5644216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47930 CDS 5645161..5645400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47940 CDS complement(5646038..5647555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47950 CDS complement(5647711..5649300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47960 CDS 5649746..5650735 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962250.1 transl_table 11 codon_start 1 locus_tag LOCUS_47970 CDS 5651254..5651568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47980 CDS complement(5651844..5652632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47990 CDS 5653415..5654173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666348.1 transl_table 11 codon_start 1 locus_tag LOCUS_48000 CDS complement(5654243..5655685) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 transl_table 11 codon_start 1 locus_tag LOCUS_48010 CDS complement(5655678..5656310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48020 CDS 5656194..5656463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48030 CDS complement(5656536..5657849) product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269316.1 transl_table 11 codon_start 1 locus_tag LOCUS_48040 CDS complement(5658084..5658284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044392902.1 transl_table 11 codon_start 1 locus_tag LOCUS_48050 CDS complement(5658488..5659606) product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105465.1 transl_table 11 codon_start 1 locus_tag LOCUS_48060 gene aguA CDS complement(5659606..5660484) product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372277.1 transl_table 11 codon_start 1 locus_tag LOCUS_48070 gene aguB CDS complement(5660736..5663648) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105466.1 transl_table 11 codon_start 1 locus_tag LOCUS_48080 CDS 5663909..5664991 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269320.1 transl_table 11 codon_start 1 locus_tag LOCUS_48090 gene rfbB CDS 5664988..5665863 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103413.1 transl_table 11 codon_start 1 locus_tag LOCUS_48100 gene rfbA CDS 5665860..5666405 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 transl_table 11 codon_start 1 locus_tag LOCUS_48110 gene rfbC CDS 5666688..5668502 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033832452.1 transl_table 11 codon_start 1 locus_tag LOCUS_48120 CDS 5668499..5669884 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406997.1 transl_table 11 codon_start 1 locus_tag LOCUS_48130 CDS 5669871..5670341 product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269323.1 transl_table 11 codon_start 1 locus_tag LOCUS_48140 CDS complement(5670368..5671207) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769877.1 transl_table 11 codon_start 1 locus_tag LOCUS_48150 gene cysQ CDS complement(5671204..5671770) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372295.1 transl_table 11 codon_start 1 locus_tag LOCUS_48160 gene nudE CDS 5671870..5672532 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769873.1 transl_table 11 codon_start 1 locus_tag LOCUS_48170 gene yrfG CDS complement(5672587..5673033) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769871.1 transl_table 11 codon_start 1 locus_tag LOCUS_48180 gene lysM CDS 5673187..5674068 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401941.1 transl_table 11 codon_start 1 locus_tag LOCUS_48190 CDS 5674170..5675009 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769867.1 transl_table 11 codon_start 1 locus_tag LOCUS_48200 gene fdhD CDS 5675006..5677342 product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401937.1 transl_table 11 codon_start 1 locus_tag LOCUS_48210 CDS 5677546..5678022 product glycine zipper domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621742.1 transl_table 11 codon_start 1 locus_tag LOCUS_48220 CDS 5678181..5679014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105473.1 transl_table 11 codon_start 1 locus_tag LOCUS_48230 CDS complement(5679543..5681027) product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236902.1 transl_table 11 codon_start 1 locus_tag LOCUS_48240 CDS 5681341..5682030 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407919.1 transl_table 11 codon_start 1 locus_tag LOCUS_48250 CDS 5682174..5683181 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105506.1 transl_table 11 codon_start 1 locus_tag LOCUS_48260 CDS 5683399..5684139 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105507.1 transl_table 11 codon_start 1 locus_tag LOCUS_48270 CDS 5684928..5685704 product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247460.1 transl_table 11 codon_start 1 locus_tag LOCUS_48280 CDS 5685740..5686687 product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269373.1 transl_table 11 codon_start 1 locus_tag LOCUS_48290 CDS 5686684..5690139 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269374.1 transl_table 11 codon_start 1 locus_tag LOCUS_48300 CDS 5690178..5690654 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105510.1 transl_table 11 codon_start 1 locus_tag LOCUS_48310 CDS 5690788..5691288 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089775.1 transl_table 11 codon_start 1 locus_tag LOCUS_48320 CDS 5691285..5692283 product anti-sigma factor FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113290.1 transl_table 11 codon_start 1 locus_tag LOCUS_48330 gene foxR CDS 5692447..5694861 product ferrioxamine receptor FoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113289.1 