COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..274997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(569..919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 1162..2028 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812896.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 2168..3415 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052151.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene glgC CDS complement(3622..4242) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812893.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(4338..4904) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816902.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(4980..6278) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389815.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(6275..7054) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113429.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene sufC CDS complement(7056..8282) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389813.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene sufD CDS complement(8288..9805) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055081.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene sufB CDS 10068..10712 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114254.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 10799..11890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 12137..13147 product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774239.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 13144..13962 product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861298.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(14227..15900) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052143.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(16380..17717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(18142..21474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(21845..22294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 22856..23842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068169.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(24926..25372) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816942.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene aroQ CDS complement(25462..27087) product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363407.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(27133..28326) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816938.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene aroC CDS 28379..28834 product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143357.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(28878..30050) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003823435.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene mltG CDS complement(30064..30528) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053384.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene ruvX CDS complement(30538..33216) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389808.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene alaS CDS complement(33322..33561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812861.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(33561..33953) product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812859.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(34071..34745) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055085.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 35258..35560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 35509..35874 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818305.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(36055..36681) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene rpsD CDS complement(36933..39587) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(39763..41643) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812844.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 41890..42471 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057285.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 42499..43860 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(43963..45210) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389794.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(45197..46381) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068186.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(46410..47384) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057287.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 47569..48771 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 48768..49424 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052109.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(49491..50114) product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812798.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(50132..51184) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(51414..55544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(55685..56686) product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(56862..57500) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700625.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(57690..57989) product type II toxin-antitoxin system mRNA interferase toxin YafQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615980.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene yafQ CDS complement(57989..58261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 58667..59020 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722027.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 59424..59867 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003828945.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 60035..61018 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787284.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(62230..62994) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813595.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(63840..65156) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(65211..65609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(65783..66064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 65979..66239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(66215..66442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(66456..66791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(66830..67228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(67596..68741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(68755..69126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(69123..70202) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(70192..70392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 70628..71764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(72177..73739) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057943.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene guaA CDS 74192..76669 product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112522.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 76867..78534 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene pta CDS 78752..79981 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068227.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(80295..81731) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947060.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene aroA CDS complement(81827..82984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389781.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 tRNA 83360..83435 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(83910..86030) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055470.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene glgX CDS complement(86170..86790) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389780.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(86819..87706) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582492.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(87817..90678) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389778.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene polA CDS complement(90668..91465) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812733.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 92138..92401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 92459..92599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 note possible pseudo, internal stop codon CDS complement(92733..92939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860757.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(92992..93300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(93377..93718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 93824..94066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 94053..94373 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895797.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(94502..95005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390204.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(95083..95322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(95619..97226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(97460..100897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 101247..101501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 101554..102336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 tRNA complement(102293..102369) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 103366..105930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 106214..106819 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051922.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(106927..108369) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812729.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene pyk CDS complement(108535..109494) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812727.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(109580..111691) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389776.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene uvrB CDS complement(111726..112400) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815565.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene coaE CDS complement(112476..112997) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068818.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 113179..113841 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890811.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(114231..115706) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene rpsA CDS complement(115852..116730) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053562.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 116845..117891 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389774.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 118217..119152 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819774.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 119149..119985 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812712.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(120091..120579) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389773.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene ispF CDS complement(120581..121123) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812708.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 121331..123550 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812706.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene glgB CDS 123566..124291 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051909.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 124288..125412 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389772.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(125529..126320) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143341.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(126331..127146) product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389769.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 127314..127664 product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023658181.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(127752..129293) product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053571.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(129290..132295) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(132429..132728) product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051901.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 133022..134488 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947073.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(134674..134931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 134930..135949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 136271..138121 product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389764.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 138198..138476 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812680.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(138590..140077) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 140237..141124 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389762.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(141283..141762) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112265.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(141886..142290) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051894.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(142363..143838) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055100.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 tRNA complement(143967..144048) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(144189..145184) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068252.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(145247..145822) product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068253.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(145809..146318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(146407..147699) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene eno CDS 147977..148753 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138162.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 148926..149900 product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111826.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 149897..150592 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111829.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(150763..152214) product lincomycin efflux MFS transporter Lmr(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886396.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene lmr(B) CDS complement(152311..152892) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053897.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(152902..153777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(153915..157484) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389755.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene mfd CDS complement(157474..158073) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053586.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene pth CDS complement(158352..158903) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948661.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(158900..159403) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389754.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(159784..163023) product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389747.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 163271..164524 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(164618..165238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 note possible pseudo, frameshifted CDS complement(165473..166375) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 166618..167223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 167296..168468 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764888.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 168779..169705 product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101955.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 169752..170930 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 170990..172399 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056806.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene brnQ CDS complement(172393..173148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(173205..173624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 173879..174598 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626384.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(174582..175229) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068395.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(175453..177006) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643721.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(177125..178408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(178401..179192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(179374..179790) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389907.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(179897..180841) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370030.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 181058..181900 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170865.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 181902..182651 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144469.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 182767..183156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 183574..184548 product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185942.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(184595..185293) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389903.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 186211..187074 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054022.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 187071..187850 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene fetB CDS complement(187932..189221) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390029.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(189330..190229) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813549.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 190698..190823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(191233..191988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 192182..192310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(192626..193084) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055906.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(193252..194322) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813553.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(194662..195489) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390031.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(195658..196629) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813131.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(196802..197593) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389401.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 198096..199022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 199082..199858 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016616.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(200290..201090) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390032.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(201439..202173) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662263.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(202315..203112) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041455.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(203109..204185) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626612.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(204182..204877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 205244..206323 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803888.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(206591..207076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 207418..208362 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331257.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(208948..209319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(209383..210465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(210553..210870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(210917..211414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(211443..211955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(211952..212449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(212481..212987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(212984..213544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(213570..214037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(214122..214619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(214600..214794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(214815..215249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(215347..215883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(215901..219926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(219917..220798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(220812..223187) product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279210.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(223231..223599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(223605..223916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(224039..224881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(224894..225247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(225244..225528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(225525..225863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(225863..226288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(226305..226577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(226574..227461) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922461.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(227496..228020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(228093..228341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(228331..229464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(229406..230875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(230872..232293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(232286..232699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(232812..233081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(233128..233319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(233368..233883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(233880..234194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 tRNA complement(234265..234350) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(234451..235227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(235300..235500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(235497..236063) product oligoribonuclease Orn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820462.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(236060..236428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(236425..236658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(236655..236969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(237028..237273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(237270..238670) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389864.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(238670..238807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(238804..239886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(239908..240549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(240559..241092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(241092..241340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(241337..241543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(241540..241845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(241998..242237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(242768..243109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 243146..243637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 243634..244017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(243978..244241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 244310..244705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 244727..246052 product DUF4041 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860984.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 246053..246439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389855.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(246493..247110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(247213..248451) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389850.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(248707..249774) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813598.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene ychF CDS complement(249818..250606) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene proC CDS complement(250663..252009) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068205.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 252206..255094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 255461..256192 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390051.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(256420..259041) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(259091..259933) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162098246.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(260126..261439) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052070.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 261790..262662 product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813634.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 262941..263381 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813644.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 263381..264910 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052067.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 264986..266515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(266768..267175) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 267250..269109 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053431.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 269168..270142 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052064.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 270195..270866 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390059.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(270856..271896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(271893..273284) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390061.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(273428..274609) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390062.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 sequence02 source 1..90076 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 183..704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(852..1703) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene tsf CDS complement(1778..2605) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111661.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene rpsB CDS complement(3072..3554) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052751.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene def CDS complement(3593..5668) product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117868.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(5818..6309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816504.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(6437..7537) product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813354.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 7700..8917 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813356.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 9051..10697 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389967.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(11154..12968) product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389968.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(13027..13788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 14103..15131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 15686..17035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(17453..18583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 tRNA complement(19154..19231) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(19643..20503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(21305..22348) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363525.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene tsaD CDS complement(22348..22917) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783284.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene rimI CDS complement(22917..23762) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389971.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene tsaB CDS complement(23823..24764) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459514.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(24994..26382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(26318..27055) product vancomycin resistance response regulator transcription factor VanR-I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461303.