COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..7682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(202..396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(440..1126) product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene deoR CDS complement(1150..1818) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693439.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene deoC CDS 1968..2891 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350272.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene rbsK CDS 2902..4191 product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816331.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene fucP CDS 4203..5219 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213216.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(5287..6315) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694505.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene trpS CDS complement(6491..6817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(6817..7512) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 sequence02 source 1..3368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 143..3072 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 assembly_gap 1626..1722 estimated_length known gap_type within scaffold linkage_evidence paired-ends rRNA 3255..3351 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence03 source 1..1640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence04 source 1..1317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence05 source 1..1312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(900..1070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 sequence06 source 1..1133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence07 source 1..1096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence08 source 1..900 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence09 source 1..756 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence10 source 1..886795 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 14..110 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS 133..297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(643..1581) product factor H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981001.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 1717..5610 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828325.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene purL CDS 5646..6272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 6279..6722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 6724..7359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(7409..7603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(8062..8772) product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694288.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene hda CDS complement(8858..9544) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026840.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene pnuC CDS complement(9603..10220) product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460236.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(10244..11518) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693795.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene hisS CDS complement(11583..12575) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693834.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(12597..13706) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693796.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene ispG CDS complement(13709..14698) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693797.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(14886..16583) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693566.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene sppA CDS 16868..17428 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693567.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 17444..18010 product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 18020..18778 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693864.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene kdsB CDS 18867..19283 product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369693.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(19344..19883) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693737.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene dsbB CDS complement(19896..21437) product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868985.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene nhaB CDS 21615..22337 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652140.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene fadR CDS 22600..23772 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694128.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene pgk CDS 23843..24922 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694127.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene fbaA CDS 25331..28498 product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene cas9 CDS 28552..29469 product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002797819.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene cas1 CDS 29462..29788 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040666777.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene cas2 repeat_region 29852..30548 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attatagcactgcgaaatgaaaaagggagctacaac CDS 30735..31295 product DUF5358 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693313.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(31366..32577) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480231.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene manA CDS complement(32577..33032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(33171..34118) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207989.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 34296..35108 product lipoprotein e(P4) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061724415.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene hel CDS 35203..36495 product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081828.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene pepB CDS 36702..37139 product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032823702.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(37152..37658) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005659678.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(37818..38663) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873880.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene nfo CDS 38734..39303 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693568.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(39393..40712) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694340.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene rlmD CDS 40800..42140 product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482541.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 42256..45171 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418667.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene rapA CDS complement(45340..45966) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652947.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene upp CDS complement(46027..46914) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694606.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene ilvY CDS complement(46895..47908) product capsular polysaccharide synthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(47901..48959) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951397.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(48966..49736) product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466243.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(49800..50012) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625828.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene rpmE CDS 50271..52268 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995655.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene tkt CDS complement(52591..53601) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694244.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene rluB CDS complement(53656..54273) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(54422..54907) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650692.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(55108..56913) product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207190.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(56941..57807) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694380.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene rsmI CDS 57900..59651 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694381.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 59626..59997 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694382.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 60008..60601 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694384.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 60612..61202 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657657.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene dolP CDS 61340..62140 product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693412.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene mlaF CDS 62137..62913 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693411.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene mlaE CDS 63025..63531 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693409.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene mlaD CDS 63632..64267 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693408.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene mlaC CDS 64275..64613 product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693407.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 64613..64870 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686372.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 64948..66222 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693405.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene murA CDS complement(66263..66481) product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454365.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 66654..67589 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092881.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 67590..68387 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195287.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(68497..69501) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217196.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene bioB CDS complement(70049..70486) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693964.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(70795..71247) product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479829.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 71351..71794 product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528340.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene lysM CDS 72127..73107 product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170493.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene manX CDS 73118..73918 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004701713.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 73932..74768 product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(74855..75490) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648504.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene lexA CDS 75633..78122 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693149.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene plsB CDS 78324..80933 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693625.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene pepN CDS 80933..81349 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155265.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 81847..83010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 83034..85898 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693970.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene valS CDS 85961..87517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020902488.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 87534..88484 product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene dcm CDS 88750..89010 product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 89262..91268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(91445..93160) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693134.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene proS CDS 93516..93746 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene acpP CDS 93967..96306 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429007.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene rnr CDS 96416..96997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 97067..98077 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693652.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(98405..100252) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693211.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene typA CDS complement(100510..100779) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652821.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene rpsO CDS complement(100903..102222) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 102426..104309 product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059358191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 104382..104549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(104627..105559) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694223.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(105697..106485) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263150.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene yghU CDS 106650..108680 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene prlC CDS complement(108747..109838) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693776.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene ychF CDS complement(109909..110493) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693775.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene pth CDS complement(110611..112542) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693993.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene thrS CDS complement(112925..113842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 114337..115707 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(115784..116857) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693740.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 117003..117815 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370312.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene suhB CDS 117881..119734 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650455.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene dxs CDS 119953..120396 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792733.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 120491..120850 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627389.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene hinT CDS 120957..121226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 121309..122007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 122203..123393 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696676.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene tyrS CDS complement(123499..124173) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693885.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene ung CDS 124386..124769 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628746.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene grcA CDS complement(124808..125020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(125031..127742) product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900957.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(127739..128557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694301.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 128650..129054 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165939.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene gloA CDS 129109..129765 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene rnt CDS 130001..131113 product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962024.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene potA CDS 131100..131960 product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694014.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene potB CDS 131960..132727 product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650699.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene potC CDS 132857..133462 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694351.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene ruvA CDS 133459..134463 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene ruvB CDS 134671..136308 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996543.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 136405..137328 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene oppB CDS 137339..138256 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651799.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene oppC CDS 138268..139863 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478061.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(139932..140801) product SAM-dependent methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694518.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene tehB CDS complement(140923..141423) product 4-hydroxyphenylacetate 3-monooxygenase, reductase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211078.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene hpaC CDS complement(141433..141747) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628170.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(141744..141902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(141968..143263) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369021.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(143360..144358) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693928.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 144447..144920 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631703.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene ybaK CDS 145094..145366 product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072323.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene ybfE CDS 145394..145918 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648709.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene fldA CDS 145940..146386 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996284.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene fur CDS 146488..149136 product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694394.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 149167..149676 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225854.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene luxS CDS 149769..151604 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686318.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 151797..153185 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038439489.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(153251..154501) product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038439909.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene lolE CDS complement(154501..155187) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene lolD CDS 155376..156677 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648049.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene eno CDS complement(156757..157938) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene purT CDS complement(158065..160383) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139989449.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 160569..161777 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693280.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 162005..162421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 162512..164203 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693852.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene recN CDS 164255..164935 product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693765.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene mutH CDS 165028..165768 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 165837..166874 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693307.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene nagZ CDS 167065..168033 product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene rlmC CDS 168224..169972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(170013..170684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(170835..173045) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694339.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 173302..174609 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096232.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene hemA CDS 174774..176288 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694423.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene der CDS 176350..177780 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693548.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene hldE CDS 177780..178307 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene pyrR CDS 178393..179337 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162877157.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 179437..180303 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649513.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene rsmA CDS complement(180318..180719) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869085.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene mutT CDS complement(180816..183524) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene secA CDS complement(183614..183952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 184061..184369 product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693258.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 184403..184771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 tRNA complement(184905..184994) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(185106..185417) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668108.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 185497..186084 product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694116.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 186417..187295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(187385..188350) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene pfkA CDS complement(188480..189673) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666793.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(189670..190350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(190423..192063) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869249.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene pgi CDS complement(192092..192349) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307315.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 tRNA complement(192464..192538) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(192588..192662) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(192687..192771) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(192775..192851) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(193017..193835) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene aroE CDS complement(193838..194392) product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694486.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(194392..194937) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694485.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(194924..195244) product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170475.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene yqfB CDS complement(195234..195683) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694572.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene recX CDS complement(195746..196846) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654959.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene recA CDS complement(196970..197572) product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(197550..198461) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(198595..199449) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481388.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 199515..200063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 200224..200772 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene pgsA CDS 200817..202652 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693865.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene uvrC CDS complement(202669..203121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(203342..206965) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694451.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene recB CDS 207100..209121 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869028.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene rep CDS complement(209170..209433) product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628952.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(209546..210772) product NCS2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694289.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 210969..211574 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626527.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene recR CDS 211656..211814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 211952..212662 product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693636.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(212666..213085) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648994.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene ruvX CDS complement(213085..213639) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694360.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(213639..214373) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694361.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene rsmE CDS complement(214534..215916) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694316.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 216231..217835 product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477897.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 217894..218694 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693839.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(218680..219228) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995131.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 219493..220302 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010360614.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 220390..221850 product surface lipoprotein assembly modifier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951324.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 222045..223685 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693400.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene pyrG CDS 223960..226230 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694192.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene metE CDS 226342..227388 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(227444..227656) product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810411.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 227828..228787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(228837..229457) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650349.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(229459..229929) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694464.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(229932..230906) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694465.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene thiL CDS complement(230916..231329) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650345.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene nusB CDS complement(231443..232735) product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(232744..233157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(233166..233678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(233685..234197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(234173..234676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 234955..237567 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118806713.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 237804..238325 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648746.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene aroK CDS 238341..239429 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694088.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene aroB CDS 239431..240255 product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996270.