transl_table 11 codon_start 1 locus_tag LOCUS_48340 gene foxA rRNA complement(5695002..5695111) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 rRNA complement(5695227..5695336) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 rRNA complement(5695488..5698377) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 tRNA complement(5698619..5698694) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA complement(5698724..5698800) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 rRNA complement(5698924..5700457) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00190 CDS complement(5701042..5702262) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420380.1 transl_table 11 codon_start 1 locus_tag LOCUS_48350 CDS complement(5702273..5703454) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105512.1 transl_table 11 codon_start 1 locus_tag LOCUS_48360 CDS 5703611..5704519 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237633.1 transl_table 11 codon_start 1 locus_tag LOCUS_48370 CDS 5704955..5706076 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269378.1 transl_table 11 codon_start 1 locus_tag LOCUS_48380 CDS 5706087..5706407 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555867.1 transl_table 11 codon_start 1 locus_tag LOCUS_48390 CDS 5706407..5707861 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768392.1 transl_table 11 codon_start 1 locus_tag LOCUS_48400 CDS 5708087..5709535 product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269380.1 transl_table 11 codon_start 1 locus_tag LOCUS_48410 CDS 5709856..5710071 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383123.1 transl_table 11 codon_start 1 locus_tag LOCUS_48420 CDS 5710452..5710769 product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768387.1 transl_table 11 codon_start 1 locus_tag LOCUS_48430 CDS 5710844..5711149 product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105515.1 transl_table 11 codon_start 1 locus_tag LOCUS_48440 CDS 5711186..5711506 product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316115.1 transl_table 11 codon_start 1 locus_tag LOCUS_48450 CDS 5711503..5713464 product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105516.1 transl_table 11 codon_start 1 locus_tag LOCUS_48460 CDS complement(5713466..5713849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269382.1 transl_table 11 codon_start 1 locus_tag LOCUS_48470 CDS complement(5714014..5714457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024658065.1 transl_table 11 codon_start 1 locus_tag LOCUS_48480 CDS complement(5714732..5715007) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383132.1 transl_table 11 codon_start 1 locus_tag LOCUS_48490 CDS complement(5715199..5716347) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105519.1 transl_table 11 codon_start 1 locus_tag LOCUS_48500 CDS complement(5716485..5716652) product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401239.1 transl_table 11 codon_start 1 locus_tag LOCUS_48510 CDS 5716865..5717425 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269385.1 transl_table 11 codon_start 1 locus_tag LOCUS_48520 CDS 5717425..5718315 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245012.1 transl_table 11 codon_start 1 locus_tag LOCUS_48530 gene ubiA CDS 5718416..5719105 product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 transl_table 11 codon_start 1 locus_tag LOCUS_48540 gene phoB CDS 5719169..5720491 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245011.1 transl_table 11 codon_start 1 locus_tag LOCUS_48550 gene phoR CDS 5720591..5721931 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383143.1 transl_table 11 codon_start 1 locus_tag LOCUS_48560 CDS complement(5721996..5722898) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269387.1 transl_table 11 codon_start 1 locus_tag LOCUS_48570 CDS complement(5723059..5728275) product deaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105522.1 transl_table 11 codon_start 1 locus_tag LOCUS_48580 CDS complement(5728462..5729367) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768363.1 transl_table 11 codon_start 1 locus_tag LOCUS_48590 CDS complement(5729571..5730332) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378397.1 transl_table 11 codon_start 1 locus_tag LOCUS_48600 gene phoU CDS complement(5730403..5731236) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401255.1 transl_table 11 codon_start 1 locus_tag LOCUS_48610 gene pstB CDS complement(5731304..5732974) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174518729.1 transl_table 11 codon_start 1 locus_tag LOCUS_48620 gene pstA CDS complement(5732990..5735203) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418856.1 transl_table 11 codon_start 1 locus_tag LOCUS_48630 CDS complement(5735414..5736412) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768354.1 transl_table 11 codon_start 1 locus_tag LOCUS_48640 CDS complement(5736573..5737862) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269391.1 transl_table 11 codon_start 1 locus_tag LOCUS_48650 CDS 5738295..5738696 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378389.1 transl_table 11 codon_start 1 locus_tag LOCUS_48660 CDS 5738790..5739689 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269392.1 transl_table 11 codon_start 1 locus_tag LOCUS_48670 CDS complement(5739699..5740232) product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621857.1 transl_table 11 codon_start 1 locus_tag LOCUS_48680 CDS complement(5740311..5740559) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378385.1 