>Feature sequence1 1 1557 gene locus_tag LOCUS_00010 gene dnaA 1 1557 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400253.1 protein_id gnl|my_center|LOCUS_00010 2149 3306 gene locus_tag LOCUS_00020 gene dnaN 2149 3306 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400271.1 protein_id gnl|my_center|LOCUS_00020 3327 4484 gene locus_tag LOCUS_00030 gene recF 3327 4484 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912365.1 protein_id gnl|my_center|LOCUS_00030 4481 5044 gene locus_tag LOCUS_00040 4481 5044 CDS product DNA replication protein DciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899769.1 protein_id gnl|my_center|LOCUS_00040 5254 7332 gene locus_tag LOCUS_00050 gene gyrB 5254 7332 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907458.1 protein_id gnl|my_center|LOCUS_00050 7372 9891 gene locus_tag LOCUS_00060 gene gyrA 7372 9891 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950323.1 protein_id gnl|my_center|LOCUS_00060 9975 10877 gene locus_tag LOCUS_00070 9975 10877 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400291.1 protein_id gnl|my_center|LOCUS_00070 10938 11012 gene locus_tag LOCUS_t00010 10938 11012 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 11174 11247 gene locus_tag LOCUS_t00020 11174 11247 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11367 11702 gene locus_tag LOCUS_00080 11367 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12472 11927 gene locus_tag LOCUS_00090 12472 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00090 12718 13557 gene locus_tag LOCUS_00100 12718 13557 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205539.1 protein_id gnl|my_center|LOCUS_00100 14364 13585 gene locus_tag LOCUS_00110 14364 13585 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728215.1 protein_id gnl|my_center|LOCUS_00110 14885 14457 gene locus_tag LOCUS_00120 gene cwsA 14885 14457 CDS product cell wall synthesis protein CwsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400307.1 protein_id gnl|my_center|LOCUS_00120 15050 15598 gene locus_tag LOCUS_00130 gene ppiA 15050 15598 CDS product peptidylprolyl isomerase PpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400321.1 protein_id gnl|my_center|LOCUS_00130 15968 15609 gene locus_tag LOCUS_00140 15968 15609 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899772.1 protein_id gnl|my_center|LOCUS_00140 16471 16190 gene locus_tag LOCUS_00150 gene crgA 16471 16190 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400344.1 protein_id gnl|my_center|LOCUS_00150 16600 17343 gene locus_tag LOCUS_00160 16600 17343 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886061.1 protein_id gnl|my_center|LOCUS_00160 17381 18067 gene locus_tag LOCUS_00170 17381 18067 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899773.1 protein_id gnl|my_center|LOCUS_00170 19925 18045 gene locus_tag LOCUS_00180 gene pknB 19925 18045 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400356.1 protein_id gnl|my_center|LOCUS_00180 21262 19922 gene locus_tag LOCUS_00190 21262 19922 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907468.1 protein_id gnl|my_center|LOCUS_00190 22752 21277 gene locus_tag LOCUS_00200 gene pbpA 22752 21277 CDS product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899775.1 protein_id gnl|my_center|LOCUS_00200 24158 22749 gene locus_tag LOCUS_00210 gene rodA 24158 22749 CDS product cell shape-determining peptidoglycan glycosyltransferase RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400364.1 protein_id gnl|my_center|LOCUS_00210 25714 24155 gene locus_tag LOCUS_00220 gene pstP 25714 24155 CDS product serine/threonine phosphatase PstP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886062.1 protein_id gnl|my_center|LOCUS_00220 26178 25711 gene locus_tag LOCUS_00230 26178 25711 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400373.1 protein_id gnl|my_center|LOCUS_00230 28025 26313 gene locus_tag LOCUS_00240 gene fhaA 28025 26313 CDS product cell division-associated protein FhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912368.1 protein_id gnl|my_center|LOCUS_00240 28268 28351 gene locus_tag LOCUS_t00030 28268 28351 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28543 28941 gene locus_tag LOCUS_00250 28543 28941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30045 29233 gene locus_tag LOCUS_00260 gene istB 30045 29233 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_00260 30359 30042 gene locus_tag LOCUS_00270 30359 30042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30879 30313 gene locus_tag LOCUS_00280 30879 30313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31183 30794 gene locus_tag LOCUS_00290 31183 30794 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_00290 32475 31213 gene locus_tag LOCUS_00300 32475 31213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33605 33117 gene locus_tag LOCUS_00310 33605 33117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34471 33602 gene locus_tag LOCUS_00320 34471 33602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 37456 34853 gene locus_tag LOCUS_00330 37456 34853 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729639.1 protein_id gnl|my_center|LOCUS_00330 37958 39778 gene locus_tag LOCUS_00340 37958 39778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41620 40238 gene locus_tag LOCUS_00350 gene dnaB 41620 40238 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082792.1 protein_id gnl|my_center|LOCUS_00350 42610 42152 gene locus_tag LOCUS_00360 gene rplI 42610 42152 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400543.1 protein_id gnl|my_center|LOCUS_00360 42907 42653 gene locus_tag LOCUS_00370 gene rpsR 42907 42653 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400540.1 protein_id gnl|my_center|LOCUS_00370 43462 42953 gene locus_tag LOCUS_00380 43462 42953 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 protein_id gnl|my_center|LOCUS_00380 43844 43554 gene locus_tag LOCUS_00390 gene rpsF 43844 43554 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_00390 44606 43968 gene locus_tag LOCUS_00400 44606 43968 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400517.1 protein_id gnl|my_center|LOCUS_00400 46246 44606 gene locus_tag LOCUS_00410 46246 44606 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400514.1 protein_id gnl|my_center|LOCUS_00410 48759 46243 gene locus_tag LOCUS_00420 gene ponA1 48759 46243 CDS product transglycosylase/D,D-transpeptidase PonA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031651598.1 protein_id gnl|my_center|LOCUS_00420 49165 48752 gene locus_tag LOCUS_00430 49165 48752 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400504.1 protein_id gnl|my_center|LOCUS_00430 49230 50168 gene locus_tag LOCUS_00440 49230 50168 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907183.1 protein_id gnl|my_center|LOCUS_00440 50323 50865 gene locus_tag LOCUS_00450 50323 50865 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899787.1 protein_id gnl|my_center|LOCUS_00450 50927 52045 gene locus_tag LOCUS_00460 50927 52045 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112786.1 protein_id gnl|my_center|LOCUS_00460 52094 53008 gene locus_tag LOCUS_00470 52094 53008 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400489.1 protein_id gnl|my_center|LOCUS_00470 53040 53837 gene locus_tag LOCUS_00480 53040 53837 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400486.1 protein_id gnl|my_center|LOCUS_00480 53948 54412 gene locus_tag LOCUS_00490 53948 54412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00490 54457 54711 gene locus_tag LOCUS_00500 54457 54711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00500 54793 56562 gene locus_tag LOCUS_00510 54793 56562 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731623.1 protein_id gnl|my_center|LOCUS_00510 56559 57053 gene locus_tag LOCUS_00520 56559 57053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00520 57054 57308 gene locus_tag LOCUS_00530 57054 57308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00530 58364 57402 gene locus_tag LOCUS_00540 58364 57402 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911958.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00540 58689 58474 gene locus_tag LOCUS_00550 58689 58474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 58833 59336 gene locus_tag LOCUS_00560 58833 59336 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400476.1 protein_id gnl|my_center|LOCUS_00560 59377 60042 gene locus_tag LOCUS_00570 59377 60042 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731625.1 protein_id gnl|my_center|LOCUS_00570 63083 60072 gene locus_tag LOCUS_00580 gene leuS 63083 60072 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900794.1 protein_id gnl|my_center|LOCUS_00580 63243 64334 gene locus_tag LOCUS_00590 63243 64334 CDS product LpqN/LpqT family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900793.1 protein_id gnl|my_center|LOCUS_00590 64419 64769 gene locus_tag LOCUS_00600 64419 64769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907179.1 protein_id gnl|my_center|LOCUS_00600 64810 65817 gene locus_tag LOCUS_00610 64810 65817 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228161.1 protein_id gnl|my_center|LOCUS_00610 66409 65804 gene locus_tag LOCUS_00620 66409 65804 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400460.1 protein_id gnl|my_center|LOCUS_00620 66554 67861 gene locus_tag LOCUS_00630 66554 67861 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400431.1 protein_id gnl|my_center|LOCUS_00630 67864 68298 gene locus_tag LOCUS_00640 67864 68298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00640 68273 68638 gene locus_tag LOCUS_00650 68273 68638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00650 69246 68680 gene locus_tag LOCUS_00660 69246 68680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 69550 69161 gene locus_tag LOCUS_00670 69550 69161 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_00670 69923 69600 gene locus_tag LOCUS_00680 69923 69600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 70293 69973 gene locus_tag LOCUS_00690 70293 69973 CDS product DUF2710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400413.1 protein_id gnl|my_center|LOCUS_00690 71487 70381 gene locus_tag LOCUS_00700 71487 70381 CDS product DUF5631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400411.1 protein_id gnl|my_center|LOCUS_00700 72020 71715 gene locus_tag LOCUS_00710 72020 71715 CDS product DUF2694 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400405.1 protein_id gnl|my_center|LOCUS_00710 72334 72017 gene locus_tag LOCUS_00720 72334 72017 CDS product ESX-1 secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400401.1 protein_id gnl|my_center|LOCUS_00720 73492 72377 gene locus_tag LOCUS_00730 73492 72377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00730 74070 73690 gene locus_tag LOCUS_00740 74070 73690 CDS product DUF4226 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400395.1 protein_id gnl|my_center|LOCUS_00740 74894 74067 gene locus_tag LOCUS_00750 74894 74067 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400393.1 protein_id gnl|my_center|LOCUS_00750 75682 74891 gene locus_tag LOCUS_00760 75682 74891 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400391.1 protein_id gnl|my_center|LOCUS_00760 75826 76242 gene locus_tag LOCUS_00770 gene whiB5 75826 76242 CDS product transcriptional regulator WhiB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400388.1 protein_id gnl|my_center|LOCUS_00770 76356 77324 gene locus_tag LOCUS_00780 76356 77324 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726632.1 protein_id gnl|my_center|LOCUS_00780 77321 77620 gene locus_tag LOCUS_00790 77321 77620 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896750.1 protein_id gnl|my_center|LOCUS_00790 78943 77630 gene locus_tag LOCUS_00800 78943 77630 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_00800 79073 80032 gene locus_tag LOCUS_00810 79073 80032 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103558.1 protein_id gnl|my_center|LOCUS_00810 80541 80134 gene locus_tag LOCUS_00820 80541 80134 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030920.1 protein_id gnl|my_center|LOCUS_00820 81027 81509 gene locus_tag LOCUS_00830 81027 81509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00830 81502 81975 gene locus_tag LOCUS_00840 81502 81975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00840 82046 82702 gene locus_tag LOCUS_00850 82046 82702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00850 82699 83508 gene locus_tag LOCUS_00860 82699 83508 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070943583.1 protein_id gnl|my_center|LOCUS_00860 83514 84509 gene locus_tag LOCUS_00870 83514 84509 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728692.1 protein_id gnl|my_center|LOCUS_00870 85285 84533 gene locus_tag LOCUS_00880 gene yaaA 85285 84533 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083089.1 protein_id gnl|my_center|LOCUS_00880 85438 86238 gene locus_tag LOCUS_00890 85438 86238 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225344.1 protein_id gnl|my_center|LOCUS_00890 86819 88054 gene locus_tag LOCUS_00900 86819 88054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 88162 87962 gene locus_tag LOCUS_00910 88162 87962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 88173 88529 gene locus_tag LOCUS_00920 88173 88529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 88522 88704 gene locus_tag LOCUS_00930 88522 88704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 89505 89317 gene locus_tag LOCUS_00940 89505 89317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 89654 90916 gene locus_tag LOCUS_00950 89654 90916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 90946 91335 gene locus_tag LOCUS_00960 90946 91335 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_00960 91250 91816 gene locus_tag LOCUS_00970 91250 91816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 92943 91813 gene locus_tag LOCUS_00980 92943 91813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 93345 94427 gene locus_tag LOCUS_00990 93345 94427 CDS product type VII secretion system ESX-1 target PPE68 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399879.1 protein_id gnl|my_center|LOCUS_00990 95809 94724 gene locus_tag LOCUS_01000 95809 94724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 96048 95896 gene locus_tag LOCUS_01010 96048 95896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 97127 96108 gene locus_tag LOCUS_01020 97127 96108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01020 98602 97472 gene locus_tag LOCUS_01030 gene espE 98602 97472 CDS product type VII secretion system ESX-1 associated protein EspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399828.1 protein_id gnl|my_center|LOCUS_01030 99806 104389 gene locus_tag LOCUS_01040 gene gltB 99806 104389 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399810.1 protein_id gnl|my_center|LOCUS_01040 104382 105848 gene locus_tag LOCUS_01050 104382 105848 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899732.1 protein_id gnl|my_center|LOCUS_01050 106851 106216 gene locus_tag LOCUS_01060 106851 106216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01060 107335 108255 gene locus_tag LOCUS_01070 107335 108255 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899121.1 protein_id gnl|my_center|LOCUS_01070 107683 107762 gene locus_tag LOCUS_t00040 107683 107762 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 108961 108269 gene locus_tag LOCUS_01080 gene mpt64 108961 108269 CDS product immunoprotective protein Mpt64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409954.1 protein_id gnl|my_center|LOCUS_01080 109425 109174 gene locus_tag LOCUS_01090 109425 109174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 109626 110057 gene locus_tag LOCUS_01100 109626 110057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070947244.1 protein_id gnl|my_center|LOCUS_01100 110068 111075 gene locus_tag LOCUS_01110 110068 111075 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399801.1 protein_id gnl|my_center|LOCUS_01110 112263 111064 gene locus_tag LOCUS_01120 gene dinB 112263 111064 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731284.1 protein_id gnl|my_center|LOCUS_01120 112945 112295 gene locus_tag LOCUS_01130 gene ethR 112945 112295 CDS product HTH-type transcriptional regulator EthR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399797.1 protein_id gnl|my_center|LOCUS_01130 113018 114487 gene locus_tag LOCUS_01140 gene ethA 113018 114487 CDS product FAD-containing monooxygenase EthA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899731.1 protein_id gnl|my_center|LOCUS_01140 114992 114495 gene locus_tag LOCUS_01150 gene rraA 114992 114495 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399786.1 protein_id gnl|my_center|LOCUS_01150 115436 114996 gene locus_tag LOCUS_01160 gene hns 115436 114996 CDS product histone-like protein Hns inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399779.1 protein_id gnl|my_center|LOCUS_01160 115803 115552 gene locus_tag LOCUS_01170 115803 115552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 116532 115876 gene locus_tag LOCUS_01180 116532 115876 CDS product DUF6474 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399771.1 protein_id gnl|my_center|LOCUS_01180 117055 116657 gene locus_tag LOCUS_01190 117055 116657 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907502.1 protein_id gnl|my_center|LOCUS_01190 118270 117518 gene locus_tag LOCUS_01200 118270 117518 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399745.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01200 118700 118476 gene locus_tag LOCUS_01210 118700 118476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01210 119850 119227 gene locus_tag LOCUS_01220 119850 119227 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399735.1 protein_id gnl|my_center|LOCUS_01220 120907 121695 gene locus_tag LOCUS_01230 120907 121695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 121695 122546 gene locus_tag LOCUS_01240 121695 122546 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420924.1 protein_id gnl|my_center|LOCUS_01240 123133 122543 gene locus_tag LOCUS_01250 gene bfrB 123133 122543 CDS product ferritin BfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420920.1 protein_id gnl|my_center|LOCUS_01250 124201 123281 gene locus_tag LOCUS_01260 124201 123281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 125403 124591 gene locus_tag LOCUS_01270 125403 124591 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420910.1 protein_id gnl|my_center|LOCUS_01270 125481 126434 gene locus_tag LOCUS_01280 gene pheA 125481 126434 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420906.1 protein_id gnl|my_center|LOCUS_01280 126431 127117 gene locus_tag LOCUS_01290 126431 127117 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899720.1 protein_id gnl|my_center|LOCUS_01290 127747 127397 gene locus_tag LOCUS_01300 127747 127397 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899719.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01300 129122 127752 gene locus_tag LOCUS_01310 129122 127752 CDS product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420892.1 protein_id gnl|my_center|LOCUS_01310 129243 130502 gene locus_tag LOCUS_01320 gene serS 129243 130502 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420889.1 protein_id gnl|my_center|LOCUS_01320 130978 130499 gene locus_tag LOCUS_01330 130978 130499 CDS product DUF2834 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420879.1 protein_id gnl|my_center|LOCUS_01330 131063 131710 gene locus_tag LOCUS_01340 131063 131710 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899717.1 protein_id gnl|my_center|LOCUS_01340 131761 133338 gene locus_tag LOCUS_01350 131761 133338 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899716.1 protein_id gnl|my_center|LOCUS_01350 133672 133343 gene locus_tag LOCUS_01360 133672 133343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420840.1 protein_id gnl|my_center|LOCUS_01360 135222 133672 gene locus_tag LOCUS_01370 135222 133672 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420837.1 protein_id gnl|my_center|LOCUS_01370 135951 135283 gene locus_tag LOCUS_01380 135951 135283 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420830.1 protein_id gnl|my_center|LOCUS_01380 136089 136868 gene locus_tag LOCUS_01390 136089 136868 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420827.1 protein_id gnl|my_center|LOCUS_01390 136872 137627 gene locus_tag LOCUS_01400 136872 137627 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420824.1 protein_id gnl|my_center|LOCUS_01400 137661 138446 gene locus_tag LOCUS_01410 137661 138446 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420820.1 protein_id gnl|my_center|LOCUS_01410 138542 139270 gene locus_tag LOCUS_01420 138542 139270 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420817.1 protein_id gnl|my_center|LOCUS_01420 140908 139286 gene locus_tag LOCUS_01430 140908 139286 CDS product LGFP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420805.1 protein_id gnl|my_center|LOCUS_01430 142019 141108 gene locus_tag LOCUS_01440 142019 141108 CDS product exported repetitive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420801.1 protein_id gnl|my_center|LOCUS_01440 142308 143516 gene locus_tag LOCUS_01450 gene glf 142308 143516 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420798.1 protein_id gnl|my_center|LOCUS_01450 143513 145411 gene locus_tag LOCUS_01460 gene glfT2 143513 145411 CDS product galactofuranosyl transferase GlfT2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900761.1 protein_id gnl|my_center|LOCUS_01460 145404 145949 gene locus_tag LOCUS_01470 145404 145949 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907517.1 protein_id gnl|my_center|LOCUS_01470 145946 146854 gene locus_tag LOCUS_01480 145946 146854 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420788.1 protein_id gnl|my_center|LOCUS_01480 146829 148820 gene locus_tag LOCUS_01490 gene aftB 146829 148820 CDS product terminal beta-(1->2)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420786.1 protein_id gnl|my_center|LOCUS_01490 149217 150230 gene locus_tag LOCUS_01500 gene ag85A 149217 150230 CDS product diacylglycerol acyltransferase/mycolyltransferase Ag85A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900759.1 protein_id gnl|my_center|LOCUS_01500 150560 150312 gene locus_tag LOCUS_01510 150560 150312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 150448 151311 gene locus_tag LOCUS_01520 150448 151311 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420783.1 protein_id gnl|my_center|LOCUS_01520 151611 152561 gene locus_tag LOCUS_01530 151611 152561 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420779.1 protein_id gnl|my_center|LOCUS_01530 152879 154768 gene locus_tag LOCUS_01540 gene fadD32 152879 154768 CDS product long-chain-fatty-acid--AMP ligase FadD32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899700.1 protein_id gnl|my_center|LOCUS_01540 154791 160139 gene locus_tag LOCUS_01550 gene pks13 154791 160139 CDS product polyketide synthase Pks13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878634.1 protein_id gnl|my_center|LOCUS_01550 160139 161719 gene locus_tag LOCUS_01560 160139 161719 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420767.1 protein_id gnl|my_center|LOCUS_01560 162148 161804 gene locus_tag LOCUS_01570 162148 161804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 162032 162388 gene locus_tag LOCUS_01580 162032 162388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 162965 162399 gene locus_tag LOCUS_01590 162965 162399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 163269 162880 gene locus_tag LOCUS_01600 163269 162880 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_01600 166421 163299 gene locus_tag LOCUS_01610 166421 163299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 167153 166437 gene locus_tag LOCUS_01620 167153 166437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01620 167981 167286 gene locus_tag LOCUS_01630 167981 167286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01630 169083 167989 gene locus_tag LOCUS_01640 169083 167989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01640 169552 169136 gene locus_tag LOCUS_01650 169552 169136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895392.1 protein_id gnl|my_center|LOCUS_01650 170083 169745 gene locus_tag LOCUS_01660 170083 169745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 170061 170315 gene locus_tag LOCUS_01670 170061 170315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 171508 170423 gene locus_tag LOCUS_01680 171508 170423 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420646.1 protein_id gnl|my_center|LOCUS_01680 174862 171635 gene locus_tag LOCUS_01690 gene embB 174862 171635 CDS product arabinosyltransferase EmbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950939.1 protein_id gnl|my_center|LOCUS_01690 178143 174859 gene locus_tag LOCUS_01700 gene embA 178143 174859 CDS product arabinosyltransferase EmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899696.1 protein_id gnl|my_center|LOCUS_01700 181682 178410 gene locus_tag LOCUS_01710 gene embC 181682 178410 CDS product arabinosyltransferase EmbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420638.1 protein_id gnl|my_center|LOCUS_01710 183646 181682 gene locus_tag LOCUS_01720 183646 181682 CDS product galactan 5-O-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907529.1 protein_id gnl|my_center|LOCUS_01720 184413 183649 gene locus_tag LOCUS_01730 184413 183649 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420632.1 protein_id gnl|my_center|LOCUS_01730 185805 184414 gene locus_tag LOCUS_01740 gene dprE1 185805 184414 CDS product decaprenylphospho-beta-D-ribofuranose 2-dehydrogenase DprE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420630.1 protein_id gnl|my_center|LOCUS_01740 186345 185905 gene locus_tag LOCUS_01750 186345 185905 CDS product arabinogalactan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420627.1 protein_id gnl|my_center|LOCUS_01750 186890 186405 gene locus_tag LOCUS_01760 186890 186405 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420624.1 protein_id gnl|my_center|LOCUS_01760 187594 187085 gene locus_tag LOCUS_01770 187594 187085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01770 187896 188237 gene locus_tag LOCUS_01780 187896 188237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 188485 188255 gene locus_tag LOCUS_01790 188485 188255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084005.1 protein_id gnl|my_center|LOCUS_01790 188542 189768 gene locus_tag LOCUS_01800 188542 189768 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420618.1 protein_id gnl|my_center|LOCUS_01800 190417 189779 gene locus_tag LOCUS_01810 190417 189779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01810 190765 190418 gene locus_tag LOCUS_01820 190765 190418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01820 191034 191822 gene locus_tag LOCUS_01830 191034 191822 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013663.1 protein_id gnl|my_center|LOCUS_01830 194248 191852 gene locus_tag LOCUS_01840 194248 191852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 195510 194476 gene locus_tag LOCUS_01850 195510 194476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 195765 195523 gene locus_tag LOCUS_01860 195765 195523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 195865 196179 gene locus_tag LOCUS_01870 195865 196179 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199864957.1 protein_id gnl|my_center|LOCUS_01870 199556 196305 gene locus_tag LOCUS_01880 199556 196305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 200196 199858 gene locus_tag LOCUS_01890 200196 199858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 200879 201208 gene locus_tag LOCUS_01900 200879 201208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 202684 201329 gene locus_tag LOCUS_01910 202684 201329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 204066 203236 gene locus_tag LOCUS_01920 204066 203236 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420610.1 protein_id gnl|my_center|LOCUS_01920 204992 204063 gene locus_tag LOCUS_01930 gene glfT1 204992 204063 CDS product galactofuranosyl transferase GlfT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420606.1 protein_id gnl|my_center|LOCUS_01930 205827 204985 gene locus_tag LOCUS_01940 205827 204985 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731235.1 protein_id gnl|my_center|LOCUS_01940 206364 205831 gene locus_tag LOCUS_01950 gene bpa 206364 205831 CDS product proteasome activator protein Bpa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900754.1 protein_id gnl|my_center|LOCUS_01950 208350 206377 gene locus_tag LOCUS_01960 208350 206377 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420597.1 protein_id gnl|my_center|LOCUS_01960 208481 209677 gene locus_tag LOCUS_01970 208481 209677 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420595.1 protein_id gnl|my_center|LOCUS_01970 210709 209717 gene locus_tag LOCUS_01980 210709 209717 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907125.1 protein_id gnl|my_center|LOCUS_01980 210749 210838 gene locus_tag LOCUS_t00050 210749 210838 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 211257 213356 gene locus_tag LOCUS_01990 211257 213356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 214626 213382 gene locus_tag LOCUS_02000 gene lipE 214626 213382 CDS product lipase LipE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420590.1 protein_id gnl|my_center|LOCUS_02000 215487 214663 gene locus_tag LOCUS_02010 215487 214663 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420587.1 protein_id gnl|my_center|LOCUS_02010 215511 216095 gene locus_tag LOCUS_02020 215511 216095 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420580.1 protein_id gnl|my_center|LOCUS_02020 216579 216121 gene locus_tag LOCUS_02030 216579 216121 CDS product DUF4334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897767.1 protein_id gnl|my_center|LOCUS_02030 217661 216576 gene locus_tag LOCUS_02040 gene hisC 217661 216576 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420576.1 protein_id gnl|my_center|LOCUS_02040 217748 217837 gene locus_tag LOCUS_t00060 217748 217837 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 217869 217942 gene locus_tag LOCUS_t00070 217869 217942 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 218100 218489 gene locus_tag LOCUS_02050 218100 218489 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_02050 218404 218970 gene locus_tag LOCUS_02060 218404 218970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 220009 218981 gene locus_tag LOCUS_02070 220009 218981 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163719979.1 protein_id gnl|my_center|LOCUS_02070 220362 220015 gene locus_tag LOCUS_02080 220362 220015 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420560.1 protein_id gnl|my_center|LOCUS_02080 220487 221014 gene locus_tag LOCUS_02090 220487 221014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02090 220995 221432 gene locus_tag LOCUS_02100 220995 221432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02100 221586 222104 gene locus_tag LOCUS_02110 221586 222104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02110 222400 222050 gene locus_tag LOCUS_02120 222400 222050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 222506 223087 gene locus_tag LOCUS_02130 222506 223087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 223272 223559 gene locus_tag LOCUS_02140 223272 223559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02140 223563 225572 gene locus_tag LOCUS_02150 223563 225572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02150 225618 225827 gene locus_tag LOCUS_02160 225618 225827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 225903 226040 gene locus_tag LOCUS_02170 225903 226040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 226095 226406 gene locus_tag LOCUS_02180 226095 226406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 226418 226573 gene locus_tag LOCUS_02190 226418 226573 CDS product DUF6131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893185.1 protein_id gnl|my_center|LOCUS_02190 226686 227075 gene locus_tag LOCUS_02200 226686 227075 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_02200 226990 227556 gene locus_tag LOCUS_02210 226990 227556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02210 227659 228333 gene locus_tag LOCUS_02220 gene tcrX 227659 228333 CDS product two-component system response regulator TcrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420552.1 protein_id gnl|my_center|LOCUS_02220 228602 229825 gene locus_tag LOCUS_02230 gene tcrY 228602 229825 CDS product two-component system sensor histidine kinase TcrY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886181.1 protein_id gnl|my_center|LOCUS_02230 230238 229939 gene locus_tag LOCUS_02240 230238 229939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 230588 230830 gene locus_tag LOCUS_02250 230588 230830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 230843 233926 gene locus_tag LOCUS_02260 230843 233926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 234901 233933 gene locus_tag LOCUS_02270 234901 233933 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730118.1 protein_id gnl|my_center|LOCUS_02270 235504 234902 gene locus_tag LOCUS_02280 235504 234902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 236808 235501 gene locus_tag LOCUS_02290 236808 235501 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 protein_id gnl|my_center|LOCUS_02290 237590 236826 gene locus_tag LOCUS_02300 237590 236826 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731216.1 protein_id gnl|my_center|LOCUS_02300 238644 237592 gene locus_tag LOCUS_02310 238644 237592 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730117.1 protein_id gnl|my_center|LOCUS_02310 241219 238727 gene locus_tag LOCUS_02320 241219 238727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02320 242942 241356 gene locus_tag LOCUS_02330 242942 241356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 243495 242875 gene locus_tag LOCUS_02340 243495 242875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02340 243903 244511 gene locus_tag LOCUS_02350 243903 244511 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_02350 244596 245648 gene locus_tag LOCUS_02360 244596 245648 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420539.1 protein_id gnl|my_center|LOCUS_02360 246087 245710 gene locus_tag LOCUS_02370 246087 245710 CDS product DUF1049 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899680.1 protein_id gnl|my_center|LOCUS_02370 246202 247149 gene locus_tag LOCUS_02380 gene proX 246202 247149 CDS product glycine betaine/carnitine/choline/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950935.1 protein_id gnl|my_center|LOCUS_02380 247169 248257 gene locus_tag LOCUS_02390 gene proV 247169 248257 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420529.1 protein_id gnl|my_center|LOCUS_02390 248279 248947 gene locus_tag LOCUS_02400 gene proW 248279 248947 CDS product glycine betaine/carnitine/choline/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420526.1 protein_id gnl|my_center|LOCUS_02400 248944 249690 gene locus_tag LOCUS_02410 gene proZ 248944 249690 CDS product glycine betaine/carnitine/choline/L-proline ABC transporter permease ProZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420520.1 protein_id gnl|my_center|LOCUS_02410 249773 250294 gene locus_tag LOCUS_02420 249773 250294 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420517.1 protein_id gnl|my_center|LOCUS_02420 251135 250257 gene locus_tag LOCUS_02430 251135 250257 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085324582.1 protein_id gnl|my_center|LOCUS_02430 251333 251854 gene locus_tag LOCUS_02440 251333 251854 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420511.1 protein_id gnl|my_center|LOCUS_02440 251851 252309 gene locus_tag LOCUS_02450 251851 252309 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420508.1 protein_id gnl|my_center|LOCUS_02450 252339 252428 gene locus_tag LOCUS_t00080 252339 252428 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 252777 253094 gene locus_tag LOCUS_02460 252777 253094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 253545 253186 gene locus_tag LOCUS_02470 253545 253186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899672.1 protein_id gnl|my_center|LOCUS_02470 253988 253605 gene locus_tag LOCUS_02480 253988 253605 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975421.1 protein_id gnl|my_center|LOCUS_02480 254545 254060 gene locus_tag LOCUS_02490 254545 254060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 254663 256075 gene locus_tag LOCUS_02500 254663 256075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 255991 257187 gene locus_tag LOCUS_02510 255991 257187 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272198.1 protein_id gnl|my_center|LOCUS_02510 257184 257933 gene locus_tag LOCUS_02520 257184 257933 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084311.1 protein_id gnl|my_center|LOCUS_02520 258407 258024 gene locus_tag LOCUS_02530 258407 258024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899671.1 protein_id gnl|my_center|LOCUS_02530 258742 259131 gene locus_tag LOCUS_02540 258742 259131 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_02540 259200 259622 gene locus_tag LOCUS_02550 259200 259622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02550 259897 260232 gene locus_tag LOCUS_02560 259897 260232 CDS product PE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899670.1 protein_id gnl|my_center|LOCUS_02560 260312 260683 gene locus_tag LOCUS_02570 260312 260683 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_02570 262003 260696 gene locus_tag LOCUS_02580 262003 260696 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054880811.1 protein_id gnl|my_center|LOCUS_02580 265944 262018 gene locus_tag LOCUS_02590 265944 262018 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731067.1 protein_id gnl|my_center|LOCUS_02590 266067 267101 gene locus_tag LOCUS_02600 266067 267101 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089427.1 protein_id gnl|my_center|LOCUS_02600 267909 267136 gene locus_tag LOCUS_02610 267909 267136 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_02610 268922 267906 gene locus_tag LOCUS_02620 268922 267906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405629.1 protein_id gnl|my_center|LOCUS_02620 269137 269352 gene locus_tag LOCUS_02630 269137 269352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 269365 270462 gene locus_tag LOCUS_02640 269365 270462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 270728 271609 gene locus_tag LOCUS_02650 270728 271609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02650 271628 272227 gene locus_tag LOCUS_02660 271628 272227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02660 272271 273035 gene locus_tag LOCUS_02670 272271 273035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02670 273032 273628 gene locus_tag LOCUS_02680 273032 273628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02680 274154 273720 gene locus_tag LOCUS_02690 274154 273720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02690 274739 274173 gene locus_tag LOCUS_02700 274739 274173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02700 274999 276801 gene locus_tag LOCUS_02710 274999 276801 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729678.1 protein_id gnl|my_center|LOCUS_02710 277327 276818 gene locus_tag LOCUS_02720 277327 276818 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899658.1 protein_id gnl|my_center|LOCUS_02720 278178 277372 gene locus_tag LOCUS_02730 278178 277372 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_02730 278363 279028 gene locus_tag LOCUS_02740 278363 279028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02740 279025 279441 gene locus_tag LOCUS_02750 279025 279441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 279520 280875 gene locus_tag LOCUS_02760 279520 280875 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420440.1 protein_id gnl|my_center|LOCUS_02760 280883 281365 gene locus_tag LOCUS_02770 280883 281365 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420437.1 protein_id gnl|my_center|LOCUS_02770 282584 281385 gene locus_tag LOCUS_02780 282584 281385 CDS product DUF2330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420436.1 protein_id gnl|my_center|LOCUS_02780 282502 282750 gene locus_tag LOCUS_02790 282502 282750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02790 282751 282990 gene locus_tag LOCUS_02800 282751 282990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02800 283003 283815 gene locus_tag LOCUS_02810 283003 283815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02810 284399 283836 gene locus_tag LOCUS_02820 284399 283836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 285541 284498 gene locus_tag LOCUS_02830 285541 284498 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420435.1 protein_id gnl|my_center|LOCUS_02830 285612 286652 gene locus_tag LOCUS_02840 gene ligD 285612 286652 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899657.1 protein_id gnl|my_center|LOCUS_02840 286681 287091 gene locus_tag LOCUS_02850 286681 287091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 288380 287094 gene locus_tag LOCUS_02860 288380 287094 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003910691.1 protein_id gnl|my_center|LOCUS_02860 288688 288380 gene locus_tag LOCUS_02870 288688 288380 CDS product type VII secretion system ESX-3 target PE5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401485.1 protein_id gnl|my_center|LOCUS_02870 288930 290813 gene locus_tag LOCUS_02880 288930 290813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02880 290716 292104 gene locus_tag LOCUS_02890 290716 292104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 292702 292124 gene locus_tag LOCUS_02900 292702 292124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 293010 292699 gene locus_tag LOCUS_02910 293010 292699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 293143 296313 gene locus_tag LOCUS_02920 293143 296313 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726759.1 protein_id gnl|my_center|LOCUS_02920 296414 296797 gene locus_tag LOCUS_02930 296414 296797 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895310.1 protein_id gnl|my_center|LOCUS_02930 296925 297176 gene locus_tag LOCUS_02940 296925 297176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 297975 297082 gene locus_tag LOCUS_02950 297975 297082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 298645 298031 gene locus_tag LOCUS_02960 298645 298031 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420425.1 protein_id gnl|my_center|LOCUS_02960 299915 298839 gene locus_tag LOCUS_02970 299915 298839 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727034.1 protein_id gnl|my_center|LOCUS_02970 300255 299977 gene locus_tag LOCUS_02980 300255 299977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02980 301131 300268 gene locus_tag LOCUS_02990 301131 300268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02990 302402 301128 gene locus_tag LOCUS_03000 302402 301128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086251.1 protein_id gnl|my_center|LOCUS_03000 302544 302864 gene locus_tag LOCUS_03010 302544 302864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 302894 303283 gene locus_tag LOCUS_03020 302894 303283 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_03020 303198 303764 gene locus_tag LOCUS_03030 303198 303764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 305298 303925 gene locus_tag LOCUS_03040 305298 303925 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296723.1 protein_id gnl|my_center|LOCUS_03040 307028 305295 gene locus_tag LOCUS_03050 307028 305295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729339.1 protein_id gnl|my_center|LOCUS_03050 307582 307112 gene locus_tag LOCUS_03060 307582 307112 CDS product lipoprotein LpqH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895248.1 protein_id gnl|my_center|LOCUS_03060 307683 308216 gene locus_tag LOCUS_03070 307683 308216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 309318 308221 gene locus_tag LOCUS_03080 309318 308221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 309546 309331 gene locus_tag LOCUS_03090 309546 309331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 309664 309885 gene locus_tag LOCUS_03100 309664 309885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 310642 309917 gene locus_tag LOCUS_03110 gene lucA 310642 309917 CDS product lipid uptake coordinator LucA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420421.1 protein_id gnl|my_center|LOCUS_03110 310813 310727 gene locus_tag LOCUS_t00090 310813 310727 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 311087 312373 gene locus_tag LOCUS_03120 311087 312373 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899653.1 protein_id gnl|my_center|LOCUS_03120 312432 314297 gene locus_tag LOCUS_03130 312432 314297 CDS product DNA polymerase III subunits gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420417.1 protein_id gnl|my_center|LOCUS_03130 314575 314333 gene locus_tag LOCUS_03140 314575 314333 CDS product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729752.1 protein_id gnl|my_center|LOCUS_03140 315907 314588 gene locus_tag LOCUS_03150 315907 314588 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899652.1 protein_id gnl|my_center|LOCUS_03150 317400 315904 gene locus_tag LOCUS_03160 317400 315904 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420413.1 protein_id gnl|my_center|LOCUS_03160 317363 317800 gene locus_tag LOCUS_03170 317363 317800 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899651.1 protein_id gnl|my_center|LOCUS_03170 318558 317797 gene locus_tag LOCUS_03180 318558 317797 CDS product Rv3717 family N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420410.1 protein_id gnl|my_center|LOCUS_03180 318657 319091 gene locus_tag LOCUS_03190 318657 319091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 319103 319714 gene locus_tag LOCUS_03200 gene recR 319103 319714 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897699.1 protein_id gnl|my_center|LOCUS_03200 320437 319730 gene locus_tag LOCUS_03210 320437 319730 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900739.1 protein_id gnl|my_center|LOCUS_03210 321584 320430 gene locus_tag LOCUS_03220 321584 320430 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950929.1 protein_id gnl|my_center|LOCUS_03220 321817 322806 gene locus_tag LOCUS_03230 321817 322806 CDS product DEDDh family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420320.1 protein_id gnl|my_center|LOCUS_03230 322853 323302 gene locus_tag LOCUS_03240 322853 323302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 323302 323865 gene locus_tag LOCUS_03250 323302 323865 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977488.1 protein_id gnl|my_center|LOCUS_03250 325562 323862 gene locus_tag LOCUS_03260 gene leuA 325562 323862 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323885.1 protein_id gnl|my_center|LOCUS_03260 325920 326162 gene locus_tag LOCUS_03270 325920 326162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 326175 327209 gene locus_tag LOCUS_03280 326175 327209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 327759 329651 gene locus_tag LOCUS_03290 327759 329651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401153.1 protein_id gnl|my_center|LOCUS_03290 332675 329658 gene locus_tag LOCUS_03300 332675 329658 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911097.1 protein_id gnl|my_center|LOCUS_03300 332803 333192 gene locus_tag LOCUS_03310 332803 333192 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_03310 333107 333673 gene locus_tag LOCUS_03320 333107 333673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03320 334197 333670 gene locus_tag LOCUS_03330 334197 333670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 334534 335814 gene locus_tag LOCUS_03340 334534 335814 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419828.1 protein_id gnl|my_center|LOCUS_03340 335816 336874 gene locus_tag LOCUS_03350 gene asd 335816 336874 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419825.1 protein_id gnl|my_center|LOCUS_03350 336882 338018 gene locus_tag LOCUS_03360 336882 338018 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197492484.1 protein_id gnl|my_center|LOCUS_03360 338202 338507 gene locus_tag LOCUS_03370 338202 338507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419816.1 protein_id gnl|my_center|LOCUS_03370 338707 339084 gene locus_tag LOCUS_03380 338707 339084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 339251 340699 gene locus_tag LOCUS_03390 339251 340699 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729105.1 protein_id gnl|my_center|LOCUS_03390 340717 341394 gene locus_tag LOCUS_03400 340717 341394 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419812.1 protein_id gnl|my_center|LOCUS_03400 341542 342831 gene locus_tag LOCUS_03410 gene egtA 341542 342831 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419809.1 protein_id gnl|my_center|LOCUS_03410 342828 344129 gene locus_tag LOCUS_03420 gene egtB 342828 344129 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419808.1 protein_id gnl|my_center|LOCUS_03420 344129 344842 gene locus_tag LOCUS_03430 gene egtC 344129 344842 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419806.1 protein_id gnl|my_center|LOCUS_03430 344839 345804 gene locus_tag LOCUS_03440 gene egtD 344839 345804 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419799.1 protein_id gnl|my_center|LOCUS_03440 345801 346952 gene locus_tag LOCUS_03450 gene egtE 345801 346952 CDS product ergothioneine biosynthesis PLP-dependent enzyme EgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901701.1 protein_id gnl|my_center|LOCUS_03450 347666 346968 gene locus_tag LOCUS_03460 347666 346968 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419793.1 protein_id gnl|my_center|LOCUS_03460 349158 347677 gene locus_tag LOCUS_03470 349158 347677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899645.1 protein_id gnl|my_center|LOCUS_03470 349293 350819 gene locus_tag LOCUS_03480 gene glpK 349293 350819 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899643.1 protein_id gnl|my_center|LOCUS_03480 352869 350827 gene locus_tag LOCUS_03490 352869 350827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 353733 353029 gene locus_tag LOCUS_03500 353733 353029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 354772 353867 gene locus_tag LOCUS_03510 354772 353867 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419780.1 protein_id gnl|my_center|LOCUS_03510 354877 355869 gene locus_tag LOCUS_03520 354877 355869 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419778.1 protein_id gnl|my_center|LOCUS_03520 357196 355874 gene locus_tag LOCUS_03530 357196 355874 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419776.1 protein_id gnl|my_center|LOCUS_03530 358173 357196 gene locus_tag LOCUS_03540 358173 357196 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419775.1 protein_id gnl|my_center|LOCUS_03540 359312 358170 gene locus_tag LOCUS_03550 359312 358170 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899642.1 protein_id gnl|my_center|LOCUS_03550 359959 359309 gene locus_tag LOCUS_03560 359959 359309 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419770.1 protein_id gnl|my_center|LOCUS_03560 361206 359980 gene locus_tag LOCUS_03570 361206 359980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03570 361324 361788 gene locus_tag LOCUS_03580 361324 361788 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419765.1 protein_id gnl|my_center|LOCUS_03580 362770 361799 gene locus_tag LOCUS_03590 gene nrfD 362770 361799 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727950.1 protein_id gnl|my_center|LOCUS_03590 363657 362767 gene locus_tag LOCUS_03600 363657 362767 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727951.1 protein_id gnl|my_center|LOCUS_03600 366848 363654 gene locus_tag LOCUS_03610 gene fdh 366848 363654 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225067.1 transl_except (pos:complement(366267..366269),aa:Sec) note codon on position 194 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_03610 367584 366931 gene locus_tag LOCUS_03620 367584 366931 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728205.1 protein_id gnl|my_center|LOCUS_03620 367692 369518 gene locus_tag LOCUS_03630 367692 369518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 369525 369884 gene locus_tag LOCUS_03640 369525 369884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 372073 370772 gene locus_tag LOCUS_03650 gene selA 372073 370772 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727953.1 protein_id gnl|my_center|LOCUS_03650 372182 372088 gene locus_tag LOCUS_t00100 372182 372088 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 372215 373231 gene locus_tag LOCUS_03660 gene selD 372215 373231 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727954.1 protein_id gnl|my_center|LOCUS_03660 373423 373977 gene locus_tag LOCUS_03670 373423 373977 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112092.1 protein_id gnl|my_center|LOCUS_03670 374021 375547 gene locus_tag LOCUS_03680 374021 375547 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906341.1 protein_id gnl|my_center|LOCUS_03680 376622 375567 gene locus_tag LOCUS_03690 376622 375567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03690 377795 376629 gene locus_tag LOCUS_03700 377795 376629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03700 378418 377792 gene locus_tag LOCUS_03710 378418 377792 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256364.1 protein_id gnl|my_center|LOCUS_03710 378821 378411 gene locus_tag LOCUS_03720 gene rsbT 378821 378411 CDS product serine/threonine-protein kinase RsbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246640.1 protein_id gnl|my_center|LOCUS_03720 379200 378811 gene locus_tag LOCUS_03730 379200 378811 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 protein_id gnl|my_center|LOCUS_03730 379285 379674 gene locus_tag LOCUS_03740 379285 379674 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_03740 379589 380155 gene locus_tag LOCUS_03750 379589 380155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 381002 380166 gene locus_tag LOCUS_03760 381002 380166 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257192.1 protein_id gnl|my_center|LOCUS_03760 381186 381590 gene locus_tag LOCUS_03770 381186 381590 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419762.1 protein_id gnl|my_center|LOCUS_03770 381662 382171 gene locus_tag LOCUS_03780 381662 382171 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079520.1 protein_id gnl|my_center|LOCUS_03780 382462 383061 gene locus_tag LOCUS_03790 382462 383061 CDS product PAS and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088224.1 protein_id gnl|my_center|LOCUS_03790 383208 383462 gene locus_tag LOCUS_03800 383208 383462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 383552 383863 gene locus_tag LOCUS_03810 383552 383863 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899437.1 protein_id gnl|my_center|LOCUS_03810 383978 385273 gene locus_tag LOCUS_03820 383978 385273 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419754.1 protein_id gnl|my_center|LOCUS_03820 385344 385595 gene locus_tag LOCUS_03830 385344 385595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 385705 385631 gene locus_tag LOCUS_t00110 385705 385631 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 386872 385766 gene locus_tag LOCUS_03840 386872 385766 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901694.1 protein_id gnl|my_center|LOCUS_03840 387882 386869 gene locus_tag LOCUS_03850 387882 386869 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899637.1 protein_id gnl|my_center|LOCUS_03850 390360 387949 gene locus_tag LOCUS_03860 gene ponA2 390360 387949 CDS product transglycosylase/D,D-transpeptidase PonA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419746.1 protein_id gnl|my_center|LOCUS_03860 390721 391071 gene locus_tag LOCUS_03870 gene whiB4 390721 391071 CDS product transcriptional regulator WhiB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419743.1 protein_id gnl|my_center|LOCUS_03870 392380 391202 gene locus_tag LOCUS_03880 392380 391202 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419740.1 protein_id gnl|my_center|LOCUS_03880 393333 392377 gene locus_tag LOCUS_03890 393333 392377 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419738.1 protein_id gnl|my_center|LOCUS_03890 393475 393636 gene locus_tag LOCUS_03900 393475 393636 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419736.1 protein_id gnl|my_center|LOCUS_03900 393649 394113 gene locus_tag LOCUS_03910 393649 394113 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419733.1 protein_id gnl|my_center|LOCUS_03910 394119 394925 gene locus_tag LOCUS_03920 394119 394925 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419731.1 protein_id gnl|my_center|LOCUS_03920 395596 394922 gene locus_tag LOCUS_03930 gene crp 395596 394922 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897584.1 protein_id gnl|my_center|LOCUS_03930 396063 395695 gene locus_tag LOCUS_03940 396063 395695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899635.1 protein_id gnl|my_center|LOCUS_03940 396126 396917 gene locus_tag LOCUS_03950 gene nth 396126 396917 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419724.1 protein_id gnl|my_center|LOCUS_03950 396928 397581 gene locus_tag LOCUS_03960 396928 397581 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908815.1 protein_id gnl|my_center|LOCUS_03960 397578 398396 gene locus_tag LOCUS_03970 397578 398396 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419718.1 protein_id gnl|my_center|LOCUS_03970 398393 399595 gene locus_tag LOCUS_03980 gene marP 398393 399595 CDS product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419714.1 protein_id gnl|my_center|LOCUS_03980 400553 399588 gene locus_tag LOCUS_03990 400553 399588 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419712.1 protein_id gnl|my_center|LOCUS_03990 401072 400554 gene locus_tag LOCUS_04000 401072 400554 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419710.1 protein_id gnl|my_center|LOCUS_04000 401340 401996 gene locus_tag LOCUS_04010 401340 401996 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419708.1 protein_id gnl|my_center|LOCUS_04010 403960 402005 gene locus_tag LOCUS_04020 gene acs 403960 402005 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950924.1 protein_id gnl|my_center|LOCUS_04020 404104 405792 gene locus_tag LOCUS_04030 404104 405792 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899629.1 protein_id gnl|my_center|LOCUS_04030 405794 406720 gene locus_tag LOCUS_04040 405794 406720 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419701.1 protein_id gnl|my_center|LOCUS_04040 406713 407576 gene locus_tag LOCUS_04050 406713 407576 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419699.1 protein_id gnl|my_center|LOCUS_04050 407573 409228 gene locus_tag LOCUS_04060 407573 409228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900733.1 protein_id gnl|my_center|LOCUS_04060 409240 410010 gene locus_tag LOCUS_04070 409240 410010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899626.1 protein_id gnl|my_center|LOCUS_04070 411360 410503 gene locus_tag LOCUS_04080 411360 410503 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419689.1 protein_id gnl|my_center|LOCUS_04080 412004 412942 gene locus_tag LOCUS_04090 gene ssd 412004 412942 CDS product septum site-determining protein Ssd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419685.1 protein_id gnl|my_center|LOCUS_04090 412939 414108 gene locus_tag LOCUS_04100 412939 414108 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901691.1 protein_id gnl|my_center|LOCUS_04100 414105 414908 gene locus_tag LOCUS_04110 414105 414908 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419679.1 protein_id gnl|my_center|LOCUS_04110 414934 415536 gene locus_tag LOCUS_04120 414934 415536 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419675.1 protein_id gnl|my_center|LOCUS_04120 415561 415761 gene locus_tag LOCUS_04130 415561 415761 CDS product DUF4244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419673.1 protein_id gnl|my_center|LOCUS_04130 416053 416439 gene locus_tag LOCUS_04140 416053 416439 CDS product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899621.1 protein_id gnl|my_center|LOCUS_04140 