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene vanR CDS complement(27212..27826) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047289290.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene tsaE CDS complement(27907..28887) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057620.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene holA CDS complement(29040..31118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(31115..31912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(32301..35264) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389976.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene leuS CDS complement(35306..36157) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389977.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(36169..37110) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054371.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(37280..38104) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813380.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(38136..40064) product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390300.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 40202..40762 product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(40898..41188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(41539..41718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(41926..42642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(42639..43538) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(43535..43915) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424232.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(44117..44980) product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258548.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(45074..46042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 46576..47376 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389997.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(47398..48987) product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 49157..49669 product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261892.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 49692..50342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 50339..51073 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369289.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(51546..51950) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389998.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(52067..53071) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582570.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(53071..53379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 53356..53871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(53962..54639) product DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582450.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 54740..55165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 tRNA complement(56198..56271) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(56346..56419) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(56782..58077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(58153..58446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 58420..59082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(59306..60007) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057554.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(60004..60381) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene rsfS CDS complement(60385..61767) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390003.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene glmU tRNA complement(61842..61914) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(61991..63013) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052033.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(63141..63896) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051134.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene nadD CDS complement(63893..64471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053591.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(64468..65751) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035137421.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 65927..67414 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390008.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene thrC CDS complement(67580..68365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(68368..69072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(69078..69965) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390010.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(69962..70339) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782778.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(70542..71210) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390012.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(71227..72981) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813477.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene recN CDS complement(72981..73988) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818094.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 74119..75576 product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390013.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 75628..76287 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818088.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 76501..77184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(77181..77984) product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051151.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(77988..78203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(78363..79418) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390014.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(79415..81205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(81383..82702) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813495.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene tyrS CDS 82880..84799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 84897..85439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 85444..85752 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776996.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 85826..87217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 87229..87999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(87980..88756) product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818363.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(88753..89259) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390016.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(89387..89953) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143549.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 sequence03 source 1..81430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(157..735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(1068..1433) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813590.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(2071..4878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(4875..5462) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389733.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 5705..6775 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053235.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(6864..7646) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053236.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 7832..8596 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053237.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 8797..10224 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054004.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(10496..11296) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(11345..13030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(13145..15364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143321.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 15466..18900 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582850.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 18981..21929 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389738.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene ligA CDS 22045..23733 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949122.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 23844..24941 product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054010.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 25388..26740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 26742..27725 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 27718..28812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 28809..29705 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 29799..31070 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 31291..32232 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 32462..33373 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053710.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 33388..34188 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051288.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(34267..34620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 34730..36346 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 36781..37287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 tRNA 37278..37358 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(37598..39034) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068284.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene glnA CDS complement(39068..39316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 39376..40122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 40122..42761 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 42877..43239 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791443.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(43419..44204) product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051180.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(44463..45941) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051179.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(46191..46796) product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812622.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 46927..48294 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389742.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 48627..49247 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 49308..51917 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116779.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 51995..52921 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(53048..53683) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(53694..54353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(54358..55053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(55040..55849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 56053..56475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(56487..57032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(57654..58301) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816947.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 58543..59610 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813536.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene pheS CDS 59623..62226 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053616.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene pheT CDS 62340..63092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782767.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 64216..65310 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068279.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene argC CDS 65307..66476 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390023.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene argJ CDS 66493..67446 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813526.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene argB CDS 67436..68743 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390022.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 68812..69777 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813521.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene argF CDS 69809..70333 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817270.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene argR CDS 70424..71662 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813515.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 71844..73319 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363574.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene argH CDS 73560..77213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 77376..77840 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 77830..79209 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861575.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(79623..80645) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214358204.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene yidC CDS 80649..80819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(80797..81234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 sequence04 source 1..81209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(243..1391) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811998.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 1583..2410 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023658105.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 2416..3666 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055169.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene galT CDS 3702..4952 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057651.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene galK CDS 5242..5514 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 5578..6942 product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(6932..7216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(7405..8229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(8863..9462) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053738.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 9595..10575 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812023.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 10732..11373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057770.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 11586..15152 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene rpoB CDS 15245..19318 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399740.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 19592..20089 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 20089..22293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(22590..25238) product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068348.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(25235..26494) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051314.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(26491..28317) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 28250..28474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(28409..34339) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389587.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(34386..35690) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 36106..37179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 37262..38185 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814452.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 38182..42507 product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389589.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 42504..46508 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068346.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 46705..47397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 47848..48600 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816186.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene dapB CDS 48700..49590 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389595.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene dapA CDS 50099..52141 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812067.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 52364..54967 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068343.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene pepN CDS 55197..56573 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812074.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene glmM CDS 56765..57421 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816189.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 57466..58932 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068339.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 58951..59736 product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053362.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 60099..64133 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389461.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 64743..66359 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 66548..67438 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 67457..68401 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 68587..69252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 69489..70919 product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296810.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 71023..72135 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817320.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 72281..74104 product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396368.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(74326..75369) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390188.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 75527..76174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 tRNA complement(76212..76287) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(76617..78128) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389943.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 78988..79590 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 79774..80832 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068814.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 sequence05 source 1..79718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1720..3177 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143562.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 3174..3881 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814649.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(4037..5056) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068768.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene galE CDS complement(5131..6630) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068767.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(6627..7709) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(7798..10044) product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene gnpA CDS complement(10192..11130) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(11127..12107) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829947.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(12243..13550) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068762.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 13801..15285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(15440..16075) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363467.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 tRNA complement(16152..16238) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(16314..17600) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814634.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene serS CDS 17850..19043 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053825.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 19291..20946 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814621.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene pgm CDS 21219..22628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 22801..23499 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814612.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene rpiA CDS complement(24186..24812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052313.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 24909..26342 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene radA CDS 26423..28057 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783579.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 28054..29481 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994664.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 29478..29987 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 30114..30986 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053658.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 31006..31887 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053659.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 31884..32675 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051227.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(32846..34099) product riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003823255.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(34176..35345) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068748.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(35342..35956) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814603.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene rbfA CDS complement(36089..38917) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390214.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene infB CDS complement(39139..40173) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene nusA CDS 40249..41310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 tRNA 41404..41492 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(41721..42524) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814594.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(42778..44952) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068744.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(45189..46097) product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022173241.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(46435..46980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(47068..48063) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053048.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(48143..48541) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene rpsK CDS complement(48625..49002) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene rpsM CDS complement(49271..49489) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808114.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene infA CDS complement(49659..50222) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114385.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(50241..51575) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053045.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene secY CDS complement(51807..52268) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114381.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene rplO CDS complement(52271..52453) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053043.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene rpmD CDS complement(52453..53178) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815670.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene rpsE CDS complement(53175..53543) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053041.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene rplR CDS complement(53545..54084) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114374.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene rplF CDS complement(54102..54500) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829896.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene rpsH CDS complement(54586..54771) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114370.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(54773..55342) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814525.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene rplE CDS complement(55339..55674) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814523.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene rplX CDS complement(55677..56045) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114366.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene rplN CDS complement(56126..56386) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene rpsQ CDS complement(56389..56646) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814517.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene rpmC CDS complement(56646..57065) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114362.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene rplP CDS complement(57070..57885) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053036.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene rpsC CDS complement(57888..58247) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053035.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene rplV CDS complement(58264..58542) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114357.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene rpsS CDS complement(58558..59388) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114355.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene rplB CDS complement(59424..59720) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053033.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene rplW CDS complement(59726..60394) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114353.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene rplD CDS complement(60400..61050) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116043.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene rplC CDS complement(61068..61376) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003827292.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene rpsJ CDS complement(62625..63398) product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065998.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(63480..65102) product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 65241..66047 product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051923104.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(66295..69027) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363862.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene adhE CDS 69552..71960 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068740.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene glgX CDS complement(72100..72585) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114350.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene rpsI CDS complement(72607..73056) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053026.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene rplM CDS complement(73419..75584) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053798.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene malQ CDS complement(75649..76269) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(76311..76961) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053023.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(76958..78274) product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815644.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(78589..79509) product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390126.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 sequence06 source 1..77686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(126..482) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812098.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(611..1924) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050543882.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene xseA CDS 2325..4709 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112200.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene nrdD CDS 4885..5601 product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389607.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene nrdG CDS complement(5803..6672) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814840.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 tRNA 6938..7015 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 6946..7833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 8009..13000 product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389608.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 13211..13840 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(13996..15516) product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(15521..16780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 17265..17927 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 18652..19980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 20148..21488 product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948839.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 21587..23701 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775735.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 24139..25329 product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901552.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 25463..27109 product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453968.