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 240284..241639 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(241709..242407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(242480..243850) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694117.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene gorA CDS 244075..244887 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211898.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(244884..245678) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005670537.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 245815..246750 product KpsF/GutQ family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012054716.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 246750..247235 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene greB CDS complement(247232..247408) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368237.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene yacG CDS complement(247441..248055) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869082.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene coaE CDS 248176..249480 product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531977.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene fadI CDS 249509..251632 product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425046.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene fadJ CDS 251654..253075 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216605.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(253161..253802) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693413.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene sodA CDS 254168..256624 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693830.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene thrA CDS 256624..257571 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene thrB CDS 257724..258650 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141022.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene hemC CDS 258656..259414 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815338.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene hemD CDS 259432..260889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 260899..262152 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694537.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(262219..263115) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221396.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(263115..263576) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308670.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene argR CDS 263776..264720 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694235.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene mdh CDS 264807..265070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 265117..265965 product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985340.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 266028..266981 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693473.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene trxB CDS 267114..267659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 267681..269687 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044509453.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene prc CDS 269781..271364 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694392.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 271508..272062 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170957.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 272079..272708 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694389.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 272724..273473 product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694634.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(273594..275009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(275063..277318) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100763.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(277318..278649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(278667..279542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(279556..279975) product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212170.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene exbD CDS complement(279977..280726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(280737..281519) product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012000798.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(281662..282465) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815405.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(282462..283451) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209059.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(283451..284287) product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156544.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 284441..285193 product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 285271..286428 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647570.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene pheA CDS 286519..287199 product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116956690.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 287264..288313 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene galE CDS 288314..289594 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162628661.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 289667..290311 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649108.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene adk CDS complement(290597..290857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 290739..292112 product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694344.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 292294..293889 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418419.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 294186..295190 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927863.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 295209..296099 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653671.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 296109..297101 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209562.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene dppD CDS 297115..298113 product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(298172..299479) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061720832.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 299618..300835 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225095.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 300937..301842 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655039.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene rarD CDS 301851..302714 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655039.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene rarD CDS 302718..304928 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694336.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene priA CDS complement(304939..305760) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(305783..307486) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693234.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 307710..308444 product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694261.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene artP CDS 308464..309189 product lysine/arginine/ornithine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694262.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 309194..309865 product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694263.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene artQ CDS 309865..310539 product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694264.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene artM CDS 310758..312044 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693239.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene purD CDS 312200..313870 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650218.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene ettA CDS 313959..314285 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653629.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene grxD CDS complement(314599..315069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(315062..315247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(315301..316032) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456757.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene truC CDS complement(316036..316347) product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 316786..317820 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648552.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene metN CDS 317810..318487 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459160.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 318520..319350 product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694548.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 319446..320258 product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694548.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 320313..321107 product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694548.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(321205..322632) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693997.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene pntB CDS complement(322643..324172) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693998.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene pntA CDS 324470..325522 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657804.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 325625..326659 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687477.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene mreC CDS 326656..327144 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657800.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene mreD CDS 327144..328484 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696686.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 328550..330478 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693783.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 330526..330900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 330893..331591 product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694470.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 331788..332153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 note possible pseudo, frameshifted CDS 332598..333617 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479089.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 333751..335403 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262596.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 335410..336420 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277486.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(336425..337399) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694659.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene dusA CDS 337656..339644 product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244147.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(339719..341317) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693238.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene purH CDS 341549..342130 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693244.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 342167..343405 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769341.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 343418..346543 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769342.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 346957..347751 product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874217.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene metQ CDS complement(347824..348138) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247584.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene trxA CDS complement(348255..349559) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868917.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 349983..351500 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693140.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(351849..353513) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 353891..356020 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139988996.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene pnp CDS 356136..357074 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694062.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene nlpI CDS 357276..359093 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694061.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 359198..359731 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693256.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene tadA CDS complement(359795..360871) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene leuB CDS 361005..361235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(361232..361945) product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098010.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene ubiG CDS 362211..363548 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212610.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene gdhA CDS 363739..365715 product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694555.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene cpdB CDS complement(365761..366270) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693842.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 366423..367802 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693844.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene cysS CDS 367936..369489 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656746.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene sbcB CDS 369559..370524 product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 370571..371389 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693963.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 371455..372909 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828363.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 372912..373187 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882652.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 373187..373642 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene nrdR CDS 373751..374863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 374865..375539 product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995908.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 375543..376736 product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693216.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 376740..377690 product N-acetyllactosaminide alpha-2,3-sialyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244089.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene lst CDS 377687..378859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 378852..379799 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908873.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 379814..380848 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765277.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 381031..381792 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648226.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 381810..383216 product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995534.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene wbaP CDS complement(383266..384519) product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995535.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(384598..385074) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694444.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene greA CDS 385366..386712 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694445.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene dacB CDS complement(386709..387215) product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653606.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(387217..389235) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665886.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene ligA CDS complement(389299..390126) product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693425.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene zipA CDS 390239..391090 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693426.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene cysZ CDS 391134..391622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(391643..393376) product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693193.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(393389..393610) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693192.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(393816..394652) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704691.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(394737..395468) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686921.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(395601..396275) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692001.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(396265..396924) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686917.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(397094..397489) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene msrB CDS 397682..400351 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694321.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene gyrA CDS complement(400428..401666) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(401760..402668) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694359.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene rdgC CDS 402744..403562 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482485.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene proC CDS 403559..404710 product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694357.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 404861..405403 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650156.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene apt CDS 405428..407521 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208605.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene dnaX CDS 407521..408417 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368204.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 408428..409183 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972208.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(409221..413144) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996585.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene hrpA CDS complement(413166..413711) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693397.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(413718..414296) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146104764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene grpE CDS 414519..414857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 415215..416981 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene aspS CDS 417049..417468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 417484..417936 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694349.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene nudB CDS 418004..418747 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649034.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 418782..419276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686672.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 419360..419935 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694350.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene ruvC CDS complement(419965..420309) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813850.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(420391..421410) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene ilvE CDS 421648..421866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 421883..422770 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667412.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(422832..424286) product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694602.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 424467..424946 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene gpt CDS 425012..425635 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295237.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene gmk CDS 425752..427143 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042593394.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 427233..428681 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095844.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene thiI CDS complement(428731..429432) product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260996.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 429549..430205 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666869.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene folE CDS 430258..431052 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693653.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene truA CDS 431147..432274 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene alr CDS complement(432371..432913) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694052.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 433070..435898 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694053.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene uvrA CDS 436013..436387 product YacL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 436534..437586 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693184.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene galT CDS 437599..438756 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869061.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene galK CDS 438877..439863 product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263236.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene galM CDS complement(439923..441347) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995201.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene aspA CDS complement(441539..441904) product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631924.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(441919..442287) product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074426.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(442406..443044) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693938.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene purN CDS complement(443112..444143) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene purM CDS 444373..444822 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene dksA CDS 444854..446449 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868929.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene pcnB CDS 446456..446944 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693858.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene folK CDS 447035..447349 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene yhbY CDS 447431..448153 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 448156..449073 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694104.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene nagK CDS 449091..450650 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858148.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 450711..451418 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262416.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene gloB CDS 451523..452236 product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655860.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene uppS CDS 452263..453132 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693266.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 453144..454463 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693265.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene rseP CDS 454517..456937 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693264.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene bamA CDS 457029..457802 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693263.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 457802..458830 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene lpxD CDS 458861..459310 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035660215.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene fabZ CDS 459333..460127 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651701.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene lpxA CDS complement(460752..461990) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(462008..464197) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(464213..465463) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938312.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 465674..466432 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694182.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene modA CDS 466521..467207 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628423.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene modB CDS 467216..468271 product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694180.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene modC tRNA 468402..468478 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 468592..468792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 468809..470029 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101723.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(470378..470941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(470953..471120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 471386..471646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 471834..472091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 note possible pseudo, internal stop codon, frameshifted CDS 472108..472245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(472271..473209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 473330..473905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 473932..474294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 474366..475223 product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028854.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 475450..477372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(477684..478547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(478818..479294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 479917..481626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(481731..482522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(482913..483167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(483501..483824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(483917..484303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(484600..484980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 485863..486597 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715210.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene dsbC CDS 487109..487471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 487616..488812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 488760..489005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 489346..489594 product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689049.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 489594..489932 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217440.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 490430..491761 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694213.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene argG CDS 491849..492145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(492157..492906) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene trmJ CDS 493029..494063 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694419.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(494175..494507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(494500..494775) product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259386.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(494883..496826) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694483.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 496908..497540 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262766.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 497599..498846 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693918.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene moeA CDS 498856..499335 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694049.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene bcp CDS 499325..499867 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694551.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene gmhB CDS complement(499985..500731) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107734.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(500752..501918) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107732.