417479 416448 gene locus_tag LOCUS_04150 417479 416448 CDS product DUF5628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419657.1 protein_id gnl|my_center|LOCUS_04150 420286 417971 gene locus_tag LOCUS_04160 420286 417971 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419652.1 protein_id gnl|my_center|LOCUS_04160 420535 420738 gene locus_tag LOCUS_04170 gene cspA 420535 420738 CDS product cold shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007166602.1 protein_id gnl|my_center|LOCUS_04170 420883 421461 gene locus_tag LOCUS_04180 420883 421461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419642.1 protein_id gnl|my_center|LOCUS_04180 421848 424469 gene locus_tag LOCUS_04190 gene topA 421848 424469 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899617.1 protein_id gnl|my_center|LOCUS_04190 426070 424481 gene locus_tag LOCUS_04200 426070 424481 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419638.1 protein_id gnl|my_center|LOCUS_04200 426475 427431 gene locus_tag LOCUS_04210 426475 427431 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419637.1 protein_id gnl|my_center|LOCUS_04210 427511 427586 gene locus_tag LOCUS_t00120 427511 427586 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 427824 427597 gene locus_tag LOCUS_04220 427824 427597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419633.1 protein_id gnl|my_center|LOCUS_04220 428537 428779 gene locus_tag LOCUS_04230 428537 428779 CDS product antitoxin VbhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419627.1 protein_id gnl|my_center|LOCUS_04230 428791 429429 gene locus_tag LOCUS_04240 428791 429429 CDS product Fic/DOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899616.1 protein_id gnl|my_center|LOCUS_04240 430140 430322 gene locus_tag LOCUS_04250 430140 430322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 430352 430741 gene locus_tag LOCUS_04260 430352 430741 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_04260 430656 431222 gene locus_tag LOCUS_04270 430656 431222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 432568 431756 gene locus_tag LOCUS_04280 gene istB 432568 431756 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_04280 433014 432565 gene locus_tag LOCUS_04290 433014 432565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 433085 433474 gene locus_tag LOCUS_04300 433085 433474 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_04300 433389 433955 gene locus_tag LOCUS_04310 433389 433955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 434998 433952 gene locus_tag LOCUS_04320 gene istA 434998 433952 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047902700.1 protein_id gnl|my_center|LOCUS_04320 435305 435658 gene locus_tag LOCUS_04330 435305 435658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 436722 435895 gene locus_tag LOCUS_04340 436722 435895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 438385 436850 gene locus_tag LOCUS_04350 gene eccD1 438385 436850 CDS product type VII secretion system ESX-1 subunit EccD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399976.1 protein_id gnl|my_center|LOCUS_04350 439176 438382 gene locus_tag LOCUS_04360 439176 438382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 441463 441176 gene locus_tag LOCUS_04370 gene esxA 441463 441176 CDS product type VII secretion system ESX-1 WXG100 family target ESAT-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399963.1 protein_id gnl|my_center|LOCUS_04370 441802 441500 gene locus_tag LOCUS_04380 gene esxB 441802 441500 CDS product type VII secretion system ESX-1 WXG100 family target CFP-10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399940.1 protein_id gnl|my_center|LOCUS_04380 442997 441894 gene locus_tag LOCUS_04390 442997 441894 CDS product type VII secretion system ESX-1 target PPE68 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399879.1 protein_id gnl|my_center|LOCUS_04390 443338 443042 gene locus_tag LOCUS_04400 443338 443042 CDS product type VII secretion system ESX-1 target PE35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399870.1 protein_id gnl|my_center|LOCUS_04400 445222 443474 gene locus_tag LOCUS_04410 gene eccCb1 445222 443474 CDS product type VII secretion system ESX-1 FtsK/SpoIIIE family ATPase EccCb1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399865.1 protein_id gnl|my_center|LOCUS_04410 447539 445299 gene locus_tag LOCUS_04420 gene eccCa1 447539 445299 CDS product type VII secretion system ESX-1 FtsK/SpoIIIE family ATPase EccCa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899738.1 protein_id gnl|my_center|LOCUS_04420 448183 447536 gene locus_tag LOCUS_04430 448183 447536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04430 448626 448192 gene locus_tag LOCUS_04440 448626 448192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04440 450706 448985 gene locus_tag LOCUS_04450 gene eccA1 450706 448985 CDS product type VII secretion system ESX-1 AAA family ATPase EccA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399850.1 protein_id gnl|my_center|LOCUS_04450 451267 450710 gene locus_tag LOCUS_04460 gene espH 451267 450710 CDS product type VII secretion system ESX-1 associated protein EspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399844.1 protein_id gnl|my_center|LOCUS_04460 452147 451308 gene locus_tag LOCUS_04470 gene espG1 452147 451308 CDS product type VII secretion system ESX-1 adaptor EspG1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399839.1 protein_id gnl|my_center|LOCUS_04470 452460 452149 gene locus_tag LOCUS_04480 gene espF 452460 452149 CDS product type VII secretion system ESX-1 associated protein EspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899737.1 protein_id gnl|my_center|LOCUS_04480 453814 452558 gene locus_tag LOCUS_04490 gene espE 453814 452558 CDS product type VII secretion system ESX-1 associated protein EspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399828.1 protein_id gnl|my_center|LOCUS_04490 455095 454049 gene locus_tag LOCUS_04500 455095 454049 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899735.1 protein_id gnl|my_center|LOCUS_04500 455439 455837 gene locus_tag LOCUS_04510 gene whiB6 455439 455837 CDS product transcriptional regulator WhiB6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899734.1 protein_id gnl|my_center|LOCUS_04510 456776 455973 gene locus_tag LOCUS_04520 456776 455973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 457769 458977 gene locus_tag LOCUS_04530 457769 458977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 459007 459396 gene locus_tag LOCUS_04540 459007 459396 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_04540 459311 459877 gene locus_tag LOCUS_04550 459311 459877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 460040 460378 gene locus_tag LOCUS_04560 gene espL 460040 460378 CDS product type VII secretion system ESX-1 associated protein EspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399988.1 protein_id gnl|my_center|LOCUS_04560 460409 460744 gene locus_tag LOCUS_04570 460409 460744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 460838 461374 gene locus_tag LOCUS_04580 gene espH 460838 461374 CDS product type VII secretion system ESX-1 associated protein EspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399844.1 protein_id gnl|my_center|LOCUS_04580 462580 461552 gene locus_tag LOCUS_04590 462580 461552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 463417 462851 gene locus_tag LOCUS_04600 463417 462851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04600 463721 463332 gene locus_tag LOCUS_04610 463721 463332 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_04610 464137 463946 gene locus_tag LOCUS_04620 464137 463946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 464247 464678 gene locus_tag LOCUS_04630 464247 464678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04630 464924 469165 gene locus_tag LOCUS_04640 464924 469165 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917711.1 protein_id gnl|my_center|LOCUS_04640 469667 469215 gene locus_tag LOCUS_04650 469667 469215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 469554 469940 gene locus_tag LOCUS_04660 469554 469940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04660 469975 470274 gene locus_tag LOCUS_04670 469975 470274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04670 470338 471723 gene locus_tag LOCUS_04680 470338 471723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 473302 472298 gene locus_tag LOCUS_04690 473302 472298 CDS product (R)-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082714.1 protein_id gnl|my_center|LOCUS_04690 473551 474603 gene locus_tag LOCUS_04700 473551 474603 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400562.1 protein_id gnl|my_center|LOCUS_04700 474746 475186 gene locus_tag LOCUS_04710 474746 475186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04710 475475 476551 gene locus_tag LOCUS_04720 475475 476551 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284839.1 protein_id gnl|my_center|LOCUS_04720 476645 478150 gene locus_tag LOCUS_04730 476645 478150 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901784.1 protein_id gnl|my_center|LOCUS_04730 479161 478187 gene locus_tag LOCUS_04740 479161 478187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 479356 480390 gene locus_tag LOCUS_04750 479356 480390 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950743.1 protein_id gnl|my_center|LOCUS_04750 480675 480836 gene locus_tag LOCUS_04760 480675 480836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 480837 481616 gene locus_tag LOCUS_04770 480837 481616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899159.1 protein_id gnl|my_center|LOCUS_04770 481829 482092 gene locus_tag LOCUS_04780 481829 482092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403210.1 protein_id gnl|my_center|LOCUS_04780 482791 482216 gene locus_tag LOCUS_04790 482791 482216 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038060574.1 protein_id gnl|my_center|LOCUS_04790 482893 484065 gene locus_tag LOCUS_04800 482893 484065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 484198 485457 gene locus_tag LOCUS_04810 484198 485457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 485426 485587 gene locus_tag LOCUS_04820 485426 485587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 485749 488091 gene locus_tag LOCUS_04830 485749 488091 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899532.1 protein_id gnl|my_center|LOCUS_04830 489346 488168 gene locus_tag LOCUS_04840 489346 488168 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104541.1 protein_id gnl|my_center|LOCUS_04840 489509 491221 gene locus_tag LOCUS_04850 489509 491221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04850 491181 492827 gene locus_tag LOCUS_04860 491181 492827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04860 493824 492883 gene locus_tag LOCUS_04870 493824 492883 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674001.1 protein_id gnl|my_center|LOCUS_04870 494001 494243 gene locus_tag LOCUS_04880 494001 494243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 494256 495353 gene locus_tag LOCUS_04890 494256 495353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 495391 495825 gene locus_tag LOCUS_04900 495391 495825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 496615 495857 gene locus_tag LOCUS_04910 496615 495857 CDS product evbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135362122.1 protein_id gnl|my_center|LOCUS_04910 497182 496685 gene locus_tag LOCUS_04920 497182 496685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04920 497794 497222 gene locus_tag LOCUS_04930 497794 497222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04930 498951 497929 gene locus_tag LOCUS_04940 498951 497929 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728054.1 protein_id gnl|my_center|LOCUS_04940 499277 498960 gene locus_tag LOCUS_04950 499277 498960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 499447 499274 gene locus_tag LOCUS_04960 499447 499274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 500077 499448 gene locus_tag LOCUS_04970 500077 499448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 500365 500096 gene locus_tag LOCUS_04980 500365 500096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 501903 500365 gene locus_tag LOCUS_04990 501903 500365 CDS product methane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893346.1 protein_id gnl|my_center|LOCUS_04990 502096 502722 gene locus_tag LOCUS_05000 502096 502722 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228788.1 protein_id gnl|my_center|LOCUS_05000 503419 502694 gene locus_tag LOCUS_05010 503419 502694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05010 504194 504553 gene locus_tag LOCUS_05020 504194 504553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 504563 505282 gene locus_tag LOCUS_05030 504563 505282 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731404.1 protein_id gnl|my_center|LOCUS_05030 505441 506520 gene locus_tag LOCUS_05040 505441 506520 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986828.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05040 506676 506942 gene locus_tag LOCUS_05050 506676 506942 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079596.1 protein_id gnl|my_center|LOCUS_05050 508175 506982 gene locus_tag LOCUS_05060 508175 506982 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 protein_id gnl|my_center|LOCUS_05060 510435 508330 gene locus_tag LOCUS_05070 510435 508330 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731362.1 protein_id gnl|my_center|LOCUS_05070 511429 510563 gene locus_tag LOCUS_05080 511429 510563 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411868.1 protein_id gnl|my_center|LOCUS_05080 511744 512319 gene locus_tag LOCUS_05090 gene kstR 511744 512319 CDS product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224372.1 protein_id gnl|my_center|LOCUS_05090 513540 512329 gene locus_tag LOCUS_05100 513540 512329 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_05100 513969 513571 gene locus_tag LOCUS_05110 513969 513571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 514481 514065 gene locus_tag LOCUS_05120 514481 514065 CDS product DUF5313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891959.1 protein_id gnl|my_center|LOCUS_05120 515003 514512 gene locus_tag LOCUS_05130 515003 514512 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727022.1 protein_id gnl|my_center|LOCUS_05130 515147 515362 gene locus_tag LOCUS_05140 515147 515362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 515375 516472 gene locus_tag LOCUS_05150 515375 516472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 517740 516523 gene locus_tag LOCUS_05160 517740 516523 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729905.1 protein_id gnl|my_center|LOCUS_05160 518446 517880 gene locus_tag LOCUS_05170 518446 517880 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731396.1 protein_id gnl|my_center|LOCUS_05170 518574 519005 gene locus_tag LOCUS_05180 518574 519005 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731395.1 protein_id gnl|my_center|LOCUS_05180 519064 520104 gene locus_tag LOCUS_05190 519064 520104 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731394.1 protein_id gnl|my_center|LOCUS_05190 520154 520543 gene locus_tag LOCUS_05200 520154 520543 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_05200 520458 521024 gene locus_tag LOCUS_05210 520458 521024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 522126 521059 gene locus_tag LOCUS_05220 522126 521059 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_05220 523368 522145 gene locus_tag LOCUS_05230 523368 522145 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_05230 524615 523491 gene locus_tag LOCUS_05240 524615 523491 CDS product adenylate cyclase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730263.1 protein_id gnl|my_center|LOCUS_05240 526965 524728 gene locus_tag LOCUS_05250 526965 524728 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899797.1 protein_id gnl|my_center|LOCUS_05250 527961 527395 gene locus_tag LOCUS_05260 527961 527395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 528085 527876 gene locus_tag LOCUS_05270 528085 527876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05270 528362 528709 gene locus_tag LOCUS_05280 528362 528709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 528735 529088 gene locus_tag LOCUS_05290 528735 529088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 529092 530087 gene locus_tag LOCUS_05300 529092 530087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 530263 531153 gene locus_tag LOCUS_05310 530263 531153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05310 531267 531758 gene locus_tag LOCUS_05320 531267 531758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 531893 532282 gene locus_tag LOCUS_05330 531893 532282 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_05330 532197 532763 gene locus_tag LOCUS_05340 532197 532763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 533086 532811 gene locus_tag LOCUS_05350 533086 532811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 533311 533868 gene locus_tag LOCUS_05360 533311 533868 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227507.1 protein_id gnl|my_center|LOCUS_05360 535531 533927 gene locus_tag LOCUS_05370 535531 533927 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089081.1 protein_id gnl|my_center|LOCUS_05370 537034 535649 gene locus_tag LOCUS_05380 537034 535649 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400600.1 protein_id gnl|my_center|LOCUS_05380 538308 537031 gene locus_tag LOCUS_05390 538308 537031 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899799.1 protein_id gnl|my_center|LOCUS_05390 538709 538305 gene locus_tag LOCUS_05400 gene gcvH 538709 538305 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 protein_id gnl|my_center|LOCUS_05400 539883 538756 gene locus_tag LOCUS_05410 gene gcvT 539883 538756 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223708.1 protein_id gnl|my_center|LOCUS_05410 542786 539901 gene locus_tag LOCUS_05420 gene gcvP 542786 539901 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088877.1 protein_id gnl|my_center|LOCUS_05420 543187 543429 gene locus_tag LOCUS_05430 543187 543429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 543442 544431 gene locus_tag LOCUS_05440 543442 544431 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911958.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05440 544554 544724 gene locus_tag LOCUS_05450 544554 544724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05450 544745 545245 gene locus_tag LOCUS_05460 544745 545245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05460 545249 546241 gene locus_tag LOCUS_05470 545249 546241 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899801.1 protein_id gnl|my_center|LOCUS_05470 547084 546263 gene locus_tag LOCUS_05480 547084 546263 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403421.1 protein_id gnl|my_center|LOCUS_05480 548373 547297 gene locus_tag LOCUS_05490 548373 547297 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878255.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05490 548595 548386 gene locus_tag LOCUS_05500 548595 548386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05500 548934 548725 gene locus_tag LOCUS_05510 548934 548725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 549302 549691 gene locus_tag LOCUS_05520 549302 549691 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_05520 549606 550172 gene locus_tag LOCUS_05530 549606 550172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05530 550552 550169 gene locus_tag LOCUS_05540 550552 550169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 551284 550616 gene locus_tag LOCUS_05550 551284 550616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05550 552306 551281 gene locus_tag LOCUS_05560 552306 551281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900087.1 protein_id gnl|my_center|LOCUS_05560 552441 552986 gene locus_tag LOCUS_05570 552441 552986 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225734.1 protein_id gnl|my_center|LOCUS_05570 553928 553098 gene locus_tag LOCUS_05580 553928 553098 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900801.1 protein_id gnl|my_center|LOCUS_05580 553989 554594 gene locus_tag LOCUS_05590 553989 554594 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899803.1 protein_id gnl|my_center|LOCUS_05590 554715 555335 gene locus_tag LOCUS_05600 554715 555335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401963.1 protein_id gnl|my_center|LOCUS_05600 555691 556299 gene locus_tag LOCUS_05610 555691 556299 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095797.1 protein_id gnl|my_center|LOCUS_05610 557261 556350 gene locus_tag LOCUS_05620 557261 556350 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403421.1 protein_id gnl|my_center|LOCUS_05620 557367 557816 gene locus_tag LOCUS_05630 557367 557816 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224025.1 protein_id gnl|my_center|LOCUS_05630 558667 557861 gene locus_tag LOCUS_05640 558667 557861 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080431.1 protein_id gnl|my_center|LOCUS_05640 558727 559911 gene locus_tag LOCUS_05650 558727 559911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 562309 559940 gene locus_tag LOCUS_05660 562309 559940 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776000.1 protein_id gnl|my_center|LOCUS_05660 563210 562320 gene locus_tag LOCUS_05670 563210 562320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027540.1 protein_id gnl|my_center|LOCUS_05670 563419 563207 gene locus_tag LOCUS_05680 563419 563207 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775998.1 protein_id gnl|my_center|LOCUS_05680 563621 564094 gene locus_tag LOCUS_05690 563621 564094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 564682 564119 gene locus_tag LOCUS_05700 564682 564119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 565731 564721 gene locus_tag LOCUS_05710 565731 564721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 566297 565818 gene locus_tag LOCUS_05720 566297 565818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 566540 567178 gene locus_tag LOCUS_05730 566540 567178 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728871.1 protein_id gnl|my_center|LOCUS_05730 567281 569080 gene locus_tag LOCUS_05740 567281 569080 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_05740 569077 570753 gene locus_tag LOCUS_05750 569077 570753 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728442.1 protein_id gnl|my_center|LOCUS_05750 571794 570637 gene locus_tag LOCUS_05760 571794 570637 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110593.1 protein_id gnl|my_center|LOCUS_05760 572044 572259 gene locus_tag LOCUS_05770 572044 572259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 572272 573306 gene locus_tag LOCUS_05780 572272 573306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 573388 575103 gene locus_tag LOCUS_05790 573388 575103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 575202 575591 gene locus_tag LOCUS_05800 575202 575591 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_05800 575506 576072 gene locus_tag LOCUS_05810 575506 576072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 576895 576083 gene locus_tag LOCUS_05820 576895 576083 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085604.1 protein_id gnl|my_center|LOCUS_05820 577012 577494 gene locus_tag LOCUS_05830 577012 577494 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400665.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05830 578469 577669 gene locus_tag LOCUS_05840 578469 577669 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225713.1 protein_id gnl|my_center|LOCUS_05840 578721 579545 gene locus_tag LOCUS_05850 578721 579545 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899807.1 protein_id gnl|my_center|LOCUS_05850 580184 579570 gene locus_tag LOCUS_05860 580184 579570 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 protein_id gnl|my_center|LOCUS_05860 580255 581115 gene locus_tag LOCUS_05870 580255 581115 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729274.1 protein_id gnl|my_center|LOCUS_05870 582232 581198 gene locus_tag LOCUS_05880 582232 581198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 582460 582245 gene locus_tag LOCUS_05890 582460 582245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 582604 583233 gene locus_tag LOCUS_05900 582604 583233 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731397.1 protein_id gnl|my_center|LOCUS_05900 583230 584054 gene locus_tag LOCUS_05910 583230 584054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 584165 584920 gene locus_tag LOCUS_05920 584165 584920 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400678.1 protein_id gnl|my_center|LOCUS_05920 585278 585763 gene locus_tag LOCUS_05930 585278 585763 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079454.1 protein_id gnl|my_center|LOCUS_05930 585865 586668 gene locus_tag LOCUS_05940 585865 586668 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_05940 586750 589662 gene locus_tag LOCUS_05950 gene mmpL4 586750 589662 CDS product siderophore RND transporter MmpL4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898458.1 protein_id gnl|my_center|LOCUS_05950 593936 589686 gene locus_tag LOCUS_05960 593936 589686 CDS product thioester reductase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908667.1 protein_id gnl|my_center|LOCUS_05960 594184 593933 gene locus_tag LOCUS_05970 594184 593933 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400793.1 protein_id gnl|my_center|LOCUS_05970 595772 594177 gene locus_tag LOCUS_05980 gene fadD10 595772 594177 CDS product fatty acid--CoA ligase FadD10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400792.1 protein_id gnl|my_center|LOCUS_05980 596355 595801 gene locus_tag LOCUS_05990 gene fcoT 596355 595801 CDS product fatty acyl CoA thioesterase FcoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899810.1 protein_id gnl|my_center|LOCUS_05990 597221 596352 gene locus_tag LOCUS_06000 597221 596352 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400786.1 protein_id gnl|my_center|LOCUS_06000 598833 597415 gene locus_tag LOCUS_06010 598833 597415 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400781.1 protein_id gnl|my_center|LOCUS_06010 599160 599969 gene locus_tag LOCUS_06020 599160 599969 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110056.1 protein_id gnl|my_center|LOCUS_06020 601122 600088 gene locus_tag LOCUS_06030 601122 600088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 601350 601135 gene locus_tag LOCUS_06040 601350 601135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 601494 602207 gene locus_tag LOCUS_06050 601494 602207 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899809.1 protein_id gnl|my_center|LOCUS_06050 604519 602228 gene locus_tag LOCUS_06060 604519 602228 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899808.1 protein_id gnl|my_center|LOCUS_06060 604644 605198 gene locus_tag LOCUS_06070 gene sigC 604644 605198 CDS product RNA polymerase sigma factor SigC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056568.1 protein_id gnl|my_center|LOCUS_06070 605914 605234 gene locus_tag LOCUS_06080 605914 605234 CDS product DUF5134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898666.1 protein_id gnl|my_center|LOCUS_06080 606080 608056 gene locus_tag LOCUS_06090 606080 608056 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900808.1 protein_id gnl|my_center|LOCUS_06090 608291 608073 gene locus_tag LOCUS_06100 608291 608073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 610557 608284 gene locus_tag LOCUS_06110 610557 608284 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400797.1 protein_id gnl|my_center|LOCUS_06110 610803 610618 gene locus_tag LOCUS_06120 610803 610618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 610847 612016 gene locus_tag LOCUS_06130 610847 612016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06130 611964 612530 gene locus_tag LOCUS_06140 611964 612530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06140 612615 614201 gene locus_tag LOCUS_06150 612615 614201 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899813.1 protein_id gnl|my_center|LOCUS_06150 614507 614271 gene locus_tag LOCUS_06160 614507 614271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06160 615648 614416 gene locus_tag LOCUS_06170 615648 614416 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950630.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06170 616244 615651 gene locus_tag LOCUS_06180 616244 615651 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079706.1 protein_id gnl|my_center|LOCUS_06180 616444 617394 gene locus_tag LOCUS_06190 616444 617394 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079707.1 protein_id gnl|my_center|LOCUS_06190 617678 617415 gene locus_tag LOCUS_06200 gene rpsR 617678 617415 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410619.1 protein_id gnl|my_center|LOCUS_06200 617990 617685 gene locus_tag LOCUS_06210 gene rpsN 617990 617685 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063153.1 protein_id gnl|my_center|LOCUS_06210 618155 617991 gene locus_tag LOCUS_06220 gene rpmG 618155 617991 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063154.1 protein_id gnl|my_center|LOCUS_06220 618391 618155 gene locus_tag LOCUS_06230 gene rpmB 618391 618155 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410631.1 protein_id gnl|my_center|LOCUS_06230 618521 619717 gene locus_tag LOCUS_06240 618521 619717 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400804.1 protein_id gnl|my_center|LOCUS_06240 619714 619986 gene locus_tag LOCUS_06250 619714 619986 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897470.1 protein_id gnl|my_center|LOCUS_06250 620156 621055 gene locus_tag LOCUS_06260 620156 621055 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111061.1 protein_id gnl|my_center|LOCUS_06260 621058 622644 gene locus_tag LOCUS_06270 gene fadD12 621058 622644 CDS product acyl-CoA ligase FadD12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898876.1 protein_id gnl|my_center|LOCUS_06270 627485 622617 gene locus_tag LOCUS_06280 627485 622617 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886065.1 protein_id gnl|my_center|LOCUS_06280 628226 627954 gene locus_tag LOCUS_06290 628226 627954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400812.1 protein_id gnl|my_center|LOCUS_06290 628665 629054 gene locus_tag LOCUS_06300 628665 629054 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_06300 628969 629535 gene locus_tag LOCUS_06310 628969 629535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 629555 631168 gene locus_tag LOCUS_06320 629555 631168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 631218 632162 gene locus_tag LOCUS_06330 631218 632162 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400822.1 protein_id gnl|my_center|LOCUS_06330 632197 632658 gene locus_tag LOCUS_06340 632197 632658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 633428 632640 gene locus_tag LOCUS_06350 633428 632640 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730670.1 protein_id gnl|my_center|LOCUS_06350 635040 633430 gene locus_tag LOCUS_06360 635040 633430 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 protein_id gnl|my_center|LOCUS_06360 635829 635050 gene locus_tag LOCUS_06370 635829 635050 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730668.1 protein_id gnl|my_center|LOCUS_06370 637431 635842 gene locus_tag LOCUS_06380 637431 635842 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730667.1 protein_id gnl|my_center|LOCUS_06380 637602 638477 gene locus_tag LOCUS_06390 637602 638477 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897035.1 protein_id gnl|my_center|LOCUS_06390 638479 639873 gene locus_tag LOCUS_06400 638479 639873 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730666.1 protein_id gnl|my_center|LOCUS_06400 639888 641069 gene locus_tag LOCUS_06410 639888 641069 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730665.1 protein_id gnl|my_center|LOCUS_06410 641075 642928 gene locus_tag LOCUS_06420 641075 642928 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730664.1 protein_id gnl|my_center|LOCUS_06420 642928 643863 gene locus_tag LOCUS_06430 642928 643863 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730663.1 protein_id gnl|my_center|LOCUS_06430 643856 645076 gene locus_tag LOCUS_06440 643856 645076 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730662.1 protein_id gnl|my_center|LOCUS_06440 645314 647326 gene locus_tag LOCUS_06450 645314 647326 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900811.1 protein_id gnl|my_center|LOCUS_06450 647995 647330 gene locus_tag LOCUS_06460 647995 647330 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085254309.1 protein_id gnl|my_center|LOCUS_06460 649068 648136 gene locus_tag LOCUS_06470 649068 648136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 649145 649528 gene locus_tag LOCUS_06480 649145 649528 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_06480 649443 650009 gene locus_tag LOCUS_06490 649443 650009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 650332 650117 gene locus_tag LOCUS_06500 650332 650117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 650946 651161 gene locus_tag LOCUS_06510 650946 651161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400850.1 protein_id gnl|my_center|LOCUS_06510 651314 653017 gene locus_tag LOCUS_06520 651314 653017 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172591985.1 protein_id gnl|my_center|LOCUS_06520 653794 653069 gene locus_tag LOCUS_06530 gene ldtMt1 653794 653069 CDS product L,D-transpeptidase LdtMt1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400856.1 protein_id gnl|my_center|LOCUS_06530 655426 654341 gene locus_tag LOCUS_06540 655426 654341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 655681 655439 gene locus_tag LOCUS_06550 655681 655439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 655744 656601 gene locus_tag LOCUS_06560 gene oxyS 655744 656601 CDS product LysR family transcriptional regulator OxyS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400857.1 protein_id gnl|my_center|LOCUS_06560 658348 656585 gene locus_tag LOCUS_06570 gene oxc 658348 656585 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400858.1 protein_id gnl|my_center|LOCUS_06570 658606 660249 gene locus_tag LOCUS_06580 658606 660249 CDS product FadD7 family fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901806.1 protein_id gnl|my_center|LOCUS_06580 662895 660739 gene locus_tag LOCUS_06590 662895 660739 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916609.1 protein_id gnl|my_center|LOCUS_06590 663476 663066 gene locus_tag LOCUS_06600 663476 663066 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400864.1 protein_id gnl|my_center|LOCUS_06600 663361 664038 gene locus_tag LOCUS_06610 663361 664038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 664193 665224 gene locus_tag LOCUS_06620 664193 665224 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400885.1 protein_id gnl|my_center|LOCUS_06620 665346 667130 gene locus_tag LOCUS_06630 gene treS 665346 667130 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400893.1 protein_id gnl|my_center|LOCUS_06630 667204 668571 gene locus_tag LOCUS_06640 gene mak 667204 668571 CDS product maltokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899824.1 protein_id gnl|my_center|LOCUS_06640 668686 669366 gene locus_tag LOCUS_06650 668686 669366 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899825.1 protein_id gnl|my_center|LOCUS_06650 670485 669445 gene locus_tag LOCUS_06660 gene ag85C 670485 669445 CDS product diacylglycerol acyltransferase/mycolyltransferase Ag85C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400908.1 protein_id gnl|my_center|LOCUS_06660 671335 670838 gene locus_tag LOCUS_06670 671335 670838 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897761.1 protein_id gnl|my_center|LOCUS_06670 671372 671827 gene locus_tag LOCUS_06680 gene htdZ 671372 671827 CDS product 3-hydroxyacyl-thioester dehydratase HtdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400912.1 protein_id gnl|my_center|LOCUS_06680 672801 671908 gene locus_tag LOCUS_06690 672801 671908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06690 673203 672838 gene locus_tag LOCUS_06700 673203 672838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06700 673338 673970 gene locus_tag LOCUS_06710 673338 673970 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_06710 676037 674007 gene locus_tag LOCUS_06720 676037 674007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 676836 676168 gene locus_tag LOCUS_06730 676836 676168 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727865.1 protein_id gnl|my_center|LOCUS_06730 676907 678004 gene locus_tag LOCUS_06740 676907 678004 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727866.1 protein_id gnl|my_center|LOCUS_06740 678040 679173 gene locus_tag LOCUS_06750 678040 679173 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727867.1 protein_id gnl|my_center|LOCUS_06750 679443 679967 gene locus_tag LOCUS_06760 679443 679967 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229399.1 protein_id gnl|my_center|LOCUS_06760 679967 681016 gene locus_tag LOCUS_06770 679967 681016 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_06770 682130 681018 gene locus_tag LOCUS_06780 682130 681018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 682726 682127 gene locus_tag LOCUS_06790 682726 682127 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416599.1 protein_id gnl|my_center|LOCUS_06790 682773 683996 gene locus_tag LOCUS_06800 682773 683996 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_06800 684035 684532 gene locus_tag LOCUS_06810 684035 684532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06810 684529 684924 gene locus_tag LOCUS_06820 684529 684924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06820 686031 684994 gene locus_tag LOCUS_06830 686031 684994 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730444.1 protein_id gnl|my_center|LOCUS_06830 686250 686038 gene locus_tag LOCUS_06840 686250 686038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 686901 686296 gene locus_tag LOCUS_06850 686901 686296 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400935.1 protein_id gnl|my_center|LOCUS_06850 687076 687369 gene locus_tag LOCUS_06860 687076 687369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06860 687366 688352 gene locus_tag LOCUS_06870 687366 688352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06870 688904 688389 gene locus_tag LOCUS_06880 gene msrA 688904 688389 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400942.1 protein_id gnl|my_center|LOCUS_06880 689061 689567 gene locus_tag LOCUS_06890 689061 689567 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400945.1 protein_id gnl|my_center|LOCUS_06890 690135 690488 gene locus_tag LOCUS_06900 690135 690488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06900 690699 691079 gene locus_tag LOCUS_06910 690699 691079 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400949.1 protein_id gnl|my_center|LOCUS_06910 691467 691066 gene locus_tag LOCUS_06920 691467 691066 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400951.1 protein_id gnl|my_center|LOCUS_06920 691540 692451 gene locus_tag LOCUS_06930 691540 692451 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400956.1 protein_id gnl|my_center|LOCUS_06930 693990 692545 gene locus_tag LOCUS_06940 693990 692545 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899828.1 protein_id gnl|my_center|LOCUS_06940 694088 695074 gene locus_tag LOCUS_06950 694088 695074 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726658.1 protein_id gnl|my_center|LOCUS_06950 695071 695709 gene locus_tag LOCUS_06960 695071 695709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06960 695854 696786 gene locus_tag LOCUS_06970 695854 696786 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899829.1 protein_id gnl|my_center|LOCUS_06970 696800 697741 gene locus_tag LOCUS_06980 696800 697741 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900814.1 protein_id gnl|my_center|LOCUS_06980 697741 698676 gene locus_tag LOCUS_06990 697741 698676 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726662.1 protein_id gnl|my_center|LOCUS_06990 698826 700310 gene locus_tag LOCUS_07000 698826 700310 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400974.1 protein_id gnl|my_center|LOCUS_07000 700383 701243 gene locus_tag LOCUS_07010 700383 701243 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400979.1 protein_id gnl|my_center|LOCUS_07010 701248 702216 gene locus_tag LOCUS_07020 701248 702216 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400985.1 protein_id gnl|my_center|LOCUS_07020 703519 702242 gene locus_tag LOCUS_07030 703519 702242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07030 704011 703529 gene locus_tag LOCUS_07040 704011 703529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07040 706070 704418 gene locus_tag LOCUS_07050 706070 704418 CDS product PE-PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401003.1 protein_id gnl|my_center|LOCUS_07050 707988 706240 gene locus_tag LOCUS_07060 707988 706240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 708861 708088 gene locus_tag LOCUS_07070 708861 708088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 709756 708878 gene locus_tag LOCUS_07080 709756 708878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07080 710097 709753 gene locus_tag LOCUS_07090 710097 709753 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234794028.1 protein_id gnl|my_center|LOCUS_07090 711005 710094 gene locus_tag LOCUS_07100 711005 710094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07100 711959 711129 gene locus_tag LOCUS_07110 gene ptbB 711959 711129 CDS product tyrosine-protein phosphatase PtbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401010.1 protein_id gnl|my_center|LOCUS_07110 713184 711952 gene locus_tag LOCUS_07120 713184 711952 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401015.1 protein_id gnl|my_center|LOCUS_07120 713327 714196 gene locus_tag LOCUS_07130 713327 714196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420405.1 protein_id gnl|my_center|LOCUS_07130 714271 714732 gene locus_tag LOCUS_07140 714271 714732 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223540.1 protein_id gnl|my_center|LOCUS_07140 714975 716063 gene locus_tag LOCUS_07150 714975 716063 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401026.1 protein_id gnl|my_center|LOCUS_07150 716079 716417 gene locus_tag LOCUS_07160 716079 716417 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909006.1 protein_id gnl|my_center|LOCUS_07160 716414 717910 gene locus_tag LOCUS_07170 716414 717910 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899835.1 protein_id gnl|my_center|LOCUS_07170 718151 717834 gene locus_tag LOCUS_07180 718151 717834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 718127 718750 gene locus_tag LOCUS_07190 718127 718750 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401044.1 protein_id gnl|my_center|LOCUS_07190 720245 718764 gene locus_tag LOCUS_07200 720245 718764 CDS product PE-PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911094.1 protein_id gnl|my_center|LOCUS_07200 721012 720455 gene locus_tag LOCUS_07210 721012 720455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07210 721945 721046 gene locus_tag LOCUS_07220 721945 721046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07220 723692 722097 gene locus_tag LOCUS_07230 723692 722097 CDS product PE-PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900817.1 protein_id gnl|my_center|LOCUS_07230 724663 723776 gene locus_tag LOCUS_07240 724663 723776 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206791.1 protein_id gnl|my_center|LOCUS_07240 724769 725851 gene locus_tag LOCUS_07250 724769 725851 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 protein_id gnl|my_center|LOCUS_07250 725871 726611 gene locus_tag LOCUS_07260 725871 726611 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729123.1 protein_id gnl|my_center|LOCUS_07260 726632 727972 gene locus_tag LOCUS_07270 726632 727972 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401056.1 protein_id gnl|my_center|LOCUS_07270 728524 727979 gene locus_tag LOCUS_07280 728524 727979 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893908.1 protein_id gnl|my_center|LOCUS_07280 729047 728583 gene locus_tag LOCUS_07290 729047 728583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 729633 729067 gene locus_tag LOCUS_07300 729633 729067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07300 729937 729548 gene locus_tag LOCUS_07310 729937 729548 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_07310 730332 729967 gene locus_tag LOCUS_07320 730332 729967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 731211 730372 gene locus_tag LOCUS_07330 731211 730372 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728436.1 protein_id gnl|my_center|LOCUS_07330 731603 731361 gene locus_tag LOCUS_07340 731603 731361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 731493 732212 gene locus_tag LOCUS_07350 731493 732212 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728746.1 protein_id gnl|my_center|LOCUS_07350 732227 733147 gene locus_tag LOCUS_07360 732227 733147 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730112.1 protein_id gnl|my_center|LOCUS_07360 733847 733269 gene locus_tag LOCUS_07370 733847 733269 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893928.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07370 735013 733844 gene locus_tag LOCUS_07380 735013 733844 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728430.1 protein_id gnl|my_center|LOCUS_07380 735115 736284 gene locus_tag LOCUS_07390 735115 736284 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_07390 737405 736371 gene locus_tag LOCUS_07400 737405 736371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 737633 737418 gene locus_tag LOCUS_07410 737633 737418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 737986 738924 gene locus_tag LOCUS_07420 gene mcr 737986 738924 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898740.1 protein_id gnl|my_center|LOCUS_07420 738982 739743 gene locus_tag LOCUS_07430 738982 739743 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405961.1 protein_id gnl|my_center|LOCUS_07430 740010 739879 gene locus_tag LOCUS_07440 740010 739879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730366.1 protein_id gnl|my_center|LOCUS_07440 740392 740727 gene locus_tag LOCUS_07450 740392 740727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07450 740645 741562 gene locus_tag LOCUS_07460 740645 741562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07460 741553 742731 gene locus_tag LOCUS_07470 741553 742731 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904560.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07470 742739 743374 gene locus_tag LOCUS_07480 742739 743374 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730363.1 protein_id gnl|my_center|LOCUS_07480 743404 743793 gene locus_tag LOCUS_07490 743404 743793 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_07490 743708 744274 gene locus_tag LOCUS_07500 743708 744274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 744228 745355 gene locus_tag LOCUS_07510 744228 745355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 746901 745390 gene locus_tag LOCUS_07520 746901 745390 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531929.1 protein_id gnl|my_center|LOCUS_07520 747223 750042 gene locus_tag LOCUS_07530 747223 750042 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406189.1 protein_id gnl|my_center|LOCUS_07530 751161 750106 gene locus_tag LOCUS_07540 gene dapC 751161 750106 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903345.1 protein_id gnl|my_center|LOCUS_07540 751559 751233 gene locus_tag LOCUS_07550 751559 751233 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406185.1 protein_id gnl|my_center|LOCUS_07550 751773 752339 gene locus_tag LOCUS_07560 751773 752339 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406182.1 protein_id gnl|my_center|LOCUS_07560 752339 754363 gene locus_tag LOCUS_07570 752339 754363 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911416.1 protein_id gnl|my_center|LOCUS_07570 754575 754907 gene locus_tag LOCUS_07580 754575 754907 CDS product hemophore-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406169.1 protein_id gnl|my_center|LOCUS_07580 754972 755355 gene locus_tag LOCUS_07590 754972 755355 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_07590 755270 755836 gene locus_tag LOCUS_07600 755270 755836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 758651 756051 gene locus_tag LOCUS_07610 758651 756051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 761793 759223 gene locus_tag LOCUS_07620 761793 759223 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406167.1 protein_id gnl|my_center|LOCUS_07620 761998 762654 gene locus_tag LOCUS_07630 761998 762654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 763757 762723 gene locus_tag LOCUS_07640 763757 762723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 764012 763770 gene locus_tag LOCUS_07650 764012 763770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 764750 764184 gene locus_tag LOCUS_07660 764750 764184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 765054 764665 gene locus_tag LOCUS_07670 765054 764665 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_07670 765630 765271 gene locus_tag LOCUS_07680 765630 765271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406163.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07680 766746 765841 gene locus_tag LOCUS_07690 gene mshB 766746 765841 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406154.1 protein_id gnl|my_center|LOCUS_07690 766919 767533 gene locus_tag LOCUS_07700 766919 767533 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406104.1 protein_id gnl|my_center|LOCUS_07700 768692 767562 gene locus_tag LOCUS_07710 768692 767562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 770993 768891 gene locus_tag LOCUS_07720 770993 768891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 773306 771303 gene locus_tag LOCUS_07730 gene lpqW 773306 771303 CDS product lipoarabinomannan biosynthesis protein LpqW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406102.1 protein_id gnl|my_center|LOCUS_07730 775074 773308 gene locus_tag LOCUS_07740 gene typA 775074 773308 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730337.1 protein_id gnl|my_center|LOCUS_07740 775009 775191 gene locus_tag LOCUS_07750 775009 775191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 775579 775875 gene locus_tag LOCUS_07760 775579 775875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 776660 776094 gene locus_tag LOCUS_07770 776660 776094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07770 776964 776575 gene locus_tag LOCUS_07780 776964 776575 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_07780 777027 777338 gene locus_tag LOCUS_07790 777027 777338 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730347.1 protein_id gnl|my_center|LOCUS_07790 778638 777364 gene locus_tag LOCUS_07800 778638 777364 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900282.1 protein_id gnl|my_center|LOCUS_07800 778775 779401 gene locus_tag LOCUS_07810 778775 779401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406075.1 protein_id gnl|my_center|LOCUS_07810 780228 779818 gene locus_tag LOCUS_07820 780228 779818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 780267 780653 gene locus_tag LOCUS_07830 780267 780653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07830 780831 780685 gene locus_tag LOCUS_07840 780831 780685 CDS product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896554.1 protein_id gnl|my_center|LOCUS_07840 781434 780856 gene locus_tag LOCUS_07850 781434 780856 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406064.1 protein_id gnl|my_center|LOCUS_07850 781696 781508 gene locus_tag LOCUS_07860 781696 781508 CDS product DUF5302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406063.1 protein_id gnl|my_center|LOCUS_07860 782162 781719 gene locus_tag LOCUS_07870 782162 781719 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406060.1 protein_id gnl|my_center|LOCUS_07870 782219 782734 gene locus_tag LOCUS_07880 782219 782734 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936776.