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(27242..27883) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 28004..30340 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052488.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 30786..31412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 31409..33241 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052496.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 33241..35319 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068826.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 35585..36595 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052498.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 37166..37657 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052499.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 37714..38634 product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052500.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene rihC CDS 38677..40053 product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360057.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene dcuC CDS 40282..41730 product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052501.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene dcuC CDS 42552..43268 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296249.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(43549..44838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(45190..47850) product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(48101..49408) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643054.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 49778..50842 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776801.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(50895..51632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 51904..54141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 54850..55266 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966530.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 55359..56006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 56276..59602 product mupirocin-resistant isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene ileS CDS complement(59910..60533) product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147394.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 60755..63385 product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053269.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 64070..65254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 65257..66972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 66960..70151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 70148..71236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 71233..72846 product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene cas1 CDS 72806..73153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 repeat_region 73421..76050 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcaaggcttagcgccttgcaccttcgttgagga sequence07 source 1..71853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2565..3602) product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363729.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(3888..4883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(4885..5835) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704297.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(5816..6199) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357453.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 6314..6562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(6596..7135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 7405..7728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 7765..7977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(8159..11044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 11251..12516 product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051574.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 13031..13663 product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054303.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 13660..14409 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125982028.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 14406..16316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 16313..17116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068101.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(17142..17999) product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783136.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(17996..18841) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068323.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(18841..19716) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068324.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(19716..20687) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814940.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(21000..22604) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390129.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 22798..23562 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814936.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(23827..25239) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390130.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(25551..25877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 25776..26096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(26177..28249) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 28651..29643 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814924.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(29640..30500) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(30509..32398) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene glmS CDS complement(33324..33812) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812219.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene smpB CDS 33854..34222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(34344..35765) product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389632.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(36041..36964) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812215.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene ftsX CDS complement(36961..38535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(38660..39790) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051295.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene prfB CDS complement(39959..40951) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052463.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene dapD CDS complement(41027..42118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389745.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(42118..42765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(42756..43871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389743.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(43948..44679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 44953..45585 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 45582..46748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(46866..47621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811747.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(47769..49061) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(49309..50052) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004132877.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene map CDS complement(50223..51077) product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814886.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 51227..53308 product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(53322..54746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(54868..56661) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414654.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 56889..57062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055427169.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 57080..57466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(57905..58330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(58526..59932) product PIF1 family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068808.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(59982..60659) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814872.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene orn CDS complement(61310..62860) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814866.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene guaB CDS complement(63048..64211) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052448.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(64208..64867) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814862.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 65082..65837 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(65964..66323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(67189..68832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(68868..69956) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814857.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene prfA CDS complement(70096..70308) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814855.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene rpmE CDS 70637..71467 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219082261.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 sequence08 source 1..70784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(197..1456) product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054321935.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(1716..3023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 note possible pseudo, frameshifted tmRNA 3189..3585 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 3902..4087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 4050..4592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(4910..5812) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389668.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(5897..7111) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067997.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 7467..8198 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143294.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(8381..9418) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080889.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 9315..9599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(9591..12263) product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 12474..13373 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067998.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 13670..14482 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817044.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene nagB CDS 14532..15788 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene nagA CDS 16108..17745 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050760733.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 17851..18963 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052566.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 18966..20081 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363253.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 20074..21804 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389671.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(21956..23251) product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829550.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(23532..23741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 23652..26774 product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067986.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 26817..29945 product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067987.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 30009..31301 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080901.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 31298..32272 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067989.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 32272..33108 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067990.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 33133..34419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067991.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 34586..36958 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027130.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 37063..38184 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067994.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(38294..38815) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817058.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(38967..40712) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068002.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 40787..42529 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389673.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 42536..46261 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389674.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene smc CDS 46290..46949 product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(47168..47893) product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812371.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(47976..49214) product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389675.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(49289..50890) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389678.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(50951..52549) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389678.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(52769..53518) product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113025.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 53629..54264 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057260.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 54261..54515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389679.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(55419..56369) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112999.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 56647..57666 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821233.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(57699..58220) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812394.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene ybaK CDS complement(58408..59466) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812396.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene gap CDS complement(59697..60470) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 60730..62616 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906399.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene asnB CDS 62980..63630 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032682519.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene infC CDS 63611..63805 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812404.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene rpmI CDS 63855..64238 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812406.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene rplT CDS 64332..65303 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene xerD CDS 65369..66244 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389684.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 66270..67112 product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389685.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 67138..67809 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene scpB CDS 67962..70778 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054447.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 sequence09 source 1..63430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 tRNA complement(573..649) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 768..1802 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054763.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene metA CDS 2273..3079 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814317.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene atpB CDS 3159..3392 product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003831420.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene atpE CDS 3444..3974 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 4021..4842 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054765.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 4890..6566 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene atpA CDS 6569..7486 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051479.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 7496..8983 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004120484.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene atpD CDS 8983..9294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 9395..10123 product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363923.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene nucS CDS complement(10263..11180) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068443.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 11270..12487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389467.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 12490..13494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051473.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 13662..14612 product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389468.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(14817..15443) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 tRNA 15626..15699 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 15844..17271 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080642.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 17384..17773 product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811675.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 18247..20043 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138659.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene argS CDS 20286..21881 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389477.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 22023..23336 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389478.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 23434..24483 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068713.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 24749..26212 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389479.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 26530..27606 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057860.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 27960..29591 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 29688..30380 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051389.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 30565..32082 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051388.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene araA CDS 32329..34431 product glycoside hydrolase family 20 zincin-like fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389334.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(34628..36445) product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(36583..36888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 36779..40546 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068393.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 41011..41874 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068388.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 42196..42987 product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410358.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(43267..44928) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811972.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(45118..46128) product G5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(46256..46606) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821172.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene trxA CDS 46770..47393 product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363143.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 47512..48369 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811981.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 48419..49519 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389573.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene nudC CDS 49575..51200 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389574.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 51287..51667 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051338.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene gcvH CDS 51909..53159 product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811988.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 53198..55723 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051336.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 55789..56829 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811990.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 56965..57486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 57487..58638 product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051334.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 58651..59370 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811992.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 59633..61861 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399464.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 61953..63281 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055215.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 sequence10 source 1..62189 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..722 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068463.1:N-acetylmuramoyl-L-alanine amidase locus_tag LOCUS_07330 CDS complement(719..1549) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219082261.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(1776..4043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143591.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(4040..4444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 4416..6500 product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054760.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 6704..7201 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(7440..8180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 8371..9111 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814301.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 9126..9803 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814299.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene nth CDS 9879..11411 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057703.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 11455..14190 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390284.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene valS CDS complement(14288..14680) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051524.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(14727..15209) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051756.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 15436..16701 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056527.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(17093..19057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(19324..20925) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(21125..21439) product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820018.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(21439..22575) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820016.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(22660..24159) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene gatB CDS complement(24181..25716) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814276.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene gatA CDS complement(25718..25981) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815962.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene gatC CDS complement(26079..27077) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993690.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(27074..28288) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152349884.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(28661..29614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032736338.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 29831..30058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(30519..30674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(31077..31934) product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390290.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(31950..32639) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814265.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(33090..34439) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390292.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(34905..37559) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene clpB CDS complement(38328..39146) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389507.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(39236..39547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(39673..40497) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582354.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(40602..41171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(41312..41575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(41867..43183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(43247..43963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(44329..45954) product isopeptide-forming domain-containing fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(46173..49556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(49914..51182) product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414594.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(51167..52306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 note possible pseudo, frameshifted CDS complement(52452..53126) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051540.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 tRNA 53518..53593 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(54621..55283) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389990.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(55458..55904) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene rplI CDS complement(55925..56173) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051545.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene rpsR CDS complement(56243..56878) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811755.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene ssb CDS complement(56926..57222) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886572.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene rpsF CDS complement(57972..59096) product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389495.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(59166..59822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(59835..60308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 sequence11 source 1..58696 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 291..1691 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812547.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene hisS CDS 1688..3481 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816387.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene aspS CDS complement(3933..5099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 5098..5637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(6016..6183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 6590..7399 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162094060.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 7489..8310 product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012471745.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 8313..8990 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053211.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 8997..10172 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 10341..11387 product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055606.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 11465..14023 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389729.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 14104..15531 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389730.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 15751..16500 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 16576..16830 product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994234.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 17150..18646 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389731.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(18823..19251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 20267..20509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(20520..21041) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811539.