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(501931..502728) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115101.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 502939..504006 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837452.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 504046..504588 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206776.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(504684..505241) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632773.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene frr CDS 505406..505990 product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694260.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene lpcA CDS 506328..508271 product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 508466..509680 product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 510506..520570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(520949..521674) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694346.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene cmoA CDS complement(521722..522156) product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694240.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene yfbV CDS 522281..523027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648352.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 523048..523596 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655641.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 523586..524032 product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655643.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene yciA CDS 524060..524356 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648344.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(524437..524790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 525222..528104 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693853.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene glnE CDS 528097..528837 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 528834..529223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 529308..530288 product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694646.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene rseB CDS 530310..530738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 530749..532458 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693780.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene fadD CDS complement(532553..533353) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647819.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(533478..534263) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693761.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene znuB CDS complement(534281..535066) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666536.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene znuC CDS 535220..536836 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene mepM CDS 536848..537534 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647404.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene dsbC CDS 537609..539324 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694232.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene recJ CDS 539463..540311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 540385..541203 product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210759.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 541216..541734 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642421.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 541848..542735 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525505.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene dapA CDS 543086..543838 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694391.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 543967..546540 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112130572.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene clpB CDS complement(547068..547922) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142493.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(547965..550016) product MobH family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088056948.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene mobH CDS 550147..551103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 551266..552033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(552139..552462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 552709..553365 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042061.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(553711..554295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(554261..555604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(555929..556573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(556681..556803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(556794..557036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(557111..557299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(557382..558353) product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150388385.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(558443..559327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(559450..559581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(559622..559858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(559851..560105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(560178..560522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 560911..561336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 561339..562313 product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024483820.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 562332..564302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 564315..564668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 564748..565056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(565110..566624) product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(566624..566971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(567026..567400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(567444..570287) product conjugative transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165699602.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(570300..570713) product TIGR03751 family conjugal transfer lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149288294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(570724..572148) product TIGR03752 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166082.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(572158..572997) product TIGR03749 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058700.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(573004..573648) product TIGR03746 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203388111.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(573645..574022) product TIGR03750 family conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817086.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(574037..574396) product TIGR03745 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126599277.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(574429..574665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(574662..574988) product RAQPRD family integrative conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007372612.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(575315..576055) product TIGR03747 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007251563.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(576055..576390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(576371..578533) product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene traD CDS complement(578530..579036) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162526859.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(579052..579888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(579867..580616) product TIGR03759 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734461.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(580733..581386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(581540..581872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(581938..582411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(582790..583128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(583250..583867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(583958..584167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(584219..584656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(585790..587820) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267044.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 587916..588152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(588127..589032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382296.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(589211..589486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(589630..590085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(590156..590671) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694052.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(590999..591502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(591495..592232) product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(592886..594145) product STY4528 family pathogenicity island replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016190692.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(594230..594790) product DUF2857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817114.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(594783..596528) product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029724.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(596531..597919) product SPI-7-type island replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059486.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene dnaB-PI CDS complement(597930..598760) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895559.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 tRNA complement(598840..598925) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(599112..599984) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene ubiA CDS complement(599984..600748) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(600825..602192) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423729.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene purB CDS complement(602207..602836) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694504.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene hflD CDS 603053..605458 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693703.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene lon tRNA complement(605889..605965) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(606056..606871) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664434.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene apaH CDS 607026..609200 product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920055.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(609314..611323) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694220.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene rnb CDS complement(611409..612197) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649928.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 612422..613048 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694443.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene rlmE CDS 613115..615064 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869183.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene ftsH CDS 615293..616543 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444484.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene icd CDS 616656..618290 product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216735.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 618479..621082 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209333.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene acnB CDS 621167..622453 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097545.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(622506..623993) product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207749.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(624026..624463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(624463..625683) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828332.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene rhlB CDS 625867..626883 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885260.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene argF CDS 626943..627575 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693620.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene lolB CDS 627575..628429 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869257.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene ispE CDS 628455..629405 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647284.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 629481..630491 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693962.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene pyrD CDS complement(630533..631168) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654382.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene nth CDS complement(631168..631929) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664344.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(631954..633054) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693251.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene proB CDS 633301..636153 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693204.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene polA CDS complement(636439..636957) product rhodanese family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022010.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 637227..638825 product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169566.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene tyrR CDS 638825..640498 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693646.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 640526..641485 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693647.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 641475..642365 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693648.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 642368..643414 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693649.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(643507..644397) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042594642.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 644554..647166 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429232.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene topA CDS 647408..647983 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693127.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene yihI CDS 648014..648463 product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693128.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 648471..649838 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213155.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene hemN CDS 649915..652275 product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene lptD CDS complement(652419..652922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 653382..654458 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694426.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(655026..655661) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996462.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(655673..656683) product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660510.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene purR CDS 656963..658966 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706179.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene mnmC CDS complement(659021..660217) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705754.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(660287..660517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 660429..661355 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694317.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene accD CDS 661356..662654 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene folC CDS 662973..663845 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693846.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene tesB CDS 663995..664960 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694009.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene cmoB CDS complement(664957..665394) product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209282.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(665413..665979) product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225832.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 666082..667032 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693987.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene ttcA CDS 667091..667894 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663264.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene xthA CDS complement(667984..669636) product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707241.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(669918..672191) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694306.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 672604..674325 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005671546.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 674318..674809 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647229.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene ilvN CDS 675053..676264 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050845826.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene sstT CDS 676493..678703 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693861.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(678746..679513) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662331.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene fnr CDS complement(679833..681236) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869177.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene asnS CDS 681391..682896 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696218.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene ppx CDS complement(682882..683091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 683165..683629 product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660595.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene nanQ CDS 683638..684504 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 684599..685480 product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694428.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene nanA CDS 685714..686595 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652747.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene metF CDS complement(686657..687682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 note possible pseudo, frameshifted CDS complement(688243..689631) product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099331.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene cpxA CDS complement(689688..690401) product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene cpxR CDS complement(690501..691283) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693705.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene mazG CDS 691358..692677 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693180.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene pepP CDS 692802..693884 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694273.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene serC CDS 693967..695061 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694274.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene hisC CDS 695150..696448 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693605.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene aroA CDS 696613..697038 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648375.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene uspA CDS 697210..699834 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995486.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene alaS CDS 699894..700085 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632782.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene csrA CDS 700128..701492 product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene cpsG CDS 701566..702453 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693178.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene galU CDS 702508..703539 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648024.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene degS CDS 703548..704219 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042611231.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene cmk CDS 704316..705983 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene rpsA CDS 706046..706327 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420161.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene ihfB CDS 706369..706656 product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650128.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 706656..707846 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694286.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene lapB CDS 707859..708551 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667227.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene pyrF CDS 708580..708891 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455336.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene yciH CDS 709031..709285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(709356..710075) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693920.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene bioD CDS complement(710124..711323) product DNA-binding transcriptional repressor Mlc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225287.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene mlc CDS 711477..712616 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013526513.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene rnd CDS complement(712886..713086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 713629..718365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 718741..719052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 719241..720443 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694241.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 720572..722707 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694242.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene pta CDS 722872..723642 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649665.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(723691..724371) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663315.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(724364..725266) product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693893.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene fdxH CDS complement(725268..728333) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602782.1 transl_table 11 codon_start 1 transl_except (pos:727746..727748,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_06720 gene fdnG CDS 728523..729362 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene fdhD CDS complement(729417..730082) product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210637.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene ompW CDS complement(730258..730890) product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693879.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 730961..731602 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732846.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(732007..733269) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693240.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(733400..735991) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694204.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene glnD CDS complement(736126..737736) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648384.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene pckA CDS 737966..738241 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455577.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene ftsB CDS 738257..738943 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655267.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene ispD CDS 738936..739415 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene ispF CDS complement(739432..739701) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705401.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 tRNA complement(739779..739855) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 740051..741157 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112089645.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene mltA CDS complement(741215..742681) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693773.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene xseA CDS 742856..743119 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(743184..743432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 743610..744365 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693825.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 744399..745451 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420484.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 745564..746097 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651852.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene yjgA CDS 746099..746446 product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652996.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(746567..747526) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092876.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(747696..748112) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650453.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(748112..748780) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650452.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene sspA CDS 748921..749238 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653635.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 749312..750007 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631770.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene can CDS complement(750085..754548) product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693982.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene mukB CDS complement(754548..755276) product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693983.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene mukE CDS complement(755362..756693) product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869195.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene mukF CDS complement(756798..757703) product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693559.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(757712..758482) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666147.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene mtgA CDS complement(758469..758777) product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629736.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene trpR CDS complement(758849..759487) product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693608.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene lolA CDS complement(759564..759695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 759797..760366 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309405.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 760478..760687 product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652728.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene cspD CDS complement(760841..761578) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694112.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene pgeF CDS complement(761605..761994) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630808.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 762130..763131 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869067.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene yejK CDS 763193..763537 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693190.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene bamE CDS complement(763603..764691) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298239.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(764718..765659) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429261.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene truB CDS complement(765662..766045) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694530.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene rbfA CDS complement(766237..767892) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095358.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene treC CDS complement(767944..768354) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206102.