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07880 782749 783585 gene locus_tag LOCUS_07890 782749 783585 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898744.1 protein_id gnl|my_center|LOCUS_07890 783999 783595 gene locus_tag LOCUS_07900 783999 783595 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406047.1 protein_id gnl|my_center|LOCUS_07900 784019 784735 gene locus_tag LOCUS_07910 gene cobB 784019 784735 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406044.1 protein_id gnl|my_center|LOCUS_07910 785481 784843 gene locus_tag LOCUS_07920 785481 784843 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405982.1 protein_id gnl|my_center|LOCUS_07920 786135 785569 gene locus_tag LOCUS_07930 786135 785569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 786439 786050 gene locus_tag LOCUS_07940 786439 786050 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_07940 787362 786469 gene locus_tag LOCUS_07950 787362 786469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 787447 789078 gene locus_tag LOCUS_07960 gene pruA 787447 789078 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900286.1 protein_id gnl|my_center|LOCUS_07960 789078 790037 gene locus_tag LOCUS_07970 789078 790037 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900287.1 protein_id gnl|my_center|LOCUS_07970 791551 790064 gene locus_tag LOCUS_07980 791551 790064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07980 791828 791502 gene locus_tag LOCUS_07990 791828 791502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07990 792280 791825 gene locus_tag LOCUS_08000 792280 791825 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224383.1 protein_id gnl|my_center|LOCUS_08000 792705 792277 gene locus_tag LOCUS_08010 792705 792277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08010 792857 792705 gene locus_tag LOCUS_08020 792857 792705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 793266 792841 gene locus_tag LOCUS_08030 793266 792841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08030 793671 795023 gene locus_tag LOCUS_08040 793671 795023 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403919.1 protein_id gnl|my_center|LOCUS_08040 795193 796113 gene locus_tag LOCUS_08050 795193 796113 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406215.1 protein_id gnl|my_center|LOCUS_08050 796117 796941 gene locus_tag LOCUS_08060 796117 796941 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898763.1 protein_id gnl|my_center|LOCUS_08060 796986 798404 gene locus_tag LOCUS_08070 796986 798404 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406218.1 protein_id gnl|my_center|LOCUS_08070 799029 798421 gene locus_tag LOCUS_08080 799029 798421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 799333 798944 gene locus_tag LOCUS_08090 799333 798944 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_08090 800075 799383 gene locus_tag LOCUS_08100 800075 799383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 800694 800128 gene locus_tag LOCUS_08110 800694 800128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 800998 800609 gene locus_tag LOCUS_08120 800998 800609 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_08120 801309 801028 gene locus_tag LOCUS_08130 801309 801028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08130 802324 802626 gene locus_tag LOCUS_08140 802324 802626 CDS product PE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418781.1 protein_id gnl|my_center|LOCUS_08140 802666 803847 gene locus_tag LOCUS_08150 802666 803847 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950503.1 protein_id gnl|my_center|LOCUS_08150 804369 804004 gene locus_tag LOCUS_08160 804369 804004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 805025 806308 gene locus_tag LOCUS_08170 805025 806308 CDS product MHS family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406233.1 protein_id gnl|my_center|LOCUS_08170 806885 806319 gene locus_tag LOCUS_08180 806885 806319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 807189 806800 gene locus_tag LOCUS_08190 807189 806800 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_08190 807852 807610 gene locus_tag LOCUS_08200 807852 807610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 808127 808627 gene locus_tag LOCUS_08210 808127 808627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 809626 808682 gene locus_tag LOCUS_08220 gene dapD 809626 808682 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898768.1 protein_id gnl|my_center|LOCUS_08220 809749 810813 gene locus_tag LOCUS_08230 gene dapE 809749 810813 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406235.1 protein_id gnl|my_center|LOCUS_08230 810863 811252 gene locus_tag LOCUS_08240 810863 811252 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_08240 811167 811733 gene locus_tag LOCUS_08250 811167 811733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08250 812238 811744 gene locus_tag LOCUS_08260 812238 811744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 812409 812936 gene locus_tag LOCUS_08270 812409 812936 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898770.1 protein_id gnl|my_center|LOCUS_08270 813007 814788 gene locus_tag LOCUS_08280 gene fadD6 813007 814788 CDS product long-chain-acyl-CoA synthetase FadD6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406240.1 protein_id gnl|my_center|LOCUS_08280 814878 815753 gene locus_tag LOCUS_08290 gene folP 814878 815753 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406241.1 protein_id gnl|my_center|LOCUS_08290 815750 816733 gene locus_tag LOCUS_08300 815750 816733 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908106.1 protein_id gnl|my_center|LOCUS_08300 816782 817153 gene locus_tag LOCUS_08310 816782 817153 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406243.1 protein_id gnl|my_center|LOCUS_08310 817150 817728 gene locus_tag LOCUS_08320 817150 817728 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406244.1 protein_id gnl|my_center|LOCUS_08320 817893 818060 gene locus_tag LOCUS_08330 817893 818060 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406247.1 protein_id gnl|my_center|LOCUS_08330 819246 818083 gene locus_tag LOCUS_08340 gene glgA 819246 818083 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898773.1 protein_id gnl|my_center|LOCUS_08340 820518 819484 gene locus_tag LOCUS_08350 820518 819484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 820746 820531 gene locus_tag LOCUS_08360 820746 820531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 820836 822104 gene locus_tag LOCUS_08370 gene glgC 820836 822104 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406249.1 protein_id gnl|my_center|LOCUS_08370 823962 822196 gene locus_tag LOCUS_08380 823962 822196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 824761 824207 gene locus_tag LOCUS_08390 824761 824207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 826047 825019 gene locus_tag LOCUS_08400 826047 825019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08400 826934 826260 gene locus_tag LOCUS_08410 826934 826260 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406252.1 protein_id gnl|my_center|LOCUS_08410 828606 826963 gene locus_tag LOCUS_08420 828606 826963 CDS product multidrug efflux ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898775.1 protein_id gnl|my_center|LOCUS_08420 829550 828603 gene locus_tag LOCUS_08430 829550 828603 CDS product multidrug efflux ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900295.1 protein_id gnl|my_center|LOCUS_08430 830178 829540 gene locus_tag LOCUS_08440 gene raaS 830178 829540 CDS product transcriptional regulator RaaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406254.1 protein_id gnl|my_center|LOCUS_08440 830323 830538 gene locus_tag LOCUS_08450 830323 830538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 830551 831648 gene locus_tag LOCUS_08460 830551 831648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 832059 834014 gene locus_tag LOCUS_08470 832059 834014 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950840.1 protein_id gnl|my_center|LOCUS_08470 834143 834532 gene locus_tag LOCUS_08480 834143 834532 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_08480 834447 835013 gene locus_tag LOCUS_08490 834447 835013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 835638 835024 gene locus_tag LOCUS_08500 835638 835024 CDS product SAM-dependent O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911448.1 protein_id gnl|my_center|LOCUS_08500 835921 836688 gene locus_tag LOCUS_08510 gene sigE 835921 836688 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406257.1 protein_id gnl|my_center|LOCUS_08510 836834 837238 gene locus_tag LOCUS_08520 836834 837238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 837545 838924 gene locus_tag LOCUS_08530 gene htrA 837545 838924 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898779.1 protein_id gnl|my_center|LOCUS_08530 838924 839316 gene locus_tag LOCUS_08540 gene tatB 838924 839316 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406260.1 protein_id gnl|my_center|LOCUS_08540 840492 839332 gene locus_tag LOCUS_08550 840492 839332 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406273.1 protein_id gnl|my_center|LOCUS_08550 841950 840544 gene locus_tag LOCUS_08560 841950 840544 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916796.1 protein_id gnl|my_center|LOCUS_08560 842599 842069 gene locus_tag LOCUS_08570 842599 842069 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406283.1 protein_id gnl|my_center|LOCUS_08570 843903 842596 gene locus_tag LOCUS_08580 843903 842596 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406286.1 protein_id gnl|my_center|LOCUS_08580 844221 844003 gene locus_tag LOCUS_08590 844221 844003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08590 844640 844218 gene locus_tag LOCUS_08600 844640 844218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 844633 844863 gene locus_tag LOCUS_08610 844633 844863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 845011 845430 gene locus_tag LOCUS_08620 845011 845430 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406290.1 protein_id gnl|my_center|LOCUS_08620 845477 846877 gene locus_tag LOCUS_08630 gene lpqY 845477 846877 CDS product trehalose ABC transporter substrate-binding protein LpqY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898783.1 protein_id gnl|my_center|LOCUS_08630 846874 847782 gene locus_tag LOCUS_08640 gene sugA 846874 847782 CDS product trehalose ABC transporter permease SugA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406295.1 protein_id gnl|my_center|LOCUS_08640 847772 848623 gene locus_tag LOCUS_08650 gene sugB 847772 848623 CDS product trehalose ABC transporter permease SugB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900298.1 protein_id gnl|my_center|LOCUS_08650 848628 849815 gene locus_tag LOCUS_08660 gene sugC 848628 849815 CDS product trehalose ABC transporter ATP-binding protein SugC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406299.1 protein_id gnl|my_center|LOCUS_08660 849812 850405 gene locus_tag LOCUS_08670 849812 850405 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730287.1 protein_id gnl|my_center|LOCUS_08670 850688 852133 gene locus_tag LOCUS_08680 850688 852133 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731109.1 protein_id gnl|my_center|LOCUS_08680 852375 853520 gene locus_tag LOCUS_08690 852375 853520 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014210.1 protein_id gnl|my_center|LOCUS_08690 854625 853525 gene locus_tag LOCUS_08700 gene corA 854625 853525 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916789.1 protein_id gnl|my_center|LOCUS_08700 854809 855798 gene locus_tag LOCUS_08710 854809 855798 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406301.1 protein_id gnl|my_center|LOCUS_08710 855957 857171 gene locus_tag LOCUS_08720 855957 857171 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878221.1 protein_id gnl|my_center|LOCUS_08720 857183 858034 gene locus_tag LOCUS_08730 857183 858034 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900301.1 protein_id gnl|my_center|LOCUS_08730 858904 858071 gene locus_tag LOCUS_08740 858904 858071 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898788.1 protein_id gnl|my_center|LOCUS_08740 862798 859061 gene locus_tag LOCUS_08750 862798 859061 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950509.1 protein_id gnl|my_center|LOCUS_08750 863596 862979 gene locus_tag LOCUS_08760 863596 862979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406325.1 protein_id gnl|my_center|LOCUS_08760 863950 865830 gene locus_tag LOCUS_08770 863950 865830 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406326.1 protein_id gnl|my_center|LOCUS_08770 867815 865839 gene locus_tag LOCUS_08780 867815 865839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08780 868634 867996 gene locus_tag LOCUS_08790 868634 867996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08790 869255 868650 gene locus_tag LOCUS_08800 869255 868650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08800 869925 869329 gene locus_tag LOCUS_08810 869925 869329 CDS product LppP/LprE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406334.1 protein_id gnl|my_center|LOCUS_08810 870045 871760 gene locus_tag LOCUS_08820 870045 871760 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406344.1 protein_id gnl|my_center|LOCUS_08820 871757 872899 gene locus_tag LOCUS_08830 871757 872899 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908130.1 protein_id gnl|my_center|LOCUS_08830 873763 872990 gene locus_tag LOCUS_08840 873763 872990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 874027 874248 gene locus_tag LOCUS_08850 874027 874248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 874810 874403 gene locus_tag LOCUS_08860 874810 874403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 874832 875311 gene locus_tag LOCUS_08870 874832 875311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 875888 875322 gene locus_tag LOCUS_08880 875888 875322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 876192 875803 gene locus_tag LOCUS_08890 876192 875803 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_08890 877325 876222 gene locus_tag LOCUS_08900 877325 876222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 878421 877840 gene locus_tag LOCUS_08910 878421 877840 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406350.1 protein_id gnl|my_center|LOCUS_08910 879662 878421 gene locus_tag LOCUS_08920 gene cyp130 879662 878421 CDS product cytochrome P450 Cyp130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406352.1 protein_id gnl|my_center|LOCUS_08920 881234 879867 gene locus_tag LOCUS_08930 881234 879867 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406358.1 protein_id gnl|my_center|LOCUS_08930 882497 881292 gene locus_tag LOCUS_08940 882497 881292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406359.1 protein_id gnl|my_center|LOCUS_08940 882632 883444 gene locus_tag LOCUS_08950 882632 883444 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406360.1 protein_id gnl|my_center|LOCUS_08950 883448 884584 gene locus_tag LOCUS_08960 883448 884584 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406361.1 protein_id gnl|my_center|LOCUS_08960 884622 885770 gene locus_tag LOCUS_08970 884622 885770 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896435.1 protein_id gnl|my_center|LOCUS_08970 886134 885682 gene locus_tag LOCUS_08980 886134 885682 CDS product F420H(2)-dependent quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406364.1 protein_id gnl|my_center|LOCUS_08980 886573 886145 gene locus_tag LOCUS_08990 886573 886145 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406366.1 protein_id gnl|my_center|LOCUS_08990 886676 888064 gene locus_tag LOCUS_09000 886676 888064 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 protein_id gnl|my_center|LOCUS_09000 888611 888078 gene locus_tag LOCUS_09010 888611 888078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 890089 888608 gene locus_tag LOCUS_09020 890089 888608 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727267.1 protein_id gnl|my_center|LOCUS_09020 890070 891371 gene locus_tag LOCUS_09030 890070 891371 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406372.1 protein_id gnl|my_center|LOCUS_09030 891632 891874 gene locus_tag LOCUS_09040 891632 891874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 892548 891982 gene locus_tag LOCUS_09050 892548 891982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 892852 892463 gene locus_tag LOCUS_09060 892852 892463 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_09060 892923 893918 gene locus_tag LOCUS_09070 892923 893918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 894057 894626 gene locus_tag LOCUS_09080 gene abmR 894057 894626 CDS product transcriptional regulator AbmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406375.1 protein_id gnl|my_center|LOCUS_09080 895000 894638 gene locus_tag LOCUS_09090 895000 894638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09090 896566 895247 gene locus_tag LOCUS_09100 896566 895247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09100 896845 897063 gene locus_tag LOCUS_09110 896845 897063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 899373 897118 gene locus_tag LOCUS_09120 899373 897118 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872986.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09120 899829 899419 gene locus_tag LOCUS_09130 899829 899419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 901273 899954 gene locus_tag LOCUS_09140 901273 899954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 902126 901455 gene locus_tag LOCUS_09150 gene espD 902126 901455 CDS product type VII secretion system ESX-1 target EspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419545.1 protein_id gnl|my_center|LOCUS_09150 902451 902140 gene locus_tag LOCUS_09160 gene espC 902451 902140 CDS product type VII secretion system ESX-1 filament-forming target EspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899599.1 protein_id gnl|my_center|LOCUS_09160 903699 902512 gene locus_tag LOCUS_09170 gene espA 903699 902512 CDS product type VII secretion system ESX-1 target EspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950920.1 protein_id gnl|my_center|LOCUS_09170 905161 905580 gene locus_tag LOCUS_09180 905161 905580 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085915.1 protein_id gnl|my_center|LOCUS_09180 905901 905659 gene locus_tag LOCUS_09190 905901 905659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09190 906418 906777 gene locus_tag LOCUS_09200 906418 906777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 906985 907878 gene locus_tag LOCUS_09210 906985 907878 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916971.1 protein_id gnl|my_center|LOCUS_09210 909085 907910 gene locus_tag LOCUS_09220 909085 907910 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902894.1 protein_id gnl|my_center|LOCUS_09220 910440 909103 gene locus_tag LOCUS_09230 910440 909103 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525242.1 protein_id gnl|my_center|LOCUS_09230 910967 910440 gene locus_tag LOCUS_09240 gene ripB 910967 910440 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 protein_id gnl|my_center|LOCUS_09240 911803 910955 gene locus_tag LOCUS_09250 911803 910955 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551952.1 protein_id gnl|my_center|LOCUS_09250 911909 912811 gene locus_tag LOCUS_09260 911909 912811 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242958.1 protein_id gnl|my_center|LOCUS_09260 914992 913202 gene locus_tag LOCUS_09270 914992 913202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 915315 915100 gene locus_tag LOCUS_09280 915315 915100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 916490 915345 gene locus_tag LOCUS_09290 gene embR 916490 915345 CDS product response regulator transcription factor EmbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406553.1 protein_id gnl|my_center|LOCUS_09290 917553 916843 gene locus_tag LOCUS_09300 917553 916843 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898800.1 protein_id gnl|my_center|LOCUS_09300 918032 917697 gene locus_tag LOCUS_09310 918032 917697 CDS product DUF4189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406558.1 protein_id gnl|my_center|LOCUS_09310 918889 918149 gene locus_tag LOCUS_09320 gene lprA 918889 918149 CDS product TLR2 agonist LprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406562.1 protein_id gnl|my_center|LOCUS_09320 919455 919129 gene locus_tag LOCUS_09330 919455 919129 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406566.1 protein_id gnl|my_center|LOCUS_09330 920019 919687 gene locus_tag LOCUS_09340 920019 919687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 920737 922152 gene locus_tag LOCUS_09350 920737 922152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09350 922041 922550 gene locus_tag LOCUS_09360 922041 922550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 924538 922616 gene locus_tag LOCUS_09370 924538 922616 CDS product fatty acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406569.1 protein_id gnl|my_center|LOCUS_09370 926274 924535 gene locus_tag LOCUS_09380 926274 924535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406574.1 protein_id gnl|my_center|LOCUS_09380 926422 926979 gene locus_tag LOCUS_09390 926422 926979 CDS product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406577.1 protein_id gnl|my_center|LOCUS_09390 926976 927554 gene locus_tag LOCUS_09400 926976 927554 CDS product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900308.1 protein_id gnl|my_center|LOCUS_09400 928213 927617 gene locus_tag LOCUS_09410 928213 927617 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406581.1 protein_id gnl|my_center|LOCUS_09410 928452 928261 gene locus_tag LOCUS_09420 928452 928261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 928405 929556 gene locus_tag LOCUS_09430 928405 929556 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406584.1 protein_id gnl|my_center|LOCUS_09430 929553 932183 gene locus_tag LOCUS_09440 929553 932183 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898806.1 protein_id gnl|my_center|LOCUS_09440 932233 933822 gene locus_tag LOCUS_09450 932233 933822 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406598.1 protein_id gnl|my_center|LOCUS_09450 934411 933845 gene locus_tag LOCUS_09460 934411 933845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 934715 934326 gene locus_tag LOCUS_09470 934715 934326 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_09470 934846 936096 gene locus_tag LOCUS_09480 934846 936096 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730246.1 protein_id gnl|my_center|LOCUS_09480 937741 936083 gene locus_tag LOCUS_09490 gene oppA 937741 936083 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900310.1 protein_id gnl|my_center|LOCUS_09490 939659 937821 gene locus_tag LOCUS_09500 939659 937821 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406602.1 protein_id gnl|my_center|LOCUS_09500 940549 939656 gene locus_tag LOCUS_09510 940549 939656 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406607.1 protein_id gnl|my_center|LOCUS_09510 941523 940546 gene locus_tag LOCUS_09520 941523 940546 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406613.1 protein_id gnl|my_center|LOCUS_09520 941846 942337 gene locus_tag LOCUS_09530 gene canA 941846 942337 CDS product beta-carbonic anhydrase CanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406616.1 protein_id gnl|my_center|LOCUS_09530 942779 942345 gene locus_tag LOCUS_09540 942779 942345 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104285.1 protein_id gnl|my_center|LOCUS_09540 942967 943899 gene locus_tag LOCUS_09550 gene cysD 942967 943899 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911471.1 protein_id gnl|my_center|LOCUS_09550 943899 945749 gene locus_tag LOCUS_09560 gene cysC 943899 945749 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406621.1 protein_id gnl|my_center|LOCUS_09560 945849 946328 gene locus_tag LOCUS_09570 945849 946328 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406624.1 protein_id gnl|my_center|LOCUS_09570 946558 946767 gene locus_tag LOCUS_09580 946558 946767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 946682 947248 gene locus_tag LOCUS_09590 946682 947248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 947646 947245 gene locus_tag LOCUS_09600 947646 947245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 948152 947739 gene locus_tag LOCUS_09610 948152 947739 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230839.1 protein_id gnl|my_center|LOCUS_09610 948207 949079 gene locus_tag LOCUS_09620 948207 949079 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896372.1 protein_id gnl|my_center|LOCUS_09620 949175 950449 gene locus_tag LOCUS_09630 949175 950449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09630 951845 950586 gene locus_tag LOCUS_09640 951845 950586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 952336 951842 gene locus_tag LOCUS_09650 952336 951842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 952597 953061 gene locus_tag LOCUS_09660 952597 953061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09660 953327 953806 gene locus_tag LOCUS_09670 953327 953806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 953921 954202 gene locus_tag LOCUS_09680 953921 954202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09680 954218 954547 gene locus_tag LOCUS_09690 954218 954547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09690 956066 954588 gene locus_tag LOCUS_09700 956066 954588 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406627.1 protein_id gnl|my_center|LOCUS_09700 957251 956439 gene locus_tag LOCUS_09710 gene istB 957251 956439 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_09710 957565 957248 gene locus_tag LOCUS_09720 957565 957248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 958085 957519 gene locus_tag LOCUS_09730 958085 957519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 958389 958000 gene locus_tag LOCUS_09740 958389 958000 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_09740 959681 958419 gene locus_tag LOCUS_09750 959681 958419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 959934 960122 gene locus_tag LOCUS_09760 959934 960122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 960474 960217 gene locus_tag LOCUS_09770 960474 960217 CDS product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_09770 961734 960652 gene locus_tag LOCUS_09780 961734 960652 CDS product 3 beta-hydroxysteroid dehydrogenase/delta 5-->4-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405840.1 protein_id gnl|my_center|LOCUS_09780 962049 961801 gene locus_tag LOCUS_09790 962049 961801 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405844.1 protein_id gnl|my_center|LOCUS_09790 963286 962039 gene locus_tag LOCUS_09800 gene xseA 963286 962039 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405846.1 protein_id gnl|my_center|LOCUS_09800 963900 963283 gene locus_tag LOCUS_09810 963900 963283 CDS product lipid droplet-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898730.1 protein_id gnl|my_center|LOCUS_09810 964977 963982 gene locus_tag LOCUS_09820 964977 963982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 965054 965437 gene locus_tag LOCUS_09830 965054 965437 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_09830 965352 965918 gene locus_tag LOCUS_09840 965352 965918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 966241 966026 gene locus_tag LOCUS_09850 966241 966026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 966386 967384 gene locus_tag LOCUS_09860 966386 967384 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405853.1 protein_id gnl|my_center|LOCUS_09860 968599 967406 gene locus_tag LOCUS_09870 968599 967406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197492561.1 protein_id gnl|my_center|LOCUS_09870 968759 969859 gene locus_tag LOCUS_09880 gene ychF 968759 969859 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730394.1 protein_id gnl|my_center|LOCUS_09880 970321 970710 gene locus_tag LOCUS_09890 970321 970710 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_09890 970625 971191 gene locus_tag LOCUS_09900 970625 971191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 971248 972030 gene locus_tag LOCUS_09910 gene espJ 971248 972030 CDS product type VII secretion system ESX-1 associated protein EspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950951.1 protein_id gnl|my_center|LOCUS_09910 973772 971997 gene locus_tag LOCUS_09920 gene espK 973772 971997 CDS product type VII secretion system ESX-1 associated protein EspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950952.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09920 974076 973744 gene locus_tag LOCUS_09930 974076 973744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09930 974515 974051 gene locus_tag LOCUS_09940 974515 974051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09940 975082 974768 gene locus_tag LOCUS_09950 975082 974768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 975503 975159 gene locus_tag LOCUS_09960 gene espL 975503 975159 CDS product type VII secretion system ESX-1 associated protein EspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399988.1 protein_id gnl|my_center|LOCUS_09960 976285 975500 gene locus_tag LOCUS_09970 976285 975500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09970 976878 976291 gene locus_tag LOCUS_09980 976878 976291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09980 977626 977267 gene locus_tag LOCUS_09990 977626 977267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 977508 978278 gene locus_tag LOCUS_10000 977508 978278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10000 978706 979209 gene locus_tag LOCUS_10010 978706 979209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 979525 980043 gene locus_tag LOCUS_10020 979525 980043 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017206458.1 protein_id gnl|my_center|LOCUS_10020 980119 980448 gene locus_tag LOCUS_10030 980119 980448 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405871.1 protein_id gnl|my_center|LOCUS_10030 981246 980545 gene locus_tag LOCUS_10040 981246 980545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898734.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10040 981279 981443 gene locus_tag LOCUS_10050 981279 981443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110167.1 protein_id gnl|my_center|LOCUS_10050 982020 981454 gene locus_tag LOCUS_10060 982020 981454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 982324 981935 gene locus_tag LOCUS_10070 982324 981935 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_10070 983207 982374 gene locus_tag LOCUS_10080 983207 982374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 983353 984762 gene locus_tag LOCUS_10090 983353 984762 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898735.1 protein_id gnl|my_center|LOCUS_10090 984777 985799 gene locus_tag LOCUS_10100 gene gnd 984777 985799 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405880.1 protein_id gnl|my_center|LOCUS_10100 986662 985796 gene locus_tag LOCUS_10110 986662 985796 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405884.1 protein_id gnl|my_center|LOCUS_10110 986936 987286 gene locus_tag LOCUS_10120 986936 987286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10120 987863 987276 gene locus_tag LOCUS_10130 987863 987276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 987933 988424 gene locus_tag LOCUS_10140 987933 988424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 988597 989322 gene locus_tag LOCUS_10150 988597 989322 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10150 989342 990568 gene locus_tag LOCUS_10160 989342 990568 CDS product WS/DGAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900276.1 protein_id gnl|my_center|LOCUS_10160 991180 990575 gene locus_tag LOCUS_10170 991180 990575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405892.1 protein_id gnl|my_center|LOCUS_10170 992670 991177 gene locus_tag LOCUS_10180 992670 991177 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903329.1 protein_id gnl|my_center|LOCUS_10180 992915 993424 gene locus_tag LOCUS_10190 992915 993424 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908043.1 protein_id gnl|my_center|LOCUS_10190 993445 995217 gene locus_tag LOCUS_10200 993445 995217 CDS product DUF3556 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950497.1 protein_id gnl|my_center|LOCUS_10200 997586 995295 gene locus_tag LOCUS_10210 gene metE 997586 995295 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405914.1 protein_id gnl|my_center|LOCUS_10210 998653 998003 gene locus_tag LOCUS_10220 998653 998003 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035335.1 protein_id gnl|my_center|LOCUS_10220 999512 998670 gene locus_tag LOCUS_10230 999512 998670 CDS product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730142.1 protein_id gnl|my_center|LOCUS_10230 1000813 999617 gene locus_tag LOCUS_10240 1000813 999617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1001679 1001329 gene locus_tag LOCUS_10250 1001679 1001329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1002603 1001878 gene locus_tag LOCUS_10260 1002603 1001878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1002725 1003261 gene locus_tag LOCUS_10270 1002725 1003261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1003262 1004227 gene locus_tag LOCUS_10280 1003262 1004227 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463536.1 protein_id gnl|my_center|LOCUS_10280 1004220 1005713 gene locus_tag LOCUS_10290 1004220 1005713 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897260.1 protein_id gnl|my_center|LOCUS_10290 1005771 1006496 gene locus_tag LOCUS_10300 1005771 1006496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10300 1006469 1006810 gene locus_tag LOCUS_10310 1006469 1006810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10310 1007270 1008328 gene locus_tag LOCUS_10320 1007270 1008328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10320 1008329 1009036 gene locus_tag LOCUS_10330 1008329 1009036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10330 1011311 1009101 gene locus_tag LOCUS_10340 1011311 1009101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10340 1012358 1011399 gene locus_tag LOCUS_10350 1012358 1011399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10350 1014690 1012825 gene locus_tag LOCUS_10360 1014690 1012825 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405919.1 protein_id gnl|my_center|LOCUS_10360 1015230 1016006 gene locus_tag LOCUS_10370 1015230 1016006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10370 1016003 1016377 gene locus_tag LOCUS_10380 1016003 1016377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10380 1016374 1016733 gene locus_tag LOCUS_10390 1016374 1016733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1016763 1017152 gene locus_tag LOCUS_10400 1016763 1017152 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_10400 1017067 1017633 gene locus_tag LOCUS_10410 1017067 1017633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1017587 1018111 gene locus_tag LOCUS_10420 1017587 1018111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1018250 1018639 gene locus_tag LOCUS_10430 1018250 1018639 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_10430 1018554 1019120 gene locus_tag LOCUS_10440 1018554 1019120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1019985 1020425 gene locus_tag LOCUS_10450 1019985 1020425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1020699 1020881 gene locus_tag LOCUS_10460 1020699 1020881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1021114 1020878 gene locus_tag LOCUS_10470 1021114 1020878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1022076 1021060 gene locus_tag LOCUS_10480 1022076 1021060 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405932.1 protein_id gnl|my_center|LOCUS_10480 1022582 1022073 gene locus_tag LOCUS_10490 1022582 1022073 CDS product isoprenylcysteine carboxyl methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405935.1 protein_id gnl|my_center|LOCUS_10490 1023625 1022576 gene locus_tag LOCUS_10500 1023625 1022576 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408181.1 protein_id gnl|my_center|LOCUS_10500 1023700 1024806 gene locus_tag LOCUS_10510 1023700 1024806 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730370.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10510 1024706 1024963 gene locus_tag LOCUS_10520 1024706 1024963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10520 1024960 1025679 gene locus_tag LOCUS_10530 1024960 1025679 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405938.1 protein_id gnl|my_center|LOCUS_10530 1027055 1025685 gene locus_tag LOCUS_10540 1027055 1025685 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510669.1 protein_id gnl|my_center|LOCUS_10540 1027931 1027128 gene locus_tag LOCUS_10550 1027931 1027128 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405957.1 protein_id gnl|my_center|LOCUS_10550 1029107 1028073 gene locus_tag LOCUS_10560 1029107 1028073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1029335 1029126 gene locus_tag LOCUS_10570 1029335 1029126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1029432 1029803 gene locus_tag LOCUS_10580 1029432 1029803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1029840 1030544 gene locus_tag LOCUS_10590 1029840 1030544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728437.1 protein_id gnl|my_center|LOCUS_10590 1030541 1031749 gene locus_tag LOCUS_10600 1030541 1031749 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877431.1 protein_id gnl|my_center|LOCUS_10600 1031751 1032719 gene locus_tag LOCUS_10610 1031751 1032719 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728439.1 protein_id gnl|my_center|LOCUS_10610 1032716 1033477 gene locus_tag LOCUS_10620 1032716 1033477 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728440.1 protein_id gnl|my_center|LOCUS_10620 1033474 1034208 gene locus_tag LOCUS_10630 1033474 1034208 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728441.1 protein_id gnl|my_center|LOCUS_10630 1034205 1035710 gene locus_tag LOCUS_10640 1034205 1035710 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728442.1 protein_id gnl|my_center|LOCUS_10640 1035707 1036648 gene locus_tag LOCUS_10650 1035707 1036648 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728443.1 protein_id gnl|my_center|LOCUS_10650 1037795 1036653 gene locus_tag LOCUS_10660 1037795 1036653 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401058.1 protein_id gnl|my_center|LOCUS_10660 1037846 1038271 gene locus_tag LOCUS_10670 1037846 1038271 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401060.1 protein_id gnl|my_center|LOCUS_10670 1038344 1038784 gene locus_tag LOCUS_10680 1038344 1038784 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401063.1 protein_id gnl|my_center|LOCUS_10680 1039405 1038809 gene locus_tag LOCUS_10690 1039405 1038809 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041179536.1 protein_id gnl|my_center|LOCUS_10690 1039661 1041310 gene locus_tag LOCUS_10700 gene fadD5 1039661 1041310 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950356.1 protein_id gnl|my_center|LOCUS_10700 1041526 1042329 gene locus_tag LOCUS_10710 1041526 1042329 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401074.1 protein_id gnl|my_center|LOCUS_10710 1042331 1043200 gene locus_tag LOCUS_10720 1042331 1043200 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401077.1 protein_id gnl|my_center|LOCUS_10720 1043205 1044338 gene locus_tag LOCUS_10730 gene mce1A 1043205 1044338 CDS product cell invasion protein Mce1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908975.1 protein_id gnl|my_center|LOCUS_10730 1044335 1044529 gene locus_tag LOCUS_10740 1044335 1044529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10740 1044526 1045566 gene locus_tag LOCUS_10750 1044526 1045566 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908976.1 protein_id gnl|my_center|LOCUS_10750 1045563 1047128 gene locus_tag LOCUS_10760 1045563 1047128 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901818.1 protein_id gnl|my_center|LOCUS_10760 1047125 1048732 gene locus_tag LOCUS_10770 1047125 1048732 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908978.1 protein_id gnl|my_center|LOCUS_10770 1048729 1049955 gene locus_tag LOCUS_10780 1048729 1049955 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323508.1 protein_id gnl|my_center|LOCUS_10780 1049949 1051502 gene locus_tag LOCUS_10790 1049949 1051502 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908980.1 protein_id gnl|my_center|LOCUS_10790 1051472 1052275 gene locus_tag LOCUS_10800 1051472 1052275 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401093.1 protein_id gnl|my_center|LOCUS_10800 1052272 1053261 gene locus_tag LOCUS_10810 1052272 1053261 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908982.1 protein_id gnl|my_center|LOCUS_10810 1053258 1053815 gene locus_tag LOCUS_10820 1053258 1053815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908983.1 protein_id gnl|my_center|LOCUS_10820 1053782 1054585 gene locus_tag LOCUS_10830 1053782 1054585 CDS product Mce associated membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899844.1 protein_id gnl|my_center|LOCUS_10830 1054635 1055024 gene locus_tag LOCUS_10840 1054635 1055024 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_10840 1054939 1055505 gene locus_tag LOCUS_10850 1054939 1055505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10850 1056714 1055587 gene locus_tag LOCUS_10860 1056714 1055587 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899845.1 protein_id gnl|my_center|LOCUS_10860 1058151 1056778 gene locus_tag LOCUS_10870 1058151 1056778 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899846.1 protein_id gnl|my_center|LOCUS_10870 1058974 1058201 gene locus_tag LOCUS_10880 1058974 1058201 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401107.1 protein_id gnl|my_center|LOCUS_10880 1060553 1059126 gene locus_tag LOCUS_10890 1060553 1059126 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 protein_id gnl|my_center|LOCUS_10890 1061617 1060556 gene locus_tag LOCUS_10900 gene sigG 1061617 1060556 CDS product sigma-70 family RNA polymerase sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401110.1 protein_id gnl|my_center|LOCUS_10900 1061649 1062488 gene locus_tag LOCUS_10910 1061649 1062488 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401112.1 protein_id gnl|my_center|LOCUS_10910 1062535 1063284 gene locus_tag LOCUS_10920 1062535 1063284 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401116.1 protein_id gnl|my_center|LOCUS_10920 1063281 1063805 gene locus_tag LOCUS_10930 1063281 1063805 CDS product TIGR04338 family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401120.1 protein_id gnl|my_center|LOCUS_10930 1063862 1064140 gene locus_tag LOCUS_10940 1063862 1064140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10940 1064137 1065855 gene locus_tag LOCUS_10950 1064137 1065855 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401122.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10950 1066850 1066173 gene locus_tag LOCUS_10960 1066850 1066173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1069704 1067071 gene locus_tag LOCUS_10970 1069704 1067071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10970 1069904 1070119 gene locus_tag LOCUS_10980 1069904 1070119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1070793 1070227 gene locus_tag LOCUS_10990 1070793 1070227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1071097 1070708 gene locus_tag LOCUS_11000 1071097 1070708 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_11000 1071168 1072163 gene locus_tag LOCUS_11010 1071168 1072163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1074000 1072306 gene locus_tag LOCUS_11020 gene ilvD 1074000 1072306 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900824.1 protein_id gnl|my_center|LOCUS_11020 1074140 1074430 gene locus_tag LOCUS_11030 1074140 1074430 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401147.1 protein_id gnl|my_center|LOCUS_11030 1074620 1075804 gene locus_tag LOCUS_11040 1074620 1075804 CDS product Rv0191 family MFS efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401149.1 protein_id gnl|my_center|LOCUS_11040 1075924 1077099 gene locus_tag LOCUS_11050 1075924 1077099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1078356 1077259 gene locus_tag LOCUS_11060 1078356 1077259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1078611 1078369 gene locus_tag LOCUS_11070 1078611 1078369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1078517 1079059 gene locus_tag LOCUS_11080 1078517 1079059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1079046 1081283 gene locus_tag LOCUS_11090 1079046 1081283 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908489.1 protein_id gnl|my_center|LOCUS_11090 1083334 1081340 gene locus_tag LOCUS_11100 gene zmp1 1083334 1081340 CDS product zinc metalloprotease Zmp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401172.1 protein_id gnl|my_center|LOCUS_11100 1083377 1084024 gene locus_tag LOCUS_11110 1083377 1084024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401181.1 protein_id gnl|my_center|LOCUS_11110 1084057 1084710 gene locus_tag LOCUS_11120 1084057 1084710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401184.1 protein_id gnl|my_center|LOCUS_11120 1085236 1084697 gene locus_tag LOCUS_11130 1085236 1084697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908994.1 protein_id gnl|my_center|LOCUS_11130 1088193 1085233 gene locus_tag LOCUS_11140 1088193 1085233 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323530.1 protein_id gnl|my_center|LOCUS_11140 1088605 1089114 gene locus_tag LOCUS_11150 1088605 1089114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1090333 1089116 gene locus_tag LOCUS_11160 1090333 1089116 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901825.1 protein_id gnl|my_center|LOCUS_11160 1090516 1091685 gene locus_tag LOCUS_11170 1090516 1091685 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950360.1 protein_id gnl|my_center|LOCUS_11170 1094628 1091746 gene locus_tag LOCUS_11180 1094628 1091746 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908997.1 protein_id gnl|my_center|LOCUS_11180 1095471 1094734 gene locus_tag LOCUS_11190 1095471 1094734 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401202.1 protein_id gnl|my_center|LOCUS_11190 1096327 1095509 gene locus_tag LOCUS_11200 gene trmB 1096327 1095509 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401204.1 protein_id gnl|my_center|LOCUS_11200 1096490 1097620 gene locus_tag LOCUS_11210 1096490 1097620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401206.1 protein_id gnl|my_center|LOCUS_11210 1097617 1099170 gene locus_tag LOCUS_11220 1097617 1099170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401208.1 protein_id gnl|my_center|LOCUS_11220 1099373 1101202 gene locus_tag LOCUS_11230 1099373 1101202 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401212.1 protein_id gnl|my_center|LOCUS_11230 1101212 1102735 gene locus_tag LOCUS_11240 gene fadD4 1101212 1102735 CDS product fatty-acid--CoA ligase FadD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900829.1 protein_id gnl|my_center|LOCUS_11240 1102738 1103706 gene locus_tag LOCUS_11250 1102738 1103706 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726786.1 protein_id gnl|my_center|LOCUS_11250 1104308 1103742 gene locus_tag LOCUS_11260 1104308 1103742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1104612 1104223 gene locus_tag LOCUS_11270 1104612 1104223 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_11270 1105076 1104675 gene locus_tag LOCUS_11280 1105076 1104675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1106359 1105187 gene locus_tag LOCUS_11290 1106359 1105187 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902894.1 protein_id gnl|my_center|LOCUS_11290 1106415 1107422 gene locus_tag LOCUS_11300 1106415 1107422 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401224.1 protein_id gnl|my_center|LOCUS_11300 1107437 1107964 gene locus_tag LOCUS_11310 1107437 1107964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11310 1108347 1108658 gene locus_tag LOCUS_11320 1108347 1108658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11320 1108658 1109959 gene locus_tag LOCUS_11330 1108658 1109959 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726791.1 protein_id gnl|my_center|LOCUS_11330 1110277 1110978 gene locus_tag LOCUS_11340 1110277 1110978 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727344.1 protein_id gnl|my_center|LOCUS_11340 1110975 1112321 gene locus_tag LOCUS_11350 1110975 1112321 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911099.1 protein_id gnl|my_center|LOCUS_11350 1112323 1112841 gene locus_tag LOCUS_11360 1112323 1112841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401230.1 protein_id gnl|my_center|LOCUS_11360 1112997 1114175 gene locus_tag LOCUS_11370 gene lipC 1112997 1114175 CDS product esterase LipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899863.1 protein_id gnl|my_center|LOCUS_11370 1114220 1115659 gene locus_tag LOCUS_11380 1114220 1115659 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900834.1 protein_id gnl|my_center|LOCUS_11380 1115656 1116438 gene locus_tag LOCUS_11390 1115656 1116438 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899864.1 protein_id gnl|my_center|LOCUS_11390 1116537 1118024 gene locus_tag LOCUS_11400 1116537 1118024 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730162.1 protein_id gnl|my_center|LOCUS_11400 1118021 1118317 gene locus_tag LOCUS_11410 1118021 1118317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896282.1 protein_id gnl|my_center|LOCUS_11410 1118980 1120626 gene locus_tag LOCUS_11420 1118980 1120626 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_11420 1120738 1125402 gene locus_tag LOCUS_11430 1120738 1125402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1126100 1125480 gene locus_tag LOCUS_11440 1126100 1125480 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401168.1 protein_id gnl|my_center|LOCUS_11440 1126351 1126097 gene locus_tag LOCUS_11450 1126351 1126097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1126414 1126656 gene locus_tag LOCUS_11460 1126414 1126656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1127330 1126764 gene locus_tag LOCUS_11470 1127330 1126764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1127634 1127245 gene locus_tag LOCUS_11480 1127634 1127245 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_11480 1127705 1128637 gene locus_tag LOCUS_11490 1127705 1128637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1128788 1129603 gene locus_tag LOCUS_11500 1128788 1129603 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729009.1 protein_id gnl|my_center|LOCUS_11500 1130030 1129668 gene locus_tag LOCUS_11510 1130030 1129668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11510 1131135 1129939 gene locus_tag LOCUS_11520 1131135 1129939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11520 1131947 1131180 gene locus_tag LOCUS_11530 1131947 1131180 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401240.1 protein_id gnl|my_center|LOCUS_11530 1132003 1133166 gene locus_tag LOCUS_11540 1132003 1133166 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401246.1 protein_id gnl|my_center|LOCUS_11540 1134975 1133176 gene locus_tag LOCUS_11550 1134975 1133176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401250.1 protein_id gnl|my_center|LOCUS_11550 1136266 1134986 gene locus_tag LOCUS_11560 1136266 1134986 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401257.1 protein_id gnl|my_center|LOCUS_11560 1136446 1137612 gene locus_tag LOCUS_11570 1136446 1137612 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401260.1 protein_id gnl|my_center|LOCUS_11570 1139525 1137624 gene locus_tag LOCUS_11580 1139525 1137624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1140127 1140615 gene locus_tag LOCUS_11590 1140127 1140615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1141258 1140674 gene locus_tag LOCUS_11600 1141258 1140674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1141640 1141242 gene locus_tag LOCUS_11610 1141640 1141242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1142526 1141714 gene locus_tag LOCUS_11620 gene istB 1142526 1141714 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_11620 1142840 1142523 gene locus_tag LOCUS_11630 1142840 1142523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1143360 1142794 gene locus_tag LOCUS_11640 1143360 1142794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1143664 1143275 gene locus_tag LOCUS_11650 1143664 1143275 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_11650 1144964 1143714 gene locus_tag LOCUS_11660 1144964 1143714 CDS product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401317.1 protein_id gnl|my_center|LOCUS_11660 1145174 1144971 gene locus_tag LOCUS_11670 1145174 1144971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1145905 1145417 gene locus_tag LOCUS_11680 1145905 1145417 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401313.1 protein_id gnl|my_center|LOCUS_11680 1146448 1148283 gene locus_tag LOCUS_11690 1146448 1148283 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401312.1 protein_id gnl|my_center|LOCUS_11690 1149892 1148567 gene locus_tag LOCUS_11700 1149892 1148567 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401309.1 protein_id gnl|my_center|LOCUS_11700 1150062 1151426 gene locus_tag LOCUS_11710 1150062 1151426 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899869.1 protein_id gnl|my_center|LOCUS_11710 1151445 1152296 gene locus_tag LOCUS_11720 gene htdX 1151445 1152296 CDS product 3-hydroxyacyl-thioester dehydratase HtdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401305.1 protein_id gnl|my_center|LOCUS_11720 1153477 1152308 gene locus_tag LOCUS_11730 1153477 1152308 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980880.1 protein_id gnl|my_center|LOCUS_11730 1153442 1153684 gene locus_tag LOCUS_11740 1153442 1153684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1154307 1153681 gene locus_tag LOCUS_11750 1154307 1153681 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401297.1 protein_id gnl|my_center|LOCUS_11750 1155588 1154395 gene locus_tag LOCUS_11760 gene lpqI 1155588 1154395 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401295.1 protein_id gnl|my_center|LOCUS_11760 1155692 1155949 gene locus_tag LOCUS_11770 1155692 1155949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1156018 1156191 gene locus_tag LOCUS_11780 1156018 1156191 CDS product DUF2613 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401289.1 protein_id gnl|my_center|LOCUS_11780 1156280 1160458 gene locus_tag LOCUS_11790 1156280 1160458 CDS product DUF3367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911102.1 protein_id gnl|my_center|LOCUS_11790 1160962 1160462 gene locus_tag LOCUS_11800 1160962 1160462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1161159 1161947 gene locus_tag LOCUS_11810 1161159 1161947 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401625.1 protein_id gnl|my_center|LOCUS_11810 1162070 1163494 gene locus_tag LOCUS_11820 1162070 1163494 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401279.1 protein_id gnl|my_center|LOCUS_11820 1165074 1163812 gene locus_tag LOCUS_11830 1165074 1163812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1165908 1165171 gene locus_tag LOCUS_11840 1165908 1165171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11840 1167282 1166098 gene locus_tag LOCUS_11850 1167282 1166098 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950814.1 protein_id gnl|my_center|LOCUS_11850 1167719 1169095 gene locus_tag LOCUS_11860 1167719 1169095 CDS product NADP-dependent succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912534.1 protein_id gnl|my_center|LOCUS_11860 1169677 1169216 gene locus_tag LOCUS_11870 1169677 1169216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11870 1171692 1169986 gene locus_tag LOCUS_11880 1171692 1169986 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401265.1 protein_id gnl|my_center|LOCUS_11880 1172034 1172672 gene locus_tag LOCUS_11890 1172034 1172672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11890 1172650 1173024 gene locus_tag LOCUS_11900 1172650 1173024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11900 1173196 1174731 gene locus_tag LOCUS_11910 1173196 1174731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1175994 1174774 gene locus_tag LOCUS_11920 1175994 1174774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1177824 1177258 gene locus_tag LOCUS_11930 1177824 1177258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11930 1178128 1177739 gene locus_tag LOCUS_11940 1178128 1177739 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_11940 1178377 1178222 gene locus_tag LOCUS_11950 1178377 1178222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726930.1 protein_id gnl|my_center|LOCUS_11950 1179174 1178428 gene locus_tag LOCUS_11960 1179174 1178428 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401319.1 protein_id gnl|my_center|LOCUS_11960 1181102 1179174 gene locus_tag LOCUS_11970 1181102 1179174 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401322.1 protein_id gnl|my_center|LOCUS_11970 1181970 1181149 gene locus_tag LOCUS_11980 1181970 1181149 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401324.1 protein_id gnl|my_center|LOCUS_11980 1182345 1182049 gene locus_tag LOCUS_11990 1182345 1182049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401329.1 protein_id gnl|my_center|LOCUS_11990 1182461 1183231 gene locus_tag LOCUS_12000 1182461 1183231 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079937.1 protein_id gnl|my_center|LOCUS_12000 1183764 1183306 gene locus_tag LOCUS_12010 gene acr2 1183764 1183306 CDS product stress-responsive chaperone Acr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900838.1 protein_id gnl|my_center|LOCUS_12010 1183998 1186244 gene locus_tag LOCUS_12020 gene nirB 1183998 1186244 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401336.1 protein_id gnl|my_center|LOCUS_12020 1186329 1186556 gene locus_tag LOCUS_12030 1186329 1186556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12030 1186582 1186938 gene locus_tag LOCUS_12040 gene nirD 1186582 1186938 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401341.1 protein_id gnl|my_center|LOCUS_12040 1187530 1187075 gene locus_tag LOCUS_12050 1187530 1187075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401352.1 protein_id gnl|my_center|LOCUS_12050 1187666 1187881 gene locus_tag LOCUS_12060 1187666 1187881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1187894 1188928 gene locus_tag LOCUS_12070 1187894 1188928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1189791 1189030 gene locus_tag LOCUS_12080 1189791 1189030 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401354.1 protein_id gnl|my_center|LOCUS_12080 1190933 1189782 gene locus_tag LOCUS_12090 1190933 1189782 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401357.1 protein_id gnl|my_center|LOCUS_12090 1191248 1191012 gene locus_tag LOCUS_12100 1191248 1191012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12100 1191989 1191252 gene locus_tag LOCUS_12110 1191989 1191252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12110 1192264 1192022 gene locus_tag LOCUS_12120 1192264 1192022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12120 1193190 1192645 gene locus_tag LOCUS_12130 gene aac(2')-Ic 1193190 1192645 CDS product aminoglycoside N-acetyltransferase AAC(2')-Ic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899880.1 protein_id gnl|my_center|LOCUS_12130 1194086 1193217 gene locus_tag LOCUS_12140 1194086 1193217 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401367.1 protein_id gnl|my_center|LOCUS_12140 1194773 1194102 gene locus_tag LOCUS_12150 1194773 1194102 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908952.1 protein_id gnl|my_center|LOCUS_12150 1195878 1194886 gene locus_tag LOCUS_12160 1195878 1194886 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401373.1 protein_id gnl|my_center|LOCUS_12160 1196132 1197529 gene locus_tag LOCUS_12170 1196132 1197529 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401380.1 protein_id gnl|my_center|LOCUS_12170 1198324 1197530 gene locus_tag LOCUS_12180 1198324 1197530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12180 1198801 1198349 gene locus_tag LOCUS_12190 1198801 1198349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12190 1198791 1200533 gene locus_tag LOCUS_12200 gene fadD2 1198791 1200533 CDS product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899884.1 protein_id gnl|my_center|LOCUS_12200 1201119 1201508 gene locus_tag LOCUS_12210 1201119 1201508 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_12210 1201423 1201989 gene locus_tag LOCUS_12220 1201423 1201989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12220 1203260 1201986 gene locus_tag LOCUS_12230 1203260 1201986 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420440.1 protein_id gnl|my_center|LOCUS_12230 1205682 1203496 gene locus_tag LOCUS_12240 1205682 1203496 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401392.1 protein_id gnl|my_center|LOCUS_12240 1206701 1205739 gene locus_tag LOCUS_12250 1206701 1205739 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519563.1 protein_id gnl|my_center|LOCUS_12250 1207690 1206698 gene locus_tag LOCUS_12260 1207690 1206698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401394.1 protein_id gnl|my_center|LOCUS_12260 1208441 1207833 gene locus_tag LOCUS_12270 1208441 1207833 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401397.1 protein_id gnl|my_center|LOCUS_12270 1208532 1209113 gene locus_tag LOCUS_12280 1208532 1209113 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401399.1 protein_id gnl|my_center|LOCUS_12280 1209120 1209668 gene locus_tag LOCUS_12290 1209120 1209668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079442.1 protein_id gnl|my_center|LOCUS_12290 1210278 1209622 gene locus_tag LOCUS_12300 1210278 1209622 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899886.1 protein_id gnl|my_center|LOCUS_12300 1210514 1211305 gene locus_tag LOCUS_12310 1210514 1211305 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401404.1 protein_id gnl|my_center|LOCUS_12310 1211540 1213117 gene locus_tag LOCUS_12320 1211540 1213117 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950374.1 protein_id gnl|my_center|LOCUS_12320 1213167 1213556 gene locus_tag LOCUS_12330 1213167 1213556 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_12330 1213471 1214037 gene locus_tag LOCUS_12340 1213471 1214037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1214070 1214975 gene locus_tag LOCUS_12350 1214070 1214975 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401448.1 protein_id gnl|my_center|LOCUS_12350 1215417 1217279 gene locus_tag LOCUS_12360 gene eccA3 1215417 1217279 CDS product type VII secretion system ESX-3 AAA family ATPase EccA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898392.1 protein_id gnl|my_center|LOCUS_12360 1217276 1218877 gene locus_tag LOCUS_12370 gene eccB3 1217276 1218877 CDS product type VII secretion system ESX-3 subunit EccB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401472.1 protein_id gnl|my_center|LOCUS_12370 1218874 1222875 gene locus_tag LOCUS_12380 gene eccC3 1218874 1222875 CDS product type VII secretion system ESX-3 FtsK/SpoIIIE family ATPase EccC3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401478.1 protein_id gnl|my_center|LOCUS_12380 1222878 1223186 gene locus_tag LOCUS_12390 1222878 1223186 CDS product type VII secretion system ESX-3 target PE5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401485.1 protein_id gnl|my_center|LOCUS_12390 1223189 1224742 gene locus_tag LOCUS_12400 1223189 1224742 CDS product type VII secretion system ESX-3 target PPE4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401488.1 protein_id gnl|my_center|LOCUS_12400 1224779 1225072 gene locus_tag LOCUS_12410 gene esxG 1224779 1225072 CDS product type VII secretion system protein EsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401503.1 protein_id gnl|my_center|LOCUS_12410 1225101 1225391 gene locus_tag LOCUS_12420 gene esxH 1225101 1225391 CDS product type VII secretion system effector EsxH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401514.1 protein_id gnl|my_center|LOCUS_12420 1225409 1226296 gene locus_tag LOCUS_12430 gene espG3 1225409 1226296 CDS product type VII secretion system ESX-3 associated protein EspG3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401521.1 protein_id gnl|my_center|LOCUS_12430 1226368 1227786 gene locus_tag LOCUS_12440 gene eccD3 1226368 1227786 CDS product type VII secretion system ESX-3 subunit EccD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401524.1 protein_id gnl|my_center|LOCUS_12440 1227783 1229207 gene locus_tag LOCUS_12450 gene mycP3 1227783 1229207 CDS product type VII secretion system ESX-3 serine protease mycosin MycP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401528.1 protein_id gnl|my_center|LOCUS_12450 1229197 1230210 gene locus_tag LOCUS_12460 gene eccE3 1229197 1230210 CDS product type VII secretion system ESX-3 subunit EccE3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401533.1 protein_id gnl|my_center|LOCUS_12460 1230796 1230197 gene locus_tag LOCUS_12470 1230796 1230197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12470 1231207 1230818 gene locus_tag LOCUS_12480 1231207 1230818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12480 1231574 1232365 gene locus_tag LOCUS_12490 1231574 1232365 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401538.1 protein_id gnl|my_center|LOCUS_12490 1233780 1232383 gene locus_tag LOCUS_12500 1233780 1232383 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401544.1 protein_id gnl|my_center|LOCUS_12500 1234497 1233847 gene locus_tag LOCUS_12510 gene bluB 1234497 1233847 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401584.1 protein_id gnl|my_center|LOCUS_12510 1234584 1234943 gene locus_tag LOCUS_12520 1234584 1234943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092894.1 protein_id gnl|my_center|LOCUS_12520 1235409 1234927 gene locus_tag LOCUS_12530 1235409 1234927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401589.1 protein_id gnl|my_center|LOCUS_12530 1235481 1236134 gene locus_tag LOCUS_12540 1235481 1236134 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401594.1 protein_id gnl|my_center|LOCUS_12540 1236288 1236896 gene locus_tag LOCUS_12550 1236288 1236896 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401597.1 protein_id gnl|my_center|LOCUS_12550 1237393 1236905 gene locus_tag LOCUS_12560 1237393 1236905 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401601.1 protein_id gnl|my_center|LOCUS_12560 1237471 1238715 gene locus_tag LOCUS_12570 1237471 1238715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898398.1 protein_id gnl|my_center|LOCUS_12570 1238868 1240757 gene locus_tag LOCUS_12580 1238868 1240757 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401607.1 protein_id gnl|my_center|LOCUS_12580 1240979 1242433 gene locus_tag LOCUS_12590 1240979 1242433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1242501 1242887 gene locus_tag LOCUS_12600 1242501 1242887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401613.1 protein_id gnl|my_center|LOCUS_12600 1243663 1242935 gene locus_tag LOCUS_12610 1243663 1242935 CDS product DUF3060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401619.1 protein_id gnl|my_center|LOCUS_12610 1243799 1244476 gene locus_tag LOCUS_12620 1243799 1244476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12620 1244421 1244747 gene locus_tag LOCUS_12630 1244421 1244747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12630 1244959 1245819 gene locus_tag LOCUS_12640 1244959 1245819 CDS product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401621.1 protein_id gnl|my_center|LOCUS_12640 1245919 1246578 gene locus_tag LOCUS_12650 1245919 1246578 CDS product muconolactone Delta-isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401623.1 protein_id gnl|my_center|LOCUS_12650 1246613 1247275 gene locus_tag LOCUS_12660 1246613 1247275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1248665 1247223 gene locus_tag LOCUS_12670 gene xylB 1248665 1247223 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877620.1 protein_id gnl|my_center|LOCUS_12670 1249282 1248716 gene locus_tag LOCUS_12680 1249282 1248716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1249586 