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 21224..22102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 22208..22924 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 22914..24257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 24434..27532 product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 tRNA complement(24530..24613) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(27618..28043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 28416..28970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 29142..29900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 29828..30094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(30328..30729) product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052491.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(30716..31003) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052490.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(31160..31462) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 31474..33819 product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399551.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(34108..34785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814794.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 35122..35574 product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 35657..38878 product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389398.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 38894..39559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 40009..40344 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027506.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 40405..40740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 note possible pseudo, internal stop codon CDS complement(40693..40911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 40892..42373 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115220.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 42641..44119 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284170.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 44116..47607 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776704.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(47737..48117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(48196..48867) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014078.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(49160..49678) product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068139.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 49785..50984 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209537.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 51289..51621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 51666..52607 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969689.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(53104..53994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(54116..55738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 56014..56778 product DUF4391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056866.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(56759..57064) product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053232.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 57288..58076 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171842511.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene tenA sequence12 source 1..195176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(336..1478) product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994459.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 1935..4091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(4544..5764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 6343..7386 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068665.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(7620..8528) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052908.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(8525..9469) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055566.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(9602..10906) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(11506..12531) product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068667.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(12691..13770) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068665.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(13823..15946) product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068664.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 16196..17755 product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 18869..20665 product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057431.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(21388..21981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(22363..25035) product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157437265.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(25163..25618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(25620..28742) product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(28983..30311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(30301..31014) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775405.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(31504..32946) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674808.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(33396..35306) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814147.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene leuA CDS 35525..37069 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143619.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(37147..37767) product DUF5701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051613.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(37892..38962) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994594.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(38975..39556) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(39611..40396) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051616.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(40932..41534) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051621.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene recR CDS complement(41670..44729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(44934..46112) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057587.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(46306..46623) product flp pilus-assembly TadE/G-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414673.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(46704..47033) product TadE family type IV pilus minor pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(47138..47419) product DUF4244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051627.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(47725..48327) product Flp pilus assembly protein TadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051628.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene tadC CDS complement(48713..49456) product Flp pilus assembly protein TadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054679.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene tadB CDS complement(49453..50475) product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363998.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(50462..51397) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214304241.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(51776..51988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 52569..54806 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814112.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 54914..56044 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507753.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 56049..56942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 57476..58120 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053093.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene upp CDS complement(58302..64070) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(64647..66665) product beta-L-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068480.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene hypBA1 CDS complement(66864..67682) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051554.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(67696..68613) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051555.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(68891..70207) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 70613..71728 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054733.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(71813..72862) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363043.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(73045..75933) product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(76369..77259) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740577.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(77467..79443) product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143601.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(79471..79704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815980.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(79806..80600) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815981.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(80608..82104) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068484.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(82108..83541) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171023377.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene dnaB CDS complement(83583..84827) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462283.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(85356..88940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(88937..89686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(89749..90732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(90729..91745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(91742..92569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 93253..94662 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051563.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(94622..96478) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058100.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(96634..96972) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814240.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(96974..98257) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(98615..99892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 100030..100827 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054725.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 101027..102064 product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390299.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 tRNA 102665..102738 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(102876..103547) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226988.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 103833..104420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(104404..105600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 105613..105915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(105912..107411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 107801..109330 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814091.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 109327..111168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(111325..112140) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052900.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(112224..113447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(113586..115130) product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051661.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(115371..117884) product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816051.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(118593..119561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(119545..120693) product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095405.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(120727..121608) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115716.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(121608..122555) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112250.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(122665..123921) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112252.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 124169..125194 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068660.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(125468..126424) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390350.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(126515..128932) product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033493356.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 129293..130336 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068660.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 130580..132631 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(132908..134401) product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068661.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(134553..135464) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050496022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(135531..137957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 137974..138246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(138228..139025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(139221..141029) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052919.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(141046..142893) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582988.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(143310..144287) product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051219.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 144939..146003 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581611.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(147895..149265) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966721.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(149497..150825) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245259.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 151077..151892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 152018..153565 product DUF5597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(153682..155547) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390353.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene metG CDS 155710..156285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 156440..156868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(156838..157785) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene rsmI CDS complement(157869..158309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 158497..160092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(160079..161032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(161296..162981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(163208..166978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(167446..169560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(169608..170507) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052908.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(170504..171760) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(171923..173170) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 173520..174599 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 175080..175709 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068494.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(176490..177476) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705392.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 177769..178590 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390165.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(178693..180162) product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976002.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(180181..182595) product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027547.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene yicI CDS complement(182712..183608) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803807.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(183605..184570) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803806.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(184699..186000) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(186252..187274) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 187637..188356 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051631.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 tRNA 188595..188668 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(190308..193853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 tRNA 194602..194689 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 sequence13 source 1..52546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 228..821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(894..3965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(4276..7497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(8073..9824) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 10286..11836 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379675.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene guaD CDS 12103..12879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 13526..19135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 19474..20790 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389462.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 21033..21524 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837227.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 21889..23214 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056295.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene murA CDS complement(23515..24369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143323.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(24837..26294) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015512063.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(26695..27351) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389464.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 27588..28472 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 28588..29583 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811732.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 30365..31582 product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389489.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 31668..34154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 34798..35844 product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052453.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene amrS CDS 36005..37315 product DUF4854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582958.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 37381..38361 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051462.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(38498..39283) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389509.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(39534..40262) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051459.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 40587..41234 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053629.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(41320..42585) product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389510.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 43043..43732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(43639..43932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 43944..44258 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727806.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 44418..46025 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051460.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(46536..47984) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068433.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 48181..50682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 50973..52334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 sequence14 source 1..44709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(207..572) product cysteine-rich VLP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861105.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(569..1903) product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861101.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(1870..2193) product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene mobC CDS complement(2452..2823) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009009558.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 3034..3870 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860817.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 3882..5108 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 5562..5996 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989664.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 5993..6232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 6553..6735 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 7005..8027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 9836..10270 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297668.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 10276..10515 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288964.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 10950..11153 product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004613735.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 11233..12513 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(12843..13364) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 13576..14592 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101884.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 14733..15473 product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949081.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 15575..16504 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803903.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(16725..17411) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(17408..17902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 18090..18509 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056959.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 18620..20296 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814786.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene ettA CDS 21785..22687 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363792.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(22803..23351) product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814779.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(23348..24214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(24305..26413) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene ftsH CDS complement(26410..26973) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816281.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene hpt CDS complement(26948..28057) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390178.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene tilS CDS complement(28057..29454) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390179.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(29539..31170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814762.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(31170..32015) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582910.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(32060..33286) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(33286..34968) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390181.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(35083..36234) product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052368.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene fucO CDS 36653..39553 product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 tRNA complement(40595..40669) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(40886..41743) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390182.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene trmB CDS 42089..43099 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068781.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene galE CDS 43284..44015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 tRNA 44197..44271 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 44317..44392 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 sequence15 source 1..40685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 132..1034 product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 1300..1899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1868..2665) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(2722..3189) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 3407..3601 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861102.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(3669..3875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(3872..4798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(4820..11308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(11442..13532) product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861108.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(13529..14344) product DUF4366 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035394374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(14334..14588) product DUF4315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861111.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(14591..15046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(15058..17037) product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(17069..19480) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861114.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(19377..19826) product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(19833..20759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040412236.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(20766..21629) product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368724.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(21742..21957) product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(22057..22287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(22318..24123) product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(24120..24596) product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(24702..24914) product DUF5348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610290.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(24930..26078) product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 26358..27623 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(27658..29307) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052115.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(29763..31040) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390162.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 31396..32115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 32112..33101 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814542.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene rarD CDS complement(33636..33968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 34413..35759 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053874.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene xylA tRNA complement(35830..35921) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 36085..38043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 38090..39325 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222038.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(39356..40402) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 sequence16 source 1..40370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 tRNA complement(637..711) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 1327..1914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813977.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(2011..2535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390204.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(2647..4425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(4636..8238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 8930..9166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(9313..9840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390204.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(9957..11729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(11914..14571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(14994..15722) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068849.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(16085..17308) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052436.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 17560..19101 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782901.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(20789..21415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(21415..22497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(22582..23334) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974670.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(23336..24535) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584101.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 24538..24783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(24780..26558) product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203328.