transl_table 11 codon_start 1 locus_tag LOCUS_48690 CDS complement(5740687..5741769) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105529.1 transl_table 11 codon_start 1 locus_tag LOCUS_48700 CDS complement(5741779..5742270) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340324.1 transl_table 11 codon_start 1 locus_tag LOCUS_48710 gene purE CDS 5742650..5743291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105533.1 transl_table 11 codon_start 1 locus_tag LOCUS_48720 CDS complement(5743327..5744229) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418861.1 transl_table 11 codon_start 1 locus_tag LOCUS_48730 CDS 5744703..5746127 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739655.1 transl_table 11 codon_start 1 locus_tag LOCUS_48740 gene aspA CDS 5746410..5747861 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269396.1 transl_table 11 codon_start 1 locus_tag LOCUS_48750 CDS 5747888..5748889 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105534.1 transl_table 11 codon_start 1 locus_tag LOCUS_48760 CDS complement(5748917..5750521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48770 CDS complement(5750636..5751544) product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316074.1 transl_table 11 codon_start 1 locus_tag LOCUS_48780 CDS complement(5751667..5752878) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768334.1 transl_table 11 codon_start 1 locus_tag LOCUS_48790 CDS complement(5752972..5754528) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105535.1 transl_table 11 codon_start 1 locus_tag LOCUS_48800 CDS 5754618..5755241 product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105536.1 transl_table 11 codon_start 1 locus_tag LOCUS_48810 CDS 5755253..5755699 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105537.1 transl_table 11 codon_start 1 locus_tag LOCUS_48820 CDS 5755716..5756387 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105538.1 transl_table 11 codon_start 1 locus_tag LOCUS_48830 CDS complement(5756574..5758379) product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269402.1 transl_table 11 codon_start 1 locus_tag LOCUS_48840 gene oadA CDS complement(5758482..5759915) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401293.1 transl_table 11 codon_start 1 locus_tag LOCUS_48850 CDS 5760120..5761073 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768326.1 transl_table 11 codon_start 1 locus_tag LOCUS_48860 CDS complement(5761024..5761245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244987.1 transl_table 11 codon_start 1 locus_tag LOCUS_48870 CDS complement(5761342..5762208) product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401299.1 transl_table 11 codon_start 1 locus_tag LOCUS_48880 gene hexR CDS complement(5762376..5764871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48890 CDS 5765107..5767290 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269405.1 transl_table 11 codon_start 1 locus_tag LOCUS_48900 gene uvrD CDS 5767602..5768444 product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768318.1 transl_table 11 codon_start 1 locus_tag LOCUS_48910 CDS 5768672..5769079 product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316056.1 transl_table 11 codon_start 1 locus_tag LOCUS_48920 CDS complement(5769108..5770874) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768314.1 transl_table 11 codon_start 1 locus_tag LOCUS_48930 CDS 5771184..5771669 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378342.1 transl_table 11 codon_start 1 locus_tag LOCUS_48940 CDS complement(5771809..5772681) product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768313.1 transl_table 11 codon_start 1 locus_tag LOCUS_48950 gene pdxY CDS 5772796..5773188 product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401310.1 transl_table 11 codon_start 1 locus_tag LOCUS_48960 CDS complement(5773170..5774144) product CobW family GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105543.1 transl_table 11 codon_start 1 locus_tag LOCUS_48970 CDS 5774199..5774573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244983.1 transl_table 11 codon_start 1 locus_tag LOCUS_48980 CDS complement(5774570..5775220) product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269410.1 transl_table 11 codon_start 1 locus_tag LOCUS_48990 CDS complement(5775220..5776428) product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269411.1 transl_table 11 codon_start 1 locus_tag LOCUS_49000 gene zigA CDS 5776552..5776974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269412.1 transl_table 11 codon_start 1 locus_tag LOCUS_49010 CDS complement(5776981..5778210) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340262.1 transl_table 11 codon_start 1 locus_tag LOCUS_49020 CDS complement(5778397..5778918) product DUF3617 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401328.1 transl_table 11 codon_start 1 locus_tag LOCUS_49030 CDS 5779078..5780517 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768306.1 transl_table 11 codon_start 1 locus_tag LOCUS_49040 gene cls CDS complement(5780520..5781704) product C17 cyclopropane fatty acid synthase CfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269413.1 transl_table 11 codon_start 1 locus_tag LOCUS_49050 gene cfaB CDS complement(5781902..5783815) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768304.1 transl_table 11 codon_start 1 locus_tag LOCUS_49060 CDS complement(5783812..5784849) product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105547.1 