1249197 gene locus_tag LOCUS_12690 1249586 1249197 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_12690 1250016 1249636 gene locus_tag LOCUS_12700 1250016 1249636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1251603 1250722 gene locus_tag LOCUS_12710 1251603 1250722 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900538.1 protein_id gnl|my_center|LOCUS_12710 1251983 1251600 gene locus_tag LOCUS_12720 1251983 1251600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1252137 1252062 gene locus_tag LOCUS_t00130 1252137 1252062 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1252983 1252165 gene locus_tag LOCUS_12730 1252983 1252165 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878396.1 protein_id gnl|my_center|LOCUS_12730 1254072 1253011 gene locus_tag LOCUS_12740 1254072 1253011 CDS product poly-gamma-glutamate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898648.1 protein_id gnl|my_center|LOCUS_12740 1254518 1254189 gene locus_tag LOCUS_12750 1254518 1254189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1255760 1254684 gene locus_tag LOCUS_12760 1255760 1254684 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898649.1 protein_id gnl|my_center|LOCUS_12760 1256369 1256584 gene locus_tag LOCUS_12770 1256369 1256584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1256597 1257631 gene locus_tag LOCUS_12780 1256597 1257631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1257885 1257700 gene locus_tag LOCUS_12790 1257885 1257700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12790 1258167 1257925 gene locus_tag LOCUS_12800 1258167 1257925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12800 1258332 1258721 gene locus_tag LOCUS_12810 1258332 1258721 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_12810 1258636 1259202 gene locus_tag LOCUS_12820 1258636 1259202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1260301 1259213 gene locus_tag LOCUS_12830 1260301 1259213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404767.1 protein_id gnl|my_center|LOCUS_12830 1261118 1260327 gene locus_tag LOCUS_12840 1261118 1260327 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404769.1 protein_id gnl|my_center|LOCUS_12840 1261575 1262564 gene locus_tag LOCUS_12850 gene pstS 1261575 1262564 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908715.1 protein_id gnl|my_center|LOCUS_12850 1262577 1263551 gene locus_tag LOCUS_12860 gene pstC 1262577 1263551 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404779.1 protein_id gnl|my_center|LOCUS_12860 1263548 1264450 gene locus_tag LOCUS_12870 gene pstA 1263548 1264450 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886095.1 protein_id gnl|my_center|LOCUS_12870 1266584 1264458 gene locus_tag LOCUS_12880 gene pknD 1266584 1264458 CDS product serine/threonine protein kinase PknD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404782.1 protein_id gnl|my_center|LOCUS_12880 1267873 1266875 gene locus_tag LOCUS_12890 gene pstS 1267873 1266875 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404784.1 protein_id gnl|my_center|LOCUS_12890 1268923 1268048 gene locus_tag LOCUS_12900 1268923 1268048 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404795.1 protein_id gnl|my_center|LOCUS_12900 1269039 1269281 gene locus_tag LOCUS_12910 1269039 1269281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1269294 1270016 gene locus_tag LOCUS_12920 1269294 1270016 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950834.1 protein_id gnl|my_center|LOCUS_12920 1269968 1270327 gene locus_tag LOCUS_12930 1269968 1270327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416355.1 protein_id gnl|my_center|LOCUS_12930 1271448 1270537 gene locus_tag LOCUS_12940 1271448 1270537 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730629.1 protein_id gnl|my_center|LOCUS_12940 1272604 1271570 gene locus_tag LOCUS_12950 1272604 1271570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1272832 1272617 gene locus_tag LOCUS_12960 1272832 1272617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1272962 1275226 gene locus_tag LOCUS_12970 1272962 1275226 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898655.1 protein_id gnl|my_center|LOCUS_12970 1275223 1275753 gene locus_tag LOCUS_12980 1275223 1275753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12980 1275796 1277154 gene locus_tag LOCUS_12990 1275796 1277154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12990 1277739 1277173 gene locus_tag LOCUS_13000 1277739 1277173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13000 1278043 1277654 gene locus_tag LOCUS_13010 1278043 1277654 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_13010 1279781 1278093 gene locus_tag LOCUS_13020 1279781 1278093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1280824 1279901 gene locus_tag LOCUS_13030 1280824 1279901 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101528280.1 protein_id gnl|my_center|LOCUS_13030 1280869 1281711 gene locus_tag LOCUS_13040 1280869 1281711 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086691.1 protein_id gnl|my_center|LOCUS_13040 1282584 1281715 gene locus_tag LOCUS_13050 1282584 1281715 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404819.1 protein_id gnl|my_center|LOCUS_13050 1282723 1283112 gene locus_tag LOCUS_13060 1282723 1283112 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_13060 1283027 1283593 gene locus_tag LOCUS_13070 1283027 1283593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1284427 1283663 gene locus_tag LOCUS_13080 1284427 1283663 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404823.1 protein_id gnl|my_center|LOCUS_13080 1284748 1285005 gene locus_tag LOCUS_13090 1284748 1285005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1286281 1284923 gene locus_tag LOCUS_13100 1286281 1284923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1287201 1286278 gene locus_tag LOCUS_13110 1287201 1286278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1287339 1288082 gene locus_tag LOCUS_13120 gene cobF 1287339 1288082 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896950.1 protein_id gnl|my_center|LOCUS_13120 1288262 1289959 gene locus_tag LOCUS_13130 1288262 1289959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1290035 1291075 gene locus_tag LOCUS_13140 1290035 1291075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13140 1291250 1291735 gene locus_tag LOCUS_13150 1291250 1291735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1291854 1292930 gene locus_tag LOCUS_13160 1291854 1292930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1294032 1292935 gene locus_tag LOCUS_13170 1294032 1292935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1294260 1294045 gene locus_tag LOCUS_13180 1294260 1294045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1294706 1294335 gene locus_tag LOCUS_13190 1294706 1294335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1294723 1294917 gene locus_tag LOCUS_13200 1294723 1294917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13200 1294914 1295267 gene locus_tag LOCUS_13210 1294914 1295267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13210 1295356 1296105 gene locus_tag LOCUS_13220 1295356 1296105 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404829.1 protein_id gnl|my_center|LOCUS_13220 1296701 1296135 gene locus_tag LOCUS_13230 1296701 1296135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1297005 1296616 gene locus_tag LOCUS_13240 1297005 1296616 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_13240 1298796 1297132 gene locus_tag LOCUS_13250 gene pgi 1298796 1297132 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404830.1 protein_id gnl|my_center|LOCUS_13250 1299642 1298839 gene locus_tag LOCUS_13260 1299642 1298839 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729176.1 protein_id gnl|my_center|LOCUS_13260 1299791 1300180 gene locus_tag LOCUS_13270 1299791 1300180 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_13270 1300095 1300661 gene locus_tag LOCUS_13280 1300095 1300661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1301079 1300807 gene locus_tag LOCUS_13290 1301079 1300807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1301395 1301610 gene locus_tag LOCUS_13300 1301395 1301610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1301623 1302657 gene locus_tag LOCUS_13310 1301623 1302657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1302858 1304111 gene locus_tag LOCUS_13320 1302858 1304111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1304369 1305604 gene locus_tag LOCUS_13330 1304369 1305604 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510567.1 protein_id gnl|my_center|LOCUS_13330 1306009 1307187 gene locus_tag LOCUS_13340 1306009 1307187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13340 1307309 1308448 gene locus_tag LOCUS_13350 gene adhP 1307309 1308448 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_13350 1309017 1308439 gene locus_tag LOCUS_13360 1309017 1308439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403957.1 protein_id gnl|my_center|LOCUS_13360 1309124 1310017 gene locus_tag LOCUS_13370 1309124 1310017 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403962.1 protein_id gnl|my_center|LOCUS_13370 1310014 1312131 gene locus_tag LOCUS_13380 1310014 1312131 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898586.1 protein_id gnl|my_center|LOCUS_13380 1312539 1312090 gene locus_tag LOCUS_13390 1312539 1312090 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730836.1 protein_id gnl|my_center|LOCUS_13390 1312634 1313197 gene locus_tag LOCUS_13400 1312634 1313197 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730835.1 protein_id gnl|my_center|LOCUS_13400 1314806 1313187 gene locus_tag LOCUS_13410 1314806 1313187 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 protein_id gnl|my_center|LOCUS_13410 1314975 1315679 gene locus_tag LOCUS_13420 1314975 1315679 CDS product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898589.1 protein_id gnl|my_center|LOCUS_13420 1316515 1315637 gene locus_tag LOCUS_13430 1316515 1315637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1316421 1316723 gene locus_tag LOCUS_13440 1316421 1316723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1316827 1317042 gene locus_tag LOCUS_13450 1316827 1317042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1317189 1317578 gene locus_tag LOCUS_13460 1317189 1317578 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_13460 1317493 1318059 gene locus_tag LOCUS_13470 1317493 1318059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1318091 1319023 gene locus_tag LOCUS_13480 1318091 1319023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1319241 1320059 gene locus_tag LOCUS_13490 1319241 1320059 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 protein_id gnl|my_center|LOCUS_13490 1320721 1320140 gene locus_tag LOCUS_13500 1320721 1320140 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403989.1 protein_id gnl|my_center|LOCUS_13500 1320763 1321482 gene locus_tag LOCUS_13510 1320763 1321482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13510 1322144 1321509 gene locus_tag LOCUS_13520 1322144 1321509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13520 1322906 1323145 gene locus_tag LOCUS_13530 gene purS 1322906 1323145 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403993.1 protein_id gnl|my_center|LOCUS_13530 1323142 1323816 gene locus_tag LOCUS_13540 gene purQ 1323142 1323816 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403995.1 protein_id gnl|my_center|LOCUS_13540 1324292 1323828 gene locus_tag LOCUS_13550 1324292 1323828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403998.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13550 1324857 1324393 gene locus_tag LOCUS_13560 1324857 1324393 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061809.1 protein_id gnl|my_center|LOCUS_13560 1326367 1324883 gene locus_tag LOCUS_13570 1326367 1324883 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404013.1 protein_id gnl|my_center|LOCUS_13570 1326694 1326482 gene locus_tag LOCUS_13580 1326694 1326482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1327731 1326925 gene locus_tag LOCUS_13590 1327731 1326925 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404092.1 protein_id gnl|my_center|LOCUS_13590 1328735 1327728 gene locus_tag LOCUS_13600 1328735 1327728 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404098.1 protein_id gnl|my_center|LOCUS_13600 1328788 1330080 gene locus_tag LOCUS_13610 1328788 1330080 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618338.1 protein_id gnl|my_center|LOCUS_13610 1330105 1330452 gene locus_tag LOCUS_13620 1330105 1330452 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898592.1 protein_id gnl|my_center|LOCUS_13620 1331121 1330471 gene locus_tag LOCUS_13630 1331121 1330471 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404111.1 protein_id gnl|my_center|LOCUS_13630 1331219 1333516 gene locus_tag LOCUS_13640 gene purL 1331219 1333516 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916276.1 protein_id gnl|my_center|LOCUS_13640 1333549 1334163 gene locus_tag LOCUS_13650 1333549 1334163 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404117.1 protein_id gnl|my_center|LOCUS_13650 1334203 1335171 gene locus_tag LOCUS_13660 gene cpdA 1334203 1335171 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404120.1 protein_id gnl|my_center|LOCUS_13660 1336714 1335116 gene locus_tag LOCUS_13670 1336714 1335116 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898594.1 protein_id gnl|my_center|LOCUS_13670 1337737 1336937 gene locus_tag LOCUS_13680 1337737 1336937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13680 1338141 1337743 gene locus_tag LOCUS_13690 1338141 1337743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13690 1339425 1338220 gene locus_tag LOCUS_13700 1339425 1338220 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726690.1 protein_id gnl|my_center|LOCUS_13700 1339445 1339834 gene locus_tag LOCUS_13710 1339445 1339834 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404127.1 protein_id gnl|my_center|LOCUS_13710 1339973 1341499 gene locus_tag LOCUS_13720 gene purF 1339973 1341499 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404129.1 protein_id gnl|my_center|LOCUS_13720 1341641 1342666 gene locus_tag LOCUS_13730 gene purM 1341641 1342666 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404132.1 protein_id gnl|my_center|LOCUS_13730 1342939 1342760 gene locus_tag LOCUS_13740 1342939 1342760 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404135.1 protein_id gnl|my_center|LOCUS_13740 1344189 1343098 gene locus_tag LOCUS_13750 1344189 1343098 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404137.1 protein_id gnl|my_center|LOCUS_13750 1344786 1344211 gene locus_tag LOCUS_13760 1344786 1344211 CDS product DUF5134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898666.1 protein_id gnl|my_center|LOCUS_13760 1347225 1345021 gene locus_tag LOCUS_13770 1347225 1345021 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935691.1 protein_id gnl|my_center|LOCUS_13770 1347520 1347212 gene locus_tag LOCUS_13780 1347520 1347212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1347975 1347622 gene locus_tag LOCUS_13790 gene csoR 1347975 1347622 CDS product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404935.1 protein_id gnl|my_center|LOCUS_13790 1348110 1349000 gene locus_tag LOCUS_13800 1348110 1349000 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916726.1 protein_id gnl|my_center|LOCUS_13800 1351628 1349262 gene locus_tag LOCUS_13810 1351628 1349262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1352426 1351755 gene locus_tag LOCUS_13820 1352426 1351755 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898596.1 protein_id gnl|my_center|LOCUS_13820 1352880 1352578 gene locus_tag LOCUS_13830 1352880 1352578 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404278.1 protein_id gnl|my_center|LOCUS_13830 1353724 1352882 gene locus_tag LOCUS_13840 1353724 1352882 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404293.1 protein_id gnl|my_center|LOCUS_13840 1354232 1353762 gene locus_tag LOCUS_13850 1354232 1353762 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908759.1 protein_id gnl|my_center|LOCUS_13850 1355344 1354532 gene locus_tag LOCUS_13860 gene lmeA 1355344 1354532 CDS product mannan chain length control protein LmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404298.1 protein_id gnl|my_center|LOCUS_13860 1355964 1356515 gene locus_tag LOCUS_13870 1355964 1356515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1356512 1357474 gene locus_tag LOCUS_13880 gene mshD 1356512 1357474 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404307.1 protein_id gnl|my_center|LOCUS_13880 1357758 1358717 gene locus_tag LOCUS_13890 gene pstS 1357758 1358717 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172591975.1 protein_id gnl|my_center|LOCUS_13890 1359418 1359248 gene locus_tag LOCUS_13900 1359418 1359248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1359402 1359806 gene locus_tag LOCUS_13910 1359402 1359806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13910 1359803 1360711 gene locus_tag LOCUS_13920 gene pstA 1359803 1360711 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104396.1 protein_id gnl|my_center|LOCUS_13920 1360731 1361507 gene locus_tag LOCUS_13930 gene pstB 1360731 1361507 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404312.1 protein_id gnl|my_center|LOCUS_13930 1362210 1361542 gene locus_tag LOCUS_13940 gene phoU 1362210 1361542 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404314.1 protein_id gnl|my_center|LOCUS_13940 1364481 1362268 gene locus_tag LOCUS_13950 1364481 1362268 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404316.1 protein_id gnl|my_center|LOCUS_13950 1365789 1364656 gene locus_tag LOCUS_13960 gene dusB 1365789 1364656 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898601.1 protein_id gnl|my_center|LOCUS_13960 1366814 1365798 gene locus_tag LOCUS_13970 gene desA1 1366814 1365798 CDS product acyl-ACP desaturase DesA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404321.1 protein_id gnl|my_center|LOCUS_13970 1367708 1366914 gene locus_tag LOCUS_13980 1367708 1366914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1367936 1367721 gene locus_tag LOCUS_13990 1367936 1367721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1368132 1369190 gene locus_tag LOCUS_14000 1368132 1369190 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898602.1 protein_id gnl|my_center|LOCUS_14000 1369661 1369341 gene locus_tag LOCUS_14010 gene kmtR 1369661 1369341 CDS product Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404335.1 protein_id gnl|my_center|LOCUS_14010 1370350 1369784 gene locus_tag LOCUS_14020 1370350 1369784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1370654 1370265 gene locus_tag LOCUS_14030 1370654 1370265 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_14030 1370758 1371675 gene locus_tag LOCUS_14040 1370758 1371675 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104523.1 protein_id gnl|my_center|LOCUS_14040 1373219 1371738 gene locus_tag LOCUS_14050 1373219 1371738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14050 1373466 1374014 gene locus_tag LOCUS_14060 1373466 1374014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1374479 1374694 gene locus_tag LOCUS_14070 1374479 1374694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1374707 1375741 gene locus_tag LOCUS_14080 1374707 1375741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1376992 1375868 gene locus_tag LOCUS_14090 1376992 1375868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 protein_id gnl|my_center|LOCUS_14090 1378128 1376992 gene locus_tag LOCUS_14100 1378128 1376992 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900650.1 protein_id gnl|my_center|LOCUS_14100 1378173 1378775 gene locus_tag LOCUS_14110 1378173 1378775 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416599.1 protein_id gnl|my_center|LOCUS_14110 1378772 1379506 gene locus_tag LOCUS_14120 1378772 1379506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1379756 1380082 gene locus_tag LOCUS_14130 1379756 1380082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1380112 1380501 gene locus_tag LOCUS_14140 1380112 1380501 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_14140 1380416 1380982 gene locus_tag LOCUS_14150 1380416 1380982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1380999 1381670 gene locus_tag LOCUS_14160 1380999 1381670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1381682 1382149 gene locus_tag LOCUS_14170 1381682 1382149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416593.1 protein_id gnl|my_center|LOCUS_14170 1382198 1383166 gene locus_tag LOCUS_14180 1382198 1383166 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416588.1 protein_id gnl|my_center|LOCUS_14180 1383150 1384457 gene locus_tag LOCUS_14190 1383150 1384457 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416584.1 protein_id gnl|my_center|LOCUS_14190 1384459 1384908 gene locus_tag LOCUS_14200 1384459 1384908 CDS product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900648.1 protein_id gnl|my_center|LOCUS_14200 1385129 1386907 gene locus_tag LOCUS_14210 1385129 1386907 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405919.1 protein_id gnl|my_center|LOCUS_14210 1387772 1389655 gene locus_tag LOCUS_14220 1387772 1389655 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405919.1 protein_id gnl|my_center|LOCUS_14220 1391300 1389714 gene locus_tag LOCUS_14230 gene nuoN 1391300 1389714 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900644.1 protein_id gnl|my_center|LOCUS_14230 1392886 1391297 gene locus_tag LOCUS_14240 1392886 1391297 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416460.1 protein_id gnl|my_center|LOCUS_14240 1394781 1392880 gene locus_tag LOCUS_14250 gene nuoL 1394781 1392880 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900642.1 protein_id gnl|my_center|LOCUS_14250 1395091 1394792 gene locus_tag LOCUS_14260 gene nuoK 1395091 1394792 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416452.1 protein_id gnl|my_center|LOCUS_14260 1395876 1395088 gene locus_tag LOCUS_14270 1395876 1395088 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416449.1 protein_id gnl|my_center|LOCUS_14270 1396418 1395873 gene locus_tag LOCUS_14280 gene nuoI 1396418 1395873 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416447.1 protein_id gnl|my_center|LOCUS_14280 1397685 1396411 gene locus_tag LOCUS_14290 gene nuoH 1397685 1396411 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416445.1 protein_id gnl|my_center|LOCUS_14290 1400152 1397735 gene locus_tag LOCUS_14300 1400152 1397735 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899937.1 protein_id gnl|my_center|LOCUS_14300 1402248 1400149 gene locus_tag LOCUS_14310 1402248 1400149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1403543 1402245 gene locus_tag LOCUS_14320 gene nuoD 1403543 1402245 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416430.1 protein_id gnl|my_center|LOCUS_14320 1404297 1403560 gene locus_tag LOCUS_14330 1404297 1403560 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416425.1 protein_id gnl|my_center|LOCUS_14330 1404848 1404294 gene locus_tag LOCUS_14340 1404848 1404294 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416420.1 protein_id gnl|my_center|LOCUS_14340 1405345 1404857 gene locus_tag LOCUS_14350 1405345 1404857 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416417.1 protein_id gnl|my_center|LOCUS_14350 1405660 1407012 gene locus_tag LOCUS_14360 1405660 1407012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1407194 1408780 gene locus_tag LOCUS_14370 1407194 1408780 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900400.1 protein_id gnl|my_center|LOCUS_14370 1409266 1408817 gene locus_tag LOCUS_14380 1409266 1408817 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416410.1 protein_id gnl|my_center|LOCUS_14380 1409835 1409293 gene locus_tag LOCUS_14390 1409835 1409293 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728126.1 protein_id gnl|my_center|LOCUS_14390 1410278 1409868 gene locus_tag LOCUS_14400 1410278 1409868 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728127.1 protein_id gnl|my_center|LOCUS_14400 1410631 1410290 gene locus_tag LOCUS_14410 1410631 1410290 CDS product DUF6285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728129.1 protein_id gnl|my_center|LOCUS_14410 1411593 1410733 gene locus_tag LOCUS_14420 1411593 1410733 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728130.1 protein_id gnl|my_center|LOCUS_14420 1412828 1411590 gene locus_tag LOCUS_14430 1412828 1411590 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893439.1 protein_id gnl|my_center|LOCUS_14430 1413494 1412853 gene locus_tag LOCUS_14440 1413494 1412853 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893440.1 protein_id gnl|my_center|LOCUS_14440 1414390 1413494 gene locus_tag LOCUS_14450 1414390 1413494 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893441.1 protein_id gnl|my_center|LOCUS_14450 1415592 1414387 gene locus_tag LOCUS_14460 1415592 1414387 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095590.1 protein_id gnl|my_center|LOCUS_14460 1416779 1415589 gene locus_tag LOCUS_14470 1416779 1415589 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728131.1 protein_id gnl|my_center|LOCUS_14470 1417885 1416782 gene locus_tag LOCUS_14480 1417885 1416782 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728132.1 protein_id gnl|my_center|LOCUS_14480 1418201 1420183 gene locus_tag LOCUS_14490 1418201 1420183 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901256.1 protein_id gnl|my_center|LOCUS_14490 1421172 1420201 gene locus_tag LOCUS_14500 1421172 1420201 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416403.1 protein_id gnl|my_center|LOCUS_14500 1422213 1421215 gene locus_tag LOCUS_14510 1422213 1421215 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728135.1 protein_id gnl|my_center|LOCUS_14510 1423289 1422282 gene locus_tag LOCUS_14520 1423289 1422282 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731552.1 protein_id gnl|my_center|LOCUS_14520 1424326 1423286 gene locus_tag LOCUS_14530 1424326 1423286 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088038.1 protein_id gnl|my_center|LOCUS_14530 1424850 1424323 gene locus_tag LOCUS_14540 1424850 1424323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14540 1425186 1424872 gene locus_tag LOCUS_14550 1425186 1424872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14550 1426781 1425183 gene locus_tag LOCUS_14560 1426781 1425183 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007421.1 protein_id gnl|my_center|LOCUS_14560 1426904 1427572 gene locus_tag LOCUS_14570 1426904 1427572 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401571.1 protein_id gnl|my_center|LOCUS_14570 1427569 1428579 gene locus_tag LOCUS_14580 gene mhpF 1427569 1428579 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044314.1 protein_id gnl|my_center|LOCUS_14580 1428753 1428995 gene locus_tag LOCUS_14590 1428753 1428995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1429008 1430042 gene locus_tag LOCUS_14600 1429008 1430042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1430106 1431053 gene locus_tag LOCUS_14610 gene dmpG 1430106 1431053 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013510.1 protein_id gnl|my_center|LOCUS_14610 1431102 1431878 gene locus_tag LOCUS_14620 gene budA 1431102 1431878 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831009.1 protein_id gnl|my_center|LOCUS_14620 1431881 1432084 gene locus_tag LOCUS_14630 1431881 1432084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1433047 1432169 gene locus_tag LOCUS_14640 1433047 1432169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14640 1433433 1433044 gene locus_tag LOCUS_14650 1433433 1433044 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234794028.1 protein_id gnl|my_center|LOCUS_14650 1433602 1433811 gene locus_tag LOCUS_14660 1433602 1433811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14660 1433726 1434292 gene locus_tag LOCUS_14670 1433726 1434292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1434329 1434634 gene locus_tag LOCUS_14680 1434329 1434634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1435634 1435900 gene locus_tag LOCUS_14690 1435634 1435900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1437115 1435910 gene locus_tag LOCUS_14700 1437115 1435910 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899936.1 protein_id gnl|my_center|LOCUS_14700 1438567 1437170 gene locus_tag LOCUS_14710 1438567 1437170 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900638.1 protein_id gnl|my_center|LOCUS_14710 1439437 1438649 gene locus_tag LOCUS_14720 gene hisN 1439437 1438649 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416388.1 protein_id gnl|my_center|LOCUS_14720 1439479 1439796 gene locus_tag LOCUS_14730 1439479 1439796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416383.1 protein_id gnl|my_center|LOCUS_14730 1440963 1439815 gene locus_tag LOCUS_14740 1440963 1439815 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416381.1 protein_id gnl|my_center|LOCUS_14740 1442646 1441501 gene locus_tag LOCUS_14750 1442646 1441501 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416376.1 protein_id gnl|my_center|LOCUS_14750 1444372 1443338 gene locus_tag LOCUS_14760 1444372 1443338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1444627 1444385 gene locus_tag LOCUS_14770 1444627 1444385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1445184 1445816 gene locus_tag LOCUS_14780 1445184 1445816 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416373.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14780 1445840 1446490 gene locus_tag LOCUS_14790 gene devR 1445840 1446490 CDS product two-component system response regulator DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416369.1 protein_id gnl|my_center|LOCUS_14790 1446502 1448259 gene locus_tag LOCUS_14800 gene devS 1446502 1448259 CDS product two-component system sensor histidine kinase DevS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416363.1 protein_id gnl|my_center|LOCUS_14800 1449237 1448239 gene locus_tag LOCUS_14810 1449237 1448239 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416362.1 protein_id gnl|my_center|LOCUS_14810 1449429 1450817 gene locus_tag LOCUS_14820 gene tgs1 1449429 1450817 CDS product diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899932.1 protein_id gnl|my_center|LOCUS_14820 1450820 1451236 gene locus_tag LOCUS_14830 1450820 1451236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1451744 1451397 gene locus_tag LOCUS_14840 1451744 1451397 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082943.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14840 1452023 1452232 gene locus_tag LOCUS_14850 1452023 1452232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14850 1452147 1452713 gene locus_tag LOCUS_14860 1452147 1452713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14860 1453684 1452710 gene locus_tag LOCUS_14870 1453684 1452710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416354.1 protein_id gnl|my_center|LOCUS_14870 1453845 1455209 gene locus_tag LOCUS_14880 1453845 1455209 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405897.1 protein_id gnl|my_center|LOCUS_14880 1455238 1455441 gene locus_tag LOCUS_14890 1455238 1455441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1455452 1455787 gene locus_tag LOCUS_14900 1455452 1455787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14900 1455836 1457044 gene locus_tag LOCUS_14910 1455836 1457044 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14910 1458415 1457045 gene locus_tag LOCUS_14920 1458415 1457045 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907864.1 protein_id gnl|my_center|LOCUS_14920 1458549 1459664 gene locus_tag LOCUS_14930 gene prfB 1458549 1459664 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416129.1 protein_id gnl|my_center|LOCUS_14930 1459612 1460640 gene locus_tag LOCUS_14940 1459612 1460640 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416127.1 protein_id gnl|my_center|LOCUS_14940 1460643 1461143 gene locus_tag LOCUS_14950 1460643 1461143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1461185 1461877 gene locus_tag LOCUS_14960 gene ftsE 1461185 1461877 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416120.1 protein_id gnl|my_center|LOCUS_14960 1461878 1462771 gene locus_tag LOCUS_14970 gene ftsX 1461878 1462771 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416117.1 protein_id gnl|my_center|LOCUS_14970 1462774 1463280 gene locus_tag LOCUS_14980 gene smpB 1462774 1463280 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416113.1 protein_id gnl|my_center|LOCUS_14980 1464042 1463314 gene locus_tag LOCUS_14990 1464042 1463314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084357.1 protein_id gnl|my_center|LOCUS_14990 1465064 1464180 gene locus_tag LOCUS_15000 1465064 1464180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15000 1466518 1465067 gene locus_tag LOCUS_15010 1466518 1465067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1467182 1468051 gene locus_tag LOCUS_15020 1467182 1468051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15020 1468099 1469127 gene locus_tag LOCUS_15030 1468099 1469127 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727956.1 protein_id gnl|my_center|LOCUS_15030 1469152 1469997 gene locus_tag LOCUS_15040 1469152 1469997 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416111.1 protein_id gnl|my_center|LOCUS_15040 1470076 1470441 gene locus_tag LOCUS_tm00010 1470076 1470441 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1472262 1470748 gene locus_tag LOCUS_15050 1472262 1470748 CDS product PecA family PE domain-processing aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950732.1 protein_id gnl|my_center|LOCUS_15050 1472677 1473033 gene locus_tag LOCUS_15060 1472677 1473033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1473310 1473074 gene locus_tag LOCUS_15070 1473310 1473074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1473940 1474287 gene locus_tag LOCUS_15080 1473940 1474287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15080 1474676 1474311 gene locus_tag LOCUS_15090 1474676 1474311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1474771 1475160 gene locus_tag LOCUS_15100 1474771 1475160 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_15100 1475075 1475641 gene locus_tag LOCUS_15110 1475075 1475641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1476684 1475638 gene locus_tag LOCUS_15120 gene istA 1476684 1475638 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047902700.1 protein_id gnl|my_center|LOCUS_15120 1477539 1476847 gene locus_tag LOCUS_15130 1477539 1476847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1477894 1478130 gene locus_tag LOCUS_15140 1477894 1478130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15140 1478148 1479011 gene locus_tag LOCUS_15150 1478148 1479011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15150 1479956 1478970 gene locus_tag LOCUS_15160 gene cysM 1479956 1478970 CDS product O-phosphoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406912.1 protein_id gnl|my_center|LOCUS_15160 1480436 1480215 gene locus_tag LOCUS_15170 1480436 1480215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1481392 1480433 gene locus_tag LOCUS_15180 1481392 1480433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15180 1481772 1481467 gene locus_tag LOCUS_15190 1481772 1481467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1482207 1482449 gene locus_tag LOCUS_15200 1482207 1482449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1482462 1483559 gene locus_tag LOCUS_15210 1482462 1483559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1484382 1483564 gene locus_tag LOCUS_15220 1484382 1483564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15220 1484636 1484400 gene locus_tag LOCUS_15230 1484636 1484400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15230 1485465 1484695 gene locus_tag LOCUS_15240 1485465 1484695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1486860 1485820 gene locus_tag LOCUS_15250 1486860 1485820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15250 1488195 1486888 gene locus_tag LOCUS_15260 1488195 1486888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15260 1489775 1488192 gene locus_tag LOCUS_15270 1489775 1488192 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015287949.1 protein_id gnl|my_center|LOCUS_15270 1491132 1490014 gene locus_tag LOCUS_15280 1491132 1490014 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404705.1 protein_id gnl|my_center|LOCUS_15280 1491870 1491139 gene locus_tag LOCUS_15290 1491870 1491139 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404702.1 protein_id gnl|my_center|LOCUS_15290 1491897 1493378 gene locus_tag LOCUS_15300 1491897 1493378 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404691.1 protein_id gnl|my_center|LOCUS_15300 1495137 1495316 gene locus_tag LOCUS_15310 1495137 1495316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1495389 1495625 gene locus_tag LOCUS_15320 1495389 1495625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15320 1495643 1496506 gene locus_tag LOCUS_15330 1495643 1496506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15330 1496503 1496937 gene locus_tag LOCUS_15340 1496503 1496937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15340 1496895 1498718 gene locus_tag LOCUS_15350 1496895 1498718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15350 1498820 1499008 gene locus_tag LOCUS_15360 1498820 1499008 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404724.1 protein_id gnl|my_center|LOCUS_15360 1499013 1499459 gene locus_tag LOCUS_15370 1499013 1499459 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404726.1 protein_id gnl|my_center|LOCUS_15370 1500569 1499571 gene locus_tag LOCUS_15380 gene espE 1500569 1499571 CDS product type VII secretion system ESX-1 associated protein EspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899736.1 protein_id gnl|my_center|LOCUS_15380 1500990 1501763 gene locus_tag LOCUS_15390 1500990 1501763 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404735.1 protein_id gnl|my_center|LOCUS_15390 1501903 1502268 gene locus_tag LOCUS_15400 1501903 1502268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404738.1 protein_id gnl|my_center|LOCUS_15400 1502747 1502274 gene locus_tag LOCUS_15410 1502747 1502274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1504284 1502764 gene locus_tag LOCUS_15420 1504284 1502764 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404742.1 protein_id gnl|my_center|LOCUS_15420 1505521 1504286 gene locus_tag LOCUS_15430 1505521 1504286 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404744.1 protein_id gnl|my_center|LOCUS_15430 1506968 1505775 gene locus_tag LOCUS_15440 1506968 1505775 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404747.1 protein_id gnl|my_center|LOCUS_15440 1507474 1507052 gene locus_tag LOCUS_15450 1507474 1507052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1508298 1507663 gene locus_tag LOCUS_15460 1508298 1507663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1508291 1508623 gene locus_tag LOCUS_15470 1508291 1508623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1508698 1508913 gene locus_tag LOCUS_15480 1508698 1508913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1508926 1509960 gene locus_tag LOCUS_15490 1508926 1509960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1511122 1510628 gene locus_tag LOCUS_15500 1511122 1510628 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897021.1 protein_id gnl|my_center|LOCUS_15500 1511621 1511388 gene locus_tag LOCUS_15510 1511621 1511388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1512256 1511894 gene locus_tag LOCUS_15520 1512256 1511894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15520 1512146 1512538 gene locus_tag LOCUS_15530 1512146 1512538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1513699 1514469 gene locus_tag LOCUS_15540 1513699 1514469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1514462 1515010 gene locus_tag LOCUS_15550 1514462 1515010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1515292 1515780 gene locus_tag LOCUS_15560 1515292 1515780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1516258 1516788 gene locus_tag LOCUS_15570 1516258 1516788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1516773 1519226 gene locus_tag LOCUS_15580 1516773 1519226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15580 1520041 1519547 gene locus_tag LOCUS_15590 1520041 1519547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1520575 1521489 gene locus_tag LOCUS_15600 1520575 1521489 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727303.1 protein_id gnl|my_center|LOCUS_15600 1521550 1521921 gene locus_tag LOCUS_15610 1521550 1521921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1521921 1522130 gene locus_tag LOCUS_15620 1521921 1522130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1523071 1522181 gene locus_tag LOCUS_15630 1523071 1522181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1523385 1523077 gene locus_tag LOCUS_15640 1523385 1523077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413717.1 protein_id gnl|my_center|LOCUS_15640 1523675 1524136 gene locus_tag LOCUS_15650 1523675 1524136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1524550 1524161 gene locus_tag LOCUS_15660 1524550 1524161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899409.1 protein_id gnl|my_center|LOCUS_15660 1525492 1526235 gene locus_tag LOCUS_15670 1525492 1526235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1526245 1526415 gene locus_tag LOCUS_15680 1526245 1526415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1526431 1526817 gene locus_tag LOCUS_15690 1526431 1526817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1527377 1527081 gene locus_tag LOCUS_15700 1527377 1527081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1527906 1527595 gene locus_tag LOCUS_15710 1527906 1527595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1528238 1527903 gene locus_tag LOCUS_15720 1528238 1527903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1529216 1528359 gene locus_tag LOCUS_15730 1529216 1528359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1529895 1529380 gene locus_tag LOCUS_15740 1529895 1529380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1530143 1529895 gene locus_tag LOCUS_15750 1530143 1529895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1531524 1530931 gene locus_tag LOCUS_15760 1531524 1530931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15760 1531726 1531517 gene locus_tag LOCUS_15770 1531726 1531517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1531966 1531727 gene locus_tag LOCUS_15780 1531966 1531727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 1533245 1532148 gene locus_tag LOCUS_15790 1533245 1532148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1533500 1533258 gene locus_tag LOCUS_15800 1533500 1533258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1533893 1533705 gene locus_tag LOCUS_15810 1533893 1533705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1534002 1534574 gene locus_tag LOCUS_15820 1534002 1534574 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115701.1 protein_id gnl|my_center|LOCUS_15820 1534639 1535730 gene locus_tag LOCUS_15830 1534639 1535730 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110336.1 protein_id gnl|my_center|LOCUS_15830 1536591 1535806 gene locus_tag LOCUS_15840 1536591 1535806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1537360 1536608 gene locus_tag LOCUS_15850 1537360 1536608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15850 1537693 1537620 gene locus_tag LOCUS_t00140 1537693 1537620 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1538495 1537749 gene locus_tag LOCUS_15860 1538495 1537749 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401627.1 protein_id gnl|my_center|LOCUS_15860 1538745 1540079 gene locus_tag LOCUS_15870 1538745 1540079 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978280.1 protein_id gnl|my_center|LOCUS_15870 1540166 1540582 gene locus_tag LOCUS_15880 1540166 1540582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1540606 1541274 gene locus_tag LOCUS_15890 gene pcp 1540606 1541274 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401632.1 protein_id gnl|my_center|LOCUS_15890 1541639 1542145 gene locus_tag LOCUS_15900 1541639 1542145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401636.1 protein_id gnl|my_center|LOCUS_15900 1542191 1542763 gene locus_tag LOCUS_15910 gene dcd 1542191 1542763 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898399.1 protein_id gnl|my_center|LOCUS_15910 1542960 1543655 gene locus_tag LOCUS_15920 1542960 1543655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15920 1544083 1543829 gene locus_tag LOCUS_15930 1544083 1543829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1544257 1544532 gene locus_tag LOCUS_15940 1544257 1544532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1544682 1546202 gene locus_tag LOCUS_15950 1544682 1546202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1546279 1547613 gene locus_tag LOCUS_15960 1546279 1547613 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898400.1 protein_id gnl|my_center|LOCUS_15960 1547674 1548429 gene locus_tag LOCUS_15970 1547674 1548429 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401662.1 protein_id gnl|my_center|LOCUS_15970 1548465 1548839 gene locus_tag LOCUS_15980 1548465 1548839 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401666.1 protein_id gnl|my_center|LOCUS_15980 1548869 1549735 gene locus_tag LOCUS_15990 gene rfbA 1548869 1549735 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401670.1 protein_id gnl|my_center|LOCUS_15990 1551097 1549772 gene locus_tag LOCUS_16000 1551097 1549772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1551409 1551281 gene locus_tag LOCUS_16010 1551409 1551281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1551549 1551938 gene locus_tag LOCUS_16020 1551549 1551938 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_16020 1551853 1552419 gene locus_tag LOCUS_16030 1551853 1552419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16030 1552852 1555662 gene locus_tag LOCUS_16040 1552852 1555662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16040 1557031 1555760 gene locus_tag LOCUS_16050 1557031 1555760 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401733.1 protein_id gnl|my_center|LOCUS_16050 1560019 1557080 gene locus_tag LOCUS_16060 1560019 1557080 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401734.1 protein_id gnl|my_center|LOCUS_16060 1562602 1560149 gene locus_tag LOCUS_16070 gene iniR 1562602 1560149 CDS product isoniazid response ATPase/transcriptional regulator IniR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401735.1 protein_id gnl|my_center|LOCUS_16070 1562806 1563345 gene locus_tag LOCUS_16080 1562806 1563345 CDS product IniB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401737.1 protein_id gnl|my_center|LOCUS_16080 1565536 1563473 gene locus_tag LOCUS_16090 1565536 1563473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1566412 1565540 gene locus_tag LOCUS_16100 1566412 1565540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1566624 1568477 gene locus_tag LOCUS_16110 gene iniA 1566624 1568477 CDS product isoniazid-induced dynamin-like GTPase IniA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900124.1 protein_id gnl|my_center|LOCUS_16110 1568474 1569955 gene locus_tag LOCUS_16120 gene iniC 1568474 1569955 CDS product isoniazid-induced dynamin-like GTPase IniC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401747.1 protein_id gnl|my_center|LOCUS_16120 1570540 1569974 gene locus_tag LOCUS_16130 1570540 1569974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1570844 1570455 gene locus_tag LOCUS_16140 1570844 1570455 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_16140 1572735 1570894 gene locus_tag LOCUS_16150 1572735 1570894 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727124.1 protein_id gnl|my_center|LOCUS_16150 1572837 1573271 gene locus_tag LOCUS_16160 1572837 1573271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1573598 1573747 gene locus_tag LOCUS_16170 1573598 1573747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1574010 1573744 gene locus_tag LOCUS_16180 1574010 1573744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1574610 1574047 gene locus_tag LOCUS_16190 1574610 1574047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401751.1 protein_id gnl|my_center|LOCUS_16190 1575178 1574702 gene locus_tag LOCUS_16200 1575178 1574702 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_16200 1576058 1575216 gene locus_tag LOCUS_16210 1576058 1575216 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730865.1 protein_id gnl|my_center|LOCUS_16210 1578385 1576055 gene locus_tag LOCUS_16220 1578385 1576055 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730863.1 protein_id gnl|my_center|LOCUS_16220 1578545 1579093 gene locus_tag LOCUS_16230 1578545 1579093 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727921.1 protein_id gnl|my_center|LOCUS_16230 1579477 1579109 gene locus_tag LOCUS_16240 1579477 1579109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1581145 1579682 gene locus_tag LOCUS_16250 1581145 1579682 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898409.1 protein_id gnl|my_center|LOCUS_16250 1581489 1583357 gene locus_tag LOCUS_16260 gene dnaK 1581489 1583357 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401814.1 protein_id gnl|my_center|LOCUS_16260 1583354 1584007 gene locus_tag LOCUS_16270 gene grpE 1583354 1584007 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401817.1 protein_id gnl|my_center|LOCUS_16270 1584065 1585255 gene locus_tag LOCUS_16280 gene dnaJ 1584065 1585255 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401821.1 protein_id gnl|my_center|LOCUS_16280 1585256 1585642 gene locus_tag LOCUS_16290 gene hspR 1585256 1585642 CDS product heat shock transcriptional regulator HspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401823.1 protein_id gnl|my_center|LOCUS_16290 1586572 1585670 gene locus_tag LOCUS_16300 1586572 1585670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16300 1592575 1586612 gene locus_tag LOCUS_16310 1592575 1586612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16310 1595626 1592906 gene locus_tag LOCUS_16320 1595626 1592906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1603457 1595862 gene locus_tag LOCUS_16330 1603457 1595862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16330 1605555 1604665 gene locus_tag LOCUS_16340 1605555 1604665 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727141.1 protein_id gnl|my_center|LOCUS_16340 1606811 1605630 gene locus_tag LOCUS_16350 1606811 1605630 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401910.1 protein_id gnl|my_center|LOCUS_16350 1608040 1606937 gene locus_tag LOCUS_16360 1608040 1606937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1607925 1608131 gene locus_tag LOCUS_16370 1607925 1608131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1608445 1610991 gene locus_tag LOCUS_16380 gene clpB 1608445 1610991 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401905.1 protein_id gnl|my_center|LOCUS_16380 1611818 1610988 gene locus_tag LOCUS_16390 1611818 1610988 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731540.1 protein_id gnl|my_center|LOCUS_16390 1612176 1613030 gene locus_tag LOCUS_16400 gene ttfA 1612176 1613030 CDS product trehalose monomycolate transport factor TtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401897.1 protein_id gnl|my_center|LOCUS_16400 1613075 1613848 gene locus_tag LOCUS_16410 1613075 1613848 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727156.1 protein_id gnl|my_center|LOCUS_16410 1613826 1614374 gene locus_tag LOCUS_16420 gene pyrE 1613826 1614374 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401894.1 protein_id gnl|my_center|LOCUS_16420 1614385 1615278 gene locus_tag LOCUS_16430 1614385 1615278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401890.1 protein_id gnl|my_center|LOCUS_16430 1615275 1615919 gene locus_tag LOCUS_16440 1615275 1615919 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323891.1 protein_id gnl|my_center|LOCUS_16440 1616243 1616028 gene locus_tag LOCUS_16450 gene secE2 1616243 1616028 CDS product calcium dodecin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401885.1 protein_id gnl|my_center|LOCUS_16450 1617226 1616261 gene locus_tag LOCUS_16460 1617226 1616261 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401875.1 protein_id gnl|my_center|LOCUS_16460 1617361 1619364 gene locus_tag LOCUS_16470 1617361 1619364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1619367 1619846 gene locus_tag LOCUS_16480 1619367 1619846 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401867.1 protein_id gnl|my_center|LOCUS_16480 1619843 1622233 gene locus_tag LOCUS_16490 1619843 1622233 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900133.1 protein_id gnl|my_center|LOCUS_16490 1622243 1623127 gene locus_tag LOCUS_16500 1622243 1623127 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401865.1 protein_id gnl|my_center|LOCUS_16500 1623124 1623714 gene locus_tag LOCUS_16510 1623124 1623714 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401864.1 protein_id gnl|my_center|LOCUS_16510 1623715 1624593 gene locus_tag LOCUS_16520 1623715 1624593 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401863.1 protein_id gnl|my_center|LOCUS_16520 1624607 1625281 gene locus_tag LOCUS_16530 1624607 1625281 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727165.1 protein_id gnl|my_center|LOCUS_16530 1625559 1626482 gene locus_tag LOCUS_16540 1625559 1626482 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950389.