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(768323..768958) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(769129..770553) product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042066915.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene treB CDS complement(770687..771238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 note possible pseudo, frameshifted CDS complement(771232..771906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 note possible pseudo, frameshifted CDS complement(771997..772941) product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174281.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene treR CDS complement(773062..775653) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650282.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene infB CDS complement(775673..777187) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691699.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene nusA CDS complement(777202..777681) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657488.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene rimP tRNA complement(777942..778018) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(778142..779161) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694623.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene glpX CDS 779370..781046 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650680.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene glnS CDS complement(781120..781980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(781982..783994) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694308.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene uvrB CDS complement(784106..786037) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065250839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(786047..786835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 786959..787183 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693923.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene xseB CDS 787183..788076 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061724061.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene ispA CDS complement(788320..788841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(789628..789786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(790205..790654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(790675..791232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(791277..791621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(791744..791932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(792254..792451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(792705..792965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(793161..793340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(793397..793612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(793602..793763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 793922..794122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 794232..794447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 794506..794781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(794796..795128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(795176..795625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(795942..796235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 796457..796678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 tRNA complement(796822..796895) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(796900..796975) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 797197..798009 product EfeM/EfeO family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836939.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 798019..799218 product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136411.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene efeB CDS 799175..800896 product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900389.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 801031..803058 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667119.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 803311..805584 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694003.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene glgB CDS 805589..807571 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694002.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene glgX CDS 807597..808892 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005706553.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene glgC CDS 809023..810456 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429230.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene glgA CDS complement(810841..811323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(811268..811861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(811916..812116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(812179..812403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 812433..812621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(812649..812834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 813470..814933 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694071.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene guaB CDS 815187..815687 product DUF1919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694305.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 815720..815944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 note possible pseudo, internal stop codon, frameshifted CDS 816097..816582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 816628..818199 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene guaA CDS complement(818718..819824) product methionine biosynthesis PLP-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661154.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(819867..820679) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694461.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene dapB CDS complement(820754..821839) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869151.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene rlmM CDS complement(821856..822257) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693396.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 822680..823573 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694398.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene moaA CDS 823589..824089 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005642378.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene moaC CDS 824086..824331 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene moaD CDS 824332..824802 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694395.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene moaE CDS 824840..825325 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663323.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene ybeY CDS 825337..827190 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298646.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 827288..828280 product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene mglB CDS 828331..829848 product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652432.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene mglA CDS 829867..830877 product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652434.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene mglC CDS 830993..832201 product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097970.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene setB CDS complement(832226..832939) product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995886.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(832932..833867) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 834061..835134 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694320.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(835258..836412) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627231.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene metK CDS 836563..838080 product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706611.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 838101..838865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 838862..840007 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099301.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene argE CDS 840082..841062 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172553.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 tRNA complement(841204..841279) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(841367..842119) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829217.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene moeB CDS complement(842119..843276) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693701.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene hemW CDS complement(843369..844748) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693026.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(844793..846022) product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666700.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(846254..847633) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693612.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene radA CDS 847864..848301 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 848367..849761 product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694368.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 849754..850968 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694369.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 850965..851624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(851695..853212) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694238.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene purF CDS complement(853221..853733) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694239.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(853808..855424) product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(855582..857006) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663527.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene lpdA CDS complement(857160..859070) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963533.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene aceF CDS complement(859126..861783) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694293.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene aceE CDS 862154..862648 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693627.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene purE CDS 862659..863624 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642578.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 863721..864809 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693629.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene purK CDS complement(864883..866385) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050838325.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene lysS CDS complement(866537..868969) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995225.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene gyrB CDS complement(869158..870078) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693890.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene fdhE CDS 870273..871307 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 871405..873438 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769364.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 873449..874501 product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429501.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene fbpC CDS complement(874627..874776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(874969..875457) product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene folA CDS complement(875558..877201) product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017019471.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene ushA CDS complement(877264..877626) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072235.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(877756..879090) product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693469.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(879185..879949) product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995944.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(879958..880818) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368935.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene fieF CDS complement(880861..881391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(881388..882164) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869102.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene yaaA CDS complement(882317..883447) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650087.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene nrdB CDS complement(883515..885782) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815972.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene nrdA misc_feature complement(886094..>886795) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235893157.1:group II intron reverse transcriptase/maturase locus_tag LOCUS_08260 sequence11 source 1..678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence12 source 1..610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 155..231 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 271..346 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 sequence13 source 1..552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence14 source 1..493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence15 source 1..486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence16 source 1..440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence17 source 1..422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence18 source 1..420 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence19 source 1..404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 171..246 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 sequence20 source 1..395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence21 source 1..391542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(279..827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(1735..1920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(1904..2113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 2707..4890 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647471.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene uvrD CDS 4915..5673 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666039.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 6021..7304 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693148.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(7350..8384) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694133.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene tsaD CDS complement(8487..9266) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694110.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 9415..10392 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694111.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene rluD CDS complement(10707..11474) product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477430.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene fecE CDS complement(11474..12472) product Fe(3+) dicitrate ABC transporter permease subunit FecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684856.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene fecD CDS complement(12472..13386) product iron-dicitrate ABC transporter permease FecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125178.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene fecC CDS complement(13455..14351) product Fe(3+) dicitrate ABC transporter substrate-binding protein FecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879153.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene fecB CDS complement(14395..15291) product Fe(3+) dicitrate ABC transporter substrate-binding protein FecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879153.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene fecB CDS 15483..17642 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097266.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene rlmKL CDS 17652..18131 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652354.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene trmL CDS complement(18176..19021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(19031..19417) product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694050.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene exbD CDS complement(19483..19935) product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648856.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene exbB CDS 20101..20427 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694604.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene glpE CDS 20520..21575 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216779.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene sohB CDS 21790..22779 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869101.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene dusB CDS 22779..23072 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651583.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene fis CDS complement(23551..24846) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693676.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 tRNA complement(24891..24967) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(25055..25131) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(25145..25238) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(25390..25881) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651674.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(25883..26755) product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995656.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene serB CDS 26891..27556 product AhpA/YtjB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417713.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 27646..27864 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627617.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene infA CDS complement(27917..28084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(28077..29075) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693863.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene lpxK CDS complement(29130..30383) product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661954.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene clpX CDS complement(30388..30972) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694635.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene clpP CDS 31108..31491 product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694476.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(31484..32068) product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693799.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene pilW CDS complement(32145..33317) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172454032.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 tRNA complement(33548..33623) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(33658..33733) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(33783..33858) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 34050..35489 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668173.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene gltX tRNA 35571..35646 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(35808..36221) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693236.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 36365..37255 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143867.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(37285..39453) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083954.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene copA CDS complement(39454..39651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 39802..41706 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693553.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene parE CDS complement(41747..42628) product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648623.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(42630..43325) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687966.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 43578..44846 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456066.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 44951..45727 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166916.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene deoC CDS 45796..47028 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815520.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene deoB CDS 47051..47767 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694122.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene deoD CDS complement(47833..48816) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693356.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene thiB CDS 49156..50439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 50558..51985 product surface lipoprotein assembly modifier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980777.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 52558..53997 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694060.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene mltF CDS complement(54223..55020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(55185..56843) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693715.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(56890..57837) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693714.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene fruK CDS complement(57847..59400) product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693713.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene fruB CDS complement(59599..60018) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172454026.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene ndk CDS complement(60068..62119) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694519.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene metG CDS complement(62398..63318) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693459.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene lpxC CDS complement(63357..64538) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462780.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene ftsZ CDS complement(64578..65846) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693456.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene ftsA CDS complement(65874..66653) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693455.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(66653..67576) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693454.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(67641..69068) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693453.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene murC CDS complement(69158..70213) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693451.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene murG CDS complement(70226..71404) product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661306.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene ftsW CDS complement(71404..72705) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene murD CDS complement(72766..73848) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651824.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene mraY CDS complement(73859..75253) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996536.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene murF CDS complement(75292..75819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(75821..77326) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693448.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene murE CDS complement(77338..79380) product peptidoglycan synthase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(79387..79698) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647600.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene ftsL CDS complement(79698..80636) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651812.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene rsmH CDS complement(80671..81129) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686427.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene mraZ CDS 81550..81858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(81997..83133) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(83156..83653) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693857.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene tsaE CDS complement(83667..84218) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene orn CDS complement(84211..84699) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171873.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene coaD CDS complement(84692..85993) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694491.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene waaA CDS complement(86019..89495) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693144.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene dnaE CDS complement(89507..90574) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694193.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene lptG CDS complement(90576..91673) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658246.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene lptF CDS 91863..93353 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694194.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 93497..94894 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693745.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene yegQ CDS 95002..95820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(95811..97628) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693132.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene recQ CDS complement(97628..97936) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655473.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene cyaY CDS 98236..99186 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691510.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 99253..99996 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694335.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene trmB CDS 100015..100362 product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694334.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 100410..100943 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209984.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 100953..101249 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417561.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene yggU CDS 101338..102117 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261310.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 102213..103496 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828395.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 103667..104650 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693233.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene ispB CDS 104684..105379 product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651413.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 105445..106380 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694437.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene fabD CDS 106429..107154 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694436.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene fabG CDS 107286..108566 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039275.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene brnQ CDS 108642..109466 product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693293.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene mutM CDS 109553..110476 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene rocF CDS complement(110796..112139) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655956.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene accC CDS complement(112217..112681) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693317.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene accB CDS complement(112881..113321) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707111.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene aroQ CDS complement(113379..113723) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206513.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene arsC CDS complement(113723..115024) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429435.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(115202..117079) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963039.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 117482..117871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(117972..119330) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693343.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene mnmE CDS complement(119528..120736) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095714.