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(26888..29386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(29632..30759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(30787..32262) product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(32326..34293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(34555..36174) product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906008.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(36251..37120) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226353.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(37122..38162) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(38311..39585) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226351.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 sequence17 source 1..34106 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1778..2530 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861813.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 2861..4255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(4456..5484) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814163.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(5749..6018) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814166.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 6255..7904 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814167.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene ptsP CDS 8543..9097 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817572.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 9222..10808 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389450.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 10960..12477 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068506.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(12730..13077) product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051599.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 13299..13835 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051598.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(13931..15286) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811607.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 15763..16422 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389452.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 16468..17358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068504.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(18793..19956) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068502.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(20067..21050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 21271..22287 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226192.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 22509..23687 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224934.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 23798..24742 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803837.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 24746..25561 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803838.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 25650..27707 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(27767..28501) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389454.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(28584..29675) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(30145..31623) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 31866..33386 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051591.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene gltX tRNA 33713..33786 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 33824..33898 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 sequence18 source 1..33286 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 87..374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(483..1040) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389849.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(1317..2570) product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389848.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(2610..4538) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776694.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(4538..6268) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067016493.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(6468..7316) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812945.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(7479..8717) product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389828.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene glgA CDS 8945..9715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 9749..10063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(10072..10392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(10424..11266) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854387.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(11614..11751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(11788..13566) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350502.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(14245..14448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 14867..15091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 15081..15467 product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(16322..16606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 16980..17366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 note possible pseudo, frameshifted CDS 17467..17712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(17948..18406) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068160.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(18786..20318) product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812939.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(20320..24900) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068166.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene gltB CDS complement(25388..26560) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080545203.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene hemW CDS complement(26712..28595) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053360.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene lepA CDS 29275..29535 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812925.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene rpsT CDS complement(29930..30697) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389822.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(31034..32161) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812920.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(32418..33008) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 sequence19 source 1..33094 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 83..526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 538..3741 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922218.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 4531..5247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 5346..6506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 6642..8072 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055741.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 8212..10143 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068113.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 10155..10472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389921.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 10556..13129 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068114.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 13223..13570 product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052872.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 13697..14398 product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813164.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(14997..15362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(15387..16034) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052293.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(16118..16555) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052292.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(16561..17394) product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389926.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(17398..17730) product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(17730..18692) product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(18699..19310) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052288.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(19325..20176) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389929.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene hisG CDS complement(20214..20477) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054261.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(20519..21184) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813194.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene rpe CDS complement(21259..22254) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111650.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene lgt CDS complement(22327..23199) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813197.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene trpA CDS complement(23214..25304) product bifunctional indole-3-glycerol phosphate synthase/tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068116.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(25596..27149) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389964.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene trpE CDS complement(27253..27666) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813324.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene hisI CDS complement(27749..28519) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813327.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene hisF CDS complement(28655..29818) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068098.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene rlmN CDS complement(29943..30929) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052757.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(30963..31517) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052756.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene frr CDS complement(31599..32348) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813336.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene pyrH CDS complement(32471..32890) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813451.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 sequence20 source 1..32272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 705..980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 tRNA complement(1499..1588) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 2201..2392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 2433..3707 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390232.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene dinB CDS complement(3744..4865) product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(4923..6116) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390233.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene dapC CDS complement(6273..6593) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053016.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(6684..7886) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390234.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(8192..8368) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814458.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene rpmG tRNA complement(8412..8486) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(8490..8562) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(8563..8645) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(8898..9974) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138644.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene hisC CDS complement(10052..14695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(14698..15747) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080275.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(15900..16193) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114319.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene groES CDS complement(16377..17696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814448.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(17733..18392) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053783.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 18655..19515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 19579..19776 product evolved beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815625.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(20886..21107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363879.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(21104..24724) product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390239.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(24732..26300) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390240.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(26331..27773) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(27977..28357) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053002.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene rplL CDS complement(28469..28990) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053001.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene rplJ CDS complement(29251..30636) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052999.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 30886..31764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068754.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 sequence21 source 1..32118 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(332..4468) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389653.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene hrpA CDS complement(4604..5254) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054390.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 5583..7127 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067980.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene hflX CDS 7311..8297 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112440.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 9316..10302 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(10622..11323) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812299.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene lexA CDS 11475..12146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 12340..12657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(13135..14334) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054393.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene serA CDS complement(14345..16624) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052539.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 17221..17751 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052541.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene mraZ CDS 17751..18779 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene rsmH CDS 18776..19240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 19249..21045 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389659.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 21082..21966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067982.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 22006..23529 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389661.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 23560..24660 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052547.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene mraY CDS 24707..26137 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389662.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene murD CDS 26124..27431 product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389663.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 27532..28716 product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052550.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 28801..30381 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389664.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene murC CDS 30378..31379 product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(31461..31940) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812335.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene dtd sequence22 source 1..28780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1127..1642) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390189.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(1699..2358) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(2457..3329) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390190.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 3460..3873 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390191.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(3969..5009) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052357.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(5185..5925) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053845.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(6098..6316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 6252..6707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(7115..8116) product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390193.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 8576..9688 product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052351.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene serC CDS 9728..9982 product DUF2530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052350.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(10082..11359) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055303.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 11521..12201 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363821.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene phoU CDS complement(12226..12537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(12567..13307) product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112459.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(13391..14404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056804.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(14539..15612) product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068774.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene menA CDS complement(15781..16593) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(16700..18043) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966692.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 18341..19381 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(19359..21125) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814662.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene lysS tRNA 21166..21240 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 21394..22581 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 23172..25724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 25918..26520 product DUF4125 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814656.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(26650..27675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821051.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(27668..28675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 note possible pseudo, frameshifted sequence23 source 1..174874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 535..1299 product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414678.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(2135..3400) product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051833.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene ilvA CDS complement(3584..5404) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068628.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(5757..8120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(8471..10246) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(10258..11088) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(11085..11978) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052964.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(12068..13552) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582923.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 13877..14899 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390364.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(15592..16473) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(16473..17372) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(17382..18686) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068626.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 18880..20109 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054616.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(20331..22529) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390374.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 22745..23560 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(23740..24201) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390371.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 24444..26522 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068624.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(26622..27383) product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783033.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 27550..28428 product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730142.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 29715..30296 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051821.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene dcd CDS complement(30463..33405) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390375.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 33908..34534 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816569.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 34879..36270 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814403.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(36308..37579) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068619.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 37521..37745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 37769..38761 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814978.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene rlmB CDS complement(38927..40357) product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390376.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(41222..42349) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051809.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene ugpC CDS 42974..43933 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112414.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 43985..45388 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 45429..46388 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068827.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 46617..47312 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813911.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 47309..48631 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775459.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(48916..49554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(49547..51970) product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775403.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 52361..55252 product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 55515..56840 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 56856..57557 product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene rgbR CDS 57563..58861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 59036..61939 product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(62128..62841) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(63781..64773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032736338.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(65652..68528) product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 69003..71480 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783044.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 71581..72567 product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390383.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 tRNA 72833..72907 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 73371..74876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 74936..75838 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068602.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene rsmA CDS 75835..76728 product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051793.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 76844..77461 product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051792.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(77658..79076) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051791.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 79218..79877 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815006.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 79949..82048 product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143650.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 82045..86265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 86891..87829 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114045.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene trxB CDS complement(88043..89422) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068597.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(89425..90411) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051774.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(92751..93278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(93360..93518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(93775..94587) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056575.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene rsmG CDS complement(95413..95940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114037.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(96066..97079) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051771.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene yidC CDS complement(97082..97396) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051770.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene yidD CDS complement(97393..97752) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051769.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene rnpA CDS complement(97776..97916) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051768.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene rpmH CDS 98234..99778 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815928.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene dnaA CDS 100822..101946 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815931.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene dnaN CDS 102057..103577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 103574..104053 product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783054.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 104202..106298 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815936.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene gyrB CDS 106450..109125 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399363.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene gyrA CDS 109185..109775 product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051760.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 110172..110387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(111420..112763) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene gdhA CDS 112939..113922 product transcriptional regulator PtxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113738.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene ptxS CDS 114638..115969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329694.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 116014..116757 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102224.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 116849..117817 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963717.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 117814..118431 product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963718.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 118579..119136 product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963719.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene hxlB CDS 119434..120756 product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054178.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 121319..121567 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051803.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 121564..122055 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783041.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene nrdI CDS 122211..124403 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054636.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene nrdE CDS 124495..125487 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068610.