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16540 1627258 1626485 gene locus_tag LOCUS_16550 gene eutC 1627258 1626485 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727733.1 protein_id gnl|my_center|LOCUS_16550 1628664 1627255 gene locus_tag LOCUS_16560 1628664 1627255 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892941.1 protein_id gnl|my_center|LOCUS_16560 1630112 1628661 gene locus_tag LOCUS_16570 gene eat 1630112 1628661 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111333.1 protein_id gnl|my_center|LOCUS_16570 1630783 1631916 gene locus_tag LOCUS_16580 gene cya 1630783 1631916 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408035.1 protein_id gnl|my_center|LOCUS_16580 1632015 1633130 gene locus_tag LOCUS_16590 1632015 1633130 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401858.1 protein_id gnl|my_center|LOCUS_16590 1633811 1633119 gene locus_tag LOCUS_16600 1633811 1633119 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401857.1 protein_id gnl|my_center|LOCUS_16600 1633912 1634946 gene locus_tag LOCUS_16610 gene fbaA 1633912 1634946 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401856.1 protein_id gnl|my_center|LOCUS_16610 1636421 1635033 gene locus_tag LOCUS_16620 gene mgtE 1636421 1635033 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898415.1 protein_id gnl|my_center|LOCUS_16620 1637995 1637180 gene locus_tag LOCUS_16630 1637995 1637180 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401853.1 protein_id gnl|my_center|LOCUS_16630 1638155 1638559 gene locus_tag LOCUS_16640 1638155 1638559 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892178.1 protein_id gnl|my_center|LOCUS_16640 1638782 1639540 gene locus_tag LOCUS_16650 1638782 1639540 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898940.1 protein_id gnl|my_center|LOCUS_16650 1639957 1640931 gene locus_tag LOCUS_16660 1639957 1640931 CDS product glycolipid sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898849.1 protein_id gnl|my_center|LOCUS_16660 1641823 1640960 gene locus_tag LOCUS_16670 1641823 1640960 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054878839.1 protein_id gnl|my_center|LOCUS_16670 1642707 1641928 gene locus_tag LOCUS_16680 1642707 1641928 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401851.1 protein_id gnl|my_center|LOCUS_16680 1643395 1642718 gene locus_tag LOCUS_16690 1643395 1642718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401831.1 protein_id gnl|my_center|LOCUS_16690 1643486 1644784 gene locus_tag LOCUS_16700 1643486 1644784 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_16700 1644781 1645440 gene locus_tag LOCUS_16710 1644781 1645440 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401827.1 protein_id gnl|my_center|LOCUS_16710 1646399 1645839 gene locus_tag LOCUS_16720 1646399 1645839 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742110.1 protein_id gnl|my_center|LOCUS_16720 1648142 1646796 gene locus_tag LOCUS_16730 1648142 1646796 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950393.1 protein_id gnl|my_center|LOCUS_16730 1648345 1648734 gene locus_tag LOCUS_16740 1648345 1648734 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_16740 1648649 1649215 gene locus_tag LOCUS_16750 1648649 1649215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1649540 1650880 gene locus_tag LOCUS_16760 gene purT 1649540 1650880 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950394.1 protein_id gnl|my_center|LOCUS_16760 1650877 1651305 gene locus_tag LOCUS_16770 1650877 1651305 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401921.1 protein_id gnl|my_center|LOCUS_16770 1651964 1652632 gene locus_tag LOCUS_16780 1651964 1652632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16780 1652884 1652687 gene locus_tag LOCUS_16790 1652884 1652687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16790 1654102 1652888 gene locus_tag LOCUS_16800 1654102 1652888 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898428.1 protein_id gnl|my_center|LOCUS_16800 1654822 1654598 gene locus_tag LOCUS_16810 1654822 1654598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1654746 1655936 gene locus_tag LOCUS_16820 1654746 1655936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1656478 1655834 gene locus_tag LOCUS_16830 1656478 1655834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1657917 1656676 gene locus_tag LOCUS_16840 1657917 1656676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1658639 1657914 gene locus_tag LOCUS_16850 1658639 1657914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1659047 1658670 gene locus_tag LOCUS_16860 1659047 1658670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1659535 1659047 gene locus_tag LOCUS_16870 1659535 1659047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1661046 1659532 gene locus_tag LOCUS_16880 1661046 1659532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1662062 1661412 gene locus_tag LOCUS_16890 1662062 1661412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401963.1 protein_id gnl|my_center|LOCUS_16890 1663280 1662066 gene locus_tag LOCUS_16900 1663280 1662066 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898432.1 protein_id gnl|my_center|LOCUS_16900 1664505 1663357 gene locus_tag LOCUS_16910 1664505 1663357 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896599.1 protein_id gnl|my_center|LOCUS_16910 1665704 1664517 gene locus_tag LOCUS_16920 1665704 1664517 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401972.1 protein_id gnl|my_center|LOCUS_16920 1665740 1666120 gene locus_tag LOCUS_16930 1665740 1666120 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401978.1 protein_id gnl|my_center|LOCUS_16930 1666293 1666799 gene locus_tag LOCUS_16940 1666293 1666799 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727180.1 protein_id gnl|my_center|LOCUS_16940 1666796 1667902 gene locus_tag LOCUS_16950 1666796 1667902 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728201.1 protein_id gnl|my_center|LOCUS_16950 1667899 1669017 gene locus_tag LOCUS_16960 1667899 1669017 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086421.1 protein_id gnl|my_center|LOCUS_16960 1669014 1670345 gene locus_tag LOCUS_16970 1669014 1670345 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086420.1 protein_id gnl|my_center|LOCUS_16970 1673078 1670259 gene locus_tag LOCUS_16980 gene mmpL1 1673078 1670259 CDS product RND transporter MmpL1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898435.1 protein_id gnl|my_center|LOCUS_16980 1673560 1673132 gene locus_tag LOCUS_16990 1673560 1673132 CDS product MmpS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402074.1 protein_id gnl|my_center|LOCUS_16990 1674815 1673781 gene locus_tag LOCUS_17000 1674815 1673781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1675070 1674828 gene locus_tag LOCUS_17010 1675070 1674828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1675530 1676051 gene locus_tag LOCUS_17020 1675530 1676051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17020 1676310 1677299 gene locus_tag LOCUS_17030 1676310 1677299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17030 1677296 1681513 gene locus_tag LOCUS_17040 1677296 1681513 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911169.1 protein_id gnl|my_center|LOCUS_17040 1682289 1681537 gene locus_tag LOCUS_17050 1682289 1681537 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898437.1 protein_id gnl|my_center|LOCUS_17050 1682479 1683489 gene locus_tag LOCUS_17060 gene fgd 1682479 1683489 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898438.1 protein_id gnl|my_center|LOCUS_17060 1683482 1683682 gene locus_tag LOCUS_17070 1683482 1683682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17070 1683788 1685581 gene locus_tag LOCUS_17080 gene pta 1683788 1685581 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402089.1 protein_id gnl|my_center|LOCUS_17080 1685598 1686737 gene locus_tag LOCUS_17090 1685598 1686737 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402097.1 protein_id gnl|my_center|LOCUS_17090 1686856 1687776 gene locus_tag LOCUS_17100 1686856 1687776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727189.1 protein_id gnl|my_center|LOCUS_17100 1690204 1687901 gene locus_tag LOCUS_17110 gene pknG 1690204 1687901 CDS product serine/threonine protein kinase PknG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402100.1 protein_id gnl|my_center|LOCUS_17110 1691190 1690204 gene locus_tag LOCUS_17120 1691190 1690204 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900142.1 protein_id gnl|my_center|LOCUS_17120 1692509 1691190 gene locus_tag LOCUS_17130 gene glnX 1692509 1691190 CDS product protein kinase G-activating protein GlnX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402108.1 protein_id gnl|my_center|LOCUS_17130 1692661 1693284 gene locus_tag LOCUS_17140 1692661 1693284 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402111.1 protein_id gnl|my_center|LOCUS_17140 1693918 1693256 gene locus_tag LOCUS_17150 gene thiE 1693918 1693256 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402115.1 protein_id gnl|my_center|LOCUS_17150 1694224 1695099 gene locus_tag LOCUS_17160 gene thiO 1694224 1695099 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402118.1 protein_id gnl|my_center|LOCUS_17160 1695096 1695293 gene locus_tag LOCUS_17170 gene thiS 1695096 1695293 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402121.1 protein_id gnl|my_center|LOCUS_17170 1695286 1696077 gene locus_tag LOCUS_17180 gene thiG 1695286 1696077 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402126.1 protein_id gnl|my_center|LOCUS_17180 1696209 1696877 gene locus_tag LOCUS_17190 1696209 1696877 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510615.1 protein_id gnl|my_center|LOCUS_17190 1697410 1696880 gene locus_tag LOCUS_17200 1697410 1696880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1697572 1697814 gene locus_tag LOCUS_17210 1697572 1697814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1698488 1697922 gene locus_tag LOCUS_17220 1698488 1697922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 1698792 1698403 gene locus_tag LOCUS_17230 1698792 1698403 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_17230 1698863 1699795 gene locus_tag LOCUS_17240 1698863 1699795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1700286 1700618 gene locus_tag LOCUS_17250 1700286 1700618 CDS product CD225/dispanin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228394.1 protein_id gnl|my_center|LOCUS_17250 1700633 1701058 gene locus_tag LOCUS_17260 1700633 1701058 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228393.1 protein_id gnl|my_center|LOCUS_17260 1701251 1702702 gene locus_tag LOCUS_17270 1701251 1702702 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402133.1 protein_id gnl|my_center|LOCUS_17270 1702699 1703667 gene locus_tag LOCUS_17280 1702699 1703667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17280 1703597 1704172 gene locus_tag LOCUS_17290 1703597 1704172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17290 1704315 1705778 gene locus_tag LOCUS_17300 1704315 1705778 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898442.1 protein_id gnl|my_center|LOCUS_17300 1709090 1705809 gene locus_tag LOCUS_17310 1709090 1705809 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900661.1 protein_id gnl|my_center|LOCUS_17310 1709521 1711047 gene locus_tag LOCUS_17320 1709521 1711047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1711354 1711040 gene locus_tag LOCUS_17330 1711354 1711040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402143.1 protein_id gnl|my_center|LOCUS_17330 1711626 1711402 gene locus_tag LOCUS_17340 1711626 1711402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104552.1 protein_id gnl|my_center|LOCUS_17340 1711728 1713071 gene locus_tag LOCUS_17350 1711728 1713071 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876881.1 protein_id gnl|my_center|LOCUS_17350 1713615 1712980 gene locus_tag LOCUS_17360 1713615 1712980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402145.1 protein_id gnl|my_center|LOCUS_17360 1714424 1713612 gene locus_tag LOCUS_17370 gene thiD 1714424 1713612 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402147.1 protein_id gnl|my_center|LOCUS_17370 1716076 1714436 gene locus_tag LOCUS_17380 gene thiC 1716076 1714436 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900143.1 protein_id gnl|my_center|LOCUS_17380 1716274 1716996 gene locus_tag LOCUS_17390 1716274 1716996 CDS product PAS and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088224.1 protein_id gnl|my_center|LOCUS_17390 1717127 1717522 gene locus_tag LOCUS_17400 1717127 1717522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1717519 1721382 gene locus_tag LOCUS_17410 1717519 1721382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1721691 1721416 gene locus_tag LOCUS_17420 1721691 1721416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402157.1 protein_id gnl|my_center|LOCUS_17420 1726327 1721741 gene locus_tag LOCUS_17430 1726327 1721741 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904400.1 protein_id gnl|my_center|LOCUS_17430 1726823 1726377 gene locus_tag LOCUS_17440 1726823 1726377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402171.1 protein_id gnl|my_center|LOCUS_17440 1727797 1726967 gene locus_tag LOCUS_17450 1727797 1726967 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402176.1 protein_id gnl|my_center|LOCUS_17450 1728696 1727800 gene locus_tag LOCUS_17460 1728696 1727800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402179.1 protein_id gnl|my_center|LOCUS_17460 1729289 1728696 gene locus_tag LOCUS_17470 1729289 1728696 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402185.1 protein_id gnl|my_center|LOCUS_17470 1729551 1729847 gene locus_tag LOCUS_17480 1729551 1729847 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402188.1 protein_id gnl|my_center|LOCUS_17480 1729963 1730394 gene locus_tag LOCUS_17490 1729963 1730394 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323879.1 protein_id gnl|my_center|LOCUS_17490 1730602 1731183 gene locus_tag LOCUS_17500 1730602 1731183 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908619.1 protein_id gnl|my_center|LOCUS_17500 1731248 1732315 gene locus_tag LOCUS_17510 1731248 1732315 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900145.1 protein_id gnl|my_center|LOCUS_17510 1733128 1732418 gene locus_tag LOCUS_17520 1733128 1732418 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086031.1 protein_id gnl|my_center|LOCUS_17520 1733385 1733125 gene locus_tag LOCUS_17530 1733385 1733125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1733300 1733854 gene locus_tag LOCUS_17540 1733300 1733854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17540 1733860 1734480 gene locus_tag LOCUS_17550 1733860 1734480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17550 1734619 1735275 gene locus_tag LOCUS_17560 1734619 1735275 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402203.1 protein_id gnl|my_center|LOCUS_17560 1735325 1735714 gene locus_tag LOCUS_17570 1735325 1735714 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_17570 1735629 1736195 gene locus_tag LOCUS_17580 1735629 1736195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17580 1738390 1736216 gene locus_tag LOCUS_17590 1738390 1736216 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402206.1 protein_id gnl|my_center|LOCUS_17590 1739205 1738387 gene locus_tag LOCUS_17600 gene pssA 1739205 1738387 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402213.1 protein_id gnl|my_center|LOCUS_17600 1739981 1739259 gene locus_tag LOCUS_17610 1739981 1739259 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402216.1 protein_id gnl|my_center|LOCUS_17610 1741338 1740067 gene locus_tag LOCUS_17620 1741338 1740067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1741464 1741835 gene locus_tag LOCUS_17630 1741464 1741835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1744029 1742824 gene locus_tag LOCUS_17640 1744029 1742824 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402217.1 protein_id gnl|my_center|LOCUS_17640 1744986 1744048 gene locus_tag LOCUS_17650 1744986 1744048 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402219.1 protein_id gnl|my_center|LOCUS_17650 1745677 1745033 gene locus_tag LOCUS_17660 1745677 1745033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1745846 1747471 gene locus_tag LOCUS_17670 gene groL 1745846 1747471 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064866.1 protein_id gnl|my_center|LOCUS_17670 1747976 1747557 gene locus_tag LOCUS_17680 1747976 1747557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402238.1 protein_id gnl|my_center|LOCUS_17680 1749479 1748013 gene locus_tag LOCUS_17690 1749479 1748013 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402239.1 protein_id gnl|my_center|LOCUS_17690 1751323 1749575 gene locus_tag LOCUS_17700 1751323 1749575 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_17700 1751389 1751904 gene locus_tag LOCUS_17710 1751389 1751904 CDS product mycothiol transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402240.1 protein_id gnl|my_center|LOCUS_17710 1751914 1752762 gene locus_tag LOCUS_17720 1751914 1752762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727270.1 protein_id gnl|my_center|LOCUS_17720 1753471 1752773 gene locus_tag LOCUS_17730 gene rskA 1753471 1752773 CDS product anti-sigma-K factor RskA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898455.1 protein_id gnl|my_center|LOCUS_17730 1754031 1753468 gene locus_tag LOCUS_17740 gene sigK 1754031 1753468 CDS product sigma-70 family RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402246.1 protein_id gnl|my_center|LOCUS_17740 1754868 1754077 gene locus_tag LOCUS_17750 1754868 1754077 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402248.1 protein_id gnl|my_center|LOCUS_17750 1756154 1754868 gene locus_tag LOCUS_17760 1756154 1754868 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402250.1 protein_id gnl|my_center|LOCUS_17760 1756867 1756151 gene locus_tag LOCUS_17770 1756867 1756151 CDS product DUF1365 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402266.1 protein_id gnl|my_center|LOCUS_17770 1758177 1756861 gene locus_tag LOCUS_17780 1758177 1756861 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402268.1 protein_id gnl|my_center|LOCUS_17780 1761133 1758236 gene locus_tag LOCUS_17790 gene mmpL4 1761133 1758236 CDS product siderophore RND transporter MmpL4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898458.1 protein_id gnl|my_center|LOCUS_17790 1761549 1761130 gene locus_tag LOCUS_17800 gene mmpS4 1761549 1761130 CDS product siderophore RND transporter accessory protein MmpS4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402272.1 protein_id gnl|my_center|LOCUS_17800 1761934 1762602 gene locus_tag LOCUS_17810 1761934 1762602 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402282.1 protein_id gnl|my_center|LOCUS_17810 1762861 1763307 gene locus_tag LOCUS_17820 1762861 1763307 CDS product MmpS family transport accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903500.1 protein_id gnl|my_center|LOCUS_17820 1763304 1766306 gene locus_tag LOCUS_17830 gene mmpL2 1763304 1766306 CDS product RND transporter MmpL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911183.1 protein_id gnl|my_center|LOCUS_17830 1766685 1766338 gene locus_tag LOCUS_17840 1766685 1766338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908862.1 protein_id gnl|my_center|LOCUS_17840 1767410 1766961 gene locus_tag LOCUS_17850 1767410 1766961 CDS product DUF5078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402286.1 protein_id gnl|my_center|LOCUS_17850 1768391 1767477 gene locus_tag LOCUS_17860 1768391 1767477 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_17860 1770579 1768483 gene locus_tag LOCUS_17870 1770579 1768483 CDS product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402292.1 protein_id gnl|my_center|LOCUS_17870 1770645 1772168 gene locus_tag LOCUS_17880 1770645 1772168 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402294.1 protein_id gnl|my_center|LOCUS_17880 1772168 1772668 gene locus_tag LOCUS_17890 1772168 1772668 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898464.1 protein_id gnl|my_center|LOCUS_17890 1772728 1772967 gene locus_tag LOCUS_17900 1772728 1772967 CDS product putative holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402297.1 protein_id gnl|my_center|LOCUS_17900 1772960 1773571 gene locus_tag LOCUS_17910 1772960 1773571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1775261 1776655 gene locus_tag LOCUS_17920 gene lpdA 1775261 1776655 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402301.1 protein_id gnl|my_center|LOCUS_17920 1776658 1776933 gene locus_tag LOCUS_17930 1776658 1776933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402304.1 protein_id gnl|my_center|LOCUS_17930 1777944 1777255 gene locus_tag LOCUS_17940 1777944 1777255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17940 1778397 1777975 gene locus_tag LOCUS_17950 1778397 1777975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17950 1779241 1778675 gene locus_tag LOCUS_17960 1779241 1778675 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402306.1 protein_id gnl|my_center|LOCUS_17960 1780662 1779238 gene locus_tag LOCUS_17970 gene ramB 1780662 1779238 CDS product acetate metabolism transcriptional regulator RamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898467.1 protein_id gnl|my_center|LOCUS_17970 1780837 1781631 gene locus_tag LOCUS_17980 1780837 1781631 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402311.1 protein_id gnl|my_center|LOCUS_17980 1781939 1783225 gene locus_tag LOCUS_17990 gene aceA 1781939 1783225 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892337.1 protein_id gnl|my_center|LOCUS_17990 1783389 1784255 gene locus_tag LOCUS_18000 1783389 1784255 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908914.1 protein_id gnl|my_center|LOCUS_18000 1784391 1785251 gene locus_tag LOCUS_18010 gene umaA 1784391 1785251 CDS product SAM-dependent methyltransferase UmaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900153.1 protein_id gnl|my_center|LOCUS_18010 1786346 1785483 gene locus_tag LOCUS_18020 gene pcaA 1786346 1785483 CDS product cyclopropane mycolic acid synthase PcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402323.1 protein_id gnl|my_center|LOCUS_18020 1787207 1786503 gene locus_tag LOCUS_18030 1787207 1786503 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402330.1 protein_id gnl|my_center|LOCUS_18030 1787399 1788682 gene locus_tag LOCUS_18040 1787399 1788682 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402332.1 protein_id gnl|my_center|LOCUS_18040 1788768 1789184 gene locus_tag LOCUS_18050 1788768 1789184 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402335.1 protein_id gnl|my_center|LOCUS_18050 1789525 1790130 gene locus_tag LOCUS_18060 gene hbhA 1789525 1790130 CDS product heparin-binding hemagglutinin HbhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402339.1 protein_id gnl|my_center|LOCUS_18060 1790310 1790570 gene locus_tag LOCUS_18070 1790310 1790570 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908910.1 protein_id gnl|my_center|LOCUS_18070 1790575 1791057 gene locus_tag LOCUS_18080 1790575 1791057 CDS product DUF2599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402344.1 protein_id gnl|my_center|LOCUS_18080 1791096 1791737 gene locus_tag LOCUS_18090 gene deoC 1791096 1791737 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402347.1 protein_id gnl|my_center|LOCUS_18090 1792646 1791756 gene locus_tag LOCUS_18100 1792646 1791756 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898475.1 protein_id gnl|my_center|LOCUS_18100 1793641 1792799 gene locus_tag LOCUS_18110 1793641 1792799 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402350.1 protein_id gnl|my_center|LOCUS_18110 1794085 1794752 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgttgccgccgttgccgccgtcgc 1795849 1796802 gene locus_tag LOCUS_18120 1795849 1796802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1797044 1796799 gene locus_tag LOCUS_18130 1797044 1796799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1797504 1797229 gene locus_tag LOCUS_18140 1797504 1797229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18140 1798440 1797916 gene locus_tag LOCUS_18150 1798440 1797916 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402351.1 protein_id gnl|my_center|LOCUS_18150 1798467 1799567 gene locus_tag LOCUS_18160 1798467 1799567 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402354.1 protein_id gnl|my_center|LOCUS_18160 1799729 1800991 gene locus_tag LOCUS_18170 gene ldtMt5 1799729 1800991 CDS product L,D-transpeptidase LdtMt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402357.1 protein_id gnl|my_center|LOCUS_18170 1801694 1800975 gene locus_tag LOCUS_18180 1801694 1800975 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402359.1 protein_id gnl|my_center|LOCUS_18180 1801904 1803205 gene locus_tag LOCUS_18190 1801904 1803205 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402361.1 protein_id gnl|my_center|LOCUS_18190 1803217 1804617 gene locus_tag LOCUS_18200 gene mshA 1803217 1804617 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402367.1 protein_id gnl|my_center|LOCUS_18200 1804614 1805165 gene locus_tag LOCUS_18210 1804614 1805165 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892360.1 protein_id gnl|my_center|LOCUS_18210 1805179 1805934 gene locus_tag LOCUS_18220 1805179 1805934 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402379.1 protein_id gnl|my_center|LOCUS_18220 1806070 1807296 gene locus_tag LOCUS_18230 gene senX3 1806070 1807296 CDS product two-component system sensor histidine kinase SenX3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402390.1 protein_id gnl|my_center|LOCUS_18230 1807390 1808082 gene locus_tag LOCUS_18240 gene regX 1807390 1808082 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011742113.1 protein_id gnl|my_center|LOCUS_18240 1808443 1808045 gene locus_tag LOCUS_18250 1808443 1808045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18250 1809957 1808359 gene locus_tag LOCUS_18260 1809957 1808359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18260 1810097 1809954 gene locus_tag LOCUS_18270 1810097 1809954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18270 1810295 1810131 gene locus_tag LOCUS_18280 1810295 1810131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18280 1810534 1810328 gene locus_tag LOCUS_18290 1810534 1810328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18290 1811299 1810550 gene locus_tag LOCUS_18300 1811299 1810550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898482.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18300 1811417 1812136 gene locus_tag LOCUS_18310 1811417 1812136 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402414.1 protein_id gnl|my_center|LOCUS_18310 1812943 1812149 gene locus_tag LOCUS_18320 1812943 1812149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898484.1 protein_id gnl|my_center|LOCUS_18320 1813083 1814117 gene locus_tag LOCUS_18330 gene ppx1 1813083 1814117 CDS product exopolyphosphatase Ppx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402419.1 protein_id gnl|my_center|LOCUS_18330 1814114 1815163 gene locus_tag LOCUS_18340 1814114 1815163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402426.1 protein_id gnl|my_center|LOCUS_18340 1815180 1816022 gene locus_tag LOCUS_18350 1815180 1816022 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402432.1 protein_id gnl|my_center|LOCUS_18350 1816024 1816869 gene locus_tag LOCUS_18360 1816024 1816869 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402433.1 protein_id gnl|my_center|LOCUS_18360 1816894 1817778 gene locus_tag LOCUS_18370 gene proC 1816894 1817778 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900159.1 protein_id gnl|my_center|LOCUS_18370 1817851 1818174 gene locus_tag LOCUS_18380 1817851 1818174 CDS product cell division/environmental response transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908893.1 protein_id gnl|my_center|LOCUS_18380 1818493 1819626 gene locus_tag LOCUS_18390 1818493 1819626 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402607.1 protein_id gnl|my_center|LOCUS_18390 1819952 1819740 gene locus_tag LOCUS_18400 1819952 1819740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1820025 1820699 gene locus_tag LOCUS_18410 1820025 1820699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1821664 1820753 gene locus_tag LOCUS_18420 gene cmaA2 1821664 1820753 CDS product cyclopropane mycolic acid synthase CmaA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402621.1 protein_id gnl|my_center|LOCUS_18420 1822187 1821687 gene locus_tag LOCUS_18430 1822187 1821687 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402626.1 protein_id gnl|my_center|LOCUS_18430 1823143 1822232 gene locus_tag LOCUS_18440 1823143 1822232 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402684.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18440 1823496 1823350 gene locus_tag LOCUS_18450 1823496 1823350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1823467 1823673 gene locus_tag LOCUS_18460 1823467 1823673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18460 1823938 1824915 gene locus_tag LOCUS_18470 1823938 1824915 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727255.1 protein_id gnl|my_center|LOCUS_18470 1824912 1827089 gene locus_tag LOCUS_18480 1824912 1827089 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727254.1 protein_id gnl|my_center|LOCUS_18480 1827135 1827314 gene locus_tag LOCUS_18490 1827135 1827314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1828861 1827425 gene locus_tag LOCUS_18500 1828861 1827425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18500 1830153 1829359 gene locus_tag LOCUS_18510 1830153 1829359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1830934 1830728 gene locus_tag LOCUS_18520 1830934 1830728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1830821 1831258 gene locus_tag LOCUS_18530 1830821 1831258 CDS product MmpS family transport accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900160.1 protein_id gnl|my_center|LOCUS_18530 1831255 1834239 gene locus_tag LOCUS_18540 gene mmpL2 1831255 1834239 CDS product RND transporter MmpL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911183.1 protein_id gnl|my_center|LOCUS_18540 1834245 1834514 gene locus_tag LOCUS_18550 1834245 1834514 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402695.1 protein_id gnl|my_center|LOCUS_18550 1834589 1834972 gene locus_tag LOCUS_18560 1834589 1834972 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_18560 1834887 1835453 gene locus_tag LOCUS_18570 1834887 1835453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 1835559 1836980 gene locus_tag LOCUS_18580 1835559 1836980 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402699.1 protein_id gnl|my_center|LOCUS_18580 1836985 1837938 gene locus_tag LOCUS_18590 gene hemC 1836985 1837938 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402702.1 protein_id gnl|my_center|LOCUS_18590 1837960 1839636 gene locus_tag LOCUS_18600 1837960 1839636 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900163.1 protein_id gnl|my_center|LOCUS_18600 1839676 1840659 gene locus_tag LOCUS_18610 gene hemB 1839676 1840659 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898491.1 protein_id gnl|my_center|LOCUS_18610 1840671 1841207 gene locus_tag LOCUS_18620 1840671 1841207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402713.1 protein_id gnl|my_center|LOCUS_18620 1841204 1841488 gene locus_tag LOCUS_18630 1841204 1841488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402715.1 protein_id gnl|my_center|LOCUS_18630 1843137 1841923 gene locus_tag LOCUS_18640 1843137 1841923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18640 1847609 1843173 gene locus_tag LOCUS_18650 1847609 1843173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18650 1848209 1847619 gene locus_tag LOCUS_18660 1848209 1847619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 1849081 1849293 gene locus_tag LOCUS_18670 1849081 1849293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1850212 1849463 gene locus_tag LOCUS_18680 1850212 1849463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 1851104 1850292 gene locus_tag LOCUS_18690 gene istB 1851104 1850292 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_18690 1851418 1851101 gene locus_tag LOCUS_18700 1851418 1851101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 1851938 1851372 gene locus_tag LOCUS_18710 1851938 1851372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1852242 1851853 gene locus_tag LOCUS_18720 1852242 1851853 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_18720 1853534 1852272 gene locus_tag LOCUS_18730 1853534 1852272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1855473 1855862 gene locus_tag LOCUS_18740 1855473 1855862 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_18740 1855777 1856343 gene locus_tag LOCUS_18750 1855777 1856343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1856803 1856354 gene locus_tag LOCUS_18760 1856803 1856354 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402807.1 protein_id gnl|my_center|LOCUS_18760 1857116 1858348 gene locus_tag LOCUS_18770 1857116 1858348 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402810.1 protein_id gnl|my_center|LOCUS_18770 1858466 1859185 gene locus_tag LOCUS_18780 1858466 1859185 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402818.1 protein_id gnl|my_center|LOCUS_18780 1861645 1859483 gene locus_tag LOCUS_18790 1861645 1859483 CDS product SGNH hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624217.1 protein_id gnl|my_center|LOCUS_18790 1862641 1861697 gene locus_tag LOCUS_18800 1862641 1861697 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402824.1 protein_id gnl|my_center|LOCUS_18800 1862794 1863657 gene locus_tag LOCUS_18810 1862794 1863657 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729766.1 protein_id gnl|my_center|LOCUS_18810 1863779 1866496 gene locus_tag LOCUS_18820 1863779 1866496 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410027.1 protein_id gnl|my_center|LOCUS_18820 1866879 1868456 gene locus_tag LOCUS_18830 1866879 1868456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1868627 1869952 gene locus_tag LOCUS_18840 1868627 1869952 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900165.1 protein_id gnl|my_center|LOCUS_18840 1870861 1869959 gene locus_tag LOCUS_18850 1870861 1869959 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811401.1 protein_id gnl|my_center|LOCUS_18850 1872064 1870907 gene locus_tag LOCUS_18860 1872064 1870907 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811400.1 protein_id gnl|my_center|LOCUS_18860 1872277 1872606 gene locus_tag LOCUS_18870 1872277 1872606 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408261.1 protein_id gnl|my_center|LOCUS_18870 1872893 1872621 gene locus_tag LOCUS_18880 1872893 1872621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 1874365 1873022 gene locus_tag LOCUS_18890 1874365 1873022 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092091.1 protein_id gnl|my_center|LOCUS_18890 1874531 1874962 gene locus_tag LOCUS_18900 1874531 1874962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18900 1874862 1875875 gene locus_tag LOCUS_18910 1874862 1875875 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18910 1875949 1877280 gene locus_tag LOCUS_18920 gene hemL 1875949 1877280 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402844.1 protein_id gnl|my_center|LOCUS_18920 1877280 1877888 gene locus_tag LOCUS_18930 1877280 1877888 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402845.1 protein_id gnl|my_center|LOCUS_18930 1877891 1878502 gene locus_tag LOCUS_18940 1877891 1878502 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402846.1 protein_id gnl|my_center|LOCUS_18940 1878499 1879290 gene locus_tag LOCUS_18950 1878499 1879290 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402847.1 protein_id gnl|my_center|LOCUS_18950 1879392 1880966 gene locus_tag LOCUS_18960 1879392 1880966 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402848.1 protein_id gnl|my_center|LOCUS_18960 1880963 1881949 gene locus_tag LOCUS_18970 gene ccsB 1880963 1881949 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402849.1 protein_id gnl|my_center|LOCUS_18970 1881991 1883307 gene locus_tag LOCUS_18980 1881991 1883307 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898495.1 protein_id gnl|my_center|LOCUS_18980 1883465 1883313 gene locus_tag LOCUS_18990 1883465 1883313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402851.1 protein_id gnl|my_center|LOCUS_18990 1883512 1883880 gene locus_tag LOCUS_19000 1883512 1883880 CDS product DUF4229 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402853.1 protein_id gnl|my_center|LOCUS_19000 1884895 1883888 gene locus_tag LOCUS_19010 gene fabH 1884895 1883888 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402861.1 protein_id gnl|my_center|LOCUS_19010 1885869 1884994 gene locus_tag LOCUS_19020 1885869 1884994 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402865.1 protein_id gnl|my_center|LOCUS_19020 1885910 1886704 gene locus_tag LOCUS_19030 1885910 1886704 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402867.1 protein_id gnl|my_center|LOCUS_19030 1886701 1887741 gene locus_tag LOCUS_19040 1886701 1887741 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402868.1 protein_id gnl|my_center|LOCUS_19040 1889404 1887749 gene locus_tag LOCUS_19050 1889404 1887749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402870.1 protein_id gnl|my_center|LOCUS_19050 1889715 1889401 gene locus_tag LOCUS_19060 1889715 1889401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 1889716 1891659 gene locus_tag LOCUS_19070 1889716 1891659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 1891689 1892345 gene locus_tag LOCUS_19080 1891689 1892345 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898499.1 protein_id gnl|my_center|LOCUS_19080 1892342 1893004 gene locus_tag LOCUS_19090 1892342 1893004 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402886.1 protein_id gnl|my_center|LOCUS_19090 1894388 1893036 gene locus_tag LOCUS_19100 1894388 1893036 CDS product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402890.1 protein_id gnl|my_center|LOCUS_19100 1895509 1894400 gene locus_tag LOCUS_19110 gene menE 1895509 1894400 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402892.1 protein_id gnl|my_center|LOCUS_19110 1895850 1895554 gene locus_tag LOCUS_19120 1895850 1895554 CDS product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402896.1 protein_id gnl|my_center|LOCUS_19120 1896196 1895912 gene locus_tag LOCUS_19130 1896196 1895912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402901.1 protein_id gnl|my_center|LOCUS_19130 1897467 1896193 gene locus_tag LOCUS_19140 1897467 1896193 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402904.1 protein_id gnl|my_center|LOCUS_19140 1897972 1897565 gene locus_tag LOCUS_19150 1897972 1897565 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908792.1 protein_id gnl|my_center|LOCUS_19150 1898615 1897986 gene locus_tag LOCUS_19160 1898615 1897986 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030760.1 protein_id gnl|my_center|LOCUS_19160 1899506 1898634 gene locus_tag LOCUS_19170 1899506 1898634 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402909.1 protein_id gnl|my_center|LOCUS_19170 1900467 1899565 gene locus_tag LOCUS_19180 1900467 1899565 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402911.1 protein_id gnl|my_center|LOCUS_19180 1901165 1900464 gene locus_tag LOCUS_19190 1901165 1900464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 1902861 1901275 gene locus_tag LOCUS_19200 gene fadD8 1902861 1901275 CDS product fatty-acid--CoA ligase FadD8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402917.1 protein_id gnl|my_center|LOCUS_19200 1902965 1904572 gene locus_tag LOCUS_19210 1902965 1904572 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402920.1 protein_id gnl|my_center|LOCUS_19210 1904632 1905552 gene locus_tag LOCUS_19220 1904632 1905552 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402923.1 protein_id gnl|my_center|LOCUS_19220 1905545 1906333 gene locus_tag LOCUS_19230 1905545 1906333 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402925.1 protein_id gnl|my_center|LOCUS_19230 1906397 1908043 gene locus_tag LOCUS_19240 gene menD 1906397 1908043 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402927.1 protein_id gnl|my_center|LOCUS_19240 1908040 1908564 gene locus_tag LOCUS_19250 1908040 1908564 CDS product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911225.1 protein_id gnl|my_center|LOCUS_19250 1908640 1909791 gene locus_tag LOCUS_19260 gene mgtA 1908640 1909791 CDS product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900963.1 protein_id gnl|my_center|LOCUS_19260 1910285 1909788 gene locus_tag LOCUS_19270 1910285 1909788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1910410 1911585 gene locus_tag LOCUS_19280 1910410 1911585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1911575 1912882 gene locus_tag LOCUS_19290 1911575 1912882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224715.1 protein_id gnl|my_center|LOCUS_19290 1912956 1913606 gene locus_tag LOCUS_19300 1912956 1913606 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402936.1 protein_id gnl|my_center|LOCUS_19300 1913960 1913625 gene locus_tag LOCUS_19310 1913960 1913625 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402937.1 protein_id gnl|my_center|LOCUS_19310 1914670 1913993 gene locus_tag LOCUS_19320 1914670 1913993 CDS product benzoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402938.1 protein_id gnl|my_center|LOCUS_19320 1915974 1914736 gene locus_tag LOCUS_19330 gene menJ 1915974 1914736 CDS product menaquinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402939.1 protein_id gnl|my_center|LOCUS_19330 1915996 1917003 gene locus_tag LOCUS_19340 gene grcC 1915996 1917003 CDS product polyprenyl-diphosphate synthase GrcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402957.1 protein_id gnl|my_center|LOCUS_19340 1917094 1917954 gene locus_tag LOCUS_19350 gene htpX 1917094 1917954 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402959.1 protein_id gnl|my_center|LOCUS_19350 1919433 1917976 gene locus_tag LOCUS_19360 1919433 1917976 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908805.1 protein_id gnl|my_center|LOCUS_19360 1921422 1919869 gene locus_tag LOCUS_19370 1921422 1919869 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908805.1 protein_id gnl|my_center|LOCUS_19370 1922236 1921670 gene locus_tag LOCUS_19380 1922236 1921670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19380 1922540 1922151 gene locus_tag LOCUS_19390 1922540 1922151 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_19390 1923645 1922590 gene locus_tag LOCUS_19400 1923645 1922590 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900965.1 protein_id gnl|my_center|LOCUS_19400 1923775 1924077 gene locus_tag LOCUS_19410 1923775 1924077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1924074 1925264 gene locus_tag LOCUS_19420 1924074 1925264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 1926801 1925293 gene locus_tag LOCUS_19430 1926801 1925293 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402981.1 protein_id gnl|my_center|LOCUS_19430 1927515 1927252 gene locus_tag LOCUS_19440 1927515 1927252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 1929432 1927528 gene locus_tag LOCUS_19450 1929432 1927528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1930536 1929487 gene locus_tag LOCUS_19460 1930536 1929487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 1931221 1930685 gene locus_tag LOCUS_19470 1931221 1930685 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878199.1 protein_id gnl|my_center|LOCUS_19470 1931813 1931322 gene locus_tag LOCUS_19480 1931813 1931322 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402987.1 protein_id gnl|my_center|LOCUS_19480 1931880 1931965 gene locus_tag LOCUS_t00150 1931880 1931965 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1934393 1932006 gene locus_tag LOCUS_19490 1934393 1932006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1935121 1934387 gene locus_tag LOCUS_19500 1935121 1934387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879314.1 protein_id gnl|my_center|LOCUS_19500 1935723 1935118 gene locus_tag LOCUS_19510 1935723 1935118 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227534.1 protein_id gnl|my_center|LOCUS_19510 1936658 1935846 gene locus_tag LOCUS_19520 1936658 1935846 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730130.1 protein_id gnl|my_center|LOCUS_19520 1938000 1936780 gene locus_tag LOCUS_19530 1938000 1936780 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227558.1 protein_id gnl|my_center|LOCUS_19530 1940032 1938158 gene locus_tag LOCUS_19540 1940032 1938158 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906993.1 protein_id gnl|my_center|LOCUS_19540 1940690 1940124 gene locus_tag LOCUS_19550 1940690 1940124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1940994 1940605 gene locus_tag LOCUS_19560 1940994 1940605 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_19560 1940983 1941297 gene locus_tag LOCUS_19570 1940983 1941297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 1941647 1941844 gene locus_tag LOCUS_19580 1941647 1941844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 1942301 1941861 gene locus_tag LOCUS_19590 1942301 1941861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1942493 1942831 gene locus_tag LOCUS_19600 1942493 1942831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19600 1943732 1942902 gene locus_tag LOCUS_19610 1943732 1942902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 1945124 1946608 gene locus_tag LOCUS_19620 1945124 1946608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19620 1946626 1947957 gene locus_tag LOCUS_19630 1946626 1947957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19630 1948021 1948350 gene locus_tag LOCUS_19640 1948021 1948350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1948454 1949476 gene locus_tag LOCUS_19650 1948454 1949476 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900173.1 protein_id gnl|my_center|LOCUS_19650 1949524 1950348 gene locus_tag LOCUS_19660 1949524 1950348 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970233.1 protein_id gnl|my_center|LOCUS_19660 1950473 1951321 gene locus_tag LOCUS_19670 1950473 1951321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19670 1951242 1951454 gene locus_tag LOCUS_19680 1951242 1951454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19680 1951506 1952816 gene locus_tag LOCUS_19690 1951506 1952816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19690 1952884 1954386 gene locus_tag LOCUS_19700 1952884 1954386 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205766.1 protein_id gnl|my_center|LOCUS_19700 1954650 1955978 gene locus_tag LOCUS_19710 1954650 1955978 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402992.1 protein_id gnl|my_center|LOCUS_19710 1957132 1955963 gene locus_tag LOCUS_19720 1957132 1955963 CDS product FAD-binding domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898508.1 protein_id gnl|my_center|LOCUS_19720 1957203 1958321 gene locus_tag LOCUS_19730 gene galT 1957203 1958321 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015287872.1 protein_id gnl|my_center|LOCUS_19730 1958318 1959418 gene locus_tag LOCUS_19740 1958318 1959418 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403225.1 protein_id gnl|my_center|LOCUS_19740 1959625 1960521 gene locus_tag LOCUS_19750 1959625 1960521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19750 1964093 1960518 gene locus_tag LOCUS_19760 1964093 1960518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1964393 1965196 gene locus_tag LOCUS_19770 1964393 1965196 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877865.1 protein_id gnl|my_center|LOCUS_19770 1965773 1965207 gene locus_tag LOCUS_19780 1965773 1965207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1966077 1965688 gene locus_tag LOCUS_19790 1966077 1965688 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_19790 1968450 1966174 gene locus_tag LOCUS_19800 1968450 1966174 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715412.1 protein_id gnl|my_center|LOCUS_19800 1968556 1969329 gene locus_tag LOCUS_19810 1968556 1969329 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_19810 1970794 1969304 gene locus_tag LOCUS_19820 1970794 1969304 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918241.1 protein_id gnl|my_center|LOCUS_19820 1971371 1970886 gene locus_tag LOCUS_19830 1971371 1970886 CDS product mycobacterial cell wall protein Rv0580c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403017.1 protein_id gnl|my_center|LOCUS_19830 1972780 1971485 gene locus_tag LOCUS_19840 1972780 1971485 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409666.1 protein_id gnl|my_center|LOCUS_19840 1973673 1972984 gene locus_tag LOCUS_19850 1973673 1972984 CDS product LpqN/LpqT family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403052.1 protein_id gnl|my_center|LOCUS_19850 1973930 1974430 gene locus_tag LOCUS_19860 1973930 1974430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1975007 1974441 gene locus_tag LOCUS_19870 1975007 1974441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 1975311 1974922 gene locus_tag LOCUS_19880 1975311 1974922 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_19880 1975386 1977098 gene locus_tag LOCUS_19890 1975386 1977098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19890 1977013 1977384 gene locus_tag LOCUS_19900 1977013 1977384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19900 1978487 1977453 gene locus_tag LOCUS_19910 1978487 1977453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1978742 1978500 gene locus_tag LOCUS_19920 1978742 1978500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1981331 1978956 gene locus_tag LOCUS_19930 1981331 1978956 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900178.1 protein_id gnl|my_center|LOCUS_19930 1981993 1981427 gene locus_tag LOCUS_19940 1981993 1981427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19940 1982297 1981908 gene locus_tag LOCUS_19950 1982297 1981908 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_19950 1984124 1982361 gene locus_tag LOCUS_19960 gene recD 1984124 1982361 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727604.1 protein_id gnl|my_center|LOCUS_19960 1987453 1984121 gene locus_tag LOCUS_19970 gene recB 1987453 1984121 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727605.1 protein_id gnl|my_center|LOCUS_19970 1990752 1987453 gene locus_tag LOCUS_19980 gene recC 1990752 1987453 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877040.1 protein_id gnl|my_center|LOCUS_19980 1990803 1991318 gene locus_tag LOCUS_19990 1990803 1991318 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_19990 1991391 1991867 gene locus_tag LOCUS_20000 gene cynS 1991391 1991867 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082956.1 protein_id gnl|my_center|LOCUS_20000 1991890 1992894 gene locus_tag LOCUS_20010 1991890 1992894 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410214.1 protein_id gnl|my_center|LOCUS_20010 1993618 1992923 gene locus_tag LOCUS_20020 1993618 1992923 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403259.1 protein_id gnl|my_center|LOCUS_20020 1994002 1993700 gene locus_tag LOCUS_20030 1994002 1993700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20030 1994250 1993954 gene locus_tag LOCUS_20040 1994250 1993954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20040 1994556 1994284 gene locus_tag LOCUS_20050 1994556 1994284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20050 1995433 1994717 gene locus_tag LOCUS_20060 1995433 1994717 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403266.1 protein_id gnl|my_center|LOCUS_20060 1995544 1995753 gene locus_tag LOCUS_20070 1995544 1995753 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403268.1 protein_id gnl|my_center|LOCUS_20070 1995895 1995968 gene locus_tag LOCUS_t00160 1995895 1995968 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1996020 1996094 gene locus_tag LOCUS_t00170 1996020 1996094 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1996359 1996838 gene locus_tag LOCUS_20080 gene hadA 1996359 1996838 CDS product (3R)-hydroxyacyl-ACP dehydratase subunit HadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908608.1 protein_id gnl|my_center|LOCUS_20080 1996825 1997253 gene locus_tag LOCUS_20090 gene hadB 1996825 1997253 CDS product (3R)-hydroxyacyl-ACP dehydratase subunit HadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903106.1 protein_id gnl|my_center|LOCUS_20090 1997265 1997765 gene locus_tag LOCUS_20100 gene hadC 1997265 1997765 CDS product (3R)-hydroxyacyl-ACP dehydratase subunit HadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908606.1 protein_id gnl|my_center|LOCUS_20100 1997913 1997986 gene locus_tag LOCUS_t00180 1997913 1997986 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1998135 1998623 gene locus_tag LOCUS_20110 gene secE 1998135 1998623 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403284.1 protein_id gnl|my_center|LOCUS_20110 1998655 1999368 gene locus_tag LOCUS_20120 gene nusG 1998655 1999368 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403288.1 protein_id gnl|my_center|LOCUS_20120 1999415 1999843 gene locus_tag LOCUS_20130 gene rplK 1999415 1999843 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403291.1 protein_id gnl|my_center|LOCUS_20130 1999931 2000638 gene locus_tag LOCUS_20140 gene rplA 1999931 2000638 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892735.1 protein_id gnl|my_center|LOCUS_20140 2001950 2000724 gene locus_tag LOCUS_20150 2001950 2000724 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089001.1 protein_id gnl|my_center|LOCUS_20150 2002235 2001966 gene locus_tag LOCUS_20160 2002235 2001966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20160 2002167 2002589 gene locus_tag LOCUS_20170 2002167 2002589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 2003667 2002768 gene locus_tag LOCUS_20180 gene mmaA4 2003667 2002768 CDS product hydroxymycolate synthase MmaA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900195.1 protein_id gnl|my_center|LOCUS_20180 2004692 2003811 gene locus_tag LOCUS_20190 gene mmaA3 2004692 2003811 CDS product methoxy mycolic acid synthase MmaA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403302.1 protein_id gnl|my_center|LOCUS_20190 2005691 2004825 gene locus_tag LOCUS_20200 gene mmaA2 2005691 2004825 CDS product cyclopropane mycolic acid synthase MmaA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900985.1 protein_id gnl|my_center|LOCUS_20200 2006700 2005840 gene locus_tag LOCUS_20210 gene mmaA1 2006700 2005840 CDS product mycolic acid methyltransferase MmaA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403310.1 protein_id gnl|my_center|LOCUS_20210 2007745 2006864 gene locus_tag LOCUS_20220 gene lipG 2007745 2006864 CDS product lipase/esterase LipG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403314.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20220 2009140 2007755 gene locus_tag LOCUS_20230 2009140 2007755 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403317.1 protein_id gnl|my_center|LOCUS_20230 2010189 2009260 gene locus_tag LOCUS_20240 2010189 2009260 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112079.1 protein_id gnl|my_center|LOCUS_20240 2011649 2010240 gene locus_tag LOCUS_20250 2011649 2010240 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417900.1 protein_id gnl|my_center|LOCUS_20250 2011814 2015971 gene locus_tag LOCUS_20260 2011814 2015971 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003910172.1 protein_id gnl|my_center|LOCUS_20260 2015968 2016585 gene locus_tag LOCUS_20270 2015968 2016585 CDS product malonyl CoA-ACP transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403326.1 protein_id gnl|my_center|LOCUS_20270 2016592 2017500 gene locus_tag LOCUS_20280 2016592 2017500 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_20280 2018496 2017525 gene locus_tag LOCUS_20290 2018496 2017525 CDS product IS481-like element IS1649 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026842.1 protein_id gnl|my_center|LOCUS_20290 2019020 2020357 gene locus_tag LOCUS_20300 2019020 2020357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20300 2021136 2020546 gene locus_tag LOCUS_20310 2021136 2020546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2021033 2021251 gene locus_tag LOCUS_20320 2021033 2021251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2021404 2021976 gene locus_tag LOCUS_20330 2021404 2021976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2022351 2022971 gene locus_tag LOCUS_20340 gene rplJ 2022351 2022971 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403341.1 protein_id gnl|my_center|LOCUS_20340 2023049 2023441 gene locus_tag LOCUS_20350 gene rplL 2023049 2023441 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403353.1 protein_id gnl|my_center|LOCUS_20350 2024242 2023505 gene locus_tag LOCUS_20360 2024242 2023505 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403355.1 protein_id gnl|my_center|LOCUS_20360 2024375 2024884 gene locus_tag LOCUS_20370 2024375 2024884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20370 2024839 2025819 gene locus_tag LOCUS_20380 2024839 2025819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20380 2025998 2026984 gene locus_tag LOCUS_20390 2025998 2026984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403363.1 protein_id gnl|my_center|LOCUS_20390 2027727 2031107 gene locus_tag LOCUS_20400 2027727 2031107 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900992.1 protein_id gnl|my_center|LOCUS_20400 2031160 2035110 gene locus_tag LOCUS_20410 2031160 2035110 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403413.1 protein_id gnl|my_center|LOCUS_20410 2035771 2035992 gene locus_tag LOCUS_20420 2035771 2035992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2037906 2035993 gene locus_tag LOCUS_20430 2037906 2035993 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900995.1 protein_id gnl|my_center|LOCUS_20430 2038105 2038635 gene locus_tag LOCUS_20440 2038105 2038635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2038658 2038972 gene locus_tag LOCUS_20450 2038658 2038972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2039053 2039811 gene locus_tag LOCUS_20460 2039053 2039811 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403419.1 protein_id gnl|my_center|LOCUS_20460 2039876 2040724 gene locus_tag LOCUS_20470 2039876 2040724 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403421.1 protein_id gnl|my_center|LOCUS_20470 2040786 2042414 gene locus_tag LOCUS_20480 2040786 2042414 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403423.1 protein_id gnl|my_center|LOCUS_20480 2042423 2043361 gene locus_tag LOCUS_20490 2042423 2043361 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403426.1 protein_id gnl|my_center|LOCUS_20490 2043375 2044106 gene locus_tag LOCUS_20500 2043375 2044106 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403429.1 protein_id gnl|my_center|LOCUS_20500 2047827 2044735 gene locus_tag LOCUS_20510 gene mmpL5 2047827 2044735 CDS product siderophore RND transporter MmpL5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900997.1 protein_id gnl|my_center|LOCUS_20510 2048252 2047824 gene locus_tag LOCUS_20520 gene mmpS5 2048252 2047824 CDS product siderophore transporter accessory protein MmpS5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403439.1 protein_id gnl|my_center|LOCUS_20520 2048484 2048936 gene locus_tag LOCUS_20530 gene mmpR5 2048484 2048936 CDS product siderophore transport transcriptional regulator MmpR5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403442.1 protein_id gnl|my_center|LOCUS_20530 2049462 2048986 gene locus_tag LOCUS_20540 2049462 2048986 CDS product DUF3060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403446.1 protein_id gnl|my_center|LOCUS_20540 2049889 2049512 gene locus_tag LOCUS_20550 2049889 2049512 CDS product DUF3060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403448.1 protein_id gnl|my_center|LOCUS_20550 2050052 2050294 gene locus_tag LOCUS_20560 2050052 2050294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2050307 2051341 gene locus_tag LOCUS_20570 2050307 2051341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2051595 2052242 gene locus_tag LOCUS_20580 2051595 2052242 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403451.1 protein_id gnl|my_center|LOCUS_20580 2052618 2052992 gene locus_tag LOCUS_20590 gene rpsL 2052618 2052992 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007167812.1 protein_id gnl|my_center|LOCUS_20590 2052992 2053462 gene locus_tag LOCUS_20600 gene rpsG 2052992 2053462 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403456.1 protein_id gnl|my_center|LOCUS_20600 2053543 2055648 gene locus_tag LOCUS_20610 gene fusA 2053543 2055648 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908589.1 protein_id gnl|my_center|LOCUS_20610 2055835 2057025 gene locus_tag LOCUS_20620 gene tuf 2055835 2057025 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908588.1 protein_id gnl|my_center|LOCUS_20620 2057196 2058005 gene locus_tag LOCUS_20630 2057196 2058005 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403465.1 protein_id gnl|my_center|LOCUS_20630 2058172 2058966 gene locus_tag LOCUS_20640 2058172 2058966 CDS product Rv0687 family mycofactocin-dependent SDR oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403468.1 protein_id gnl|my_center|LOCUS_20640 2059009 2060214 gene locus_tag LOCUS_20650 2059009 2060214 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901000.1 protein_id gnl|my_center|LOCUS_20650 2060558 2060313 gene locus_tag LOCUS_20660 2060558 2060313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20660 2061374 2060622 gene locus_tag LOCUS_20670 2061374 2060622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20670 2061967 2061374 gene locus_tag LOCUS_20680 gene mftR 2061967 2061374 CDS product mycofactocin system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403482.1 protein_id gnl|my_center|LOCUS_20680 2062166 2062495 gene locus_tag LOCUS_20690 gene mftB 2062166 2062495 CDS product mycofactocin biosynthesis chaperone MftB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403486.1 protein_id gnl|my_center|LOCUS_20690 2062492 2063667 gene locus_tag LOCUS_20700 gene mftC 2062492 2063667 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403490.1 protein_id gnl|my_center|LOCUS_20700 2063670 2064842 gene locus_tag LOCUS_20710 gene mftD 2063670 2064842 CDS product mycofactocin biosynthesis FMN-dependent deaminase MftD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898557.1 protein_id gnl|my_center|LOCUS_20710 2065187 2065750 gene locus_tag LOCUS_20720 2065187 2065750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2065798 2067159 gene locus_tag LOCUS_20730 gene mftF 2065798 2067159 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403501.1 protein_id gnl|my_center|LOCUS_20730 2067168 2068604 gene locus_tag LOCUS_20740 gene mftG 2067168 2068604 CDS product mycofactocin system GMC family oxidoreductase MftG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403503.1 protein_id gnl|my_center|LOCUS_20740 2069229 2068594 gene locus_tag LOCUS_20750 2069229 2068594 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325826.1 protein_id gnl|my_center|LOCUS_20750 2069747 2069364 gene locus_tag LOCUS_20760 2069747 2069364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20760 2071275 2069863 gene locus_tag LOCUS_20770 2071275 2069863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20770 2071658 2071485 gene locus_tag LOCUS_20780 2071658 2071485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2073991 2073359 gene locus_tag LOCUS_20790 2073991 2073359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2074406 2074906 gene locus_tag LOCUS_20800 2074406 2074906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20800 2074922 2075413 gene locus_tag LOCUS_20810 2074922 2075413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20810 2076022 2077299 gene locus_tag LOCUS_20820 2076022 2077299 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112318.1 protein_id gnl|my_center|LOCUS_20820 2077232 2077552 gene locus_tag LOCUS_20830 2077232 2077552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2077843 2078148 gene locus_tag LOCUS_20840 gene rpsJ 2077843 2078148 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403578.1 protein_id gnl|my_center|LOCUS_20840 2078163 2078816 gene locus_tag LOCUS_20850 gene rplC 2078163 2078816 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403579.1 protein_id gnl|my_center|LOCUS_20850 2078816 2079490 gene locus_tag LOCUS_20860 gene rplD 2078816 2079490 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403580.1 protein_id gnl|my_center|LOCUS_20860 2079490 2079792 gene locus_tag LOCUS_20870 gene rplW 2079490 2079792 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403581.1 protein_id gnl|my_center|LOCUS_20870 2079822 2080664 gene locus_tag LOCUS_20880 gene rplB 2079822 2080664 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403582.1 protein_id gnl|my_center|LOCUS_20880 2080686 2080967 gene locus_tag LOCUS_20890 gene rpsS 2080686 2080967 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055647.1 protein_id gnl|my_center|LOCUS_20890 2080964 2081521 gene locus_tag LOCUS_20900 gene rplV 2080964 2081521 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908581.1 protein_id gnl|my_center|LOCUS_20900 2081521 2082348 gene locus_tag LOCUS_20910 gene rpsC 2081521 2082348 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403590.1 protein_id gnl|my_center|LOCUS_20910 2082352 2082768 gene locus_tag LOCUS_20920 gene rplP 2082352 2082768 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403592.1 protein_id gnl|my_center|LOCUS_20920 2082768 2083010 gene locus_tag LOCUS_20930 gene rpmC 2082768 2083010 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323024.1 protein_id gnl|my_center|LOCUS_20930 2083010 2083369 gene locus_tag LOCUS_20940 gene rpsQ 2083010 2083369 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898560.1 protein_id gnl|my_center|LOCUS_20940 2084054 2083440 gene locus_tag LOCUS_20950 2084054 2083440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2084121 2085452 gene locus_tag LOCUS_20960 2084121 2085452 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640087.1 protein_id gnl|my_center|LOCUS_20960 2085556 2087379 gene locus_tag LOCUS_20970 gene atsA 2085556 2087379 CDS product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898561.