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene ackA CDS 120909..123299 product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694212.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene mrcB CDS 123504..125129 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 125129..125692 product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694270.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(125739..126287) product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693181.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 126363..126692 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651366.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 126940..127530 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(127527..128417) product surface lipoprotein assembly modifier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225101.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(128530..129303) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123956445.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(129300..129746) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(129841..130431) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(130505..131545) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995711.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(131526..132506) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene dusC CDS complement(132520..133143) product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262343.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(133143..133982) product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694031.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene djlA CDS complement(134100..134561) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652235.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene pal CDS complement(134579..135832) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693786.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene tolB CDS complement(135889..137199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(137216..137656) product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649190.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene tolR CDS complement(137733..138413) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene tolQ CDS complement(138450..138842) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693784.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene ybgC CDS complement(138984..139271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(139382..140518) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656051.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene cydB CDS complement(140530..142083) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869127.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 142446..142769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(142837..143520) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666622.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(143651..144529) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(144529..145305) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630123.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(145316..146194) product iron/manganese ABC transporter substrate-binding protein YfeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170110.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene yfeA CDS complement(146297..147334) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694198.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene rsgA CDS complement(147631..149643) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817357.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene malQ CDS complement(149736..150626) product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817307.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene malG CDS complement(150643..152193) product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361466.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene malF CDS complement(152392..153576) product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095045.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene malE CDS 153900..155039 product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179165.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene malK CDS 155095..156372 product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174568.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 156484..157344 product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050078161.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene malM CDS complement(157472..158320) product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654786.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(158308..159174) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693587.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene prmC CDS complement(159183..160265) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032803489.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene prfA CDS complement(160393..160665) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044511.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene hupA CDS complement(160782..161372) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693732.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(161409..162485) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene hemE CDS complement(162543..163331) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650376.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(163433..164809) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693177.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene argH CDS complement(164906..166216) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene pepQ CDS 166248..166487 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869042.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene tusA CDS 166656..167546 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852073.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 167556..167885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263374.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 167911..168849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 168879..171224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 171236..172141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 172154..172888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 172879..175296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 note possible pseudo, frameshifted CDS 175323..176330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 176353..176766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 176892..177545 product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065267398.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 177566..177763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 177990..178721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 178731..179504 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005679031.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(179583..180296) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766240.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(180408..181187) product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008882117.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 181633..183420 product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663061.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene frdA CDS 183427..184197 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005639269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 184208..184600 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648336.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene frdC CDS 184611..184955 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648338.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene frdD CDS 185102..185740 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836677.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(185771..186001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(186003..186758) product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210246.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene menH CDS complement(186758..188470) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115587756.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene menD CDS complement(188641..189924) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071513.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene hemL CDS complement(190556..191506) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693427.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene cysK CDS 191721..192449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 192449..192952 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996506.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(193000..193857) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649949.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(194454..195422) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686665.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene secF CDS complement(195432..197243) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694058.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene secD CDS complement(197305..197598) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705624.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene yajC CDS 197802..198362 product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429484.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(198558..199376) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694570.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 199886..201430 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693326.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene leuA CDS complement(201503..202867) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693739.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene pssA CDS complement(203042..205855) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210509.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene ileS CDS complement(205925..206881) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828335.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene ribF CDS 206945..207112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(207175..209652) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084281.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(209788..210723) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 210839..211798 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693754.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene rluC CDS 211833..212354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 212414..213220 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694653.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene folP CDS complement(213252..214475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(214465..216222) product yersiniabactin ABC transporter ATP-binding/permease protein YbtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212761.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene ybtQ CDS complement(216228..217958) product yersiniabactin ABC transporter ATP-binding/permease protein YbtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640167.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene ybtP CDS complement(217961..219940) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279435.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 220084..220668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 220705..221052 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693817.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 221054..222190 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693818.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene dapE CDS 222191..222874 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208550.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 222871..223623 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693198.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(223691..224698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(224792..226660) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210359.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene rpoD CDS complement(226765..228513) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649498.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene dnaG CDS complement(228661..228876) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627632.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene rpsU CDS 229716..232610 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868984.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene rne CDS 232703..233446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 233513..234181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 234410..235978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 236115..237605 product surface lipoprotein assembly modifier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980777.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 238113..238739 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene yihA CDS 238743..239168 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene rraB CDS complement(239348..239986) product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224851.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 240212..240880 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654471.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene rluA CDS 240939..242330 product sodium-coupled multidrug efflux MATE transporter HmrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693623.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene hmrM CDS complement(242554..243228) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene crp CDS complement(243287..243511) product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369405.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(243532..244137) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648000.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene slmA CDS complement(244181..244636) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631431.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene dut CDS complement(244754..245959) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693302.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene coaBC CDS 246122..246814 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527272.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene radC CDS 246963..247199 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005542826.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene rpmB CDS 247210..247380 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613503.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene rpmG tRNA complement(247833..247917) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(247935..248010) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(248037..248123) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(248141..248216) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 assembly_gap 248219..248227 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(248278..248353) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(248514..251975) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694314.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene mfd CDS complement(252300..253385) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693333.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene recF CDS complement(253407..254510) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693335.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene dnaN CDS complement(254520..255848) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059095.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene dnaA CDS complement(256054..256179) product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300174.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene ykgO CDS complement(256189..256458) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217400.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 256636..257310 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070664.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene rpe CDS complement(257398..260607) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225779.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene carB CDS complement(260957..262099) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244304.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene carA CDS 262365..263663 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815452.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 263685..264764 product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524106.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(264884..265444) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705809.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 265509..265838 product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387034.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(266101..266598) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669389.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene rraA CDS complement(266665..267915) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667179.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(267912..268505) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212145.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene rnhB CDS complement(268502..269392) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693695.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(269522..270664) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828442.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene dnaJ CDS complement(270748..271119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(271311..271808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(271879..273780) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694297.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene dnaK CDS complement(274002..275060) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848110.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene rffG CDS 275219..275560 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295564.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene erpA CDS 275757..277394 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693342.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene yidC CDS 277504..277965 product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694029.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 278105..279295 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693175.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene ispC CDS 279577..280251 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263181.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene yjjG CDS 280285..281268 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667393.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene cysB CDS 281268..281912 product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689669.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(281993..283585) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(283697..285640) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694450.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene recD CDS complement(285712..287151) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429176.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene pyk CDS 287299..287793 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652786.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene sixA CDS 288076..288288 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221949.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene cspE CDS complement(288641..291043) product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817356.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene malP CDS complement(291197..291367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 291547..292614 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490838.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(292873..295587) product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208926.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene malT CDS 296025..296978 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723876.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene msrP CDS 296978..297571 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240095.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene msrQ CDS 297680..298441 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453786.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 298504..300336 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112119346.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene glmS CDS complement(300409..301239) product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693770.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene cpdA CDS complement(301367..303268) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693855.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene mutL CDS complement(303409..304029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(304091..304588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(304660..304947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 305419..306669 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693130.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene lysA CDS complement(306811..307002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(307071..308060) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693667.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(308144..308410) product DsrH/TusB family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649577.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(308429..308800) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654660.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene tusC CDS complement(308802..309155) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694173.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene tusD CDS complement(309155..309811) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694171.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(309862..310578) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212318.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene fkpA CDS 310653..310886 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694169.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 310894..311625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 311622..312314 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694230.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 312479..313810 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704839.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene rimO CDS 313830..315872 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208722.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 316136..316384 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653865.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene rpsP CDS 316414..316941 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653863.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene rimM CDS 316992..317747 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661387.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene trmD CDS 317773..318123 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648735.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene rplS CDS complement(318221..318664) product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628871.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene matP CDS 318775..320415 product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826279.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 320529..321059 product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650386.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene fabA CDS 321147..321671 product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693285.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 321625..322326 product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 322326..322988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 322981..323280 product DUF5374 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995601.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 323336..326611 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693290.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene recC CDS 326611..329553 product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816978.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene ptrA CDS complement(329752..330114) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene crcB CDS complement(330133..331137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(331370..331570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(331685..333364) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109303.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(333387..333557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(333832..334545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 note possible pseudo, internal stop codon CDS complement(334598..336673) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073633.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(336763..337776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(337915..338853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(339557..340516) product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694411.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene znuA CDS 341074..342489 product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302010.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene tnaA CDS 342556..343782 product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043405.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 343944..345407 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene ubiD CDS complement(345707..346918) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693774.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 347079..348638 product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142741014.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(348683..349438) product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388039.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 349516..350082 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909445.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 350227..351135 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628151.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene glyQ CDS 351251..351808 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 351813..352571 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694435.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 352559..352978 product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834704.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene psiE CDS 352987..353610 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013526508.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene nudF CDS 353763..354257 product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445093.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene hutX CDS 354269..354799 product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704904.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene hutZ CDS 354932..355840 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692390.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene xerC CDS complement(355845..357035) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694067.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene nhaA CDS 357331..357465 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539760.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene rpmH CDS 357502..357885 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647913.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene rnpA CDS 357834..358121 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene yidD CDS 358344..358820 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686601.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 358850..359182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691265.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 359261..360154 product DUF692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647267.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 360173..360901 product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693614.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(360923..361531) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828482.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 361707..362669 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 362811..365444 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704330.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 365517..365942 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339636.