transl_table 11 codon_start 1 locus_tag LOCUS_49070 CDS complement(5784846..5785871) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269416.1 transl_table 11 codon_start 1 locus_tag LOCUS_49080 CDS complement(5785883..5787835) product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105548.1 transl_table 11 codon_start 1 locus_tag LOCUS_49090 CDS 5788352..5789941 product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768286.1 transl_table 11 codon_start 1 locus_tag LOCUS_49100 CDS 5790343..5791650 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105555.1 transl_table 11 codon_start 1 locus_tag LOCUS_49110 CDS 5791660..5792946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105556.1 transl_table 11 codon_start 1 locus_tag LOCUS_49120 CDS complement(5792940..5793593) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401355.1 transl_table 11 codon_start 1 locus_tag LOCUS_49130 CDS complement(5793593..5794657) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105559.1 transl_table 11 codon_start 1 locus_tag LOCUS_49140 CDS complement(5794712..5796013) product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739694.1 transl_table 11 codon_start 1 locus_tag LOCUS_49150 CDS complement(5796026..5797780) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105560.1 transl_table 11 codon_start 1 locus_tag LOCUS_49160 CDS complement(5798146..5800068) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269422.1 transl_table 11 codon_start 1 locus_tag LOCUS_49170 CDS complement(5800260..5800688) product flagellar export chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211107.1 transl_table 11 codon_start 1 locus_tag LOCUS_49180 gene flgN CDS complement(5800740..5801030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49190 CDS complement(5801118..5801765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49200 CDS 5802003..5802419 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 transl_table 11 codon_start 1 locus_tag LOCUS_49210 gene flgB CDS 5802434..5802841 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367329.1 transl_table 11 codon_start 1 locus_tag LOCUS_49220 gene flgC CDS 5802845..5803522 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367328.1 transl_table 11 codon_start 1 locus_tag LOCUS_49230 gene flgD CDS 5803604..5804752 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034888230.1 transl_table 11 codon_start 1 locus_tag LOCUS_49240 gene flgE CDS 5804756..5805511 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349311.1 transl_table 11 codon_start 1 locus_tag LOCUS_49250 gene flgF CDS 5805543..5806325 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050114401.1 transl_table 11 codon_start 1 locus_tag LOCUS_49260 gene flgG CDS 5806331..5807029 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160434.1 transl_table 11 codon_start 1 locus_tag LOCUS_49270 gene flgH CDS 5807041..5808186 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817185.1 transl_table 11 codon_start 1 locus_tag LOCUS_49280 CDS 5808186..5809151 product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080846.1 transl_table 11 codon_start 1 locus_tag LOCUS_49290 gene flgJ CDS 5809430..5811040 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816603.1 transl_table 11 codon_start 1 locus_tag LOCUS_49300 gene flgK CDS 5811067..5812263 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200262.1 transl_table 11 codon_start 1 locus_tag LOCUS_49310 gene flgL CDS complement(5812391..5813179) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 transl_table 11 codon_start 1 locus_tag LOCUS_49320 gene fliR CDS complement(5813185..5813454) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 transl_table 11 codon_start 1 locus_tag LOCUS_49330 gene fliQ CDS complement(5813471..5814232) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160406.1 transl_table 11 codon_start 1 locus_tag LOCUS_49340 gene fliP CDS complement(5814229..5814651) product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704951.1 transl_table 11 codon_start 1 locus_tag LOCUS_49350 gene fliO CDS complement(5814648..5815124) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930335.1 transl_table 11 codon_start 1 locus_tag LOCUS_49360 gene fliN CDS complement(5815117..5816169) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043526237.1 transl_table 11 codon_start 1 locus_tag LOCUS_49370 gene fliM CDS complement(5816173..5816646) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196785.1 transl_table 11 codon_start 1 locus_tag LOCUS_49380 gene fliL CDS complement(5816769..5818136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49390 CDS complement(5818145..5818615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49400 CDS complement(5818634..5820025) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097732.1 transl_table 11 codon_start 1 locus_tag LOCUS_49410 gene fliI CDS complement(5820022..5820744) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282683.1 transl_table 11 codon_start 1 locus_tag LOCUS_49420 gene fliH CDS complement(5820737..5821735) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160381.1 transl_table 11 codon_start 1 locus_tag LOCUS_49430 gene fliG CDS complement(5821728..5823461) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704955.1 transl_table 11 codon_start 1 locus_tag LOCUS_49440 gene fliF CDS 5823724..5824044 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719033.1 transl_table 11 codon_start 1 locus_tag LOCUS_49450 gene fliE CDS 5824173..5825576 