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20970 2087426 2087914 gene locus_tag LOCUS_20980 2087426 2087914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20980 2087931 2088572 gene locus_tag LOCUS_20990 2087931 2088572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2088577 2089458 gene locus_tag LOCUS_21000 2088577 2089458 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403610.1 protein_id gnl|my_center|LOCUS_21000 2089588 2090004 gene locus_tag LOCUS_21010 2089588 2090004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21010 2089980 2090525 gene locus_tag LOCUS_21020 2089980 2090525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21020 2090776 2091144 gene locus_tag LOCUS_21030 gene rplN 2090776 2091144 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403649.1 protein_id gnl|my_center|LOCUS_21030 2091145 2091468 gene locus_tag LOCUS_21040 gene rplX 2091145 2091468 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403654.1 protein_id gnl|my_center|LOCUS_21040 2091465 2092037 gene locus_tag LOCUS_21050 gene rplE 2091465 2092037 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403660.1 protein_id gnl|my_center|LOCUS_21050 2092042 2092227 gene locus_tag LOCUS_21060 2092042 2092227 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908573.1 protein_id gnl|my_center|LOCUS_21060 2092304 2092702 gene locus_tag LOCUS_21070 gene rpsH 2092304 2092702 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403669.1 protein_id gnl|my_center|LOCUS_21070 2092713 2093252 gene locus_tag LOCUS_21080 gene rplF 2092713 2093252 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403673.1 protein_id gnl|my_center|LOCUS_21080 2093255 2093662 gene locus_tag LOCUS_21090 gene rplR 2093255 2093662 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104567.1 protein_id gnl|my_center|LOCUS_21090 2093700 2094374 gene locus_tag LOCUS_21100 gene rpsE 2093700 2094374 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403680.1 protein_id gnl|my_center|LOCUS_21100 2094371 2094589 gene locus_tag LOCUS_21110 gene rpmD 2094371 2094589 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403683.1 protein_id gnl|my_center|LOCUS_21110 2094586 2095026 gene locus_tag LOCUS_21120 gene rplO 2094586 2095026 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403685.1 protein_id gnl|my_center|LOCUS_21120 2095813 2095094 gene locus_tag LOCUS_21130 2095813 2095094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21130 2096108 2097910 gene locus_tag LOCUS_21140 gene sppA 2096108 2097910 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898564.1 protein_id gnl|my_center|LOCUS_21140 2098821 2097907 gene locus_tag LOCUS_21150 2098821 2097907 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408497.1 protein_id gnl|my_center|LOCUS_21150 2099743 2098841 gene locus_tag LOCUS_21160 2099743 2098841 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892867.1 protein_id gnl|my_center|LOCUS_21160 2100714 2099740 gene locus_tag LOCUS_21170 2100714 2099740 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403691.1 protein_id gnl|my_center|LOCUS_21170 2100943 2101716 gene locus_tag LOCUS_21180 2100943 2101716 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172835.1 protein_id gnl|my_center|LOCUS_21180 2101713 2102207 gene locus_tag LOCUS_21190 2101713 2102207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21190 2102211 2102945 gene locus_tag LOCUS_21200 2102211 2102945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21200 2103634 2102954 gene locus_tag LOCUS_21210 2103634 2102954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2103690 2104568 gene locus_tag LOCUS_21220 2103690 2104568 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_21220 2105248 2104592 gene locus_tag LOCUS_21230 2105248 2104592 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403695.1 protein_id gnl|my_center|LOCUS_21230 2106162 2105245 gene locus_tag LOCUS_21240 gene serA 2106162 2105245 CDS product D-3-phosphoglycerate dehydrogenase SerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403698.1 protein_id gnl|my_center|LOCUS_21240 2106256 2107623 gene locus_tag LOCUS_21250 2106256 2107623 CDS product D-xylulose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900204.1 protein_id gnl|my_center|LOCUS_21250 2107642 2108436 gene locus_tag LOCUS_21260 2107642 2108436 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403710.1 protein_id gnl|my_center|LOCUS_21260 2109058 2108492 gene locus_tag LOCUS_21270 2109058 2108492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21270 2110365 2109415 gene locus_tag LOCUS_21280 2110365 2109415 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403717.1 protein_id gnl|my_center|LOCUS_21280 2110632 2111957 gene locus_tag LOCUS_21290 gene secY 2110632 2111957 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403723.1 protein_id gnl|my_center|LOCUS_21290 2111954 2112499 gene locus_tag LOCUS_21300 2111954 2112499 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403726.1 protein_id gnl|my_center|LOCUS_21300 2112502 2113302 gene locus_tag LOCUS_21310 gene map 2112502 2113302 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403728.1 protein_id gnl|my_center|LOCUS_21310 2113397 2113888 gene locus_tag LOCUS_21320 gene sigL 2113397 2113888 CDS product sigma-70 family RNA polymerase sigma factor SigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403731.1 protein_id gnl|my_center|LOCUS_21320 2113967 2114713 gene locus_tag LOCUS_21330 gene rslA 2113967 2114713 CDS product anti-sigma-L factor RslA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403733.1 protein_id gnl|my_center|LOCUS_21330 2114800 2115300 gene locus_tag LOCUS_21340 2114800 2115300 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403738.1 protein_id gnl|my_center|LOCUS_21340 2115324 2115869 gene locus_tag LOCUS_21350 2115324 2115869 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403741.1 protein_id gnl|my_center|LOCUS_21350 2116766 2115882 gene locus_tag LOCUS_21360 gene mmsB 2116766 2115882 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403844.1 protein_id gnl|my_center|LOCUS_21360 2117951 2116779 gene locus_tag LOCUS_21370 2117951 2116779 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403845.1 protein_id gnl|my_center|LOCUS_21370 2119477 2117957 gene locus_tag LOCUS_21380 2119477 2117957 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403847.1 protein_id gnl|my_center|LOCUS_21380 2121237 2119657 gene locus_tag LOCUS_21390 2121237 2119657 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027955.1 protein_id gnl|my_center|LOCUS_21390 2121447 2121836 gene locus_tag LOCUS_21400 2121447 2121836 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_21400 2121751 2122317 gene locus_tag LOCUS_21410 2121751 2122317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2122933 2122328 gene locus_tag LOCUS_21420 gene rfbC 2122933 2122328 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418610.1 protein_id gnl|my_center|LOCUS_21420 2123930 2122935 gene locus_tag LOCUS_21430 gene rfbB 2123930 2122935 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418607.1 protein_id gnl|my_center|LOCUS_21430 2124176 2123940 gene locus_tag LOCUS_21440 2124176 2123940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21440 2124818 2124213 gene locus_tag LOCUS_21450 2124818 2124213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21450 2125741 2124845 gene locus_tag LOCUS_21460 2125741 2124845 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418604.1 protein_id gnl|my_center|LOCUS_21460 2126904 2125870 gene locus_tag LOCUS_21470 2126904 2125870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 2127132 2126917 gene locus_tag LOCUS_21480 2127132 2126917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2127431 2127652 gene locus_tag LOCUS_21490 gene infA 2127431 2127652 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418601.1 protein_id gnl|my_center|LOCUS_21490 2127990 2128364 gene locus_tag LOCUS_21500 gene rpsM 2127990 2128364 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908646.1 protein_id gnl|my_center|LOCUS_21500 2128368 2128784 gene locus_tag LOCUS_21510 gene rpsK 2128368 2128784 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908645.1 protein_id gnl|my_center|LOCUS_21510 2128809 2129414 gene locus_tag LOCUS_21520 gene rpsD 2128809 2129414 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418354.1 protein_id gnl|my_center|LOCUS_21520 2129500 2130543 gene locus_tag LOCUS_21530 2129500 2130543 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418351.1 protein_id gnl|my_center|LOCUS_21530 2130604 2131176 gene locus_tag LOCUS_21540 gene rplQ 2130604 2131176 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418346.1 protein_id gnl|my_center|LOCUS_21540 2131292 2132017 gene locus_tag LOCUS_21550 gene truA 2131292 2132017 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418344.1 protein_id gnl|my_center|LOCUS_21550 2132677 2132033 gene locus_tag LOCUS_21560 2132677 2132033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21560 2133438 2132746 gene locus_tag LOCUS_21570 2133438 2132746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21570 2134932 2133790 gene locus_tag LOCUS_21580 2134932 2133790 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408416.1 protein_id gnl|my_center|LOCUS_21580 2136146 2134998 gene locus_tag LOCUS_21590 2136146 2134998 CDS product type VII secretion system ESX-5 target PPE25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950601.1 protein_id gnl|my_center|LOCUS_21590 2137975 2136317 gene locus_tag LOCUS_21600 2137975 2136317 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950891.1 protein_id gnl|my_center|LOCUS_21600 2138520 2138188 gene locus_tag LOCUS_21610 2138520 2138188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2139565 2138954 gene locus_tag LOCUS_21620 gene cut4 2139565 2138954 CDS product cutinase Cut4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418339.1 protein_id gnl|my_center|LOCUS_21620 2140484 2139681 gene locus_tag LOCUS_21630 2140484 2139681 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418336.1 protein_id gnl|my_center|LOCUS_21630 2140598 2141752 gene locus_tag LOCUS_21640 gene eccB4 2140598 2141752 CDS product type VII secretion system ESX-4 subunit EccB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418333.1 protein_id gnl|my_center|LOCUS_21640 2142315 2141749 gene locus_tag LOCUS_21650 2142315 2141749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2142619 2142230 gene locus_tag LOCUS_21660 2142619 2142230 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_21660 2143782 2143105 gene locus_tag LOCUS_21670 2143782 2143105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 2144252 2143779 gene locus_tag LOCUS_21680 2144252 2143779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2144929 2145318 gene locus_tag LOCUS_21690 2144929 2145318 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_21690 2145233 2145799 gene locus_tag LOCUS_21700 2145233 2145799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2146245 2145796 gene locus_tag LOCUS_21710 2146245 2145796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2147189 2146884 gene locus_tag LOCUS_21720 gene esxJ 2147189 2146884 CDS product type VII secretion system ESX-5 protein EsxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421604.1 protein_id gnl|my_center|LOCUS_21720 2147313 2147570 gene locus_tag LOCUS_21730 2147313 2147570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2147985 2148179 gene locus_tag LOCUS_21740 2147985 2148179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2148192 2148413 gene locus_tag LOCUS_21750 2148192 2148413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2148806 2149132 gene locus_tag LOCUS_21760 2148806 2149132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2149803 2149372 gene locus_tag LOCUS_21770 2149803 2149372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2150565 2151350 gene locus_tag LOCUS_21780 2150565 2151350 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325634.1 protein_id gnl|my_center|LOCUS_21780 2151425 2152126 gene locus_tag LOCUS_21790 2151425 2152126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2152689 2152123 gene locus_tag LOCUS_21800 2152689 2152123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21800 2152993 2152604 gene locus_tag LOCUS_21810 2152993 2152604 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_21810 2153652 2154320 gene locus_tag LOCUS_21820 2153652 2154320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 2154726 2155253 gene locus_tag LOCUS_21830 2154726 2155253 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950452.1 protein_id gnl|my_center|LOCUS_21830 2155406 2155795 gene locus_tag LOCUS_21840 2155406 2155795 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_21840 2155710 2156276 gene locus_tag LOCUS_21850 2155710 2156276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21850 2156230 2156658 gene locus_tag LOCUS_21860 2156230 2156658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2157858 2156548 gene locus_tag LOCUS_21870 gene mycP4 2157858 2156548 CDS product type VII secretion system ESX-4 serine protease mycosin MycP4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418331.1 protein_id gnl|my_center|LOCUS_21870 2159300 2157918 gene locus_tag LOCUS_21880 gene eccD4 2159300 2157918 CDS product type VII secretion system ESX-4 subunit EccD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900062.1 protein_id gnl|my_center|LOCUS_21880 2159415 2160170 gene locus_tag LOCUS_21890 2159415 2160170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21890 2160207 2161286 gene locus_tag LOCUS_21900 2160207 2161286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21900 2161169 2161573 gene locus_tag LOCUS_21910 2161169 2161573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21910 2161515 2163092 gene locus_tag LOCUS_21920 2161515 2163092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21920 2163089 2164333 gene locus_tag LOCUS_21930 2163089 2164333 CDS product type VII secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418324.1 protein_id gnl|my_center|LOCUS_21930 2164390 2164749 gene locus_tag LOCUS_21940 gene esxU 2164390 2164749 CDS product type VII secretion system ESX-4 protein EsxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900060.1 protein_id gnl|my_center|LOCUS_21940 2164765 2165061 gene locus_tag LOCUS_21950 2164765 2165061 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900059.1 protein_id gnl|my_center|LOCUS_21950 2165300 2165743 gene locus_tag LOCUS_21960 gene rplM 2165300 2165743 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418312.1 protein_id gnl|my_center|LOCUS_21960 2165740 2166198 gene locus_tag LOCUS_21970 gene rpsI 2165740 2166198 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907685.1 protein_id gnl|my_center|LOCUS_21970 2166349 2167686 gene locus_tag LOCUS_21980 gene glmM 2166349 2167686 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418304.1 protein_id gnl|my_center|LOCUS_21980 2167792 2168103 gene locus_tag LOCUS_21990 2167792 2168103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418301.1 protein_id gnl|my_center|LOCUS_21990 2168106 2169503 gene locus_tag LOCUS_22000 2168106 2169503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418300.1 protein_id gnl|my_center|LOCUS_22000 2170576 2169530 gene locus_tag LOCUS_22010 2170576 2169530 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054881081.1 protein_id gnl|my_center|LOCUS_22010 2171428 2170589 gene locus_tag LOCUS_22020 2171428 2170589 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418298.1 protein_id gnl|my_center|LOCUS_22020 2171899 2171438 gene locus_tag LOCUS_22030 2171899 2171438 CDS product DUF2510 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900057.1 protein_id gnl|my_center|LOCUS_22030 2171991 2173898 gene locus_tag LOCUS_22040 gene glmS 2171991 2173898 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418289.1 protein_id gnl|my_center|LOCUS_22040 2173963 2174805 gene locus_tag LOCUS_22050 2173963 2174805 CDS product DUF4436 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901640.1 protein_id gnl|my_center|LOCUS_22050 2174824 2175570 gene locus_tag LOCUS_22060 2174824 2175570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418284.1 protein_id gnl|my_center|LOCUS_22060 2175589 2177022 gene locus_tag LOCUS_22070 2175589 2177022 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418280.1 protein_id gnl|my_center|LOCUS_22070 2177059 2178444 gene locus_tag LOCUS_22080 2177059 2178444 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418277.1 protein_id gnl|my_center|LOCUS_22080 2178530 2179696 gene locus_tag LOCUS_22090 gene alr 2178530 2179696 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023637501.1 protein_id gnl|my_center|LOCUS_22090 2179686 2180807 gene locus_tag LOCUS_22100 2179686 2180807 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250368.1 protein_id gnl|my_center|LOCUS_22100 2180800 2181270 gene locus_tag LOCUS_22110 gene tsaE 2180800 2181270 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418042.1 protein_id gnl|my_center|LOCUS_22110 2181267 2181893 gene locus_tag LOCUS_22120 gene tsaB 2181267 2181893 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418038.1 protein_id gnl|my_center|LOCUS_22120 2181890 2182366 gene locus_tag LOCUS_22130 gene rimI 2181890 2182366 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418034.1 protein_id gnl|my_center|LOCUS_22130 2182367 2183398 gene locus_tag LOCUS_22140 gene tsaD 2182367 2183398 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900052.1 protein_id gnl|my_center|LOCUS_22140 2183712 2184014 gene locus_tag LOCUS_22150 gene groES 2183712 2184014 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418028.1 protein_id gnl|my_center|LOCUS_22150 2184107 2185726 gene locus_tag LOCUS_22160 gene groL 2184107 2185726 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418021.1 protein_id gnl|my_center|LOCUS_22160 2185977 2186591 gene locus_tag LOCUS_22170 2185977 2186591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22170 2186506 2187198 gene locus_tag LOCUS_22180 2186506 2187198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22180 2187775 2187209 gene locus_tag LOCUS_22190 2187775 2187209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2188079 2187690 gene locus_tag LOCUS_22200 2188079 2187690 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_22200 2188410 2188129 gene locus_tag LOCUS_22210 2188410 2188129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 2189360 2188872 gene locus_tag LOCUS_22220 2189360 2188872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22220 2190391 2189279 gene locus_tag LOCUS_22230 2190391 2189279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22230 2190312 2190605 gene locus_tag LOCUS_22240 2190312 2190605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2192709 2191135 gene locus_tag LOCUS_22250 2192709 2191135 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419334.1 protein_id gnl|my_center|LOCUS_22250 2193087 2194742 gene locus_tag LOCUS_22260 2193087 2194742 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066137.1 protein_id gnl|my_center|LOCUS_22260 2195097 2194789 gene locus_tag LOCUS_22270 2195097 2194789 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907698.1 protein_id gnl|my_center|LOCUS_22270 2195636 2196508 gene locus_tag LOCUS_22280 2195636 2196508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618307.1 protein_id gnl|my_center|LOCUS_22280 2196602 2197177 gene locus_tag LOCUS_22290 gene sigD 2196602 2197177 CDS product ECF RNA polymerase sigma factor SigD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418013.1 protein_id gnl|my_center|LOCUS_22290 2197170 2198216 gene locus_tag LOCUS_22300 2197170 2198216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2198690 2198277 gene locus_tag LOCUS_22310 2198690 2198277 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907700.1 protein_id gnl|my_center|LOCUS_22310 2198854 2200452 gene locus_tag LOCUS_22320 gene guaB 2198854 2200452 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900682.1 protein_id gnl|my_center|LOCUS_22320 2200459 2201589 gene locus_tag LOCUS_22330 2200459 2201589 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418005.1 protein_id gnl|my_center|LOCUS_22330 2201805 2203631 gene locus_tag LOCUS_22340 2201805 2203631 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950840.1 protein_id gnl|my_center|LOCUS_22340 2203720 2205465 gene locus_tag LOCUS_22350 gene choD 2203720 2205465 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418002.1 protein_id gnl|my_center|LOCUS_22350 2205951 2205487 gene locus_tag LOCUS_22360 2205951 2205487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22360 2206383 2206111 gene locus_tag LOCUS_22370 2206383 2206111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22370 2206498 2207019 gene locus_tag LOCUS_22380 2206498 2207019 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417984.1 protein_id gnl|my_center|LOCUS_22380 2209389 2207005 gene locus_tag LOCUS_22390 2209389 2207005 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900047.1 protein_id gnl|my_center|LOCUS_22390 2210126 2209386 gene locus_tag LOCUS_22400 2210126 2209386 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417961.1 protein_id gnl|my_center|LOCUS_22400 2210714 2210319 gene locus_tag LOCUS_22410 2210714 2210319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 2210765 2211382 gene locus_tag LOCUS_22420 2210765 2211382 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086850.1 protein_id gnl|my_center|LOCUS_22420 2212866 2211379 gene locus_tag LOCUS_22430 2212866 2211379 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811563.1 protein_id gnl|my_center|LOCUS_22430 2213014 2213697 gene locus_tag LOCUS_22440 2213014 2213697 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972704.1 protein_id gnl|my_center|LOCUS_22440 2213812 2215353 gene locus_tag LOCUS_22450 gene guaA 2213812 2215353 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417952.1 protein_id gnl|my_center|LOCUS_22450 2216095 2215421 gene locus_tag LOCUS_22460 2216095 2215421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417950.1 protein_id gnl|my_center|LOCUS_22460 2216218 2216877 gene locus_tag LOCUS_22470 2216218 2216877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900043.1 protein_id gnl|my_center|LOCUS_22470 2216926 2218455 gene locus_tag LOCUS_22480 2216926 2218455 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900042.1 protein_id gnl|my_center|LOCUS_22480 2219441 2218491 gene locus_tag LOCUS_22490 gene iunH 2219441 2218491 CDS product nucleoside hydrolase IunH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417946.1 protein_id gnl|my_center|LOCUS_22490 2221498 2219486 gene locus_tag LOCUS_22500 2221498 2219486 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417940.1 protein_id gnl|my_center|LOCUS_22500 2222251 2221538 gene locus_tag LOCUS_22510 2222251 2221538 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417932.1 protein_id gnl|my_center|LOCUS_22510 2222346 2223218 gene locus_tag LOCUS_22520 gene htdY 2222346 2223218 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 protein_id gnl|my_center|LOCUS_22520 2224404 2223232 gene locus_tag LOCUS_22530 gene otsB 2224404 2223232 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417892.1 protein_id gnl|my_center|LOCUS_22530 2225790 2224456 gene locus_tag LOCUS_22540 2225790 2224456 CDS product diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417889.1 protein_id gnl|my_center|LOCUS_22540 2225986 2229288 gene locus_tag LOCUS_22550 gene dnaE2 2225986 2229288 CDS product error-prone DNA polymerase DnaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417885.1 protein_id gnl|my_center|LOCUS_22550 2229774 2229364 gene locus_tag LOCUS_22560 2229774 2229364 CDS product TIGR03667 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417882.1 protein_id gnl|my_center|LOCUS_22560 2229807 2230451 gene locus_tag LOCUS_22570 2229807 2230451 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417881.1 protein_id gnl|my_center|LOCUS_22570 2232121 2230463 gene locus_tag LOCUS_22580 2232121 2230463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2232775 2232311 gene locus_tag LOCUS_22590 2232775 2232311 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417878.1 protein_id gnl|my_center|LOCUS_22590 2232843 2233448 gene locus_tag LOCUS_22600 2232843 2233448 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729062.1 protein_id gnl|my_center|LOCUS_22600 2233671 2236400 gene locus_tag LOCUS_22610 2233671 2236400 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900676.1 protein_id gnl|my_center|LOCUS_22610 2236397 2236828 gene locus_tag LOCUS_22620 2236397 2236828 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417776.1 protein_id gnl|my_center|LOCUS_22620 2236804 2237190 gene locus_tag LOCUS_22630 2236804 2237190 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417772.1 protein_id gnl|my_center|LOCUS_22630 2237171 2237773 gene locus_tag LOCUS_22640 2237171 2237773 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417769.1 protein_id gnl|my_center|LOCUS_22640 2237770 2238330 gene locus_tag LOCUS_22650 gene mfpA 2237770 2238330 CDS product pentapeptide repeat protein MfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417767.1 protein_id gnl|my_center|LOCUS_22650 2239019 2239600 gene locus_tag LOCUS_22660 2239019 2239600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22660 2239530 2240027 gene locus_tag LOCUS_22670 2239530 2240027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22670 2240052 2240966 gene locus_tag LOCUS_22680 2240052 2240966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22680 2241004 2243451 gene locus_tag LOCUS_22690 2241004 2243451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2243492 2244757 gene locus_tag LOCUS_22700 2243492 2244757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 2247326 2244801 gene locus_tag LOCUS_22710 2247326 2244801 CDS product ATP transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408545.1 protein_id gnl|my_center|LOCUS_22710 2248562 2247351 gene locus_tag LOCUS_22720 2248562 2247351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22720 2249998 2248526 gene locus_tag LOCUS_22730 2249998 2248526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22730 2250315 2250115 gene locus_tag LOCUS_22740 2250315 2250115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2251550 2250357 gene locus_tag LOCUS_22750 2251550 2250357 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900033.1 protein_id gnl|my_center|LOCUS_22750 2251658 2252503 gene locus_tag LOCUS_22760 2251658 2252503 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417751.1 protein_id gnl|my_center|LOCUS_22760 2252500 2252793 gene locus_tag LOCUS_22770 2252500 2252793 CDS product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417749.1 protein_id gnl|my_center|LOCUS_22770 2253036 2252797 gene locus_tag LOCUS_22780 2253036 2252797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22780 2253213 2253040 gene locus_tag LOCUS_22790 2253213 2253040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2253467 2254909 gene locus_tag LOCUS_22800 2253467 2254909 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901784.1 protein_id gnl|my_center|LOCUS_22800 2255158 2256024 gene locus_tag LOCUS_22810 2255158 2256024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22810 2256035 2256661 gene locus_tag LOCUS_22820 2256035 2256661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22820 2256725 2258257 gene locus_tag LOCUS_22830 2256725 2258257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22830 2258357 2259367 gene locus_tag LOCUS_22840 2258357 2259367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22840 2260087 2260917 gene locus_tag LOCUS_22850 2260087 2260917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22850 2261134 2264946 gene locus_tag LOCUS_22860 2261134 2264946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2265282 2264986 gene locus_tag LOCUS_22870 2265282 2264986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 2265691 2265344 gene locus_tag LOCUS_22880 2265691 2265344 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084922.1 protein_id gnl|my_center|LOCUS_22880 2265884 2266273 gene locus_tag LOCUS_22890 2265884 2266273 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_22890 2266188 2266754 gene locus_tag LOCUS_22900 2266188 2266754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2267502 2266765 gene locus_tag LOCUS_22910 2267502 2266765 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417461.1 protein_id gnl|my_center|LOCUS_22910 2268635 2267496 gene locus_tag LOCUS_22920 2268635 2267496 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417458.1 protein_id gnl|my_center|LOCUS_22920 2269996 2268647 gene locus_tag LOCUS_22930 2269996 2268647 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900028.1 protein_id gnl|my_center|LOCUS_22930 2270311 2271231 gene locus_tag LOCUS_22940 2270311 2271231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22940 2272348 2271548 gene locus_tag LOCUS_22950 2272348 2271548 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044081650.1 protein_id gnl|my_center|LOCUS_22950 2272506 2273525 gene locus_tag LOCUS_22960 gene trpS 2272506 2273525 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417440.1 protein_id gnl|my_center|LOCUS_22960 2273608 2274558 gene locus_tag LOCUS_22970 gene yhjD 2273608 2274558 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417435.1 protein_id gnl|my_center|LOCUS_22970 2275721 2274555 gene locus_tag LOCUS_22980 gene nagA 2275721 2274555 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417418.1 protein_id gnl|my_center|LOCUS_22980 2277067 2275718 gene locus_tag LOCUS_22990 2277067 2275718 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886161.1 protein_id gnl|my_center|LOCUS_22990 2278516 2277269 gene locus_tag LOCUS_23000 gene dacB1 2278516 2277269 CDS product D-alanyl-D-alanine carboxypeptidase DacB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417415.1 protein_id gnl|my_center|LOCUS_23000 2278638 2279276 gene locus_tag LOCUS_23010 2278638 2279276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 2279266 2281584 gene locus_tag LOCUS_23020 2279266 2281584 CDS product VIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122418.1 protein_id gnl|my_center|LOCUS_23020 2281829 2281605 gene locus_tag LOCUS_23030 2281829 2281605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 2282095 2281730 gene locus_tag LOCUS_23040 2282095 2281730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2283602 2282085 gene locus_tag LOCUS_23050 2283602 2282085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23050 2283853 2283602 gene locus_tag LOCUS_23060 2283853 2283602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2284175 2283924 gene locus_tag LOCUS_23070 2284175 2283924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2284714 2284085 gene locus_tag LOCUS_23080 2284714 2284085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23080 2284998 2285474 gene locus_tag LOCUS_23090 2284998 2285474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23090 2285384 2285959 gene locus_tag LOCUS_23100 2285384 2285959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23100 2286536 2285970 gene locus_tag LOCUS_23110 2286536 2285970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2286840 2286451 gene locus_tag LOCUS_23120 2286840 2286451 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_23120 2287545 2286946 gene locus_tag LOCUS_23130 2287545 2286946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2287648 2288091 gene locus_tag LOCUS_23140 2287648 2288091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211698133.1 protein_id gnl|my_center|LOCUS_23140 2288305 2290008 gene locus_tag LOCUS_23150 2288305 2290008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 2290832 2290020 gene locus_tag LOCUS_23160 2290832 2290020 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417279.1 protein_id gnl|my_center|LOCUS_23160 2292559 2290832 gene locus_tag LOCUS_23170 gene sdhA 2292559 2290832 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727811.1 protein_id gnl|my_center|LOCUS_23170 2293082 2292615 gene locus_tag LOCUS_23180 2293082 2292615 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417269.1 protein_id gnl|my_center|LOCUS_23180 2293657 2293079 gene locus_tag LOCUS_23190 gene sdhC 2293657 2293079 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907882.1 protein_id gnl|my_center|LOCUS_23190 2293721 2294119 gene locus_tag LOCUS_23200 2293721 2294119 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417264.1 protein_id gnl|my_center|LOCUS_23200 2294116 2295417 gene locus_tag LOCUS_23210 2294116 2295417 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900016.1 protein_id gnl|my_center|LOCUS_23210 2295414 2296502 gene locus_tag LOCUS_23220 2295414 2296502 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417259.1 protein_id gnl|my_center|LOCUS_23220 2296615 2297586 gene locus_tag LOCUS_23230 2296615 2297586 CDS product IS481-like element IS1649 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026842.1 protein_id gnl|my_center|LOCUS_23230 2298417 2297611 gene locus_tag LOCUS_23240 gene cmrA 2298417 2297611 CDS product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412799.1 protein_id gnl|my_center|LOCUS_23240 2298513 2299841 gene locus_tag LOCUS_23250 2298513 2299841 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412798.1 protein_id gnl|my_center|LOCUS_23250 2300629 2299838 gene locus_tag LOCUS_23260 2300629 2299838 CDS product MmpS family transport accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412795.1 protein_id gnl|my_center|LOCUS_23260 2301495 2300860 gene locus_tag LOCUS_23270 2301495 2300860 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412790.1 protein_id gnl|my_center|LOCUS_23270 2301600 2303243 gene locus_tag LOCUS_23280 2301600 2303243 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899357.1 protein_id gnl|my_center|LOCUS_23280 2303364 2304110 gene locus_tag LOCUS_23290 2303364 2304110 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412786.1 protein_id gnl|my_center|LOCUS_23290 2304160 2304807 gene locus_tag LOCUS_23300 2304160 2304807 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412782.1 protein_id gnl|my_center|LOCUS_23300 2304804 2306384 gene locus_tag LOCUS_23310 2304804 2306384 CDS product acetyl-/propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412778.1 protein_id gnl|my_center|LOCUS_23310 2306388 2308397 gene locus_tag LOCUS_23320 2306388 2308397 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899356.1 protein_id gnl|my_center|LOCUS_23320 2308404 2309570 gene locus_tag LOCUS_23330 2308404 2309570 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412771.1 protein_id gnl|my_center|LOCUS_23330 2309567 2310073 gene locus_tag LOCUS_23340 2309567 2310073 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412768.1 protein_id gnl|my_center|LOCUS_23340 2310070 2310891 gene locus_tag LOCUS_23350 gene citE 2310070 2310891 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412766.1 protein_id gnl|my_center|LOCUS_23350 2311231 2312322 gene locus_tag LOCUS_23360 gene pdhA 2311231 2312322 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412761.1 protein_id gnl|my_center|LOCUS_23360 2312333 2313379 gene locus_tag LOCUS_23370 gene bkdB 2312333 2313379 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950730.1 protein_id gnl|my_center|LOCUS_23370 2313376 2314545 gene locus_tag LOCUS_23380 2313376 2314545 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950729.1 protein_id gnl|my_center|LOCUS_23380 2314863 2315732 gene locus_tag LOCUS_23390 gene mmaA2 2314863 2315732 CDS product cyclopropane mycolic acid synthase MmaA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900985.1 protein_id gnl|my_center|LOCUS_23390 2315933 2315751 gene locus_tag LOCUS_23400 2315933 2315751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23400 2316562 2316380 gene locus_tag LOCUS_23410 2316562 2316380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23410 2316816 2316511 gene locus_tag LOCUS_23420 2316816 2316511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23420 2317493 2318968 gene locus_tag LOCUS_23430 2317493 2318968 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899877.1 protein_id gnl|my_center|LOCUS_23430 2320182 2319796 gene locus_tag LOCUS_23440 2320182 2319796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23440 2320121 2320309 gene locus_tag LOCUS_23450 2320121 2320309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 2320640 2320564 gene locus_tag LOCUS_t00190 2320640 2320564 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2320878 2322080 gene locus_tag LOCUS_23460 2320878 2322080 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412725.1 protein_id gnl|my_center|LOCUS_23460 2322292 2323776 gene locus_tag LOCUS_23470 2322292 2323776 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412717.1 protein_id gnl|my_center|LOCUS_23470 2323773 2325632 gene locus_tag LOCUS_23480 2323773 2325632 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412713.1 protein_id gnl|my_center|LOCUS_23480 2325629 2327995 gene locus_tag LOCUS_23490 2325629 2327995 CDS product glycerol-3-phosphate 1-O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950725.1 protein_id gnl|my_center|LOCUS_23490 2328982 2328053 gene locus_tag LOCUS_23500 2328982 2328053 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891479.1 protein_id gnl|my_center|LOCUS_23500 2329279 2329061 gene locus_tag LOCUS_23510 2329279 2329061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 2329596 2330114 gene locus_tag LOCUS_23520 2329596 2330114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2330182 2331858 gene locus_tag LOCUS_23530 gene ettA 2330182 2331858 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412708.1 protein_id gnl|my_center|LOCUS_23530 2332088 2332297 gene locus_tag LOCUS_23540 2332088 2332297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23540 2332212 2332778 gene locus_tag LOCUS_23550 2332212 2332778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2332899 2337737 gene locus_tag LOCUS_23560 2332899 2337737 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003910563.1 protein_id gnl|my_center|LOCUS_23560 2337734 2338150 gene locus_tag LOCUS_23570 2337734 2338150 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412703.1 protein_id gnl|my_center|LOCUS_23570 2338147 2338809 gene locus_tag LOCUS_23580 2338147 2338809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412698.1 protein_id gnl|my_center|LOCUS_23580 2339321 2341510 gene locus_tag LOCUS_23590 2339321 2341510 CDS product Rv1355c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003909410.1 protein_id gnl|my_center|LOCUS_23590 2341577 2343058 gene locus_tag LOCUS_23600 2341577 2343058 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730278.1 protein_id gnl|my_center|LOCUS_23600 2343142 2344881 gene locus_tag LOCUS_23610 2343142 2344881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 2346465 2344909 gene locus_tag LOCUS_23620 2346465 2344909 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899285.1 protein_id gnl|my_center|LOCUS_23620 2348254 2346842 gene locus_tag LOCUS_23630 2348254 2346842 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899336.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23630 2348658 2348254 gene locus_tag LOCUS_23640 gene glbO 2348658 2348254 CDS product group 2 truncated hemoglobin GlbO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412688.1 protein_id gnl|my_center|LOCUS_23640 2348794 2349435 gene locus_tag LOCUS_23650 2348794 2349435 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899334.1 protein_id gnl|my_center|LOCUS_23650 2349537 2349770 gene locus_tag LOCUS_23660 2349537 2349770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412671.1 protein_id gnl|my_center|LOCUS_23660 2349757 2350224 gene locus_tag LOCUS_23670 2349757 2350224 CDS product DUF5130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412669.1 protein_id gnl|my_center|LOCUS_23670 2352934 2350319 gene locus_tag LOCUS_23680 gene pepN 2352934 2350319 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412666.1 protein_id gnl|my_center|LOCUS_23680 2353174 2354397 gene locus_tag LOCUS_23690 2353174 2354397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23690 2354397 2354699 gene locus_tag LOCUS_23700 2354397 2354699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2354973 2355596 gene locus_tag LOCUS_23710 2354973 2355596 CDS product Rv2466c family mycothiol-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412664.1 protein_id gnl|my_center|LOCUS_23710 2355738 2356037 gene locus_tag LOCUS_23720 2355738 2356037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23720 2356031 2357107 gene locus_tag LOCUS_23730 2356031 2357107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23730 2357193 2357672 gene locus_tag LOCUS_23740 2357193 2357672 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899332.1 protein_id gnl|my_center|LOCUS_23740 2357681 2358487 gene locus_tag LOCUS_23750 2357681 2358487 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412657.1 protein_id gnl|my_center|LOCUS_23750 2360192 2359056 gene locus_tag LOCUS_23760 2360192 2359056 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412656.1 protein_id gnl|my_center|LOCUS_23760 2360344 2360271 gene locus_tag LOCUS_t00200 2360344 2360271 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2360509 2360585 gene locus_tag LOCUS_t00210 2360509 2360585 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2360622 2362076 gene locus_tag LOCUS_23770 gene tig 2360622 2362076 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412652.1 protein_id gnl|my_center|LOCUS_23770 2362199 2362795 gene locus_tag LOCUS_23780 gene clpP1 2362199 2362795 CDS product ATP-dependent CLP protease proteolytic subunit ClpP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412650.1 protein_id gnl|my_center|LOCUS_23780 2362792 2363427 gene locus_tag LOCUS_23790 gene clpP2 2362792 2363427 CDS product ATP-dependent CLP protease proteolytic subunit ClpP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412648.1 protein_id gnl|my_center|LOCUS_23790 2365149 2363485 gene locus_tag LOCUS_23800 gene jefA 2365149 2363485 CDS product multidrug efflux pump JefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412642.1 protein_id gnl|my_center|LOCUS_23800 2365792 2367072 gene locus_tag LOCUS_23810 gene clpX 2365792 2367072 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412634.1 protein_id gnl|my_center|LOCUS_23810 2367151 2368506 gene locus_tag LOCUS_23820 2367151 2368506 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412631.1 protein_id gnl|my_center|LOCUS_23820 2368725 2370686 gene locus_tag LOCUS_23830 2368725 2370686 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412627.1 protein_id gnl|my_center|LOCUS_23830 2370735 2371826 gene locus_tag LOCUS_23840 2370735 2371826 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412624.1 protein_id gnl|my_center|LOCUS_23840 2371828 2372433 gene locus_tag LOCUS_23850 2371828 2372433 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412618.1 protein_id gnl|my_center|LOCUS_23850 2375430 2373025 gene locus_tag LOCUS_23860 2375430 2373025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 2376355 2375561 gene locus_tag LOCUS_23870 2376355 2375561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23870 2376678 2376397 gene locus_tag LOCUS_23880 2376678 2376397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23880 2377442 2376723 gene locus_tag LOCUS_23890 2377442 2376723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 2377582 2377971 gene locus_tag LOCUS_23900 2377582 2377971 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_23900 2377886 2378452 gene locus_tag LOCUS_23910 2377886 2378452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 2379093 2378449 gene locus_tag LOCUS_23920 2379093 2378449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 2379583 2379125 gene locus_tag LOCUS_23930 2379583 2379125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2379887 2379498 gene locus_tag LOCUS_23940 2379887 2379498 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_23940 2380517 2379951 gene locus_tag LOCUS_23950 2380517 2379951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 2380821 2380432 gene locus_tag LOCUS_23960 2380821 2380432 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_23960 2380997 2381854 gene locus_tag LOCUS_23970 2380997 2381854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2383875 2382109 gene locus_tag LOCUS_23980 2383875 2382109 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014153.1 protein_id gnl|my_center|LOCUS_23980 2384145 2383885 gene locus_tag LOCUS_23990 2384145 2383885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2384077 2384745 gene locus_tag LOCUS_24000 2384077 2384745 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014152.1 protein_id gnl|my_center|LOCUS_24000 2385581 2384832 gene locus_tag LOCUS_24010 2385581 2384832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24010 2386072 2385827 gene locus_tag LOCUS_24020 2386072 2385827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2386383 2386135 gene locus_tag LOCUS_24030 2386383 2386135 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058085.1 protein_id gnl|my_center|LOCUS_24030 2387195 2386629 gene locus_tag LOCUS_24040 2387195 2386629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 2387499 2387110 gene locus_tag LOCUS_24050 2387499 2387110 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_24050 2388289 2388621 gene locus_tag LOCUS_24060 2388289 2388621 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234794028.1 protein_id gnl|my_center|LOCUS_24060 2388618 2389496 gene locus_tag LOCUS_24070 2388618 2389496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24070 2390616 2391347 gene locus_tag LOCUS_24080 gene rpfE 2390616 2391347 CDS product resuscitation-promoting factor protein RpfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412613.1 protein_id gnl|my_center|LOCUS_24080 2391514 2392770 gene locus_tag LOCUS_24090 2391514 2392770 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412609.1 protein_id gnl|my_center|LOCUS_24090 2392878 2393474 gene locus_tag LOCUS_24100 2392878 2393474 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896008.1 protein_id gnl|my_center|LOCUS_24100 2393558 2394181 gene locus_tag LOCUS_24110 2393558 2394181 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729242.1 protein_id gnl|my_center|LOCUS_24110 2394256 2396916 gene locus_tag LOCUS_24120 2394256 2396916 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412604.1 protein_id gnl|my_center|LOCUS_24120 2396913 2398367 gene locus_tag LOCUS_24130 gene folC 2396913 2398367 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899324.1 protein_id gnl|my_center|LOCUS_24130 2398364 2398768 gene locus_tag LOCUS_24140 2398364 2398768 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412596.1 protein_id gnl|my_center|LOCUS_24140 2399359 2398793 gene locus_tag LOCUS_24150 2399359 2398793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24150 2399663 2399274 gene locus_tag LOCUS_24160 2399663 2399274 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_24160 2399766 2400176 gene locus_tag LOCUS_24170 gene ndk 2399766 2400176 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412592.1 protein_id gnl|my_center|LOCUS_24170 2401069 2400584 gene locus_tag LOCUS_24180 2401069 2400584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2401626 2401138 gene locus_tag LOCUS_24190 2401626 2401138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 2401531 2403498 gene locus_tag LOCUS_24200 2401531 2403498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2403778 2404089 gene locus_tag LOCUS_24210 gene rplU 2403778 2404089 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896002.1 protein_id gnl|my_center|LOCUS_24210 2404107 2404373 gene locus_tag LOCUS_24220 gene rpmA 2404107 2404373 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908352.1 protein_id gnl|my_center|LOCUS_24220 2404489 2405928 gene locus_tag LOCUS_24230 gene obgE 2404489 2405928 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901405.1 protein_id gnl|my_center|LOCUS_24230 2405928 2407034 gene locus_tag LOCUS_24240 gene proB 2405928 2407034 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412568.1 protein_id gnl|my_center|LOCUS_24240 2407385 2408383 gene locus_tag LOCUS_24250 2407385 2408383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24250 2409296 2408271 gene locus_tag LOCUS_24260 2409296 2408271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24260 2409177 2409986 gene locus_tag LOCUS_24270 2409177 2409986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2410549 2409983 gene locus_tag LOCUS_24280 2410549 2409983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24280 2410853 2410464 gene locus_tag LOCUS_24290 2410853 2410464 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_24290 2411391 2410903 gene locus_tag LOCUS_24300 2411391 2410903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2412404 2411388 gene locus_tag LOCUS_24310 2412404 2411388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2413124 2412426 gene locus_tag LOCUS_24320 2413124 2412426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2413773 2413135 gene locus_tag LOCUS_24330 2413773 2413135 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729968.1 protein_id gnl|my_center|LOCUS_24330 2413902 2414327 gene locus_tag LOCUS_24340 2413902 2414327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24340 2414337 2415161 gene locus_tag LOCUS_24350 2414337 2415161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24350 2415339 2415728 gene locus_tag LOCUS_24360 2415339 2415728 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_24360 2415643 2416209 gene locus_tag LOCUS_24370 2415643 2416209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2417051 2416206 gene locus_tag LOCUS_24380 2417051 2416206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729967.1 protein_id gnl|my_center|LOCUS_24380 2417374 2419416 gene locus_tag LOCUS_24390 2417374 2419416 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901403.1 protein_id gnl|my_center|LOCUS_24390 2421157 2419529 gene locus_tag LOCUS_24400 2421157 2419529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2421248 2421913 gene locus_tag LOCUS_24410 2421248 2421913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24410 2422888 2425080 gene locus_tag LOCUS_24420 2422888 2425080 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412557.1 protein_id gnl|my_center|LOCUS_24420 2425077 2425991 gene locus_tag LOCUS_24430 2425077 2425991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 2425876 2426091 gene locus_tag LOCUS_24440 2425876 2426091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2426104 2427138 gene locus_tag LOCUS_24450 2426104 2427138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 2427202 2427912 gene locus_tag LOCUS_24460 2427202 2427912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2428159 2430258 gene locus_tag LOCUS_24470 2428159 2430258 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412557.1 protein_id gnl|my_center|LOCUS_24470 2430255 2431649 gene locus_tag LOCUS_24480 2430255 2431649 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900521.1 protein_id gnl|my_center|LOCUS_24480 2431738 2433009 gene locus_tag LOCUS_24490 2431738 2433009 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412516.1 protein_id gnl|my_center|LOCUS_24490 2433043 2433918 gene locus_tag LOCUS_24500 2433043 2433918 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412514.1 protein_id gnl|my_center|LOCUS_24500 2433932 2435371 gene locus_tag LOCUS_24510 2433932 2435371 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412513.1 protein_id gnl|my_center|LOCUS_24510 2436419 2435382 gene locus_tag LOCUS_24520 2436419 2435382 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412408.1 protein_id gnl|my_center|LOCUS_24520 2436655 2437302 gene locus_tag LOCUS_24530 gene nadD 2436655 2437302 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412398.1 protein_id gnl|my_center|LOCUS_24530 2437299 2437688 gene locus_tag LOCUS_24540 gene rsfS 2437299 2437688 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412394.1 protein_id gnl|my_center|LOCUS_24540 2437685 2438359 gene locus_tag LOCUS_24550 gene gpgP 2437685 2438359 CDS product glucosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412388.1 protein_id gnl|my_center|LOCUS_24550 2438349 2439104 gene locus_tag LOCUS_24560 2438349 2439104 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412384.1 protein_id gnl|my_center|LOCUS_24560 2439108 2439953 gene locus_tag LOCUS_24570 2439108 2439953 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412381.1 protein_id gnl|my_center|LOCUS_24570 2442910 2439989 gene locus_tag LOCUS_24580 2442910 2439989 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727041.1 protein_id gnl|my_center|LOCUS_24580 2443326 2442907 gene locus_tag LOCUS_24590 2443326 2442907 CDS product transport acessory protein MmpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876806.1 protein_id gnl|my_center|LOCUS_24590 2444449 2443673 gene locus_tag LOCUS_24600 2444449 2443673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2445501 2444452 gene locus_tag LOCUS_24610 2445501 2444452 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727034.1 protein_id gnl|my_center|LOCUS_24610 2445694 2446824 gene locus_tag LOCUS_24620 2445694 2446824 CDS product enhanced intracellular survival protein Eis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412375.1 protein_id gnl|my_center|LOCUS_24620 2447627 2447061 gene locus_tag LOCUS_24630 2447627 2447061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 2447931 2447542 gene locus_tag LOCUS_24640 2447931 2447542 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_24640 2449081 2447981 gene locus_tag LOCUS_24650 2449081 2447981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113193.1 protein_id gnl|my_center|LOCUS_24650 2449972 2449337 gene locus_tag LOCUS_24660 2449972 2449337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24660 2450455 2450117 gene locus_tag LOCUS_24670 2450455 2450117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24670 2451629 2450463 gene locus_tag LOCUS_24680 2451629 2450463 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731330.1 protein_id gnl|my_center|LOCUS_24680 2451884 2452759 gene locus_tag LOCUS_24690 2451884 2452759 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412373.1 protein_id gnl|my_center|LOCUS_24690 2453580 2454347 gene locus_tag LOCUS_24700 2453580 2454347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24700 2454360 2455337 gene locus_tag LOCUS_24710 2454360 2455337 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903885.1 protein_id gnl|my_center|LOCUS_24710 2455673 2455410 gene locus_tag LOCUS_24720 gene rpsT 2455673 2455410 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899314.1 protein_id gnl|my_center|LOCUS_24720 2455932 2457476 gene locus_tag LOCUS_24730 2455932 2457476 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412363.1 protein_id gnl|my_center|LOCUS_24730 2457476 2458453 gene locus_tag LOCUS_24740 2457476 2458453 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907835.1 protein_id gnl|my_center|LOCUS_24740 2458453 2459292 gene locus_tag LOCUS_24750 2458453 2459292 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412357.1 protein_id gnl|my_center|LOCUS_24750 2460628 2459297 gene locus_tag LOCUS_24760 2460628 2459297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 2462183 2460732 gene locus_tag LOCUS_24770 2462183 2460732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 2463185 2462346 gene locus_tag LOCUS_24780 2463185 2462346 CDS product Rv2407 family type 3 sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412350.1 protein_id gnl|my_center|LOCUS_24780 2463411 2463839 gene locus_tag LOCUS_24790 2463411 2463839 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412347.1 protein_id gnl|my_center|LOCUS_24790 2464480 2463881 gene locus_tag LOCUS_24800 2464480 2463881 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412345.1 protein_id gnl|my_center|LOCUS_24800 2464691 2466430 gene locus_tag LOCUS_24810 gene lepA 2464691 2466430 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900516.1 protein_id gnl|my_center|LOCUS_24810 2466433 2467176 gene locus_tag LOCUS_24820 2466433 2467176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 2467176 2467949 gene locus_tag LOCUS_24830 2467176 2467949 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412341.1 protein_id gnl|my_center|LOCUS_24830 2468868 2467966 gene locus_tag LOCUS_24840 2468868 2467966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24840 2470031 2468868 gene locus_tag LOCUS_24850 2470031 2468868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24850 2471268 2470102 gene locus_tag LOCUS_24860 2471268 2470102 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110188.1 protein_id gnl|my_center|LOCUS_24860 2471416 2471610 gene locus_tag LOCUS_24870 2471416 2471610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412337.1 protein_id gnl|my_center|LOCUS_24870 2471960 2473009 gene locus_tag LOCUS_24880 2471960 2473009 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412335.1 protein_id gnl|my_center|LOCUS_24880 2473006 2473908 gene locus_tag LOCUS_24890 gene cysT 2473006 2473908 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412332.1 protein_id gnl|my_center|LOCUS_24890 2473905 2474723 gene locus_tag LOCUS_24900 gene cysW 2473905 2474723 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911860.1 protein_id gnl|my_center|LOCUS_24900 2474738 2475829 gene locus_tag LOCUS_24910 2474738 2475829 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412325.1 protein_id gnl|my_center|LOCUS_24910 2477339 2475858 gene locus_tag LOCUS_24920 2477339 2475858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24920 2477861 2477343 gene locus_tag LOCUS_24930 2477861 2477343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24930 2479866 2477953 gene locus_tag LOCUS_24940 2479866 2477953 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412309.1 protein_id gnl|my_center|LOCUS_24940 2480639 2479908 gene locus_tag LOCUS_24950 2480639 2479908 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412306.1 protein_id gnl|my_center|LOCUS_24950 2481367 2480618 gene locus_tag LOCUS_24960 2481367 2480618 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412303.1 protein_id gnl|my_center|LOCUS_24960 2483031 2481364 gene locus_tag LOCUS_24970 gene sirA 2483031 2481364 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899303.1 protein_id gnl|my_center|LOCUS_24970 2483468 2484640 gene locus_tag LOCUS_24980 gene hemW 2483468 2484640 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901389.1 protein_id gnl|my_center|LOCUS_24980 2485887 2484652 gene locus_tag LOCUS_24990 2485887 2484652 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412289.1 protein_id gnl|my_center|LOCUS_24990 2486386 2486177 gene locus_tag LOCUS_25000 2486386 2486177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899302.1 protein_id gnl|my_center|LOCUS_25000 2486834 2488138 gene locus_tag LOCUS_25010 gene mbtI 2486834 2488138 CDS product mycobactin biosynthesis salicylate synthase MbtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412287.1 protein_id gnl|my_center|LOCUS_25010 2488390 2489142 gene locus_tag LOCUS_25020 2488390 2489142 CDS product dormancy-associated translation inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400655.1 protein_id gnl|my_center|LOCUS_25020 2489212 2490228 gene locus_tag LOCUS_25030 2489212 2490228 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897193.1 protein_id gnl|my_center|LOCUS_25030 2491222 2490260 gene locus_tag LOCUS_25040 2491222 2490260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2492724 2491219 gene locus_tag LOCUS_25050 2492724 2491219 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095417.1 protein_id gnl|my_center|LOCUS_25050 2493518 2492727 gene locus_tag LOCUS_25060 2493518 2492727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094778.1 protein_id gnl|my_center|LOCUS_25060 2494539 2493679 gene locus_tag LOCUS_25070 2494539 2493679 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095420.1 protein_id gnl|my_center|LOCUS_25070 2495416 2494541 gene locus_tag LOCUS_25080 gene mbtJ 2495416 2494541 CDS product acetyl hydrolase/esterase MbtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412284.1 protein_id gnl|my_center|LOCUS_25080 2495358 2495636 gene locus_tag LOCUS_25090 2495358 2495636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 2497298 2495646 gene locus_tag LOCUS_25100 gene mbtA 2497298 2495646 CDS product bifunctional salicyl-AMP ligase/salicyl-S-ArCP synthetase MbtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412282.1 protein_id gnl|my_center|LOCUS_25100 2497495 2498799 gene locus_tag LOCUS_25110 gene mbtG 2497495 2498799 CDS product NADPH-dependent L-lysine N(6)-monooxygenase MbtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729884.1 protein_id gnl|my_center|LOCUS_25110 2498780 2498995 gene locus_tag LOCUS_25120 2498780 2498995 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726914.1 protein_id gnl|my_center|LOCUS_25120 2502074 2499000 gene locus_tag LOCUS_25130 gene nbtC 2502074 2499000 CDS product nocobactin polyketide synthase NbtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110643.1 protein_id gnl|my_center|LOCUS_25130 2503390 2502071 gene locus_tag LOCUS_25140 2503390 2502071 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080165.1 protein_id gnl|my_center|LOCUS_25140 2504145 2503387 gene locus_tag LOCUS_25150 2504145 2503387 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080163.1 protein_id gnl|my_center|LOCUS_25150 2504860 2504255 gene locus_tag LOCUS_25160 2504860 2504255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2505156 2510147 gene locus_tag LOCUS_25170 2505156 2510147 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110645.1 protein_id gnl|my_center|LOCUS_25170 2510144 2514682 gene locus_tag LOCUS_25180 2510144 2514682 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110647.1 protein_id gnl|my_center|LOCUS_25180 2514718 2518209 gene locus_tag LOCUS_25190 2514718 2518209 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110650.1 protein_id gnl|my_center|LOCUS_25190 2519208 2518414 gene locus_tag LOCUS_25200 2519208 2518414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25200 2519531 2519250 gene locus_tag LOCUS_25210 2519531 2519250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25210 2519737 2520246 gene locus_tag LOCUS_25220 2519737 2520246 CDS product Low molecular weight antigen MTB12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412264.1 protein_id gnl|my_center|LOCUS_25220 2520865 2520284 gene locus_tag LOCUS_25230 2520865 2520284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 2520782 2520967 gene locus_tag LOCUS_25240 2520782 2520967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 2521598 2521032 gene locus_tag LOCUS_25250 2521598 2521032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2521902 2521513 gene locus_tag LOCUS_25260 2521902 2521513 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_25260 2522704 2522105 gene locus_tag LOCUS_25270 2522704 2522105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 2523114 2522800 gene locus_tag LOCUS_25280 2523114 2522800 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412258.1 protein_id gnl|my_center|LOCUS_25280 2523387 2524418 gene locus_tag LOCUS_25290 gene hrcA 2523387 2524418 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412252.1 protein_id gnl|my_center|LOCUS_25290 2524493 2525629 gene locus_tag LOCUS_25300 gene dnaJ 2524493 2525629 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899294.1 protein_id gnl|my_center|LOCUS_25300 2525658 2526419 gene locus_tag LOCUS_25310 2525658 2526419 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900509.1 protein_id gnl|my_center|LOCUS_25310 2527086 2526442 gene locus_tag LOCUS_25320 2527086 2526442 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731532.1 protein_id gnl|my_center|LOCUS_25320 2527966 2527070 gene locus_tag LOCUS_25330 2527966 2527070 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206791.1 protein_id gnl|my_center|LOCUS_25330 2527970 2528692 gene locus_tag LOCUS_25340 2527970 2528692 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225212.1 protein_id gnl|my_center|LOCUS_25340 2528760 2529818 gene locus_tag LOCUS_25350 2528760 2529818 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412235.1 protein_id gnl|my_center|LOCUS_25350 2529837 2530373 gene locus_tag LOCUS_25360 gene ybeY 2529837 2530373 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899292.1 protein_id gnl|my_center|LOCUS_25360 2530370 2531692 gene locus_tag LOCUS_25370 2530370 2531692 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412229.1 protein_id gnl|my_center|LOCUS_25370 2531685 2531891 gene locus_tag LOCUS_25380 2531685 2531891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 2531881 2532783 gene locus_tag LOCUS_25390 gene era 2531881 2532783 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412224.1 protein_id gnl|my_center|LOCUS_25390 2534279 2532780 gene locus_tag LOCUS_25400 2534279 2532780 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412223.1 protein_id gnl|my_center|LOCUS_25400 2534368 2535138 gene locus_tag LOCUS_25410 gene recO 2534368 2535138 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412222.1 protein_id gnl|my_center|LOCUS_25410 2535131 2536021 gene locus_tag LOCUS_25420 2535131 2536021 CDS product decaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412212.1 protein_id gnl|my_center|LOCUS_25420 2536021 2536461 gene locus_tag LOCUS_25430 2536021 2536461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906807.1 protein_id gnl|my_center|LOCUS_25430 2536871 2536458 gene locus_tag LOCUS_25440 gene zur 2536871 2536458 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903860.1 protein_id gnl|my_center|LOCUS_25440 2537263 2536868 gene locus_tag LOCUS_25450 2537263 2536868 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412205.1 protein_id gnl|my_center|LOCUS_25450 2537469 2538848 gene locus_tag LOCUS_25460 2537469 2538848 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412200.1 protein_id gnl|my_center|LOCUS_25460 2539096 2539263 gene locus_tag LOCUS_25470 2539096 2539263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25470 2539442 2539260 gene locus_tag LOCUS_25480 2539442 2539260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2539408 2540973 gene locus_tag LOCUS_25490 2539408 2540973 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015288299.