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 366156..366446 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074357.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 366443..366808 product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141056643.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(366872..367267) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688532.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 367334..368014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 367989..368675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 368686..369687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(369819..370238) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(370247..370507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 370678..371631 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694641.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene fmt CDS complement(371842..372567) product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694168.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(372712..373221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(373247..373903) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692076.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(373896..375080) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654778.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(375155..375700) product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216968.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(375710..376657) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693583.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(376787..377638) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693586.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene kdsA CDS complement(378022..378519) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693150.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene tpx CDS 378705..379430 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005689023.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 379444..380850 product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817210.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene ftsP CDS 380974..381927 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693763.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene accA CDS 382093..382677 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652768.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 382677..382868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(383187..384551) product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694197.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene qseC CDS complement(384538..385209) product two-component system response regulator QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(385287..385655) product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707500.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(385814..386578) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037586615.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(386646..387173) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055072.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene ppa CDS 387388..388869 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654301.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene ilvC CDS complement(389019..389729) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828382.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(389730..390680) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667563.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene coaA tRNA 390915..390990 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 391026..391110 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 391151..391225 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 391229..391304 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 sequence22 source 1..382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence23 source 1..360 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence24 source 1..341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence25 source 1..335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence26 source 1..331 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence27 source 1..322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence28 source 1..321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence29 source 1..321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence30 source 1..311 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence31 source 1..307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence32 source 1..270823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2752..4155) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693645.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 4261..5112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 5105..5521 product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067589.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 6013..7017 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005646416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene gap CDS 7196..7750 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649445.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(7803..9347) product Dot/Icm type IV secretion system effector LidL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946906.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene lidL CDS complement(9431..10111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(10143..10571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(10771..12120) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693467.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene pmbA CDS 12349..13272 product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704803.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene yvcK CDS 13323..14408 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694057.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene queA CDS complement(14541..14828) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691222.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene rplY CDS 15111..17624 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(17697..18692) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691796.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene epmB CDS complement(18702..19274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 19458..20024 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544066.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene efp CDS 20155..20373 product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650820.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene zapB CDS 20427..21005 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649496.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(21181..22302) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650298.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene tyrA CDS complement(22305..23366) product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548559.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene aroF CDS complement(23406..24440) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115608061.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(24467..24805) product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene tusE CDS complement(24865..25527) product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene yccA CDS complement(25837..26643) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116524.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(26643..28601) product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804463.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(28601..29554) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853884.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(29721..31310) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804465.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(31541..32002) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687959.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene rnhA CDS complement(32071..32907) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693604.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene purU CDS complement(32989..33393) product DNA-binding protein H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460020.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 33918..35423 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236747.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(35519..35737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(35737..36249) product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648824.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(36242..37399) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005645731.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene tgt CDS complement(37820..38284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(38356..39195) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887404.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(39344..40405) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(40608..41870) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223735.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(41872..42894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(42963..43427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 43673..44326 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654445.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene udk CDS 44336..44920 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649599.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene dcd CDS complement(44983..45696) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693391.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene pyrH CDS 45915..47390 product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693345.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(47454..47648) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656371.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene iscX CDS complement(47648..47989) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656373.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene fdx CDS complement(47999..49855) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693792.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene hscA CDS complement(49937..50569) product DUF2625 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693791.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(50605..51126) product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693789.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene hscB CDS complement(51136..51459) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693788.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene iscA CDS complement(51619..51999) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213175.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene iscU CDS complement(52058..53278) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868979.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(53314..53763) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005659892.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene iscR CDS complement(53909..54193) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030904.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 54446..55936 product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 56003..56563 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828387.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 56620..57810 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694414.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene metC CDS complement(57844..58761) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693153.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene murQ CDS complement(58786..59913) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693152.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(59939..62167) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703609.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene arcB CDS complement(62199..63062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(63172..63699) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene smrB CDS 63789..64739 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene prmB CDS 64970..67609 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693644.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene ppc CDS 67753..69999 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693555.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene parC CDS complement(70096..71394) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105886347.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(71381..72073) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693747.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene thiE CDS complement(72075..72902) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693748.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene thiD CDS complement(72895..73695) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene thiM CDS complement(73705..74649) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693803.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(74672..75325) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene tenA CDS complement(75368..76132) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693804.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(76129..76839) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693805.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 77262..80069 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869267.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene sucA CDS 80192..81418 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694387.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene odhB CDS 81495..81875 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 81947..82111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 82108..83274 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367670.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene sucC CDS 83274..84146 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455492.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene sucD CDS complement(84200..86326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(86421..86960) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693468.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene hpt CDS complement(87298..88893) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005670186.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(89087..90439) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095032.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene lysC CDS 90939..91769 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694094.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene mepA CDS 91907..93826 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693718.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 93950..94276 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693717.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene secG tRNA 94286..94371 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(94630..95319) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693782.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene tsaB CDS complement(95365..96435) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165590136.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene aroG CDS complement(96617..99436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(99446..99928) product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664572.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene lrp CDS complement(100082..101299) product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666410.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 101527..102498 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828336.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene menC CDS complement(102548..103180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(103317..104501) product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192216.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene ubiI CDS complement(104503..105363) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243739.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene rapZ CDS complement(105363..105905) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693461.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene ptsN CDS complement(105968..106693) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647567.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene lptB CDS complement(106703..107221) product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693464.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene lptA CDS complement(107231..107836) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467805.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene lptC CDS complement(108047..109084) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650701.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(109271..110746) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650682.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene rng CDS 110959..112722 product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650259.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(112884..114332) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707676.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 114596..116284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(116337..116765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 117009..118892 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828396.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene htpG CDS complement(118954..120165) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 120436..123018 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693268.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene leuS CDS 123114..123620 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005659127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene lptE CDS 123629..124654 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693269.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene holA CDS 124756..125670 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158246.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 125709..126152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(126237..127037) product lipooligosaccharide biosynthesis galactosyltransferase LsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995797.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene lsgF CDS complement(127037..127921) product lipooligosaccharide biosynthesis N-acetyl-glucosamine transferase LsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694185.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene lsgE CDS complement(127933..129102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(129106..129882) product lipooligosaccharide biosynthesis galactosyltransferase LsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694186.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene lsgD CDS complement(129884..130813) product lipooligosaccharide biosynthesis sialyltransferase LsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694189.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene lsgB CDS complement(130810..132015) product lipooligosaccharide flippase LsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694190.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene lsgA CDS complement(132015..132689) product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995908.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 132814..133557 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694191.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(133617..134357) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694108.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene pflA CDS complement(134547..140678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(140867..141970) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706017.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(142098..144422) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653814.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene pflB CDS complement(144517..145341) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene focA CDS 145539..146030 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693683.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 146095..146664 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099080.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene nudE CDS 146654..147076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 147145..147954 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694155.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene cysQ CDS 148033..149517 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694154.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene zwf CDS 149594..150292 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132500362.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene pgl CDS 150652..152106 product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649523.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene gnd CDS complement(152157..153239) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694095.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene aroC CDS complement(153250..156540) product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044509288.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene mscK CDS complement(156533..157984) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene menE CDS complement(158002..158562) product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648714.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene seqA CDS 158676..159455 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(159550..160158) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668333.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(160227..161486) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(161504..162184) product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647270.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 162524..163507 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene pheS CDS 163594..165981 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694456.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene pheT CDS 165998..166294 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene ihfA CDS 166347..166877 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650361.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(167072..168736) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693471.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene cydC CDS complement(168744..170513) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693472.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene cydD CDS complement(170562..174500) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694581.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(174514..176250) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429522.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(176308..177156) product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869050.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(177158..178300) product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815277.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene envC CDS 178949..179668 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097094.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene cobB CDS 179751..180578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 180734..181684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 181699..182433 product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene prpC CDS complement(182552..183274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 183912..184811 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111697003.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene prfB note possible pseudo, frameshifted CDS complement(184884..185645) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693935.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(185770..186225) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650678.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(186225..186542) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811819.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(186542..187144) product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694045.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene rdgB CDS complement(187217..188155) product lipid A biosynthesis lauroyl acyltransferase HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene htrB CDS 188354..188680 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653397.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene raiA CDS complement(188765..189370) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene leuD CDS complement(189466..190872) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140652.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene leuC CDS complement(191217..192404) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694302.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(192404..193096) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694303.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene rsuA CDS 193271..193924 product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419826.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 193980..195497 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694085.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 195494..196591 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869171.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene apbC CDS complement(196645..197286) product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 197441..198328 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694364.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene corC CDS 198356..199882 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694362.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene lnt CDS 199989..200567 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658683.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene rpoE CDS 200586..201182 product RseA family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651258.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(201863..203014) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100066294.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene mnmA CDS complement(203025..203444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(203512..204465) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989333.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(204476..204730) product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629187.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene nqrM CDS complement(204749..205813) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668096.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(205953..207185) product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648666.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene nqrF CDS complement(207198..207794) product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631374.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene nqrE CDS complement(207796..208419) product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648665.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene nqrD CDS complement(208419..209195) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689271.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(209188..210426) product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689269.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(210431..211777) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694115.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 212169..212762 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693730.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene nfuA CDS complement(212818..213060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(213057..213587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(213662..214015) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene rplT CDS complement(214111..214308) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596065.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene rpmI CDS complement(214424..214762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(215097..216239) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649699.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(216301..217290) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693888.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene rsmC CDS 217370..217795 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 217782..218225 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868917.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene rimI CDS 218296..219621 product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693742.