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene nrdF CDS 125603..126202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 tRNA complement(126257..126331) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(126379..126453) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 126581..127258 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389336.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(127377..127856) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(127954..129288) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815077.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 129847..131391 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582302.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 131777..132340 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817384.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene ahpC CDS 132362..134143 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(135155..135868) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389340.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(136335..138227) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143606.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(138224..140176) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814218.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(140235..140711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(141330..142340) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195765892.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 142756..144009 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398680.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 144044..144961 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968010.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 144977..145852 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398630.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 146018..148159 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639906.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 148361..150196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 151015..153849 product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 153846..154124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(154373..155677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(155674..156450) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813911.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(156520..159270) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068577.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 159598..161391 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068576.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(161965..163056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819920.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(163271..164371) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003827911.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene trpS CDS 164516..164899 product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815101.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 165226..166419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(166484..166909) product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003823904.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 167193..169646 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389382.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(170455..170703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 170923..171693 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362938.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 172821..174518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 sequence24 source 1..28375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1114..1893) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814420.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene pstB CDS complement(1932..2921) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782854.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene pstA CDS complement(2921..3871) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068423.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene pstC CDS complement(4011..5141) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene pstS CDS complement(5393..6094) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051437.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(6240..7493) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055698.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(7607..8338) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814409.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene mtnN CDS complement(8411..9025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(9022..10245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(11795..12982) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051440.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(13036..14169) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390252.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(14715..16049) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390254.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(16217..17674) product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068425.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(17836..18513) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051445.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(18542..19300) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068426.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(19429..20394) product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390256.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(20430..21806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(21945..22811) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051430.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(22877..25045) product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390263.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(25080..25664) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068421.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 25783..25947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 25975..26451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 26508..27626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(27776..27964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 sequence25 source 1..26718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 142..1491 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068707.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(1582..2457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067936.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(3261..4079) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192829039.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 4246..5649 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811629.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene leuC CDS 5754..6437 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053083.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene leuD CDS complement(6576..7589) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389491.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(7761..10967) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811744.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 11677..13071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 13146..13865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 13867..15807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 15970..18540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 18605..20359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 20396..21997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 22044..22229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 22283..22687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 22684..24186 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073422.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 24176..25897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 sequence26 source 1..25714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 921..2222 product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389361.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene istA CDS 2219..3004 product IS21-like element ISBlo1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472066.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene istB CDS 3534..4319 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068202.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(4533..5444) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837604.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(5476..6867) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(6867..7865) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256284.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(7972..8985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(8993..9544) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 9989..10897 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390137.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(11240..12922) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861711.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(13121..13978) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389614.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(14087..14869) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053283.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene murI CDS 15026..15901 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054039.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene dapF CDS complement(15917..16597) product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389616.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 16907..17791 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054041.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(17809..18033) product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821409.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(18119..19639) product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389618.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 19762..21255 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389619.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(21367..22977) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389620.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 23044..23892 product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389621.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 23964..24389 product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053292.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 tRNA complement(24517..24592) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 sequence27 source 1..25071 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 216..692 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812187.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 802..1083 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812190.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 1182..2495 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067968.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 2519..3073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 3070..4008 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054072.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(4030..4434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 4635..5696 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389640.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(5736..6671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 6843..10400 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582833.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene dnaE CDS complement(10549..11376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(11468..13195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 13586..15556 product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054753.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 15757..17148 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812265.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene hisD CDS 17145..18332 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 18431..19030 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052519.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene hisB CDS 19030..19740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815225.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 19800..20447 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067978.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene hisH CDS 20579..21307 product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389648.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene priA CDS 21460..22806 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052524.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene glnA CDS complement(23279..24916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 sequence28 source 1..20002 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 48..410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 428..1594 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389635.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene dxr CDS 1591..2841 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812233.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene ispG CDS 2943..4634 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 4686..5399 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815260.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene recO CDS 5591..6382 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055433.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(6465..8000) product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782652.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(8311..9861) product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782652.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(9906..11225) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067958.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(11493..12539) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067959.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(12631..13014) product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812153.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(13170..14726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(14773..15711) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 15958..17451 product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363202.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 17552..18832 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812184.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene dusB tRNA 17807..17897 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 sequence29 source 1..19144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(826..1311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(1557..1712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(2064..3524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 3813..4238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 5026..5658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 5690..6070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(6478..6936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 7332..7487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(7846..9093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(9155..9607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(10195..10398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 10647..11213 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 11278..11733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(11872..13203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(13234..13737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 14214..15551 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814403.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 15782..16381 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058038.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 16378..16635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 17318..18535 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 sequence30 source 1..14800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 379..2433 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055427524.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 2605..4122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(4182..5525) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068683.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(5528..6409) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068684.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(6578..6895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 6977..7819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(7932..8903) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125980453.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(8955..9962) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263349.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(10157..12223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143321.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 12479..14350 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068688.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 sequence31 source 1..12132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(181..1626) product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812914.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(1627..1926) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(1944..3068) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816824.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 3318..5345 product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389819.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(6093..7064) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816894.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene era CDS complement(7061..8512) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052157.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(8519..9067) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052156.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene ybeY CDS complement(9057..10169) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389817.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(10217..10552) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055091.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(10671..11468) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052153.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 tRNA 11566..11653 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 sequence32 source 1..10085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 606..2270 product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986524.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene treC CDS complement(2576..3727) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068508.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(3724..4461) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051604.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene tmk CDS complement(4814..7732) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390327.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene topA CDS complement(7821..8888) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414672.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 8946..9611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 sequence33 source 1..9555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 296..958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(1132..2025) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101922.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 2207..3055 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547290.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 3101..3979 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263344.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 4132..5160 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182588488.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(5144..5974) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(6204..7115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(7141..7998) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642522.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(8062..8274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(8338..9354) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363421.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 sequence34 source 1..146258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(268..344) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(371..445) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(543..1220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(1217..2524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(2566..3261) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116382.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 3478..4122 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125968857.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 4128..5417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(5456..6790) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390063.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene clpX CDS complement(6916..7545) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816849.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(7635..8243) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(8281..9663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(9691..9864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(9978..11363) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068214.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene tig CDS complement(11417..12700) product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390066.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(12693..13271) product DUF3000 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816858.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(13625..14506) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068217.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene pflA CDS complement(14700..17075) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819332.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene pflB CDS complement(17190..17390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(17485..19182) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390069.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 19312..20190 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390072.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(20587..21699) product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(21945..22601) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390168.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene pcp CDS complement(22651..23595) product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287082.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(23600..24319) product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024797200.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(24493..25314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(25311..26108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114776.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(26101..27231) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114774.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 27410..27940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 28022..28564 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820289.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(28671..30068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 30073..30432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(31528..33864) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390076.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(33930..34406) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055963.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene dut CDS complement(34406..34699) product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052669.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 34914..35813 product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813754.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene sepH CDS complement(36108..37328) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054496.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 37450..40161 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068049.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(40212..40844) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(40898..41563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(41565..42251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(42241..43038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(43174..43593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 44006..44665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 44662..45843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(46250..47413) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118109.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(47401..48162) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994083.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(48159..49115) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994085.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(49117..49608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(49767..49979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(50808..51350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(51470..56347) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143498.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(56411..57586) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(57701..58885) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 59448..59939 product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026883.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 59939..60151 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829211.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(60367..62688) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813771.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(62771..64207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(64340..65332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 65408..66469 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363673.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 66543..68816 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390081.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(69392..69703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(69753..70439) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390082.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 70497..71045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390083.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(71336..73234) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671827.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(73215..75155) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(75461..76141) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389343.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(76187..76894) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(77008..78069) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390084.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene trpD CDS complement(78273..81260) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390085.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene secA CDS complement(81483..82154) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene raiA CDS complement(82915..83640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(83640..84845) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820771.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene recA CDS complement(85116..85397) product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113620.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(85483..85995) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815448.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(86059..86673) product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068035.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(86670..87317) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058588.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene pgsA CDS complement(87340..90093) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363681.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 90293..90967 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390090.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(90992..91840) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031738.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(91869..92954) product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528706.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene tauA CDS complement(92990..93820) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726675.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(93889..95019) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870021.