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25490 2541042 2541431 gene locus_tag LOCUS_25500 2541042 2541431 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_25500 2541346 2541912 gene locus_tag LOCUS_25510 2541346 2541912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2542471 2543634 gene locus_tag LOCUS_25520 2542471 2543634 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900505.1 protein_id gnl|my_center|LOCUS_25520 2543714 2544010 gene locus_tag LOCUS_25530 gene esxJ 2543714 2544010 CDS product type VII secretion system ESX-5 protein EsxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900502.1 protein_id gnl|my_center|LOCUS_25530 2544025 2544309 gene locus_tag LOCUS_25540 gene esxN 2544025 2544309 CDS product effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015293199.1 protein_id gnl|my_center|LOCUS_25540 2545298 2544510 gene locus_tag LOCUS_25550 2545298 2544510 CDS product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906617.1 protein_id gnl|my_center|LOCUS_25550 2545883 2547445 gene locus_tag LOCUS_25560 2545883 2547445 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911847.1 protein_id gnl|my_center|LOCUS_25560 2547841 2548749 gene locus_tag LOCUS_25570 2547841 2548749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25570 2548855 2549394 gene locus_tag LOCUS_25580 2548855 2549394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25580 2549681 2549998 gene locus_tag LOCUS_25590 2549681 2549998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412119.1 protein_id gnl|my_center|LOCUS_25590 2550131 2550427 gene locus_tag LOCUS_25600 gene esxJ 2550131 2550427 CDS product type VII secretion system ESX-5 protein EsxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900502.1 protein_id gnl|my_center|LOCUS_25600 2550490 2550774 gene locus_tag LOCUS_25610 gene esxN 2550490 2550774 CDS product effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408840.1 protein_id gnl|my_center|LOCUS_25610 2552971 2550983 gene locus_tag LOCUS_25620 2552971 2550983 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899282.1 protein_id gnl|my_center|LOCUS_25620 2553022 2554392 gene locus_tag LOCUS_25630 2553022 2554392 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899281.1 protein_id gnl|my_center|LOCUS_25630 2554434 2556404 gene locus_tag LOCUS_25640 gene dnaG 2554434 2556404 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412049.1 protein_id gnl|my_center|LOCUS_25640 2556664 2556419 gene locus_tag LOCUS_25650 2556664 2556419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412045.1 protein_id gnl|my_center|LOCUS_25650 2556871 2556946 gene locus_tag LOCUS_t00220 2556871 2556946 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2557421 2557032 gene locus_tag LOCUS_25660 2557421 2557032 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085648.1 protein_id gnl|my_center|LOCUS_25660 2557940 2557512 gene locus_tag LOCUS_25670 2557940 2557512 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730788.1 protein_id gnl|my_center|LOCUS_25670 2558637 2557951 gene locus_tag LOCUS_25680 gene cysE 2558637 2557951 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907956.1 protein_id gnl|my_center|LOCUS_25680 2559572 2558640 gene locus_tag LOCUS_25690 gene cysK 2559572 2558640 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_25690 2559985 2559569 gene locus_tag LOCUS_25700 2559985 2559569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2561939 2560293 gene locus_tag LOCUS_25710 2561939 2560293 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950697.1 protein_id gnl|my_center|LOCUS_25710 2562111 2562326 gene locus_tag LOCUS_25720 2562111 2562326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 2562339 2563436 gene locus_tag LOCUS_25730 2562339 2563436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2563777 2565348 gene locus_tag LOCUS_25740 gene stp 2563777 2565348 CDS product multidrug resistance protein Stp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906797.1 protein_id gnl|my_center|LOCUS_25740 2567029 2565665 gene locus_tag LOCUS_25750 2567029 2565665 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003910691.1 protein_id gnl|my_center|LOCUS_25750 2567075 2567239 gene locus_tag LOCUS_25760 2567075 2567239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 2569185 2567827 gene locus_tag LOCUS_25770 2569185 2567827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 2569777 2569211 gene locus_tag LOCUS_25780 2569777 2569211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25780 2570081 2569692 gene locus_tag LOCUS_25790 2570081 2569692 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_25790 2571988 2570111 gene locus_tag LOCUS_25800 2571988 2570111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 2572392 2572895 gene locus_tag LOCUS_25810 2572392 2572895 CDS product LppP/LprE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411974.1 protein_id gnl|my_center|LOCUS_25810 2573119 2574642 gene locus_tag LOCUS_25820 2573119 2574642 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411973.1 protein_id gnl|my_center|LOCUS_25820 2575711 2575187 gene locus_tag LOCUS_25830 2575711 2575187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2576956 2575787 gene locus_tag LOCUS_25840 2576956 2575787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2577146 2578408 gene locus_tag LOCUS_25850 2577146 2578408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2578618 2578827 gene locus_tag LOCUS_25860 2578618 2578827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25860 2578742 2579308 gene locus_tag LOCUS_25870 2578742 2579308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2579430 2579579 gene locus_tag LOCUS_25880 2579430 2579579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 2579576 2580388 gene locus_tag LOCUS_25890 gene istB 2579576 2580388 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_25890 2580581 2580414 gene locus_tag LOCUS_25900 2580581 2580414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 2581212 2580655 gene locus_tag LOCUS_25910 2581212 2580655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 2581614 2581895 gene locus_tag LOCUS_25920 2581614 2581895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25920 2581937 2582731 gene locus_tag LOCUS_25930 2581937 2582731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25930 2583680 2582766 gene locus_tag LOCUS_25940 2583680 2582766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25940 2592005 2583702 gene locus_tag LOCUS_25950 2592005 2583702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25950 2592652 2594310 gene locus_tag LOCUS_25960 2592652 2594310 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920149.1 protein_id gnl|my_center|LOCUS_25960 2594642 2594415 gene locus_tag LOCUS_25970 2594642 2594415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25970 2596358 2594670 gene locus_tag LOCUS_25980 2596358 2594670 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729863.1 protein_id gnl|my_center|LOCUS_25980 2596466 2597218 gene locus_tag LOCUS_25990 2596466 2597218 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729862.1 protein_id gnl|my_center|LOCUS_25990 2597215 2598228 gene locus_tag LOCUS_26000 2597215 2598228 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235632064.1 protein_id gnl|my_center|LOCUS_26000 2598791 2598225 gene locus_tag LOCUS_26010 2598791 2598225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2598915 2598706 gene locus_tag LOCUS_26020 2598915 2598706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26020 2601789 2599282 gene locus_tag LOCUS_26030 2601789 2599282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 2602432 2601956 gene locus_tag LOCUS_26040 2602432 2601956 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411970.1 protein_id gnl|my_center|LOCUS_26040 2602611 2604623 gene locus_tag LOCUS_26050 2602611 2604623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411969.1 protein_id gnl|my_center|LOCUS_26050 2604620 2605480 gene locus_tag LOCUS_26060 2604620 2605480 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411966.1 protein_id gnl|my_center|LOCUS_26060 2605929 2605477 gene locus_tag LOCUS_26070 2605929 2605477 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411963.1 protein_id gnl|my_center|LOCUS_26070 2606053 2606928 gene locus_tag LOCUS_26080 2606053 2606928 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411960.1 protein_id gnl|my_center|LOCUS_26080 2606925 2608169 gene locus_tag LOCUS_26090 gene rocD 2606925 2608169 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727654.1 protein_id gnl|my_center|LOCUS_26090 2608199 2609668 gene locus_tag LOCUS_26100 2608199 2609668 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411955.1 protein_id gnl|my_center|LOCUS_26100 2609665 2610537 gene locus_tag LOCUS_26110 2609665 2610537 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411952.1 protein_id gnl|my_center|LOCUS_26110 2611896 2610568 gene locus_tag LOCUS_26120 2611896 2610568 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411947.1 protein_id gnl|my_center|LOCUS_26120 2612732 2611893 gene locus_tag LOCUS_26130 2612732 2611893 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411946.1 protein_id gnl|my_center|LOCUS_26130 2613591 2612719 gene locus_tag LOCUS_26140 2613591 2612719 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411940.1 protein_id gnl|my_center|LOCUS_26140 2613626 2615143 gene locus_tag LOCUS_26150 2613626 2615143 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411929.1 protein_id gnl|my_center|LOCUS_26150 2615140 2616513 gene locus_tag LOCUS_26160 2615140 2616513 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899270.1 protein_id gnl|my_center|LOCUS_26160 2616554 2616742 gene locus_tag LOCUS_26170 2616554 2616742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26170 2616791 2617408 gene locus_tag LOCUS_26180 2616791 2617408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26180 2617540 2618187 gene locus_tag LOCUS_26190 2617540 2618187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 2621257 2618660 gene locus_tag LOCUS_26200 2621257 2618660 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227286.1 protein_id gnl|my_center|LOCUS_26200 2621489 2622040 gene locus_tag LOCUS_26210 2621489 2622040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 2622609 2622142 gene locus_tag LOCUS_26220 2622609 2622142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 2622575 2622808 gene locus_tag LOCUS_26230 2622575 2622808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 2624126 2623566 gene locus_tag LOCUS_26240 2624126 2623566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 2624864 2624938 gene locus_tag LOCUS_t00230 2624864 2624938 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2626156 2624981 gene locus_tag LOCUS_26250 2626156 2624981 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110336.1 protein_id gnl|my_center|LOCUS_26250 2626483 2626277 gene locus_tag LOCUS_26260 2626483 2626277 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110337.1 protein_id gnl|my_center|LOCUS_26260 2626899 2627915 gene locus_tag LOCUS_26270 2626899 2627915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26270 2627931 2628344 gene locus_tag LOCUS_26280 2627931 2628344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26280 2628357 2629703 gene locus_tag LOCUS_26290 2628357 2629703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26290 2630688 2629894 gene locus_tag LOCUS_26300 2630688 2629894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26300 2631011 2630730 gene locus_tag LOCUS_26310 2631011 2630730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26310 2632224 2631130 gene locus_tag LOCUS_26320 2632224 2631130 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_26320 2632521 2632246 gene locus_tag LOCUS_26330 2632521 2632246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 2633041 2632475 gene locus_tag LOCUS_26340 2633041 2632475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 2633345 2632956 gene locus_tag LOCUS_26350 2633345 2632956 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_26350 2634004 2634672 gene locus_tag LOCUS_26360 2634004 2634672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2635078 2635605 gene locus_tag LOCUS_26370 2635078 2635605 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950452.1 protein_id gnl|my_center|LOCUS_26370 2635758 2636147 gene locus_tag LOCUS_26380 2635758 2636147 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_26380 2636062 2636628 gene locus_tag LOCUS_26390 2636062 2636628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 2637667 2636855 gene locus_tag LOCUS_26400 gene istB 2637667 2636855 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_26400 2637843 2637664 gene locus_tag LOCUS_26410 2637843 2637664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 2637974 2638363 gene locus_tag LOCUS_26420 2637974 2638363 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_26420 2638278 2638844 gene locus_tag LOCUS_26430 2638278 2638844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 2640097 2638841 gene locus_tag LOCUS_26440 2640097 2638841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 2640381 2641409 gene locus_tag LOCUS_26450 2640381 2641409 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413359.1 protein_id gnl|my_center|LOCUS_26450 2643000 2641417 gene locus_tag LOCUS_26460 2643000 2641417 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413355.1 protein_id gnl|my_center|LOCUS_26460 2643941 2643039 gene locus_tag LOCUS_26470 2643941 2643039 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095780.1 protein_id gnl|my_center|LOCUS_26470 2643913 2644395 gene locus_tag LOCUS_26480 2643913 2644395 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413352.1 protein_id gnl|my_center|LOCUS_26480 2644949 2644407 gene locus_tag LOCUS_26490 2644949 2644407 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109728.1 protein_id gnl|my_center|LOCUS_26490 2645042 2645827 gene locus_tag LOCUS_26500 2645042 2645827 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082932.1 protein_id gnl|my_center|LOCUS_26500 2645865 2646176 gene locus_tag LOCUS_26510 2645865 2646176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26510 2646184 2646753 gene locus_tag LOCUS_26520 2646184 2646753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26520 2647687 2646803 gene locus_tag LOCUS_26530 2647687 2646803 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899384.1 protein_id gnl|my_center|LOCUS_26530 2648264 2647749 gene locus_tag LOCUS_26540 2648264 2647749 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413345.1 protein_id gnl|my_center|LOCUS_26540 2649089 2648283 gene locus_tag LOCUS_26550 2649089 2648283 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085334929.1 protein_id gnl|my_center|LOCUS_26550 2649262 2651043 gene locus_tag LOCUS_26560 gene aspS 2649262 2651043 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899382.1 protein_id gnl|my_center|LOCUS_26560 2651040 2651471 gene locus_tag LOCUS_26570 2651040 2651471 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894385.1 protein_id gnl|my_center|LOCUS_26570 2651491 2652549 gene locus_tag LOCUS_26580 2651491 2652549 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899381.1 protein_id gnl|my_center|LOCUS_26580 2652954 2652556 gene locus_tag LOCUS_26590 2652954 2652556 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413336.1 protein_id gnl|my_center|LOCUS_26590 2653088 2654032 gene locus_tag LOCUS_26600 2653088 2654032 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413334.1 protein_id gnl|my_center|LOCUS_26600 2654025 2655080 gene locus_tag LOCUS_26610 2654025 2655080 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413332.1 protein_id gnl|my_center|LOCUS_26610 2657790 2655103 gene locus_tag LOCUS_26620 2657790 2655103 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413330.1 protein_id gnl|my_center|LOCUS_26620 2661160 2657825 gene locus_tag LOCUS_26630 2661160 2657825 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886150.1 protein_id gnl|my_center|LOCUS_26630 2662420 2661314 gene locus_tag LOCUS_26640 2662420 2661314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 2662611 2663969 gene locus_tag LOCUS_26650 2662611 2663969 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413216.1 protein_id gnl|my_center|LOCUS_26650 2664638 2664015 gene locus_tag LOCUS_26660 2664638 2664015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413213.1 protein_id gnl|my_center|LOCUS_26660 2664859 2665260 gene locus_tag LOCUS_26670 2664859 2665260 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413208.1 protein_id gnl|my_center|LOCUS_26670 2665379 2668084 gene locus_tag LOCUS_26680 gene alaS 2665379 2668084 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902305.1 protein_id gnl|my_center|LOCUS_26680 2668166 2668597 gene locus_tag LOCUS_26690 gene ruvX 2668166 2668597 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413197.1 protein_id gnl|my_center|LOCUS_26690 2668590 2669846 gene locus_tag LOCUS_26700 2668590 2669846 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413196.1 protein_id gnl|my_center|LOCUS_26700 2669843 2670676 gene locus_tag LOCUS_26710 2669843 2670676 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413193.1 protein_id gnl|my_center|LOCUS_26710 2670688 2671131 gene locus_tag LOCUS_26720 2670688 2671131 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728766.1 protein_id gnl|my_center|LOCUS_26720 2671270 2672430 gene locus_tag LOCUS_26730 gene aroC 2671270 2672430 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413027.1 protein_id gnl|my_center|LOCUS_26730 2672439 2672993 gene locus_tag LOCUS_26740 gene aroK 2672439 2672993 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413021.1 protein_id gnl|my_center|LOCUS_26740 2672990 2674078 gene locus_tag LOCUS_26750 gene aroB 2672990 2674078 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413008.1 protein_id gnl|my_center|LOCUS_26750 2674075 2674518 gene locus_tag LOCUS_26760 gene aroQ 2674075 2674518 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413001.1 protein_id gnl|my_center|LOCUS_26760 2675124 2674558 gene locus_tag LOCUS_26770 2675124 2674558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 2675428 2675225 gene locus_tag LOCUS_26780 2675428 2675225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26780 2676248 2675478 gene locus_tag LOCUS_26790 2676248 2675478 CDS product B-4DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412998.1 protein_id gnl|my_center|LOCUS_26790 2676345 2677400 gene locus_tag LOCUS_26800 2676345 2677400 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412996.1 protein_id gnl|my_center|LOCUS_26800 2677415 2677978 gene locus_tag LOCUS_26810 gene efp 2677415 2677978 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412989.1 protein_id gnl|my_center|LOCUS_26810 2677981 2678502 gene locus_tag LOCUS_26820 gene nusB 2677981 2678502 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412985.1 protein_id gnl|my_center|LOCUS_26820 2678502 2678909 gene locus_tag LOCUS_26830 2678502 2678909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412981.1 protein_id gnl|my_center|LOCUS_26830 2679092 2681923 gene locus_tag LOCUS_26840 2679092 2681923 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899363.1 protein_id gnl|my_center|LOCUS_26840 2683149 2681929 gene locus_tag LOCUS_26850 2683149 2681929 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728773.1 protein_id gnl|my_center|LOCUS_26850 2683767 2683195 gene locus_tag LOCUS_26860 2683767 2683195 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878199.1 protein_id gnl|my_center|LOCUS_26860 2684988 2683783 gene locus_tag LOCUS_26870 2684988 2683783 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003918234.1 protein_id gnl|my_center|LOCUS_26870 2685640 2686275 gene locus_tag LOCUS_26880 gene lprF 2685640 2686275 CDS product lipoprotein LprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407180.1 protein_id gnl|my_center|LOCUS_26880 2686614 2687042 gene locus_tag LOCUS_26890 2686614 2687042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26890 2687058 2688005 gene locus_tag LOCUS_26900 2687058 2688005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26900 2688002 2689183 gene locus_tag LOCUS_26910 2688002 2689183 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407185.1 protein_id gnl|my_center|LOCUS_26910 2689265 2690278 gene locus_tag LOCUS_26920 2689265 2690278 CDS product glycolipid sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898849.1 protein_id gnl|my_center|LOCUS_26920 2690278 2691291 gene locus_tag LOCUS_26930 2690278 2691291 CDS product glycolipid sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898849.1 protein_id gnl|my_center|LOCUS_26930 2691990 2691298 gene locus_tag LOCUS_26940 2691990 2691298 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898852.1 protein_id gnl|my_center|LOCUS_26940 2692117 2692680 gene locus_tag LOCUS_26950 gene pyrR 2692117 2692680 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407196.1 protein_id gnl|my_center|LOCUS_26950 2692677 2693639 gene locus_tag LOCUS_26960 2692677 2693639 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407200.1 protein_id gnl|my_center|LOCUS_26960 2693636 2694928 gene locus_tag LOCUS_26970 2693636 2694928 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407204.1 protein_id gnl|my_center|LOCUS_26970 2694925 2695446 gene locus_tag LOCUS_26980 2694925 2695446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898853.1 protein_id gnl|my_center|LOCUS_26980 2695443 2696570 gene locus_tag LOCUS_26990 gene carA 2695443 2696570 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907778.1 protein_id gnl|my_center|LOCUS_26990 2696662 2700027 gene locus_tag LOCUS_27000 gene carB 2696662 2700027 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407211.1 protein_id gnl|my_center|LOCUS_27000 2700024 2700860 gene locus_tag LOCUS_27010 gene pyrF 2700024 2700860 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907780.1 protein_id gnl|my_center|LOCUS_27010 2701835 2702152 gene locus_tag LOCUS_27020 2701835 2702152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27020 2702321 2702875 gene locus_tag LOCUS_27030 gene gmk 2702321 2702875 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900331.1 protein_id gnl|my_center|LOCUS_27030 2702962 2703294 gene locus_tag LOCUS_27040 gene rpoZ 2702962 2703294 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407248.1 protein_id gnl|my_center|LOCUS_27040 2703310 2704551 gene locus_tag LOCUS_27050 gene coaBC 2703310 2704551 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898859.1 protein_id gnl|my_center|LOCUS_27050 2704680 2705891 gene locus_tag LOCUS_27060 gene metK 2704680 2705891 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900333.1 protein_id gnl|my_center|LOCUS_27060 2706548 2705973 gene locus_tag LOCUS_27070 2706548 2705973 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094783.1 protein_id gnl|my_center|LOCUS_27070 2706843 2706685 gene locus_tag LOCUS_27080 2706843 2706685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27080 2708124 2706928 gene locus_tag LOCUS_27090 2708124 2706928 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407257.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27090 2709240 2708269 gene locus_tag LOCUS_27100 2709240 2708269 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407276.1 protein_id gnl|my_center|LOCUS_27100 2710241 2709267 gene locus_tag LOCUS_27110 2710241 2709267 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407279.1 protein_id gnl|my_center|LOCUS_27110 2710240 2710977 gene locus_tag LOCUS_27120 2710240 2710977 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898862.1 protein_id gnl|my_center|LOCUS_27120 2711088 2713034 gene locus_tag LOCUS_27130 2711088 2713034 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407285.1 protein_id gnl|my_center|LOCUS_27130 2713291 2713052 gene locus_tag LOCUS_27140 2713291 2713052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27140 2713877 2713341 gene locus_tag LOCUS_27150 2713877 2713341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27150 2714101 2714583 gene locus_tag LOCUS_27160 2714101 2714583 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407295.1 protein_id gnl|my_center|LOCUS_27160 2715530 2714706 gene locus_tag LOCUS_27170 2715530 2714706 CDS product virulence-associated methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407297.1 protein_id gnl|my_center|LOCUS_27170 2715876 2716670 gene locus_tag LOCUS_27180 gene fmt 2715876 2716670 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900336.1 protein_id gnl|my_center|LOCUS_27180 2716739 2718112 gene locus_tag LOCUS_27190 2716739 2718112 CDS product 16S rRNA m5C967 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898865.1 protein_id gnl|my_center|LOCUS_27190 2718179 2718868 gene locus_tag LOCUS_27200 gene rpe 2718179 2718868 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898866.1 protein_id gnl|my_center|LOCUS_27200 2718876 2719895 gene locus_tag LOCUS_27210 gene ribD 2718876 2719895 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407308.1 protein_id gnl|my_center|LOCUS_27210 2721453 2719900 gene locus_tag LOCUS_27220 2721453 2719900 CDS product aminoglycoside/tetracycline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407310.1 protein_id gnl|my_center|LOCUS_27220 2722154 2721453 gene locus_tag LOCUS_27230 gene lprG 2722154 2721453 CDS product lipoarabinomannan carrier protein LprG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407315.1 protein_id gnl|my_center|LOCUS_27230 2722264 2722887 gene locus_tag LOCUS_27240 2722264 2722887 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407318.1 protein_id gnl|my_center|LOCUS_27240 2723026 2724303 gene locus_tag LOCUS_27250 2723026 2724303 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407334.1 protein_id gnl|my_center|LOCUS_27250 2724300 2724782 gene locus_tag LOCUS_27260 gene ribH 2724300 2724782 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898872.1 protein_id gnl|my_center|LOCUS_27260 2724779 2725249 gene locus_tag LOCUS_27270 2724779 2725249 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407340.1 protein_id gnl|my_center|LOCUS_27270 2725269 2725922 gene locus_tag LOCUS_27280 2725269 2725922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407343.1 protein_id gnl|my_center|LOCUS_27280 2725968 2727437 gene locus_tag LOCUS_27290 2725968 2727437 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906341.1 protein_id gnl|my_center|LOCUS_27290 2727457 2729400 gene locus_tag LOCUS_27300 gene uvrC 2727457 2729400 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407347.1 protein_id gnl|my_center|LOCUS_27300 2729397 2730317 gene locus_tag LOCUS_27310 gene rapZ 2729397 2730317 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898873.1 protein_id gnl|my_center|LOCUS_27310 2730347 2731390 gene locus_tag LOCUS_27320 gene cuvA 2730347 2731390 CDS product carbon utilization/virulence protein CuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407352.1 protein_id gnl|my_center|LOCUS_27320 2731381 2732364 gene locus_tag LOCUS_27330 gene whiA 2731381 2732364 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901156.1 protein_id gnl|my_center|LOCUS_27330 2732467 2733849 gene locus_tag LOCUS_27340 2732467 2733849 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407366.1 protein_id gnl|my_center|LOCUS_27340 2735127 2733850 gene locus_tag LOCUS_27350 2735127 2733850 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407371.1 protein_id gnl|my_center|LOCUS_27350 2736758 2735124 gene locus_tag LOCUS_27360 gene fadD12 2736758 2735124 CDS product acyl-CoA ligase FadD12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898876.1 protein_id gnl|my_center|LOCUS_27360 2737565 2736762 gene locus_tag LOCUS_27370 2737565 2736762 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_27370 2737776 2739614 gene locus_tag LOCUS_27380 2737776 2739614 CDS product esterase PE16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407378.1 protein_id gnl|my_center|LOCUS_27380 2740984 2741547 gene locus_tag LOCUS_27390 2740984 2741547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27390 2741544 2742956 gene locus_tag LOCUS_27400 2741544 2742956 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407382.1 protein_id gnl|my_center|LOCUS_27400 2743267 2742974 gene locus_tag LOCUS_27410 2743267 2742974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 2743309 2743686 gene locus_tag LOCUS_27420 2743309 2743686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 2744076 2745116 gene locus_tag LOCUS_27430 gene gap 2744076 2745116 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407390.1 protein_id gnl|my_center|LOCUS_27430 2745129 2746379 gene locus_tag LOCUS_27440 2745129 2746379 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900339.1 protein_id gnl|my_center|LOCUS_27440 2746376 2747161 gene locus_tag LOCUS_27450 gene tpiA 2746376 2747161 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407398.1 protein_id gnl|my_center|LOCUS_27450 2750146 2747207 gene locus_tag LOCUS_27460 2750146 2747207 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730385.1 protein_id gnl|my_center|LOCUS_27460 2751486 2750143 gene locus_tag LOCUS_27470 2751486 2750143 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726950.1 protein_id gnl|my_center|LOCUS_27470 2751763 2752491 gene locus_tag LOCUS_27480 2751763 2752491 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533053.1 protein_id gnl|my_center|LOCUS_27480 2753013 2752525 gene locus_tag LOCUS_27490 2753013 2752525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 2753261 2753028 gene locus_tag LOCUS_27500 gene secG 2753261 2753028 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407407.1 protein_id gnl|my_center|LOCUS_27500 2753331 2756138 gene locus_tag LOCUS_27510 gene ppc 2753331 2756138 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907814.1 protein_id gnl|my_center|LOCUS_27510 2757484 2756162 gene locus_tag LOCUS_27520 2757484 2756162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 2757870 2757523 gene locus_tag LOCUS_27530 2757870 2757523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898881.1 protein_id gnl|my_center|LOCUS_27530 2758714 2757971 gene locus_tag LOCUS_27540 gene pgl 2758714 2757971 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407433.1 protein_id gnl|my_center|LOCUS_27540 2759622 2758711 gene locus_tag LOCUS_27550 gene opcA 2759622 2758711 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407437.1 protein_id gnl|my_center|LOCUS_27550 2761225 2759672 gene locus_tag LOCUS_27560 gene zwf 2761225 2759672 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407443.1 protein_id gnl|my_center|LOCUS_27560 2762343 2761222 gene locus_tag LOCUS_27570 gene tal 2762343 2761222 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407447.1 protein_id gnl|my_center|LOCUS_27570 2764461 2762359 gene locus_tag LOCUS_27580 gene tkt 2764461 2762359 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407451.1 protein_id gnl|my_center|LOCUS_27580 2764839 2765723 gene locus_tag LOCUS_27590 2764839 2765723 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898882.1 protein_id gnl|my_center|LOCUS_27590 2766650 2765802 gene locus_tag LOCUS_27600 2766650 2765802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2767169 2766660 gene locus_tag LOCUS_27610 2767169 2766660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 2767578 2771246 gene locus_tag LOCUS_27620 gene otsB 2767578 2771246 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410063.1 protein_id gnl|my_center|LOCUS_27620 2771466 2772722 gene locus_tag LOCUS_27630 2771466 2772722 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904629.1 protein_id gnl|my_center|LOCUS_27630 2773786 2772776 gene locus_tag LOCUS_27640 2773786 2772776 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407462.1 protein_id gnl|my_center|LOCUS_27640 2773785 2774639 gene locus_tag LOCUS_27650 2773785 2774639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900341.1 protein_id gnl|my_center|LOCUS_27650 2775545 2774589 gene locus_tag LOCUS_27660 2775545 2774589 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407466.1 protein_id gnl|my_center|LOCUS_27660 2776376 2775588 gene locus_tag LOCUS_27670 2776376 2775588 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407475.1 protein_id gnl|my_center|LOCUS_27670 2777332 2776373 gene locus_tag LOCUS_27680 2777332 2776373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407477.1 protein_id gnl|my_center|LOCUS_27680 2779146 2777329 gene locus_tag LOCUS_27690 gene mptB 2779146 2777329 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407479.1 protein_id gnl|my_center|LOCUS_27690 2779757 2779686 gene locus_tag LOCUS_t00240 2779757 2779686 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2780008 2781453 gene locus_tag LOCUS_27700 gene sufB 2780008 2781453 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057833.1 protein_id gnl|my_center|LOCUS_27700 2781450 2782649 gene locus_tag LOCUS_27710 gene sufD 2781450 2782649 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407487.1 protein_id gnl|my_center|LOCUS_27710 2782646 2783428 gene locus_tag LOCUS_27720 gene sufC 2782646 2783428 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907828.1 protein_id gnl|my_center|LOCUS_27720 2783431 2784684 gene locus_tag LOCUS_27730 2783431 2784684 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407490.1 protein_id gnl|my_center|LOCUS_27730 2784687 2785178 gene locus_tag LOCUS_27740 2784687 2785178 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407491.1 protein_id gnl|my_center|LOCUS_27740 2785171 2785518 gene locus_tag LOCUS_27750 2785171 2785518 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407492.1 protein_id gnl|my_center|LOCUS_27750 2785715 2786104 gene locus_tag LOCUS_27760 2785715 2786104 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_27760 2786019 2786585 gene locus_tag LOCUS_27770 2786019 2786585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 2786600 2788105 gene locus_tag LOCUS_27780 2786600 2788105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2789946 2788117 gene locus_tag LOCUS_27790 2789946 2788117 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900343.1 protein_id gnl|my_center|LOCUS_27790 2791047 2790052 gene locus_tag LOCUS_27800 2791047 2790052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 2791511 2793376 gene locus_tag LOCUS_27810 gene ctpD 2791511 2793376 CDS product cobalt-translocating P-type ATPase CtpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900344.1 protein_id gnl|my_center|LOCUS_27810 2793471 2793827 gene locus_tag LOCUS_27820 2793471 2793827 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900345.1 protein_id gnl|my_center|LOCUS_27820 2793893 2794222 gene locus_tag LOCUS_27830 gene trxA 2793893 2794222 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407501.1 protein_id gnl|my_center|LOCUS_27830 2794307 2795116 gene locus_tag LOCUS_27840 2794307 2795116 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407504.1 protein_id gnl|my_center|LOCUS_27840 2795141 2796769 gene locus_tag LOCUS_27850 2795141 2796769 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407507.1 protein_id gnl|my_center|LOCUS_27850 2796854 2797045 gene locus_tag LOCUS_27860 2796854 2797045 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407511.1 protein_id gnl|my_center|LOCUS_27860 2797610 2797047 gene locus_tag LOCUS_27870 2797610 2797047 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407514.1 protein_id gnl|my_center|LOCUS_27870 2800439 2797620 gene locus_tag LOCUS_27880 gene acn 2800439 2797620 CDS product iron-regulated aconitate hydratase Acn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898889.1 protein_id gnl|my_center|LOCUS_27880 2800742 2801293 gene locus_tag LOCUS_27890 2800742 2801293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407520.1 protein_id gnl|my_center|LOCUS_27890 2801630 2802934 gene locus_tag LOCUS_27900 gene ripA 2801630 2802934 CDS product NlpC/P60 family peptidoglycan endopeptidase RipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407523.1 protein_id gnl|my_center|LOCUS_27900 2802960 2803679 gene locus_tag LOCUS_27910 gene ripB 2802960 2803679 CDS product NlpC/P60 family peptidoglycan endopeptidase RipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407525.1 protein_id gnl|my_center|LOCUS_27910 2803878 2804993 gene locus_tag LOCUS_27920 2803878 2804993 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407527.1 protein_id gnl|my_center|LOCUS_27920 2804990 2805964 gene locus_tag LOCUS_27930 2804990 2805964 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407529.1 protein_id gnl|my_center|LOCUS_27930 2805999 2807006 gene locus_tag LOCUS_27940 2805999 2807006 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407530.1 protein_id gnl|my_center|LOCUS_27940 2807121 2807888 gene locus_tag LOCUS_27950 gene fabG1 2807121 2807888 CDS product 3-oxoacyl-ACP reductase FabG1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898892.1 protein_id gnl|my_center|LOCUS_27950 2807967 2808776 gene locus_tag LOCUS_27960 gene inhA 2807967 2808776 CDS product NADH-dependent enoyl-ACP reductase InhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407553.1 protein_id gnl|my_center|LOCUS_27960 2808783 2809805 gene locus_tag LOCUS_27970 2808783 2809805 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407559.1 protein_id gnl|my_center|LOCUS_27970 2810735 2809812 gene locus_tag LOCUS_27980 2810735 2809812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902086.1 protein_id gnl|my_center|LOCUS_27980 2810820 2811254 gene locus_tag LOCUS_27990 2810820 2811254 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407562.1 protein_id gnl|my_center|LOCUS_27990 2811276 2812430 gene locus_tag LOCUS_28000 2811276 2812430 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407571.1 protein_id gnl|my_center|LOCUS_28000 2812427 2812783 gene locus_tag LOCUS_28010 2812427 2812783 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900347.1 protein_id gnl|my_center|LOCUS_28010 2813247 2812780 gene locus_tag LOCUS_28020 2813247 2812780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 2813894 2813280 gene locus_tag LOCUS_28030 2813894 2813280 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005097973.1 protein_id gnl|my_center|LOCUS_28030 2814769 2815512 gene locus_tag LOCUS_28040 2814769 2815512 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225438.1 protein_id gnl|my_center|LOCUS_28040 2815512 2817032 gene locus_tag LOCUS_28050 2815512 2817032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 2818008 2817037 gene locus_tag LOCUS_28060 2818008 2817037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 2818852 2818073 gene locus_tag LOCUS_28070 2818852 2818073 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407583.1 protein_id gnl|my_center|LOCUS_28070 2819039 2820916 gene locus_tag LOCUS_28080 gene mutA 2819039 2820916 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407585.1 protein_id gnl|my_center|LOCUS_28080 2820922 2823183 gene locus_tag LOCUS_28090 gene scpA 2820922 2823183 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728858.1 protein_id gnl|my_center|LOCUS_28090 2823272 2824261 gene locus_tag LOCUS_28100 gene meaB 2823272 2824261 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407596.1 protein_id gnl|my_center|LOCUS_28100 2824481 2825611 gene locus_tag LOCUS_28110 2824481 2825611 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407599.1 protein_id gnl|my_center|LOCUS_28110 2825843 2825631 gene locus_tag LOCUS_28120 2825843 2825631 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898900.1 protein_id gnl|my_center|LOCUS_28120 2826672 2825971 gene locus_tag LOCUS_28130 2826672 2825971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 2827275 2826709 gene locus_tag LOCUS_28140 2827275 2826709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 2827579 2827190 gene locus_tag LOCUS_28150 2827579 2827190 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_28150 2828597 2827941 gene locus_tag LOCUS_28160 2828597 2827941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 2830771 2828651 gene locus_tag LOCUS_28170 2830771 2828651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28170 2834866 2830874 gene locus_tag LOCUS_28180 2834866 2830874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28180 2834983 2835264 gene locus_tag LOCUS_28190 2834983 2835264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28190 2835306 2836055 gene locus_tag LOCUS_28200 2835306 2836055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28200 2837056 2836124 gene locus_tag LOCUS_28210 2837056 2836124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 2837127 2837516 gene locus_tag LOCUS_28220 2837127 2837516 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_28220 2837431 2837997 gene locus_tag LOCUS_28230 2837431 2837997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 2838347 2838105 gene locus_tag LOCUS_28240 2838347 2838105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 2838816 2839379 gene locus_tag LOCUS_28250 2838816 2839379 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407692.1 protein_id gnl|my_center|LOCUS_28250 2839581 2840645 gene locus_tag LOCUS_28260 2839581 2840645 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 protein_id gnl|my_center|LOCUS_28260 2841278 2841511 gene locus_tag LOCUS_28270 2841278 2841511 CDS product Rv1535 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407710.1 protein_id gnl|my_center|LOCUS_28270 2841770 2842537 gene locus_tag LOCUS_28280 2841770 2842537 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407672.1 protein_id gnl|my_center|LOCUS_28280 2843254 2842583 gene locus_tag LOCUS_28290 2843254 2842583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 2843356 2844105 gene locus_tag LOCUS_28300 2843356 2844105 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582495.1 protein_id gnl|my_center|LOCUS_28300 2844973 2844224 gene locus_tag LOCUS_28310 2844973 2844224 CDS product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906617.1 protein_id gnl|my_center|LOCUS_28310 2846230 2844986 gene locus_tag LOCUS_28320 2846230 2844986 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908847.1 protein_id gnl|my_center|LOCUS_28320 2846611 2846294 gene locus_tag LOCUS_28330 2846611 2846294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28330 2847667 2846708 gene locus_tag LOCUS_28340 2847667 2846708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28340 2849190 2847682 gene locus_tag LOCUS_28350 2849190 2847682 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730043.1 protein_id gnl|my_center|LOCUS_28350 2849444 2849178 gene locus_tag LOCUS_28360 2849444 2849178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 2849889 2853089 gene locus_tag LOCUS_28370 gene ileS 2849889 2853089 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407714.1 protein_id gnl|my_center|LOCUS_28370 2853357 2853094 gene locus_tag LOCUS_28380 2853357 2853094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28380 2854610 2854188 gene locus_tag LOCUS_28390 2854610 2854188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28390 2854832 2856229 gene locus_tag LOCUS_28400 2854832 2856229 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904641.1 protein_id gnl|my_center|LOCUS_28400 2857150 2856194 gene locus_tag LOCUS_28410 2857150 2856194 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407720.1 protein_id gnl|my_center|LOCUS_28410 2857226 2857816 gene locus_tag LOCUS_28420 gene lspA 2857226 2857816 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407722.1 protein_id gnl|my_center|LOCUS_28420 2857831 2858742 gene locus_tag LOCUS_28430 2857831 2858742 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407723.1 protein_id gnl|my_center|LOCUS_28430 2859521 2858751 gene locus_tag LOCUS_28440 2859521 2858751 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898940.1 protein_id gnl|my_center|LOCUS_28440 2860450 2859815 gene locus_tag LOCUS_28450 2860450 2859815 CDS product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407725.1 protein_id gnl|my_center|LOCUS_28450 2860944 2860534 gene locus_tag LOCUS_28460 gene glbN 2860944 2860534 CDS product group 1 truncated hemoglobin GlbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407730.1 protein_id gnl|my_center|LOCUS_28460 2861183 2862199 gene locus_tag LOCUS_28470 2861183 2862199 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407734.1 protein_id gnl|my_center|LOCUS_28470 2862269 2863000 gene locus_tag LOCUS_28480 2862269 2863000 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_28480 2863120 2863551 gene locus_tag LOCUS_28490 2863120 2863551 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407748.1 protein_id gnl|my_center|LOCUS_28490 2863619 2867161 gene locus_tag LOCUS_28500 gene dnaE 2863619 2867161 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407751.1 protein_id gnl|my_center|LOCUS_28500 2867336 2869162 gene locus_tag LOCUS_28510 gene fadD11 2867336 2869162 CDS product fatty acid--CoA ligase FadD11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041180066.1 protein_id gnl|my_center|LOCUS_28510 2869177 2871051 gene locus_tag LOCUS_28520 2869177 2871051 CDS product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407762.1 protein_id gnl|my_center|LOCUS_28520 2871112 2871501 gene locus_tag LOCUS_28530 2871112 2871501 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_28530 2871416 2871982 gene locus_tag LOCUS_28540 2871416 2871982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 2872223 2871993 gene locus_tag LOCUS_28550 2872223 2871993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 2872326 2872763 gene locus_tag LOCUS_28560 2872326 2872763 CDS product F420H(2)-dependent quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407780.1 protein_id gnl|my_center|LOCUS_28560 2872797 2874077 gene locus_tag LOCUS_28570 gene ilvA 2872797 2874077 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407781.1 protein_id gnl|my_center|LOCUS_28570 2874749 2874105 gene locus_tag LOCUS_28580 2874749 2874105 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_28580 2874791 2876116 gene locus_tag LOCUS_28590 2874791 2876116 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 protein_id gnl|my_center|LOCUS_28590 2877892 2876129 gene locus_tag LOCUS_28600 gene treZ 2877892 2876129 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950559.1 protein_id gnl|my_center|LOCUS_28600 2880186 2877889 gene locus_tag LOCUS_28610 gene treY 2880186 2877889 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407790.1 protein_id gnl|my_center|LOCUS_28610 2882367 2880190 gene locus_tag LOCUS_28620 gene glgX 2882367 2880190 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898930.1 protein_id gnl|my_center|LOCUS_28620 2884632 2882467 gene locus_tag LOCUS_28630 2884632 2882467 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407794.1 protein_id gnl|my_center|LOCUS_28630 2885507 2884740 gene locus_tag LOCUS_28640 gene ripD 2885507 2884740 CDS product NlpC/P60 family peptidoglycan-binding protein RipD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407798.1 protein_id gnl|my_center|LOCUS_28640 2886305 2885853 gene locus_tag LOCUS_28650 2886305 2885853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 2886420 2887703 gene locus_tag LOCUS_28660 2886420 2887703 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908201.1 protein_id gnl|my_center|LOCUS_28660 2887710 2888879 gene locus_tag LOCUS_28670 2887710 2888879 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407805.1 protein_id gnl|my_center|LOCUS_28670 2888876 2889556 gene locus_tag LOCUS_28680 gene bioD 2888876 2889556 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407806.1 protein_id gnl|my_center|LOCUS_28680 2889558 2890067 gene locus_tag LOCUS_28690 2889558 2890067 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407809.1 protein_id gnl|my_center|LOCUS_28690 2890268 2891269 gene locus_tag LOCUS_28700 gene bioB 2890268 2891269 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898934.1 protein_id gnl|my_center|LOCUS_28700 2891285 2891512 gene locus_tag LOCUS_28710 2891285 2891512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407914.1 protein_id gnl|my_center|LOCUS_28710 2891509 2892207 gene locus_tag LOCUS_28720 2891509 2892207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 2893608 2892253 gene locus_tag LOCUS_28730 2893608 2892253 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407926.1 protein_id gnl|my_center|LOCUS_28730 2894561 2893950 gene locus_tag LOCUS_28740 2894561 2893950 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898937.1 protein_id gnl|my_center|LOCUS_28740 2894705 2895763 gene locus_tag LOCUS_28750 gene nadA 2894705 2895763 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407931.1 protein_id gnl|my_center|LOCUS_28750 2895760 2897334 gene locus_tag LOCUS_28760 2895760 2897334 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901204.1 protein_id gnl|my_center|LOCUS_28760 2897334 2898191 gene locus_tag LOCUS_28770 gene nadC 2897334 2898191 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407935.1 protein_id gnl|my_center|LOCUS_28770 2898663 2898253 gene locus_tag LOCUS_28780 2898663 2898253 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407939.1 protein_id gnl|my_center|LOCUS_28780 2898808 2900091 gene locus_tag LOCUS_28790 gene hisD 2898808 2900091 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900373.1 protein_id gnl|my_center|LOCUS_28790 2900088 2901236 gene locus_tag LOCUS_28800 2900088 2901236 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407947.1 protein_id gnl|my_center|LOCUS_28800 2901233 2901865 gene locus_tag LOCUS_28810 gene hisB 2901233 2901865 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407950.1 protein_id gnl|my_center|LOCUS_28810 2901862 2902494 gene locus_tag LOCUS_28820 gene hisH 2901862 2902494 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407952.1 protein_id gnl|my_center|LOCUS_28820 2902506 2903240 gene locus_tag LOCUS_28830 gene priA 2902506 2903240 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900374.1 protein_id gnl|my_center|LOCUS_28830 2903247 2904059 gene locus_tag LOCUS_28840 2903247 2904059 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911572.1 protein_id gnl|my_center|LOCUS_28840 2904061 2904846 gene locus_tag LOCUS_28850 gene hisF 2904061 2904846 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898942.1 protein_id gnl|my_center|LOCUS_28850 2904843 2905178 gene locus_tag LOCUS_28860 gene hisI 2904843 2905178 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407963.1 protein_id gnl|my_center|LOCUS_28860 2906392 2905301 gene locus_tag LOCUS_28870 2906392 2905301 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389734.1 protein_id gnl|my_center|LOCUS_28870 2906741 2906397 gene locus_tag LOCUS_28880 2906741 2906397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 2908967 2906763 gene locus_tag LOCUS_28890 2908967 2906763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 2911699 2908964 gene locus_tag LOCUS_28900 gene cphA 2911699 2908964 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021315.1 protein_id gnl|my_center|LOCUS_28900 2912293 2913786 gene locus_tag LOCUS_28910 2912293 2913786 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411955.1 protein_id gnl|my_center|LOCUS_28910 2915612 2914098 gene locus_tag LOCUS_28920 2915612 2914098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 2915856 2916938 gene locus_tag LOCUS_28930 2915856 2916938 CDS product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898943.1 protein_id gnl|my_center|LOCUS_28930 2917492 2916965 gene locus_tag LOCUS_28940 gene bcpB 2917492 2916965 CDS product peroxiredoxin BcpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407974.1 protein_id gnl|my_center|LOCUS_28940 2917474 2919012 gene locus_tag LOCUS_28950 2917474 2919012 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407977.1 protein_id gnl|my_center|LOCUS_28950 2919053 2919700 gene locus_tag LOCUS_28960 2919053 2919700 CDS product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407980.1 protein_id gnl|my_center|LOCUS_28960 2919790 2920608 gene locus_tag LOCUS_28970 gene trpC 2919790 2920608 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407990.1 protein_id gnl|my_center|LOCUS_28970 2920641 2921921 gene locus_tag LOCUS_28980 gene trpB 2920641 2921921 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016721143.1 protein_id gnl|my_center|LOCUS_28980 2921924 2922733 gene locus_tag LOCUS_28990 gene trpA 2921924 2922733 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407999.1 protein_id gnl|my_center|LOCUS_28990 2922730 2924523 gene locus_tag LOCUS_29000 2922730 2924523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 2924573 2924971 gene locus_tag LOCUS_29010 2924573 2924971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 2925035 2925352 gene locus_tag LOCUS_29020 2925035 2925352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 2925915 2925349 gene locus_tag LOCUS_29030 2925915 2925349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29030 2926219 2925830 gene locus_tag LOCUS_29040 2926219 2925830 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_29040 2926525 2928024 gene locus_tag LOCUS_29050 2926525 2928024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 2928021 2928833 gene locus_tag LOCUS_29060 gene istB 2928021 2928833 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_29060 2929053 2928859 gene locus_tag LOCUS_29070 2929053 2928859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 2929012 2929359 gene locus_tag LOCUS_29080 2929012 2929359 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408005.1 protein_id gnl|my_center|LOCUS_29080 2929992 2929381 gene locus_tag LOCUS_29090 2929992 2929381 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519559.1 protein_id gnl|my_center|LOCUS_29090 2930394 2931959 gene locus_tag LOCUS_29100 gene pyk 2930394 2931959 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898945.1 protein_id gnl|my_center|LOCUS_29100 2932059 2932964 gene locus_tag LOCUS_29110 gene tesB 2932059 2932964 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408017.1 protein_id gnl|my_center|LOCUS_29110 2933096 2934496 gene locus_tag LOCUS_29120 2933096 2934496 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900378.1 protein_id gnl|my_center|LOCUS_29120 2936152 2934458 gene locus_tag LOCUS_29130 gene cydC 2936152 2934458 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908715.1 protein_id gnl|my_center|LOCUS_29130 2937581 2936139 gene locus_tag LOCUS_29140 gene cydD 2937581 2936139 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408022.1 protein_id gnl|my_center|LOCUS_29140 2937478 2937753 gene locus_tag LOCUS_29150 2937478 2937753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 2938864 2937824 gene locus_tag LOCUS_29160 gene cydB 2938864 2937824 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408024.1 protein_id gnl|my_center|LOCUS_29160 2940267 2938912 gene locus_tag LOCUS_29170 2940267 2938912 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408027.1 protein_id gnl|my_center|LOCUS_29170 2940552 2940767 gene locus_tag LOCUS_29180 2940552 2940767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 2940914 2941303 gene locus_tag LOCUS_29190 2940914 2941303 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_29190 2941218 2941784 gene locus_tag LOCUS_29200 2941218 2941784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 2941816 2942748 gene locus_tag LOCUS_29210 2941816 2942748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 2943386 2942850 gene locus_tag LOCUS_29220 2943386 2942850 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408030.1 protein_id gnl|my_center|LOCUS_29220 2944831 2943491 gene locus_tag LOCUS_29230 gene cya 2944831 2943491 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408035.1 protein_id gnl|my_center|LOCUS_29230 2945006 2944930 gene locus_tag LOCUS_t00250 2945006 2944930 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2945124 2945750 gene locus_tag LOCUS_29240 2945124 2945750 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408045.1 protein_id gnl|my_center|LOCUS_29240 2946997 2945795 gene locus_tag LOCUS_29250 2946997 2945795 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408054.1 protein_id gnl|my_center|LOCUS_29250 2947437 2946997 gene locus_tag LOCUS_29260 2947437 2946997 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408058.1 protein_id gnl|my_center|LOCUS_29260 2947583 2950240 gene locus_tag LOCUS_29270 gene polA 2947583 2950240 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408063.1 protein_id gnl|my_center|LOCUS_29270 2950622 2952067 gene locus_tag LOCUS_29280 gene rpsA 2950622 2952067 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408066.1 protein_id gnl|my_center|LOCUS_29280 2952080 2953306 gene locus_tag LOCUS_29290 gene coaE 2952080 2953306 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408069.1 protein_id gnl|my_center|LOCUS_29290 2953960 2953424 gene locus_tag LOCUS_29300 2953960 2953424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 2954499 2954023 gene locus_tag LOCUS_29310 2954499 2954023 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519677.1 protein_id gnl|my_center|LOCUS_29310 2954649 2956829 gene locus_tag LOCUS_29320 gene uvrB 2954649 2956829 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911575.1 protein_id gnl|my_center|LOCUS_29320 2956866 2958278 gene locus_tag LOCUS_29330 2956866 2958278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898954.1 protein_id gnl|my_center|LOCUS_29330 2959835 2958267 gene locus_tag LOCUS_29340 2959835 2958267 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408080.1 protein_id gnl|my_center|LOCUS_29340 2960157 2960597 gene locus_tag LOCUS_29350 2960157 2960597 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408085.1 protein_id gnl|my_center|LOCUS_29350 2961255 2961004 gene locus_tag LOCUS_29360 2961255 2961004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 2961424 2964849 gene locus_tag LOCUS_29370 2961424 2964849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 2964815 2965201 gene locus_tag LOCUS_29380 2964815 2965201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 2965400 2965594 gene locus_tag LOCUS_29390 2965400 2965594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 2965885 2965676 gene locus_tag LOCUS_29400 2965885 2965676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 2967544 2966426 gene locus_tag LOCUS_29410 2967544 2966426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 2968368 2967541 gene locus_tag LOCUS_29420 2968368 2967541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 2969259 2968447 gene locus_tag LOCUS_29430 2969259 2968447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 2969510 2969256 gene locus_tag LOCUS_29440 2969510 2969256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 2970334 2969657 gene locus_tag LOCUS_29450 2970334 2969657 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898956.1 protein_id gnl|my_center|LOCUS_29450 2970530 2973445 gene locus_tag LOCUS_29460 gene uvrA 2970530 2973445 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408092.1 protein_id gnl|my_center|LOCUS_29460 2973715 2973488 gene locus_tag LOCUS_29470 2973715 2973488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 2973961 2973737 gene locus_tag LOCUS_29480 2973961 2973737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 2975169 2974309 gene locus_tag LOCUS_29490 2975169 2974309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29490 2975416 2975162 gene locus_tag LOCUS_29500 2975416 2975162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408096.1 protein_id gnl|my_center|LOCUS_29500 2976749 2975553 gene locus_tag LOCUS_29510 2976749 2975553 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408099.