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene srmB CDS 219847..220428 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694403.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene rsxA CDS 220428..221072 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650033.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene rsxB CDS 221056..223731 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869271.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene rsxC assembly_gap 223524..223532 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 223741..224385 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 224415..225488 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694177.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene rsxD CDS 225488..226123 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694178.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene rsxG CDS 226134..226829 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658208.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 226848..227795 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694093.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene lpxM CDS complement(227813..228115) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649214.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(228108..228542) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 228680..229723 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080512803.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene selD CDS 229723..230943 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052899460.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene ubiH CDS complement(231043..232686) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene groL CDS complement(232710..232997) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687043.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 233198..233737 product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140873.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene rimL CDS complement(233805..234689) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995695.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(234788..234946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 235071..237014 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694468.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(237091..237732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 237909..238682 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162627419.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene tcdA CDS 238922..239908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(239990..240547) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694366.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene ampD CDS 240623..241462 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693720.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 241520..242161 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686697.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene pyrE CDS 242588..243955 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694502.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene glmU CDS 244248..244964 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005645552.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene rpsB CDS 245062..245907 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693261.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene tsf CDS complement(245960..246814) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654480.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene folD tRNA 246981..247057 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 247099..247175 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(247544..249319) product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649789.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene msbA CDS complement(249475..250326) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005633091.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene htpX CDS complement(250418..251428) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261445.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene dinB CDS 251621..252532 product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491116.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(252616..253668) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694337.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(253746..254117) product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene cybC CDS complement(254215..255432) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene fabB CDS complement(255595..256887) product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052501.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene dcuC CDS complement(256906..257610) product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995241.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene pepE CDS complement(257996..259294) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139989280.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene purA CDS complement(259426..260316) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660876.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene hflC CDS complement(260316..261536) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668135.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene hflK CDS complement(261846..262790) product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775145.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene lacD CDS complement(262804..263190) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361967.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(263256..265049) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189855.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(265059..265730) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355232.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 265930..266262 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346798.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(266354..267190) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836304.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(267177..268049) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357253.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(268063..268536) product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922009.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(268547..269686) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263815.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(269796..270557) product transcriptional repressor AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209875.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene agaR sequence33 source 1..291 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence34 source 1..214 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence35 source 1..289 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence36 source 1..282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence37 source 1..281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence38 source 1..281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence39 source 1..281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence40 source 1..280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence41 source 1..280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence42 source 1..113704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1982..3706 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235893157.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene ltrA CDS 3978..4979 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829995.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 4989..6371 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948793.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 6397..7746 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948793.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(7820..8914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 8995..9264 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693195.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 9267..9953 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693196.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(10012..11544) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207318.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(11612..12976) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207319.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(13465..14427) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652627.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene lipA CDS complement(14437..15102) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691065.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene lipB CDS complement(15183..15482) product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649857.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene ybeD CDS complement(15603..16781) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693881.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(16817..17590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(17642..18760) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649852.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene rodA CDS complement(18753..20705) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649850.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene mrdA CDS complement(20720..21187) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649848.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene rlmH CDS complement(21187..21501) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005635481.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene rsfS CDS complement(21638..23059) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711547.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene nhaC CDS complement(23112..24305) product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene rocD CDS complement(24819..25844) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene hemB CDS complement(25904..26653) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694099.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene tatC CDS complement(26643..27209) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694100.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene tatB CDS complement(27213..27437) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260926.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene tatA CDS complement(27847..29238) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649877.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene miaB CDS complement(29515..30018) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654343.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene crr CDS complement(30091..31812) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649967.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene ptsI CDS complement(31925..32182) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649965.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 32498..33613 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694497.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene asd CDS complement(33925..34833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 35017..37128 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212336493.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 37216..38781 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146602274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 38836..39735 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981017.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 39814..40773 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981018.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 40763..41704 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221668.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 41714..42472 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226767.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(42480..42962) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175568.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene fxsA CDS 43119..44777 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene ilvG CDS 44780..45004 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860184.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene ilvM CDS 45019..45711 product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098567.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 45776..47611 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693142.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene ilvD CDS 47732..48061 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629464.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(48121..49716) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005670186.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 50316..50627 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626416.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene rplU CDS 50648..50905 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539872.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene rpmA CDS 50963..51907 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693231.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 51904..52824 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010360332.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 52883..54058 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693230.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene cgtA CDS 54556..58584 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666423.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene rpoB CDS 58764..63041 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693659.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene rpoC CDS complement(63270..64025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 assembly_gap 64057..64066 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(64713..65873) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869121.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene lpxB CDS complement(65998..66861) product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630043.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene pdxY CDS complement(67063..68592) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527838.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 68773..69945 product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816831.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene ubiF CDS complement(70012..71403) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693814.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene ffh CDS 71656..72633 product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031350.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 72656..73690 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035573.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(74064..74414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 74548..74769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 75066..75509 product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694621.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene mioC CDS 75510..76352 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 tRNA complement(76425..76501) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(76603..77430) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996329.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene dnaQ CDS complement(77471..78277) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694208.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene map CDS complement(78407..79075) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693208.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(79296..80558) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene rho CDS 80753..81166 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654696.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene hslR CDS 81163..82038 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693176.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene hslO CDS complement(82117..83301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 83533..83709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 note possible pseudo, internal stop codon CDS 83710..83967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 note possible pseudo, internal stop codon CDS 84036..85829 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649895.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 85914..86243 product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648303.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 86324..87418 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene trmA tRNA 87509..87598 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 87682..87771 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 87895..88380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(88657..90738) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693902.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene recG CDS complement(90858..92966) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369143.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene spoT CDS complement(93067..93348) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene rpoZ CDS 93580..96042 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694539.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(96086..96625) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665007.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 96692..97378 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693829.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(97522..98844) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660680.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(99195..99497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 99433..99981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 100174..101238 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694200.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene wecA CDS 101263..102099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 102099..103232 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176215.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene wecB CDS 103237..104493 product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211985.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene wecC CDS 104490..105209 product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099274.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene rffC CDS 105426..105893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 105972..106220 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(106240..107076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(107095..107514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(107598..108617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 109029..110024 product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612049.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene rffA CDS 110029..111120 product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217247.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene rffT CDS 111165..112445 product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211978.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene wzyE CDS 112438..113160 product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064032.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene wecG tRNA 113297..113373 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 113400..113475 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 113500..113576 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 sequence43 source 1..279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence44 source 1..255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence45 source 1..255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence46 source 1..255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence47 source 1..255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence48 source 1..255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence49 source 1..254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence50 source 1..111614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 367..1317 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693444.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene tal CDS complement(1535..1858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(2476..2907) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383115.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(2933..4060) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 4174..5031 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051309313.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(5183..5470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(5558..5851) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 6014..7600 product thiamine/thiamine pyrophosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693357.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene thiP CDS 7597..8223 product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647864.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene thiQ CDS 8309..9145 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995557.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 9161..9481 product DUF2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690805.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 9563..9772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693272.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 9823..10194 product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 10690..11082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 11093..13159 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693270.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene glyS CDS 13244..13534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(13540..14238) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(14304..15068) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868970.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene udp CDS complement(15195..15668) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649540.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene asnC CDS 15836..16828 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654693.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene asnA CDS complement(16879..17904) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197585.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene plsX CDS complement(17930..18100) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544470.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene rpmF CDS complement(18117..18641) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868949.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene yceD CDS complement(18943..19785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 note possible pseudo, internal stop codon, frameshifted CDS complement(20077..20445) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650892.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene rplL CDS complement(20503..20994) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626605.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene rplJ CDS complement(21297..21986) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649467.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene rplA CDS complement(21991..22419) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630840.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene rplK CDS complement(22784..24121) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967516.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(24741..26255) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655029.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene glpK CDS complement(26289..27068) product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005689987.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(27322..28767) product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650782.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene glpT CDS 29067..30758 product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694610.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene glpA CDS 30748..32031 product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694609.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene glpB CDS 32099..33376 product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694608.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene glpC CDS 33590..34630 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985426.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene pstS CDS 34716..35666 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene pstC CDS 35666..36514 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650601.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene pstA CDS 36527..37303 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene pstB CDS 37421..38113 product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650606.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene phoB CDS 38113..39405 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429243.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene phoR CDS complement(39453..39944) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886773.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 40223..41275 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666442.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 41284..41853 product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene satP CDS 42021..43271 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694299.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene proA CDS 43273..44124 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656225.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 44121..44555 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694618.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene dtd CDS 44601..45929 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693764.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene tilS CDS complement(45926..46219) product DUF5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665148.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(46221..47114) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694355.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene xerD CDS complement(47244..48101) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693314.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene menB CDS 48256..48909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 49018..49647 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002886687.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene fklB CDS complement(49812..54485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(55031..55792) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654608.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene birA CDS complement(55789..56817) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene murB CDS 56964..57854 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649559.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene oxyR CDS 57851..58477 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629669.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene fabR CDS 58489..59007 product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693438.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(59100..60104) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693654.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene fbp CDS 60225..61586 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694412.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene mpl CDS 61751..62329 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 62441..63886 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995848.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene tldD CDS 63943..64824 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647969.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene prmA CDS complement(64821..65108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(65498..66991) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477450.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(67072..67989) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693668.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene rbsK CDS complement(68062..68934) product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693669.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene rbsB CDS complement(69098..70057) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664522.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene rbsC CDS complement(70088..71575) product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693671.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene rbsA CDS complement(71584..72003) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693672.