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(95043..96389) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(96611..97786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(97837..98553) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792492.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(98735..99838) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene miaA CDS complement(99825..101273) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021648605.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene miaB CDS 101377..102114 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056209.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 102296..103132 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815467.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(103281..103733) product cryptic beta-D-galactosidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993824.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(103735..106752) product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993823.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(106907..107686) product DUF5067 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820673.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 107874..109310 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080850.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 109387..110073 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056206.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 110188..111372 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804430.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(111966..112898) product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812467.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(113176..113781) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(114416..117271) product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(117479..118201) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813911.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(118442..121150) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363285.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene acnA CDS complement(121277..123856) product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389700.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(124026..124610) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389699.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(124649..125920) product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055251.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(125922..126665) product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389697.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(126689..127534) product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815851.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(127777..128637) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389696.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 128930..130360 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068657.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(130572..132317) product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947105.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(132876..134639) product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947105.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(134921..137017) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(137017..138003) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112747.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(138092..139075) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138444.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(139396..140430) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058617.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 140590..140835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812433.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(140849..141952) product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389692.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(141946..142950) product prephenate dehydratase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783121.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(143120..143785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(144071..145963) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114597.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene typA sequence35 source 1..5454 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(370..3405) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA complement(3814..5337) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence36 source 1..5073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(165..1214) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811834.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(1258..1626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 1726..1920 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811837.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene rpmB CDS 2204..4873 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389529.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 sequence37 source 1..4711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 535..1188 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068451.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 1327..1629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 1626..3062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072725739.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 3140..4258 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068454.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 sequence38 source 1..2769 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1442..2092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 2115..2471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 sequence39 source 1..2644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence40 source 1..2141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(438..1241) product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815189.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 sequence41 source 1..2037 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(176..1915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 sequence42 source 1..1860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(264..509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 614..787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 894..1100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 1527..1817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 sequence43 source 1..1645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence44 source 1..1596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..1330) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531949.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 sequence45 source 1..142883 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 5..1333 product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053980.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(1655..4249) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816398.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 4388..5362 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053195.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(5539..7449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(7453..7842) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812533.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(7957..9780) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812532.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(9783..10538) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389720.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(10583..11968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 12088..12381 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812525.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(12513..14135) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812522.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene groL CDS complement(14341..14550) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816407.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(14773..15468) product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055622.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 15605..16327 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389717.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 16401..17462 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053183.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 17459..18412 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053182.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 18409..18969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021975282.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 18969..20018 product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812506.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 20015..21037 product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782716.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 21034..21660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 21911..22270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 22279..23886 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782718.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(23976..24926) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964181.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(25272..25619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(25538..26140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(26156..27091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(27088..28032) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004846624.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(28203..29027) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964178.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 29096..30538 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816427.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene purB CDS 30556..33255 product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389709.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 33391..33672 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112617.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(33793..35319) product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068846.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene pafA CDS complement(35319..35510) product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812488.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(35528..36373) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812487.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(36454..38088) product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011742989.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene dop CDS complement(38170..39735) product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389705.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene arc CDS complement(39722..40423) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057155.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 40453..41124 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812481.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene serB CDS complement(41216..42184) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815830.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene fmt CDS complement(42308..43012) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812477.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(43149..45485) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137656711.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(45517..46803) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814846.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(46994..48202) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389702.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene metK CDS complement(48375..48659) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene rpoZ CDS 48856..50709 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389701.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene ilvD CDS complement(50826..51470) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053267.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene gmk CDS complement(51467..52387) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053266.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene pyrF CDS complement(52394..55771) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363691.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene carB CDS complement(55764..56984) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819349.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene carA CDS complement(57068..57652) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053263.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene nusB CDS complement(57677..58243) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111770.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene efp CDS complement(59277..60476) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815489.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene tuf CDS complement(60652..62781) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112311.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene fusA CDS complement(62814..63284) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813834.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene rpsG CDS complement(63290..63661) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813881.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene rpsL CDS 64164..65462 product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804326.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 65655..65849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 tRNA complement(65983..66058) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(66589..67137) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(67127..67315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 67845..68870 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390097.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(68895..70076) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390098.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 70184..71503 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053649.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene purT CDS 71641..72393 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 72501..76241 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 76626..77300 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202734.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(77380..77796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 78153..78632 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(78646..78876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813910.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(78913..80484) product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(80810..81568) product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(81617..82987) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067910.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 tRNA complement(81751..81827) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(83127..84755) product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067909.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 84894..86192 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067908.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 86351..87886 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene purF CDS 87959..88993 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene purM CDS 89037..90317 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813917.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene purD CDS complement(90441..91841) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390136.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(91867..92703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(92817..94895) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014760479.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(95097..95492) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051236.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(95578..96747) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813946.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene purK CDS complement(96731..97228) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813948.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene purE CDS complement(97818..98807) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390118.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 99381..101489 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390119.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(101531..102967) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068308.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(102964..104226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(104253..105038) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051244.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 105113..105478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 105465..106736 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548117.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 tRNA 106832..106906 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 107592..108104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(108153..108710) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068495.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 108872..109534 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014358.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(109639..110454) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143563.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene pgl CDS complement(110520..111443) product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818892.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(111440..112990) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817686.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene zwf CDS complement(113067..114557) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399773.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene gndA CDS complement(114726..117062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 117217..118086 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068311.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 118505..119305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 119309..122176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 122424..123596 product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326249.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene phnW CDS 124053..124835 product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687375.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene phnX CDS complement(125722..126000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(126065..126190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(126567..127523) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020472.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 127731..128162 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460578.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(128202..128426) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(128483..129142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(129714..131795) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068315.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene dnaG CDS complement(131902..133185) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740616.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(133355..133921) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777028.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(134076..135557) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230704.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(135642..136625) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811834.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(136622..137656) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400821.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(137656..138360) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467848.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(138553..139911) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene alr CDS complement(140073..140594) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112729.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(140644..141171) product histone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068319.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(141277..141771) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390122.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(141955..142551) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641446.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 sequence46 source 1..1519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 167..1459 product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209912946.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 sequence47 source 1..1480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 685..1434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 note possible pseudo, frameshifted sequence48 source 1..1385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence49 source 1..1046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence50 source 1..1042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence51 source 1..139392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(135..569) product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389385.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene crgA CDS 660..1418 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816156.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 1415..2542 product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068569.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 2612..3256 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055904.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(3536..5602) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068568.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene pknB CDS complement(5611..6642) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(6639..8105) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389388.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(8102..9529) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056849.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(9526..11157) product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051709.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(11162..11704) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811415.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(11732..12475) product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 12803..15355 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068565.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 15833..16909 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389392.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(16906..18129) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 18483..20081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 20176..20742 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052477.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene mscL CDS 20856..21233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 21396..22487 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 22487..23533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 23643..24023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 24060..24731 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 24880..25596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 25723..26475 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015919.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 26625..27527 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143687.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 27809..28384 product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897695.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 28400..31087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 31184..31522 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723189.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(32004..32834) product Fic/DOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183270.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 tRNA complement(33485..33570) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(33647..34585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(34798..36099) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389403.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene tgt CDS 36552..38402 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068543.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 38868..41162 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389405.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 41339..42754 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811466.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 42988..43932 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389407.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene htpX tRNA 44382..44455 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 44952..47882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 48551..49639 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068538.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene fbaA CDS 50050..51039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(51443..52411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032736338.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 53049..54350 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811495.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 54405..56540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 56555..56935 product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389414.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 57179..58375 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389415.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 58676..60190 product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068532.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene gtfA CDS 60378..61046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(61292..62851) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 63251..64624 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582923.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 64731..65609 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 65609..66496 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 66861..68138 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582923.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 68327..70171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 70341..71900 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068531.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 72289..73656 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389418.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 73965..75020 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811512.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene ilvC CDS 75300..76352 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389419.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene ilvC CDS 76908..77663 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101978.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(77706..78500) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129648.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(79010..79810) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(80246..81286) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051648.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 81611..83452 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390152.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 83564..84418 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052964.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 84415..85251 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 85418..86782 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 87207..87812 product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994403.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(87925..91251) product evolved beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389421.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 91378..92283 product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368277.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene araC CDS 92420..92650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(92824..94299) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068639.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 94656..94841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(95159..95743) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811525.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 96138..96839 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811528.