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146764.1 transl_table 11 codon_start 1 locus_tag LOCUS_49460 gene fliD CDS 5825601..5826002 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160351.1 transl_table 11 codon_start 1 locus_tag LOCUS_49470 gene fliS CDS 5826005..5826400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49480 CDS 5826699..5827034 product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198199.1 transl_table 11 codon_start 1 locus_tag LOCUS_49490 gene flhD CDS 5827038..5827604 product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 transl_table 11 codon_start 1 locus_tag LOCUS_49500 gene flhC CDS 5827745..5828638 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210888.1 transl_table 11 codon_start 1 locus_tag LOCUS_49510 gene motA CDS 5828644..5829546 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795630.1 transl_table 11 codon_start 1 locus_tag LOCUS_49520 gene motB CDS 5829647..5830816 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 transl_table 11 codon_start 1 locus_tag LOCUS_49530 gene flhB CDS 5830813..5832906 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066986.1 transl_table 11 codon_start 1 locus_tag LOCUS_49540 gene flhA CDS 5832903..5835158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49550 CDS 5835155..5835607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49560 CDS 5835900..5836592 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 transl_table 11 codon_start 1 locus_tag LOCUS_49570 CDS 5836641..5837963 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169305.1 transl_table 11 codon_start 1 locus_tag LOCUS_49580 CDS complement(5838071..5841505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49590 CDS complement(5841680..5842732) product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211152.1 transl_table 11 codon_start 1 locus_tag LOCUS_49600 CDS 5843057..5843881 product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081090.1 transl_table 11 codon_start 1 locus_tag LOCUS_49610 CDS 5843965..5844795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49620 CDS complement(5844851..5846419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49630 CDS complement(5846698..5846949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49640 CDS complement(5846965..5848791) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463299.1 transl_table 11 codon_start 1 locus_tag LOCUS_49650 CDS complement(5849366..5851201) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105589.1 transl_table 11 codon_start 1 locus_tag LOCUS_49660 gene glmS CDS complement(5851211..5852017) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244951.1 transl_table 11 codon_start 1 locus_tag LOCUS_49670 CDS complement(5852156..5853523) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269444.1 transl_table 11 codon_start 1 locus_tag LOCUS_49680 gene glmU CDS complement(5853632..5854051) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004882435.1 transl_table 11 codon_start 1 locus_tag LOCUS_49690 CDS complement(5854102..5855478) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555982.1 transl_table 11 codon_start 1 locus_tag LOCUS_49700 gene atpD CDS complement(5855506..5856366) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367855.1 transl_table 11 codon_start 1 locus_tag LOCUS_49710 gene atpG CDS complement(5856417..5857961) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555984.1 transl_table 11 codon_start 1 locus_tag LOCUS_49720 gene atpA CDS complement(5857983..5858519) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315956.1 transl_table 11 codon_start 1 locus_tag LOCUS_49730 CDS complement(5858532..5859002) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613564.1 transl_table 11 codon_start 1 locus_tag LOCUS_49740 CDS complement(5859060..5859317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49750 CDS complement(5859471..5860340) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377888.1 transl_table 11 codon_start 1 locus_tag LOCUS_49760 gene atpB CDS complement(5860357..5860764) product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555989.1 transl_table 11 codon_start 1 locus_tag LOCUS_49770 CDS complement(5860911..5861783) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315951.1 transl_table 11 codon_start 1 locus_tag LOCUS_49780 CDS complement(5861793..5862584) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555991.1 transl_table 11 codon_start 1 locus_tag LOCUS_49790 CDS complement(5862603..5863247) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377883.1 transl_table 11 codon_start 1 locus_tag LOCUS_49800 gene rsmG CDS complement(5863244..5865136) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993407.1 transl_table 11 codon_start 1 locus_tag LOCUS_49810 gene mnmG CDS complement(5865720..5867090) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244945.1 transl_table 11 codon_start 1 locus_tag LOCUS_49820 gene mnmE CDS complement(5867169..5868854) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401421.1 transl_table 11 codon_start 1 locus_tag LOCUS_49830 gene yidC CDS complement(5868857..5869102) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377879.1 transl_table 11 codon_start 1 locus_tag LOCUS_49840 gene yidD CDS complement(5869095..5869499) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768230.1 transl_table 11 codon_start 1 locus_tag LOCUS_49850 gene rnpA CDS complement(5869513..5869647) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551315.1 transl_table 11 codon_start 1 locus_tag LOCUS_49860 gene rpmH