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene rbsD CDS complement(72262..73191) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660149.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene ftsX CDS complement(73218..73874) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632750.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene ftsE CDS complement(73874..75460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 75610..76149 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693161.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene rsmD CDS 76325..77119 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668148.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene nagB CDS 77128..78270 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694427.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene nagA CDS complement(78628..81186) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040035576.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene mutS CDS 81453..81866 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658616.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene secE CDS 81868..82440 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648601.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene nusG CDS 84093..85778 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 85838..86104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 86114..87100 product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880172.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 tRNA complement(88468..88543) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(88563..88638) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(88763..89857) product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene mltC CDS complement(89871..90143) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648477.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(90121..91257) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693157.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene mutY CDS 91379..91768 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462837.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 91772..92485 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396021.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene sfsA CDS 92554..92742 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523495.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 92903..93424 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501802.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene hslV CDS 93467..94789 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868991.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene hslU tmRNA 94872..95238 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 95423..95560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(95821..96765) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694033.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene rpoH CDS complement(96951..98273) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655513.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 98437..99261 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655521.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene dapF tRNA complement(99576..99670) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 99736..101121 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694593.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene selA CDS complement(101176..101451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(101486..101950) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996417.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(101968..102594) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365978.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 102625..104352 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693602.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene argS CDS 104438..106273 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694594.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene selB CDS 106388..106975 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048949.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene azoR CDS complement(107060..107872) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263714.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(107895..108506) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652031.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene rsmG CDS complement(108519..110408) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694554.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene mnmG sequence51 source 1..79442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 285..1592 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694643.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene rsmB CDS 1594..2970 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694644.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene trkA CDS complement(3258..3815) product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704904.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene hutZ CDS 3919..5610 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296749.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 5718..7850 product heme/hemoglobin uptake receptor PhuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene phuR CDS complement(8501..9394) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826367.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene asd CDS complement(9519..9863) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015701999.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 10079..11428 product opacity-associated protein OapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694343.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene oapA CDS 11494..11895 product opacity-associated protein OapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694341.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 11906..12955 product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693429.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene waaF CDS 12958..13932 product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264584.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene rfaC CDS 14009..14968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208205.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(15048..15974) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632797.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene rfaD CDS complement(16000..16662) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(16672..18237) product lysine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886371.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(18279..18791) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694639.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene def CDS 18899..20059 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693325.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene dprA CDS complement(20146..21540) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650562.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene fumC CDS complement(21682..22317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 22763..23074 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene rpsJ CDS 23091..23717 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632753.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene rplC CDS 23733..24335 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652369.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene rplD CDS 24332..24637 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632756.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene rplW CDS 24657..25478 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652371.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene rplB CDS 25505..25780 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539416.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene rpsS CDS 25791..26123 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625897.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene rplV CDS 26142..26849 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693167.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene rpsC CDS 26862..27272 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648425.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene rplP CDS 27272..27463 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625888.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene rpmC CDS 27463..27720 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625886.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene rpsQ CDS 27979..28173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 28262..30232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 30294..30890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105965.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 31120..31491 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005548786.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene rplN CDS 31502..31813 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005635734.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene rplX CDS 31831..32370 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625881.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene rplE CDS 32382..32687 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625879.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene rpsN CDS 32724..33116 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625877.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene rpsH CDS 33133..33666 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655593.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene rplF CDS 33681..34034 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625873.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene rplR CDS 34049..34549 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625871.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene rpsE CDS 34556..34735 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693169.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene rpmD CDS 34740..35174 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648410.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene rplO CDS 35178..36500 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652382.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene secY CDS 36778..37134 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648406.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene rpsM CDS 37153..37542 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543603.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene rpsK CDS 37571..38191 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693170.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene rpsD CDS 38224..39213 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438685.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene rpoA CDS 39248..39634 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648400.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene rplQ CDS complement(39712..40575) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693694.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 40665..41381 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632808.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene rph CDS complement(41460..41645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 41928..43193 product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666220.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene nadR CDS 43194..43886 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693159.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(43959..44513) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436823.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(44584..46446) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082012.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 46567..47385 product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694543.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(47451..47690) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694645.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(47690..48634) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647895.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene ispH CDS complement(48635..49123) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651632.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene lspA CDS complement(49148..49486) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436810.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene glnB CDS complement(49483..50406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(50417..51010) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647046.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene mog CDS complement(51064..51426) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986162.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(51505..52296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(52293..53024) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693139.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene lpxH CDS complement(53063..53590) product DUF1523 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652096.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(53599..54390) product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116972861.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(54446..55429) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648321.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene epmA CDS 55554..57038 product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene trkH CDS complement(57140..58417) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693831.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene thrC CDS complement(58523..60544) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665016.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene yccS CDS complement(60657..61349) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694158.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(61382..62173) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693254.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene lgt CDS complement(62181..62975) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693253.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(62968..63549) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693252.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene rppH CDS complement(64076..64813) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655733.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene rlmB CDS complement(64837..66426) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694221.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene prfC CDS complement(66547..67380) product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002828.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 67856..68833 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651675.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene corA CDS 69157..69981 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632504.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene dapD CDS 70461..71420 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693475.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene hemH CDS 71539..73566 product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962266.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(73647..75083) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647973.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene panF CDS complement(75095..75331) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647974.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(75377..75694) product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862042.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene metJ CDS 76086..76460 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543325.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene rpsL CDS 76590..77060 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138042.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene rpsG CDS 77146..79248 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869011.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene fusA sequence52 source 1..62197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(188..1006) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995756.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene murI CDS complement(1038..1544) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817301.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene ubiC CDS complement(1550..2143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(2459..3175) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856501.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene arcA CDS complement(3353..4246) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650690.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene cdd CDS complement(4276..4626) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656206.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene folB CDS 4704..5306 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653382.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene plsY CDS complement(5404..5853) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196065.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene rplI CDS complement(5872..6099) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005598105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene rpsR CDS complement(6110..6436) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210154.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene priB CDS complement(6423..6800) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627620.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene rpsF CDS 7131..8531 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385759.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 8650..8973 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652591.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 9270..10778 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650684.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene putP CDS 10894..14499 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224912.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene putA CDS 14789..15766 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402917.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 15753..17462 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229097.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 17548..18546 product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730239.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene gntR CDS complement(18543..19058) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307862.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 19246..20595 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371412.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(20663..21481) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene cysE CDS complement(21504..22514) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694541.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene gpsA CDS complement(22580..23080) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630575.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene secB CDS complement(23097..23549) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156179.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(23674..24975) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869039.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene tig CDS complement(25661..27088) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693212.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene glnA CDS 27435..28100 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694521.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(28306..29538) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693698.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene serA CDS complement(29589..30248) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693699.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene rpiA CDS complement(30368..31702) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694655.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene glmM CDS complement(31804..33330) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696111.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene ilvA CDS complement(33346..34050) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694583.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene slyD CDS complement(34172..34312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(34315..35034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(35089..35826) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693665.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene tsaA CDS 35916..36836 product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649448.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene menA CDS complement(36900..37298) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022450.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene mscL CDS complement(37379..37915) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176268.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene hemG CDS 38035..38826 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703994.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene ubiE CDS 38854..39483 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084314.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 39483..41123 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815371.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene ubiB CDS 41552..43072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(43712..44821) product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996514.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene ompA CDS 45227..48319 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694279.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 48329..48748 product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693476.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 tRNA complement(48757..48832) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(48931..49917) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868989.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(49923..50549) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828392.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene tmk CDS complement(50549..51583) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693707.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene mltG tRNA complement(51700..51775) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(51796..51871) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(51902..51977) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(52161..52952) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661219.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene tpiA CDS 53128..56940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 57002..58021 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene truD CDS 58067..58831 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694588.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene surE CDS 58831..59415 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694589.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 59429..59917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 59993..61237 product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694590.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene nlpD CDS 61461..61784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 note possible pseudo, internal stop codon sequence53 source 1..19826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(127..522) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene rpsI CDS complement(538..966) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650450.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene rplM CDS 1261..1665 product YhcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653154.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(1743..2462) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654053.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene recO CDS complement(2483..3385) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657841.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene era CDS complement(3410..4081) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693887.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene rnc CDS complement(4289..5251) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693886.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene lepB CDS complement(5332..7131) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649880.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene lepA CDS 7503..8186 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693156.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 8245..8766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 9273..9911 product zinc transporter binding subunit ZevA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694310.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene zevA CDS 9902..10885 product zinc transporter permease subunit ZevB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694309.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene zevB CDS 10987..12429 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648689.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(12494..13879) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038543.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(14124..15428) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693809.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene serS CDS complement(15476..15955) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647965.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene smpB misc_feature complement(16147..>19826) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158580290.1:YadA-like family protein locus_tag LOCUS_18080 sequence54 source 1..17084 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 14..110 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA 181..286 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 tRNA 305..381 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 417..492 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 1020..1307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 note possible pseudo, frameshifted CDS 1228..1407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 note possible pseudo, frameshifted CDS complement(1896..3260) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095288.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene hflX CDS complement(3300..3575) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693756.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene hfq CDS complement(3637..4629) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693854.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene miaA CDS complement(4719..4982) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651580.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene rpsT CDS 5229..6806 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826265.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene murJ CDS complement(6893..7444) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(7663..8082) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649396.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(8122..9495) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649402.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene atpD CDS complement(9516..10382) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693686.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene atpG CDS complement(10406..11947) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688698.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene atpA CDS complement(11960..12493) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005642563.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene atpH CDS complement(12507..12977) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629246.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene atpF CDS complement(13060..13314) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652035.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene atpE CDS complement(13459..14250) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629251.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene atpB CDS complement(14279..14665) product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005659757.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 14996..16174 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 16184..16936 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289836.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270