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 96872..100615 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740909.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 100724..102310 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068642.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(102380..103285) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(103387..104091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(104093..104287) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051161.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene thiS CDS 104678..105154 product phenazine biosynthesis protein PhzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114730.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene phzB CDS 105282..105764 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068645.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 106012..107868 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068647.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 107895..109832 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811591.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(110125..111351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 111812..113536 product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390320.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 113649..114284 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 114416..115687 product DUF2318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390318.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 115704..117005 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051582.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 116995..118422 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814181.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 118493..119284 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068491.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 119336..119893 product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(119946..121673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(121764..122591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(122731..124914) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068490.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(124911..127238) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068489.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 127438..128829 product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051574.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 128998..129276 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805023.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(129696..131624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(132232..133014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 133214..134641 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014309.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 134700..135674 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014797.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 136368..137801 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809373.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 137925..138731 product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517446.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene ucpA sequence52 source 1..116018 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(292..1236) product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055032204.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(1307..2320) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836804.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene rfbB CDS complement(2390..4222) product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618734.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(4564..6354) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068382.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(6810..9224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(10584..12050) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068360.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 12379..14817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152234455.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(15032..15211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 15511..16572 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008363445.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 16565..18844 product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167180.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 18907..19602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 19706..20143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 20636..20905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 22616..23146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(23546..23749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 24037..24312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 25239..26075 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209330306.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 26072..26881 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475869.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 26868..27965 product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107235.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 30178..31626 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870353.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(31729..33213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 35089..35493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 note possible pseudo, frameshifted CDS 35659..36276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 note possible pseudo, frameshifted CDS complement(38195..39211) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064504886.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(39250..40323) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141777.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 40393..40539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(41523..42431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(42458..43450) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(43521..44273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(44599..46074) product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068371.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(46083..47102) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836804.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene rfbB CDS complement(47105..48001) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068370.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene rfbA CDS 49005..49484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068361.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(50001..51257) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068814.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(51487..52095) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068381.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(52231..55455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(55457..56107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(56125..60006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 60276..61019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 61301..61462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 61810..62781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 62778..63797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 63794..65404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 65575..66861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(67123..67794) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051632.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(68058..68630) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054672.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(68773..69780) product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390361.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(69964..70716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(70732..72591) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814044.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene dnaK CDS 73433..74710 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(74863..75855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(76160..76393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(76730..76915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(77006..79069) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390363.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene phoA CDS complement(79397..81985) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582331.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(82236..83063) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113800.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(83065..84018) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994448.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(84035..85420) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118145.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(85560..85964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 85861..86865 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051644.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(86973..88745) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055555.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 89053..89244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(89208..90110) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113786.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(90107..91504) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(91515..92729) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 93010..94833 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068628.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(94953..95969) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390364.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(96445..96876) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016796.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(97076..99340) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068527.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene malQ CDS complement(100450..101202) product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993522.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(101308..103305) product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994410.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene pulA CDS complement(103970..104875) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113786.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(104872..106272) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(106293..107540) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 107909..109516 product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 109531..110334 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922420.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(110395..111420) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390364.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(111639..112250) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583014.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 112488..112871 product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814031.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 113095..113871 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390367.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(114012..114350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(114613..115551) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642839.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 sequence53 source 1..94893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(207..281) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(563..2692) product bifunctional cytidylate kinase/GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055764.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene der CDS complement(2689..3459) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052866.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 3682..4668 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052865.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(4585..4872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813210.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(4995..6623) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389934.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene purH CDS complement(6625..8346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(8343..9269) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389936.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene sucD CDS complement(9266..10462) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052861.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene sucC CDS complement(10524..11108) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068112.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(11162..11617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(11682..12746) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054282.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene ruvB CDS complement(12760..13377) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817463.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene ruvA CDS complement(13420..14001) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813230.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene ruvC CDS complement(14008..14763) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113651.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(14842..15585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(15582..16934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(16931..17695) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229941.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(17692..18042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 18241..18897 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816947.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 18894..20123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(20071..20718) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113650.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(20834..21466) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052854.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(21786..23843) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115326.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene thrS tRNA complement(24655..24729) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(24776..24851) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(24882..24955) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(24990..25062) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(25102..25173) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(25202..25275) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 26116..26919 product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813243.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(27117..28001) product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene uppP CDS 28176..28967 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054285.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(29097..30245) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052794.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene dnaJ CDS complement(30301..31404) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068110.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene hrcA CDS 31715..33811 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117899.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene tkt CDS 33951..35054 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813255.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene tal CDS complement(35144..38008) product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 38204..38914 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813911.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 38914..40233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(40304..41881) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812931.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(42145..42912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(43029..43862) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054292.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(43954..44904) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056108.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(45059..45316) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813271.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene secG CDS complement(45444..46238) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052784.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene tpiA CDS complement(46325..47530) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032737730.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(47694..48641) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813277.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene whiA CDS complement(48824..49759) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363500.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene rapZ CDS complement(49759..50760) product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389953.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(51192..54005) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582770.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene uvrC CDS complement(54040..56997) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813285.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene uvrA CDS 57273..58640 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389949.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 58847..60448 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813299.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 61077..62924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(62994..63800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(63873..64445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 64576..65106 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057130.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(65143..65955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(66017..66619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(66619..66801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 67013..67453 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582520.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 67503..69173 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068197.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(69288..70055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(70055..70867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(71249..71617) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052767.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(71908..72951) product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene gutB CDS complement(73120..73872) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(73874..74926) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053640.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(75016..75480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 75619..77397 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052234.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 77515..78189 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068130.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 78357..79292 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813143.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(79706..80170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(80314..80805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(81136..81837) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389897.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene pyrE CDS complement(81935..82891) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813106.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(82894..83715) product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389895.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(83775..84734) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052226.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene pyrF CDS complement(84757..86175) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389893.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(86220..86597) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816669.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(86639..87676) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054218.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene pyrB CDS complement(87791..90889) product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068132.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(91013..91855) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111779.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene metF CDS complement(91955..94264) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389888.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene metE sequence54 source 1..91243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 531..1049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390204.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 1249..1848 product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811847.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 2379..4250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(4455..5555) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389536.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene trmD CDS complement(5738..6460) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389537.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene rimM CDS complement(6475..6714) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051427.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(6711..7157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(7447..8652) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389540.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(8713..10341) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389541.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene ffh CDS 10691..11596 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055692.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(11733..13361) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389542.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene cysS CDS 13457..14170 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811881.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 14219..16531 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811882.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(16796..17236) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051418.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(17233..17520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(17888..18442) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054813.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene ilvN CDS complement(18482..20398) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054814.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(20603..21673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(21847..22041) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051413.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene rpmF CDS complement(22161..22757) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811890.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(22762..23493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(23495..23986) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051410.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene coaD CDS 24285..24584 product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811884.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(24768..25778) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051408.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(25864..27186) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055715.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 27366..28127 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058292.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene rph CDS 28174..28848 product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811906.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(29064..30062) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068404.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 tRNA complement(30149..30231) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(30296..30371) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS 30622..31980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 32176..33873 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389549.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene pgi CDS 34322..35236 product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 35313..35870 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038034018.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 36053..36526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 36983..37360 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811942.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene rplS CDS 37486..38223 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081174.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene lepB CDS 38273..38995 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068401.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 39528..40604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 40601..42061 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811699.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(42193..43137) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053065.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 43702..45018 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811704.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene dapE CDS complement(45230..46813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(46952..47740) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813911.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 47969..50902 product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 51360..54080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 54223..54531 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811712.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene rplU CDS 54568..54819 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811713.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene rpmA CDS 54990..56675 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815401.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene obgE CDS 56749..57882 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055074.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene proB CDS 58000..59220 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811723.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 tRNA 59406..59481 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS 59515..59742 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053057.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene secE CDS 59767..60567 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389487.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene nusG CDS 60822..61253 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053055.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene rplK CDS 61268..61960 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829786.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene rplA CDS complement(61888..62190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(62195..63031) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814340.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(63028..65145) product DUF6020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582940.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 65631..66617 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143590.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(66967..67548) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814345.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 68117..69991 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390271.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 69988..71595 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390270.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 71728..81159 product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399750.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 82220..84046 product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 84684..85292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 tRNA 85414..85487 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS complement(85661..85861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(85851..86015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 86501..87172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143587.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 87306..87575 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene rpsO CDS 87780..90413 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081538.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930