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29510 2980361 2977044 gene locus_tag LOCUS_29520 gene lysX 2980361 2977044 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408102.1 protein_id gnl|my_center|LOCUS_29520 2980875 2981378 gene locus_tag LOCUS_29530 gene infC 2980875 2981378 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901217.1 protein_id gnl|my_center|LOCUS_29530 2981409 2981603 gene locus_tag LOCUS_29540 gene rpmI 2981409 2981603 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408106.1 protein_id gnl|my_center|LOCUS_29540 2981674 2982063 gene locus_tag LOCUS_29550 gene rplT 2981674 2982063 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408108.1 protein_id gnl|my_center|LOCUS_29550 2982141 2982968 gene locus_tag LOCUS_29560 2982141 2982968 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408112.1 protein_id gnl|my_center|LOCUS_29560 2984024 2982972 gene locus_tag LOCUS_29570 2984024 2982972 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408141.1 protein_id gnl|my_center|LOCUS_29570 2984366 2985307 gene locus_tag LOCUS_29580 2984366 2985307 CDS product PE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900384.1 protein_id gnl|my_center|LOCUS_29580 2985577 2986329 gene locus_tag LOCUS_29590 2985577 2986329 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916840.1 protein_id gnl|my_center|LOCUS_29590 2986339 2987121 gene locus_tag LOCUS_29600 2986339 2987121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408145.1 protein_id gnl|my_center|LOCUS_29600 2987379 2988422 gene locus_tag LOCUS_29610 gene pheS 2987379 2988422 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901219.1 protein_id gnl|my_center|LOCUS_29610 2988422 2990911 gene locus_tag LOCUS_29620 gene pheT 2988422 2990911 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901220.1 protein_id gnl|my_center|LOCUS_29620 2991147 2993129 gene locus_tag LOCUS_29630 2991147 2993129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 2993424 2994938 gene locus_tag LOCUS_29640 2993424 2994938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 2996413 2995847 gene locus_tag LOCUS_29650 2996413 2995847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 2996717 2996328 gene locus_tag LOCUS_29660 2996717 2996328 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_29660 2996963 2997241 gene locus_tag LOCUS_29670 2996963 2997241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 2997410 2997799 gene locus_tag LOCUS_29680 2997410 2997799 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_29680 2997714 2998280 gene locus_tag LOCUS_29690 2997714 2998280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 2998782 2998423 gene locus_tag LOCUS_29700 2998782 2998423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416355.1 protein_id gnl|my_center|LOCUS_29700 2999456 2998734 gene locus_tag LOCUS_29710 2999456 2998734 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950834.1 protein_id gnl|my_center|LOCUS_29710 2999711 2999469 gene locus_tag LOCUS_29720 2999711 2999469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 2999828 3000880 gene locus_tag LOCUS_29730 gene argC 2999828 3000880 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898960.1 protein_id gnl|my_center|LOCUS_29730 3000944 3002167 gene locus_tag LOCUS_29740 gene argJ 3000944 3002167 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408160.1 protein_id gnl|my_center|LOCUS_29740 3002164 3003045 gene locus_tag LOCUS_29750 gene argB 3002164 3003045 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408161.1 protein_id gnl|my_center|LOCUS_29750 3003042 3004232 gene locus_tag LOCUS_29760 3003042 3004232 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408163.1 protein_id gnl|my_center|LOCUS_29760 3004229 3005155 gene locus_tag LOCUS_29770 gene argF 3004229 3005155 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408165.1 protein_id gnl|my_center|LOCUS_29770 3005152 3005652 gene locus_tag LOCUS_29780 3005152 3005652 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908325.1 protein_id gnl|my_center|LOCUS_29780 3005701 3006897 gene locus_tag LOCUS_29790 3005701 3006897 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408179.1 protein_id gnl|my_center|LOCUS_29790 3006992 3008404 gene locus_tag LOCUS_29800 gene argH 3006992 3008404 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408180.1 protein_id gnl|my_center|LOCUS_29800 3008508 3009569 gene locus_tag LOCUS_29810 3008508 3009569 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408181.1 protein_id gnl|my_center|LOCUS_29810 3009704 3015001 gene locus_tag LOCUS_29820 3009704 3015001 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900387.1 protein_id gnl|my_center|LOCUS_29820 3015031 3015420 gene locus_tag LOCUS_29830 3015031 3015420 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_29830 3015335 3015901 gene locus_tag LOCUS_29840 3015335 3015901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 3015921 3016997 gene locus_tag LOCUS_29850 3015921 3016997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 3017018 3017521 gene locus_tag LOCUS_29860 3017018 3017521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29860 3017552 3020500 gene locus_tag LOCUS_29870 3017552 3020500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29870 3020525 3021010 gene locus_tag LOCUS_29880 3020525 3021010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29880 3021007 3023361 gene locus_tag LOCUS_29890 3021007 3023361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29890 3023367 3025451 gene locus_tag LOCUS_29900 3023367 3025451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29900 3025515 3026456 gene locus_tag LOCUS_29910 3025515 3026456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29910 3026610 3027671 gene locus_tag LOCUS_29920 3026610 3027671 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408248.1 protein_id gnl|my_center|LOCUS_29920 3028955 3027654 gene locus_tag LOCUS_29930 3028955 3027654 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901231.1 protein_id gnl|my_center|LOCUS_29930 3030721 3028952 gene locus_tag LOCUS_29940 3030721 3028952 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408257.1 protein_id gnl|my_center|LOCUS_29940 3031159 3031599 gene locus_tag LOCUS_29950 3031159 3031599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 3031761 3032873 gene locus_tag LOCUS_29960 3031761 3032873 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409545.1 protein_id gnl|my_center|LOCUS_29960 3033481 3033870 gene locus_tag LOCUS_29970 3033481 3033870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 3033938 3034183 gene locus_tag LOCUS_29980 3033938 3034183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 3034413 3034622 gene locus_tag LOCUS_29990 3034413 3034622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 3034537 3035103 gene locus_tag LOCUS_30000 3034537 3035103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 3035628 3035479 gene locus_tag LOCUS_30010 3035628 3035479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 3036283 3035987 gene locus_tag LOCUS_30020 3036283 3035987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30020 3036829 3036341 gene locus_tag LOCUS_30030 3036829 3036341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30030 3037022 3037249 gene locus_tag LOCUS_30040 3037022 3037249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 3037623 3037246 gene locus_tag LOCUS_30050 3037623 3037246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 3038272 3037637 gene locus_tag LOCUS_30060 3038272 3037637 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 protein_id gnl|my_center|LOCUS_30060 3038338 3038580 gene locus_tag LOCUS_30070 3038338 3038580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 3038593 3039315 gene locus_tag LOCUS_30080 3038593 3039315 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950834.1 protein_id gnl|my_center|LOCUS_30080 3039267 3039626 gene locus_tag LOCUS_30090 3039267 3039626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416355.1 protein_id gnl|my_center|LOCUS_30090 3040401 3043385 gene locus_tag LOCUS_30100 3040401 3043385 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408360.1 protein_id gnl|my_center|LOCUS_30100 3043378 3043611 gene locus_tag LOCUS_30110 3043378 3043611 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408362.1 protein_id gnl|my_center|LOCUS_30110 3044228 3043800 gene locus_tag LOCUS_30120 3044228 3043800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3045570 3044266 gene locus_tag LOCUS_30130 3045570 3044266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 3046409 3045642 gene locus_tag LOCUS_30140 3046409 3045642 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898975.1 protein_id gnl|my_center|LOCUS_30140 3046432 3047079 gene locus_tag LOCUS_30150 3046432 3047079 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618252.1 protein_id gnl|my_center|LOCUS_30150 3047148 3048383 gene locus_tag LOCUS_30160 gene tyrS 3047148 3048383 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408375.1 protein_id gnl|my_center|LOCUS_30160 3051076 3049259 gene locus_tag LOCUS_30170 3051076 3049259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 3052105 3051503 gene locus_tag LOCUS_30180 3052105 3051503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 3052524 3052051 gene locus_tag LOCUS_30190 3052524 3052051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 3053201 3052452 gene locus_tag LOCUS_30200 3053201 3052452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 3053736 3054152 gene locus_tag LOCUS_30210 3053736 3054152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 3055645 3054050 gene locus_tag LOCUS_30220 3055645 3054050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30220 3056057 3055830 gene locus_tag LOCUS_30230 3056057 3055830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 3056124 3056513 gene locus_tag LOCUS_30240 3056124 3056513 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_30240 3056428 3056994 gene locus_tag LOCUS_30250 3056428 3056994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 3057094 3057327 gene locus_tag LOCUS_30260 3057094 3057327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 3058267 3057338 gene locus_tag LOCUS_30270 3058267 3057338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30270 3059526 3058264 gene locus_tag LOCUS_30280 3059526 3058264 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898850.1 protein_id gnl|my_center|LOCUS_30280 3060162 3060554 gene locus_tag LOCUS_30290 gene lprJ 3060162 3060554 CDS product lipoprotein LprJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408378.1 protein_id gnl|my_center|LOCUS_30290 3060798 3061448 gene locus_tag LOCUS_30300 3060798 3061448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408379.1 protein_id gnl|my_center|LOCUS_30300 3061451 3062461 gene locus_tag LOCUS_30310 3061451 3062461 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408380.1 protein_id gnl|my_center|LOCUS_30310 3062486 3062662 gene locus_tag LOCUS_30320 3062486 3062662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408381.1 protein_id gnl|my_center|LOCUS_30320 3062670 3063515 gene locus_tag LOCUS_30330 gene tlyA 3062670 3063515 CDS product 16S/23S rRNA (cytidine-2'-O)-methyltransferase TlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408382.1 protein_id gnl|my_center|LOCUS_30330 3063512 3064435 gene locus_tag LOCUS_30340 3063512 3064435 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408383.1 protein_id gnl|my_center|LOCUS_30340 3064448 3066193 gene locus_tag LOCUS_30350 gene recN 3064448 3066193 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408385.1 protein_id gnl|my_center|LOCUS_30350 3066296 3067540 gene locus_tag LOCUS_30360 gene steA 3066296 3067540 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408387.1 protein_id gnl|my_center|LOCUS_30360 3067562 3068515 gene locus_tag LOCUS_30370 3067562 3068515 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908293.1 protein_id gnl|my_center|LOCUS_30370 3068752 3070404 gene locus_tag LOCUS_30380 3068752 3070404 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408396.1 protein_id gnl|my_center|LOCUS_30380 3070397 3071020 gene locus_tag LOCUS_30390 3070397 3071020 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408399.1 protein_id gnl|my_center|LOCUS_30390 3071017 3071958 gene locus_tag LOCUS_30400 gene xerD 3071017 3071958 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408401.1 protein_id gnl|my_center|LOCUS_30400 3072726 3071965 gene locus_tag LOCUS_30410 3072726 3071965 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014848103.1 protein_id gnl|my_center|LOCUS_30410 3072877 3074103 gene locus_tag LOCUS_30420 3072877 3074103 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_30420 3074196 3074951 gene locus_tag LOCUS_30430 3074196 3074951 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028852.1 protein_id gnl|my_center|LOCUS_30430 3074951 3076372 gene locus_tag LOCUS_30440 3074951 3076372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 3076369 3077220 gene locus_tag LOCUS_30450 3076369 3077220 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031017.1 protein_id gnl|my_center|LOCUS_30450 3077220 3078170 gene locus_tag LOCUS_30460 3077220 3078170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30460 3078095 3078337 gene locus_tag LOCUS_30470 3078095 3078337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30470 3078334 3079713 gene locus_tag LOCUS_30480 3078334 3079713 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_30480 3079814 3080830 gene locus_tag LOCUS_30490 3079814 3080830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 3081541 3080975 gene locus_tag LOCUS_30500 3081541 3080975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 3081845 3081456 gene locus_tag LOCUS_30510 3081845 3081456 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_30510 3083410 3081875 gene locus_tag LOCUS_30520 3083410 3081875 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 protein_id gnl|my_center|LOCUS_30520 3084697 3083516 gene locus_tag LOCUS_30530 3084697 3083516 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408416.1 protein_id gnl|my_center|LOCUS_30530 3086242 3084929 gene locus_tag LOCUS_30540 3086242 3084929 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898980.1 protein_id gnl|my_center|LOCUS_30540 3088436 3086673 gene locus_tag LOCUS_30550 3088436 3086673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30550 3090558 3088357 gene locus_tag LOCUS_30560 3090558 3088357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30560 3090837 3090607 gene locus_tag LOCUS_30570 3090837 3090607 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726914.1 protein_id gnl|my_center|LOCUS_30570 3092081 3090858 gene locus_tag LOCUS_30580 3092081 3090858 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973142.1 protein_id gnl|my_center|LOCUS_30580 3093337 3093999 gene locus_tag LOCUS_30590 3093337 3093999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 3094283 3095035 gene locus_tag LOCUS_30600 3094283 3095035 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898982.1 protein_id gnl|my_center|LOCUS_30600 3095032 3095859 gene locus_tag LOCUS_30610 3095032 3095859 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408432.1 protein_id gnl|my_center|LOCUS_30610 3095859 3096566 gene locus_tag LOCUS_30620 gene scpB 3095859 3096566 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408436.1 protein_id gnl|my_center|LOCUS_30620 3096566 3097327 gene locus_tag LOCUS_30630 3096566 3097327 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408439.1 protein_id gnl|my_center|LOCUS_30630 3097551 3098126 gene locus_tag LOCUS_30640 gene cmk 3097551 3098126 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408441.1 protein_id gnl|my_center|LOCUS_30640 3098123 3099532 gene locus_tag LOCUS_30650 gene der 3098123 3099532 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898984.1 protein_id gnl|my_center|LOCUS_30650 3099649 3099723 gene locus_tag LOCUS_t00260 3099649 3099723 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3100010 3100762 gene locus_tag LOCUS_30660 3100010 3100762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30660 3100779 3101564 gene locus_tag LOCUS_30670 3100779 3101564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 3101853 3101647 gene locus_tag LOCUS_30680 3101853 3101647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 3102316 3102711 gene locus_tag LOCUS_30690 3102316 3102711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30690 3103257 3103457 gene locus_tag LOCUS_30700 3103257 3103457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30700 3103507 3103896 gene locus_tag LOCUS_30710 3103507 3103896 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_30710 3103811 3104377 gene locus_tag LOCUS_30720 3103811 3104377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 3104904 3104374 gene locus_tag LOCUS_30730 3104904 3104374 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222967.1 protein_id gnl|my_center|LOCUS_30730 3106188 3104926 gene locus_tag LOCUS_30740 gene paaJ 3106188 3104926 CDS product bifunctional 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206197.1 protein_id gnl|my_center|LOCUS_30740 3106441 3106235 gene locus_tag LOCUS_30750 3106441 3106235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 3107550 3106528 gene locus_tag LOCUS_30760 3107550 3106528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 3107778 3107563 gene locus_tag LOCUS_30770 3107778 3107563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 3107922 3108671 gene locus_tag LOCUS_30780 gene rsmA 3107922 3108671 CDS product anti-sigma-M factor RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400148.1 protein_id gnl|my_center|LOCUS_30780 3108761 3109759 gene locus_tag LOCUS_30790 gene trxB 3108761 3109759 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900782.1 protein_id gnl|my_center|LOCUS_30790 3109756 3110109 gene locus_tag LOCUS_30800 gene trxA 3109756 3110109 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400164.1 protein_id gnl|my_center|LOCUS_30800 3111261 3110164 gene locus_tag LOCUS_30810 3111261 3110164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 3111489 3111274 gene locus_tag LOCUS_30820 3111489 3111274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3111825 3112916 gene locus_tag LOCUS_30830 3111825 3112916 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727498.1 protein_id gnl|my_center|LOCUS_30830 3113162 3113962 gene locus_tag LOCUS_30840 3113162 3113962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 3114201 3114908 gene locus_tag LOCUS_30850 3114201 3114908 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 protein_id gnl|my_center|LOCUS_30850 3114948 3115703 gene locus_tag LOCUS_30860 3114948 3115703 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_30860 3116521 3115712 gene locus_tag LOCUS_30870 3116521 3115712 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227032.1 protein_id gnl|my_center|LOCUS_30870 3118194 3116581 gene locus_tag LOCUS_30880 3118194 3116581 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896832.1 protein_id gnl|my_center|LOCUS_30880 3118600 3118782 gene locus_tag LOCUS_30890 3118600 3118782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 3119363 3119160 gene locus_tag LOCUS_30900 3119363 3119160 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891980.1 protein_id gnl|my_center|LOCUS_30900 3120748 3120963 gene locus_tag LOCUS_30910 3120748 3120963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 3120976 3122010 gene locus_tag LOCUS_30920 3120976 3122010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 3122864 3122394 gene locus_tag LOCUS_30930 3122864 3122394 CDS product DUF5994 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728985.1 protein_id gnl|my_center|LOCUS_30930 3124201 3125532 gene locus_tag LOCUS_30940 3124201 3125532 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067221857.1 protein_id gnl|my_center|LOCUS_30940 3127189 3125645 gene locus_tag LOCUS_30950 3127189 3125645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30950 3128160 3127111 gene locus_tag LOCUS_30960 3128160 3127111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30960 3128973 3128296 gene locus_tag LOCUS_30970 3128973 3128296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408495.1 protein_id gnl|my_center|LOCUS_30970 3129225 3130211 gene locus_tag LOCUS_30980 3129225 3130211 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782346.1 protein_id gnl|my_center|LOCUS_30980 3130485 3130937 gene locus_tag LOCUS_30990 3130485 3130937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30990 3131001 3131930 gene locus_tag LOCUS_31000 3131001 3131930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31000 3132989 3131934 gene locus_tag LOCUS_31010 3132989 3131934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 3134358 3133423 gene locus_tag LOCUS_31020 3134358 3133423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728926.1 protein_id gnl|my_center|LOCUS_31020 3134547 3136058 gene locus_tag LOCUS_31030 3134547 3136058 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729139.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31030 3136189 3137610 gene locus_tag LOCUS_31040 3136189 3137610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 3140984 3137655 gene locus_tag LOCUS_31050 gene pknK 3140984 3137655 CDS product serine/threonine protein kinase PknK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899905.1 protein_id gnl|my_center|LOCUS_31050 3141123 3141365 gene locus_tag LOCUS_31060 3141123 3141365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 3141378 3142412 gene locus_tag LOCUS_31070 3141378 3142412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3143121 3142555 gene locus_tag LOCUS_31080 3143121 3142555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 3143425 3143036 gene locus_tag LOCUS_31090 3143425 3143036 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_31090 3143846 3143475 gene locus_tag LOCUS_31100 3143846 3143475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 3144191 3145576 gene locus_tag LOCUS_31110 3144191 3145576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31110 3145626 3146648 gene locus_tag LOCUS_31120 3145626 3146648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31120 3146645 3148012 gene locus_tag LOCUS_31130 3146645 3148012 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_31130 3148048 3148842 gene locus_tag LOCUS_31140 3148048 3148842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898997.1 protein_id gnl|my_center|LOCUS_31140 3149071 3150897 gene locus_tag LOCUS_31150 gene pknE 3149071 3150897 CDS product serine/threonine protein kinase PknE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898998.1 protein_id gnl|my_center|LOCUS_31150 3150967 3152322 gene locus_tag LOCUS_31160 3150967 3152322 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729279.1 protein_id gnl|my_center|LOCUS_31160 3153828 3152332 gene locus_tag LOCUS_31170 3153828 3152332 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082592.1 protein_id gnl|my_center|LOCUS_31170 3154074 3154796 gene locus_tag LOCUS_31180 3154074 3154796 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095681.1 protein_id gnl|my_center|LOCUS_31180 3154866 3157229 gene locus_tag LOCUS_31190 3154866 3157229 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296438.1 protein_id gnl|my_center|LOCUS_31190 3157445 3158914 gene locus_tag LOCUS_31200 3157445 3158914 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408678.1 protein_id gnl|my_center|LOCUS_31200 3160047 3158923 gene locus_tag LOCUS_31210 3160047 3158923 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104228.1 protein_id gnl|my_center|LOCUS_31210 3160907 3160044 gene locus_tag LOCUS_31220 3160907 3160044 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742172.1 protein_id gnl|my_center|LOCUS_31220 3161470 3161198 gene locus_tag LOCUS_31230 3161470 3161198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31230 3161698 3161483 gene locus_tag LOCUS_31240 3161698 3161483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 3162726 3162214 gene locus_tag LOCUS_31250 3162726 3162214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 3163327 3162761 gene locus_tag LOCUS_31260 3163327 3162761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 3163631 3163242 gene locus_tag LOCUS_31270 3163631 3163242 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_31270 3164014 3163661 gene locus_tag LOCUS_31280 3164014 3163661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 3164645 3166990 gene locus_tag LOCUS_31290 3164645 3166990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 3167038 3167280 gene locus_tag LOCUS_31300 3167038 3167280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 3167954 3167388 gene locus_tag LOCUS_31310 3167954 3167388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 3168258 3167869 gene locus_tag LOCUS_31320 3168258 3167869 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_31320 3168329 3169261 gene locus_tag LOCUS_31330 3168329 3169261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 3169755 3169330 gene locus_tag LOCUS_31340 3169755 3169330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 3169906 3171192 gene locus_tag LOCUS_31350 3169906 3171192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 3171316 3171783 gene locus_tag LOCUS_31360 3171316 3171783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 3171787 3172170 gene locus_tag LOCUS_31370 3171787 3172170 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225939.1 protein_id gnl|my_center|LOCUS_31370 3172327 3173850 gene locus_tag LOCUS_31380 3172327 3173850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 3173860 3174933 gene locus_tag LOCUS_31390 3173860 3174933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 3174963 3175352 gene locus_tag LOCUS_31400 3174963 3175352 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_31400 3175267 3175833 gene locus_tag LOCUS_31410 3175267 3175833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 3176001 3177017 gene locus_tag LOCUS_31420 3176001 3177017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31420 3177154 3178584 gene locus_tag LOCUS_31430 gene pknF 3177154 3178584 CDS product serine/threonine protein kinase PknF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899000.1 protein_id gnl|my_center|LOCUS_31430 3178918 3178613 gene locus_tag LOCUS_31440 3178918 3178613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730324.1 protein_id gnl|my_center|LOCUS_31440 3180003 3179209 gene locus_tag LOCUS_31450 3180003 3179209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31450 3180326 3180045 gene locus_tag LOCUS_31460 3180326 3180045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31460 3180517 3181599 gene locus_tag LOCUS_31470 3180517 3181599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31470 3181613 3182482 gene locus_tag LOCUS_31480 3181613 3182482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31480 3182483 3182677 gene locus_tag LOCUS_31490 3182483 3182677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 3182656 3183789 gene locus_tag LOCUS_31500 3182656 3183789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31500 3183817 3185601 gene locus_tag LOCUS_31510 3183817 3185601 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_31510 3186912 3185659 gene locus_tag LOCUS_31520 3186912 3185659 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087657.1 protein_id gnl|my_center|LOCUS_31520 3187134 3189767 gene locus_tag LOCUS_31530 3187134 3189767 CDS product ATP transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408545.1 protein_id gnl|my_center|LOCUS_31530 3190316 3189801 gene locus_tag LOCUS_31540 3190316 3189801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 3191329 3190388 gene locus_tag LOCUS_31550 3191329 3190388 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110164.1 protein_id gnl|my_center|LOCUS_31550 3191995 3191474 gene locus_tag LOCUS_31560 3191995 3191474 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414102.1 protein_id gnl|my_center|LOCUS_31560 3192248 3193873 gene locus_tag LOCUS_31570 3192248 3193873 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031826.1 protein_id gnl|my_center|LOCUS_31570 3194042 3194632 gene locus_tag LOCUS_31580 3194042 3194632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 3194680 3195948 gene locus_tag LOCUS_31590 3194680 3195948 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 protein_id gnl|my_center|LOCUS_31590 3196587 3196021 gene locus_tag LOCUS_31600 3196587 3196021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 3196891 3196502 gene locus_tag LOCUS_31610 3196891 3196502 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_31610 3197357 3196941 gene locus_tag LOCUS_31620 3197357 3196941 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240498.1 protein_id gnl|my_center|LOCUS_31620 3197525 3198475 gene locus_tag LOCUS_31630 3197525 3198475 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113289.1 protein_id gnl|my_center|LOCUS_31630 3200445 3198472 gene locus_tag LOCUS_31640 3200445 3198472 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_31640 3200692 3201489 gene locus_tag LOCUS_31650 3200692 3201489 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350071.1 protein_id gnl|my_center|LOCUS_31650 3201549 3202226 gene locus_tag LOCUS_31660 3201549 3202226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408551.1 protein_id gnl|my_center|LOCUS_31660 3203843 3202251 gene locus_tag LOCUS_31670 gene fadD1 3203843 3202251 CDS product fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408558.1 protein_id gnl|my_center|LOCUS_31670 3204223 3205986 gene locus_tag LOCUS_31680 3204223 3205986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 3206087 3207058 gene locus_tag LOCUS_31690 3206087 3207058 CDS product IS481-like element IS1649 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026842.1 protein_id gnl|my_center|LOCUS_31690 3207543 3208478 gene locus_tag LOCUS_31700 3207543 3208478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 3208688 3208897 gene locus_tag LOCUS_31710 3208688 3208897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31710 3208812 3209378 gene locus_tag LOCUS_31720 3208812 3209378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 3209425 3209658 gene locus_tag LOCUS_31730 3209425 3209658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 3209703 3209888 gene locus_tag LOCUS_31740 3209703 3209888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31740 3209991 3210701 gene locus_tag LOCUS_31750 3209991 3210701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31750 3210960 3211205 gene locus_tag LOCUS_31760 3210960 3211205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 3211303 3211692 gene locus_tag LOCUS_31770 3211303 3211692 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_31770 3211607 3212173 gene locus_tag LOCUS_31780 3211607 3212173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 3212541 3212170 gene locus_tag LOCUS_31790 3212541 3212170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 3213513 3212644 gene locus_tag LOCUS_31800 3213513 3212644 CDS product DUF4344 domain-containing metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726965.1 protein_id gnl|my_center|LOCUS_31800 3214738 3213566 gene locus_tag LOCUS_31810 3214738 3213566 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408802.1 protein_id gnl|my_center|LOCUS_31810 3215274 3214900 gene locus_tag LOCUS_31820 3215274 3214900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 3215366 3215551 gene locus_tag LOCUS_31830 3215366 3215551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 3215750 3216130 gene locus_tag LOCUS_31840 3215750 3216130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 3216146 3217369 gene locus_tag LOCUS_31850 3216146 3217369 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886129.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31850 3217686 3218471 gene locus_tag LOCUS_31860 3217686 3218471 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899009.1 protein_id gnl|my_center|LOCUS_31860 3218471 3218854 gene locus_tag LOCUS_31870 3218471 3218854 CDS product DUF5073 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899008.1 protein_id gnl|my_center|LOCUS_31870 3219352 3218894 gene locus_tag LOCUS_31880 3219352 3218894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728515.1 protein_id gnl|my_center|LOCUS_31880 3219650 3220279 gene locus_tag LOCUS_31890 3219650 3220279 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085636.1 protein_id gnl|my_center|LOCUS_31890 3221040 3220393 gene locus_tag LOCUS_31900 3221040 3220393 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897261.1 protein_id gnl|my_center|LOCUS_31900 3221248 3221805 gene locus_tag LOCUS_31910 3221248 3221805 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729910.1 protein_id gnl|my_center|LOCUS_31910 3222246 3221872 gene locus_tag LOCUS_31920 gene trxA 3222246 3221872 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894525.1 protein_id gnl|my_center|LOCUS_31920 3222381 3222650 gene locus_tag LOCUS_31930 3222381 3222650 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899012.1 protein_id gnl|my_center|LOCUS_31930 3222790 3223128 gene locus_tag LOCUS_31940 3222790 3223128 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730501.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31940 3223183 3223554 gene locus_tag LOCUS_31950 3223183 3223554 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408743.1 protein_id gnl|my_center|LOCUS_31950 3223751 3225601 gene locus_tag LOCUS_31960 3223751 3225601 CDS product PE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950597.1 protein_id gnl|my_center|LOCUS_31960 3225760 3227001 gene locus_tag LOCUS_31970 3225760 3227001 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904700.1 protein_id gnl|my_center|LOCUS_31970 3227069 3228274 gene locus_tag LOCUS_31980 3227069 3228274 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899014.1 protein_id gnl|my_center|LOCUS_31980 3228271 3229557 gene locus_tag LOCUS_31990 3228271 3229557 CDS product L-gulono-1,4-lactone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408749.1 protein_id gnl|my_center|LOCUS_31990 3229651 3230034 gene locus_tag LOCUS_32000 3229651 3230034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32000 3230050 3230301 gene locus_tag LOCUS_32010 3230050 3230301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 3230638 3230880 gene locus_tag LOCUS_32020 3230638 3230880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 3230893 3231927 gene locus_tag LOCUS_32030 3230893 3231927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 3232873 3232061 gene locus_tag LOCUS_32040 gene istB 3232873 3232061 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_32040 3233187 3232870 gene locus_tag LOCUS_32050 3233187 3232870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 3233707 3233141 gene locus_tag LOCUS_32060 3233707 3233141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 3234011 3233622 gene locus_tag LOCUS_32070 3234011 3233622 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_32070 3235114 3234041 gene locus_tag LOCUS_32080 gene istA 3235114 3234041 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047902700.1 protein_id gnl|my_center|LOCUS_32080 3237353 3235839 gene locus_tag LOCUS_32090 3237353 3235839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 3239435 3237423 gene locus_tag LOCUS_32100 3239435 3237423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 3239514 3239822 gene locus_tag LOCUS_32110 3239514 3239822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 3240057 3240707 gene locus_tag LOCUS_32120 3240057 3240707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32120 3240774 3241271 gene locus_tag LOCUS_32130 3240774 3241271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32130 3241926 3241327 gene locus_tag LOCUS_32140 3241926 3241327 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899018.1 protein_id gnl|my_center|LOCUS_32140 3243150 3242689 gene locus_tag LOCUS_32150 3243150 3242689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 3243125 3243496 gene locus_tag LOCUS_32160 3243125 3243496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 3243500 3243763 gene locus_tag LOCUS_32170 3243500 3243763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 3244344 3243856 gene locus_tag LOCUS_32180 3244344 3243856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 3244258 3246093 gene locus_tag LOCUS_32190 3244258 3246093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 3246146 3246361 gene locus_tag LOCUS_32200 3246146 3246361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 3247379 3246807 gene locus_tag LOCUS_32210 3247379 3246807 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081171.1 protein_id gnl|my_center|LOCUS_32210 3248062 3247613 gene locus_tag LOCUS_32220 3248062 3247613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408775.1 protein_id gnl|my_center|LOCUS_32220 3250113 3248281 gene locus_tag LOCUS_32230 3250113 3248281 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408781.1 protein_id gnl|my_center|LOCUS_32230 3250350 3250913 gene locus_tag LOCUS_32240 3250350 3250913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408792.1 protein_id gnl|my_center|LOCUS_32240 3251130 3251384 gene locus_tag LOCUS_32250 3251130 3251384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32250 3253903 3251723 gene locus_tag LOCUS_32260 gene malQ 3253903 3251723 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408795.1 protein_id gnl|my_center|LOCUS_32260 3254219 3255742 gene locus_tag LOCUS_32270 gene eccB5 3254219 3255742 CDS product type VII secretion system ESX-5 subunit EccB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899021.1 protein_id gnl|my_center|LOCUS_32270 3255739 3259905 gene locus_tag LOCUS_32280 gene eccC5 3255739 3259905 CDS product type VII secretion system ESX-5 FtsK/SpoIIIE family ATPase EccC5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950600.1 protein_id gnl|my_center|LOCUS_32280 3261112 3259937 gene locus_tag LOCUS_32290 3261112 3259937 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408802.1 protein_id gnl|my_center|LOCUS_32290 3261375 3261569 gene locus_tag LOCUS_32300 3261375 3261569 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408803.1 protein_id gnl|my_center|LOCUS_32300 3262107 3262844 gene locus_tag LOCUS_32310 3262107 3262844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 3262911 3263363 gene locus_tag LOCUS_32320 3262911 3263363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 3263562 3263861 gene locus_tag LOCUS_32330 3263562 3263861 CDS product type VII secretion system ESX-5 target PE18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408976.1 protein_id gnl|my_center|LOCUS_32330 3263873 3265099 gene locus_tag LOCUS_32340 3263873 3265099 CDS product type VII secretion system ESX-5 target PPE26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950602.1 protein_id gnl|my_center|LOCUS_32340 3265173 3265493 gene locus_tag LOCUS_32350 3265173 3265493 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406566.1 protein_id gnl|my_center|LOCUS_32350 3266058 3266357 gene locus_tag LOCUS_32360 3266058 3266357 CDS product type VII secretion system ESX-5 target PE19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408807.1 protein_id gnl|my_center|LOCUS_32360 3266702 3266998 gene locus_tag LOCUS_32370 gene esxW 3266702 3266998 CDS product type VII secretion system protein EsxW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899603.1 protein_id gnl|my_center|LOCUS_32370 3267050 3267334 gene locus_tag LOCUS_32380 gene esxN 3267050 3267334 CDS product effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408840.1 protein_id gnl|my_center|LOCUS_32380 3267423 3268325 gene locus_tag LOCUS_32390 3267423 3268325 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408846.1 protein_id gnl|my_center|LOCUS_32390 3268716 3270152 gene locus_tag LOCUS_32400 gene eccD5 3268716 3270152 CDS product type VII secretion system ESX-5 subunit EccD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950604.1 protein_id gnl|my_center|LOCUS_32400 3270313 3271872 gene locus_tag LOCUS_32410 gene mycP5 3270313 3271872 CDS product type VII secretion system ESX-5 serine protease mycosin MycP5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408854.1 protein_id gnl|my_center|LOCUS_32410 3271869 3273080 gene locus_tag LOCUS_32420 gene eccE5 3271869 3273080 CDS product type VII secretion system ESX-5 subunit EccE5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408859.1 protein_id gnl|my_center|LOCUS_32420 3273077 3274909 gene locus_tag LOCUS_32430 gene eccA5 3273077 3274909 CDS product type VII secretion system ESX-5 AAA family ATPase EccA5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408868.1 protein_id gnl|my_center|LOCUS_32430 3275809 3277161 gene locus_tag LOCUS_32440 3275809 3277161 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409179.1 protein_id gnl|my_center|LOCUS_32440 3277172 3277936 gene locus_tag LOCUS_32450 3277172 3277936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32450 3277937 3278386 gene locus_tag LOCUS_32460 3277937 3278386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 3279641 3278607 gene locus_tag LOCUS_32470 3279641 3278607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 3279869 3279654 gene locus_tag LOCUS_32480 3279869 3279654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 3280802 3280584 gene locus_tag LOCUS_32490 3280802 3280584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 3280750 3281829 gene locus_tag LOCUS_32500 3280750 3281829 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409179.1 protein_id gnl|my_center|LOCUS_32500 3282915 3284195 gene locus_tag LOCUS_32510 3282915 3284195 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901258.1 protein_id gnl|my_center|LOCUS_32510 3284282 3285529 gene locus_tag LOCUS_32520 3284282 3285529 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911666.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32520 3285989 3286306 gene locus_tag LOCUS_32530 3285989 3286306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 3286513 3287241 gene locus_tag LOCUS_32540 3286513 3287241 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899032.1 protein_id gnl|my_center|LOCUS_32540 3288427 3287243 gene locus_tag LOCUS_32550 3288427 3287243 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409193.1 protein_id gnl|my_center|LOCUS_32550 3288600 3288439 gene locus_tag LOCUS_32560 3288600 3288439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 3288937 3288602 gene locus_tag LOCUS_32570 3288937 3288602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 3289199 3290149 gene locus_tag LOCUS_32580 3289199 3290149 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901259.1 protein_id gnl|my_center|LOCUS_32580 3290270 3290938 gene locus_tag LOCUS_32590 3290270 3290938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409204.1 protein_id gnl|my_center|LOCUS_32590 3291130 3291630 gene locus_tag LOCUS_32600 3291130 3291630 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729238.1 protein_id gnl|my_center|LOCUS_32600 3291693 3293108 gene locus_tag LOCUS_32610 3291693 3293108 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409207.1 protein_id gnl|my_center|LOCUS_32610 3293333 3293154 gene locus_tag LOCUS_32620 3293333 3293154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 3295447 3293426 gene locus_tag LOCUS_32630 3295447 3293426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32630 3297933 3296014 gene locus_tag LOCUS_32640 gene bacA 3297933 3296014 CDS product vitamin B12 ABC transporter ATP-binding protein BacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900416.1 protein_id gnl|my_center|LOCUS_32640 3298028 3299689 gene locus_tag LOCUS_32650 3298028 3299689 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409218.1 protein_id gnl|my_center|LOCUS_32650 3299739 3300128 gene locus_tag LOCUS_32660 3299739 3300128 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_32660 3300043 3300609 gene locus_tag LOCUS_32670 3300043 3300609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 3300738 3303074 gene locus_tag LOCUS_32680 gene secA2 3300738 3303074 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409221.1 protein_id gnl|my_center|LOCUS_32680 3303196 3303825 gene locus_tag LOCUS_32690 3303196 3303825 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409227.1 protein_id gnl|my_center|LOCUS_32690 3303818 3304738 gene locus_tag LOCUS_32700 3303818 3304738 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901262.1 protein_id gnl|my_center|LOCUS_32700 3304801 3305133 gene locus_tag LOCUS_32710 3304801 3305133 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899037.1 protein_id gnl|my_center|LOCUS_32710 3305158 3306099 gene locus_tag LOCUS_32720 3305158 3306099 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899038.1 protein_id gnl|my_center|LOCUS_32720 3307009 3306077 gene locus_tag LOCUS_32730 3307009 3306077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 3307080 3307469 gene locus_tag LOCUS_32740 3307080 3307469 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_32740 3307384 3307950 gene locus_tag LOCUS_32750 3307384 3307950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 3308273 3308058 gene locus_tag LOCUS_32760 3308273 3308058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 3308460 3308864 gene locus_tag LOCUS_32770 gene gcvH 3308460 3308864 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409234.1 protein_id gnl|my_center|LOCUS_32770 3309122 3309610 gene locus_tag LOCUS_32780 gene garA 3309122 3309610 CDS product glycogen accumulation regulator GarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899041.1 protein_id gnl|my_center|LOCUS_32780 3309607 3310362 gene locus_tag LOCUS_32790 3309607 3310362 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409239.1 protein_id gnl|my_center|LOCUS_32790 3310503 3310997 gene locus_tag LOCUS_32800 3310503 3310997 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409242.1 protein_id gnl|my_center|LOCUS_32800 3311371 3311907 gene locus_tag LOCUS_32810 3311371 3311907 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409244.1 protein_id gnl|my_center|LOCUS_32810 3312270 3315107 gene locus_tag LOCUS_32820 gene gcvP 3312270 3315107 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950613.1 protein_id gnl|my_center|LOCUS_32820 3315658 3315137 gene locus_tag LOCUS_32830 3315658 3315137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 3315611 3315946 gene locus_tag LOCUS_32840 3315611 3315946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 3316684 3315860 gene locus_tag LOCUS_32850 3316684 3315860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32850 3317836 3316964 gene locus_tag LOCUS_32860 3317836 3316964 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 protein_id gnl|my_center|LOCUS_32860 3317886 3318128 gene locus_tag LOCUS_32870 3317886 3318128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 3318669 3318103 gene locus_tag LOCUS_32880 3318669 3318103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32880 3318967 3318584 gene locus_tag LOCUS_32890 3318967 3318584 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_32890 3319194 3319003 gene locus_tag LOCUS_32900 3319194 3319003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 3319138 3319674 gene locus_tag LOCUS_32910 3319138 3319674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32910 3321911 3319704 gene locus_tag LOCUS_32920 3321911 3319704 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901265.1 protein_id gnl|my_center|LOCUS_32920 3324157 3321962 gene locus_tag LOCUS_32930 3324157 3321962 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409271.1 protein_id gnl|my_center|LOCUS_32930 3326043 3324376 gene locus_tag LOCUS_32940 3326043 3324376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 3327288 3326236 gene locus_tag LOCUS_32950 3327288 3326236 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409281.1 protein_id gnl|my_center|LOCUS_32950 3328667 3327285 gene locus_tag LOCUS_32960 3328667 3327285 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409282.1 protein_id gnl|my_center|LOCUS_32960 3330289 3328862 gene locus_tag LOCUS_32970 3330289 3328862 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902189.1 protein_id gnl|my_center|LOCUS_32970 3331781 3330330 gene locus_tag LOCUS_32980 gene gndA 3331781 3330330 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911671.1 protein_id gnl|my_center|LOCUS_32980 3332841 3331891 gene locus_tag LOCUS_32990 3332841 3331891 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409298.1 protein_id gnl|my_center|LOCUS_32990 3333272 3332856 gene locus_tag LOCUS_33000 gene blaI 3333272 3332856 CDS product transcriptional repressor BlaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409301.1 protein_id gnl|my_center|LOCUS_33000 3334476 3333544 gene locus_tag LOCUS_33010 3334476 3333544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 3334547 3334936 gene locus_tag LOCUS_33020 3334547 3334936 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_33020 3334851 3335417 gene locus_tag LOCUS_33030 3334851 3335417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 3335767 3335525 gene locus_tag LOCUS_33040 3335767 3335525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 3336075 3336515 gene locus_tag LOCUS_33050 3336075 3336515 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903650.1 protein_id gnl|my_center|LOCUS_33050 3336512 3336877 gene locus_tag LOCUS_33060 3336512 3336877 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409305.1 protein_id gnl|my_center|LOCUS_33060 3336874 3337185 gene locus_tag LOCUS_33070 3336874 3337185 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409308.1 protein_id gnl|my_center|LOCUS_33070 3337185 3338918 gene locus_tag LOCUS_33080 3337185 3338918 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899049.1 protein_id gnl|my_center|LOCUS_33080 3338918 3339553 gene locus_tag LOCUS_33090 3338918 3339553 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950619.1 protein_id gnl|my_center|LOCUS_33090 3339564 3340235 gene locus_tag LOCUS_33100 gene ureG 3339564 3340235 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409313.1 protein_id gnl|my_center|LOCUS_33100 3340235 3340879 gene locus_tag LOCUS_33110 3340235 3340879 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409315.1 protein_id gnl|my_center|LOCUS_33110 3342344 3340959 gene locus_tag LOCUS_33120 3342344 3340959 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409317.1 protein_id gnl|my_center|LOCUS_33120 3342897 3342508 gene locus_tag LOCUS_33130 3342897 3342508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33130 3343431 3342925 gene locus_tag LOCUS_33140 3343431 3342925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33140 3343634 3343482 gene locus_tag LOCUS_33150 3343634 3343482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33150 3343985 3344404 gene locus_tag LOCUS_33160 3343985 3344404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 3344484 3345248 gene locus_tag LOCUS_33170 gene modA 3344484 3345248 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409326.1 protein_id gnl|my_center|LOCUS_33170 3345258 3346052 gene locus_tag LOCUS_33180 3345258 3346052 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409329.1 protein_id gnl|my_center|LOCUS_33180 3346898 3346065 gene locus_tag LOCUS_33190 3346898 3346065 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731439.1 protein_id gnl|my_center|LOCUS_33190 3347088 3348545 gene locus_tag LOCUS_33200 3347088 3348545 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_33200 3348542 3348742 gene locus_tag LOCUS_33210 3348542 3348742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 3348893 3350047 gene locus_tag LOCUS_33220 3348893 3350047 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899051.1 protein_id gnl|my_center|LOCUS_33220 3350097 3350486 gene locus_tag LOCUS_33230 3350097 3350486 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_33230 3350401 3350967 gene locus_tag LOCUS_33240 3350401 3350967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 3351031 3351420 gene locus_tag LOCUS_33250 3351031 3351420 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_33250 3351335 3351901 gene locus_tag LOCUS_33260 3351335 3351901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 3352002 3353006 gene locus_tag LOCUS_33270 3352002 3353006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 3353622 3353056 gene locus_tag LOCUS_33280 3353622 3353056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 3353926 3353537 gene locus_tag LOCUS_33290 3353926 3353537 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_33290 3354096 3354392 gene locus_tag LOCUS_33300 3354096 3354392 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908691.1 protein_id gnl|my_center|LOCUS_33300 3354458 3355486 gene locus_tag LOCUS_33310 3354458 3355486 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409345.1 protein_id gnl|my_center|LOCUS_33310 3356215 3355493 gene locus_tag LOCUS_33320 3356215 3355493 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899053.1 protein_id gnl|my_center|LOCUS_33320 3357235 3356555 gene locus_tag LOCUS_33330 3357235 3356555 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409351.1 protein_id gnl|my_center|LOCUS_33330 3359673 3357271 gene locus_tag LOCUS_33340 3359673 3357271 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729203.1 protein_id gnl|my_center|LOCUS_33340 3360576 3359719 gene locus_tag LOCUS_33350 3360576 3359719 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409355.1 protein_id gnl|my_center|LOCUS_33350 3360684 3361229 gene locus_tag LOCUS_33360 3360684 3361229 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 protein_id gnl|my_center|LOCUS_33360 3361296 3363776 gene locus_tag LOCUS_33370 3361296 3363776 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900424.1 protein_id gnl|my_center|LOCUS_33370 3363862 3365346 gene locus_tag LOCUS_33380 3363862 3365346 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409362.1 protein_id gnl|my_center|LOCUS_33380 3365468 3367567 gene locus_tag LOCUS_33390 3365468 3367567 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409374.1 protein_id gnl|my_center|LOCUS_33390 3368115 3367669 gene locus_tag LOCUS_33400 3368115 3367669 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208269.1 protein_id gnl|my_center|LOCUS_33400 3368571 3368239 gene locus_tag LOCUS_33410 3368571 3368239 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112420.1 protein_id gnl|my_center|LOCUS_33410 3368921 3368574 gene locus_tag LOCUS_33420 3368921 3368574 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409380.1 protein_id gnl|my_center|LOCUS_33420 3369107 3369322 gene locus_tag LOCUS_33430 3369107 3369322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 3369335 3370369 gene locus_tag LOCUS_33440 3369335 3370369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 3370789 3370511 gene locus_tag LOCUS_33450 3370789 3370511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33450 3371299 3370790 gene locus_tag LOCUS_33460 3371299 3370790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33460 3372469 3371384 gene locus_tag LOCUS_33470 3372469 3371384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33470 3373055 3372489 gene locus_tag LOCUS_33480 3373055 3372489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 3373359 3372970 gene locus_tag LOCUS_33490 3373359 3372970 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_33490 3373787 3373389 gene locus_tag LOCUS_33500 3373787 3373389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 3375108 3373891 gene locus_tag LOCUS_33510 gene lldD 3375108 3373891 CDS product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409382.1 protein_id gnl|my_center|LOCUS_33510 3375508 3375296 gene locus_tag LOCUS_33520 3375508 3375296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 3375645 3375860 gene locus_tag LOCUS_33530 3375645 3375860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 3375873 3376907 gene locus_tag LOCUS_33540 3375873 3376907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 3377256 3377053 gene locus_tag LOCUS_33550 3377256 3377053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33550 3377776 3377210 gene locus_tag LOCUS_33560 3377776 3377210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33560 3378080 3377691 gene locus_tag LOCUS_33570 3378080 3377691 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_33570 3378979 3378110 gene locus_tag LOCUS_33580 3378979 3378110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 3379526 3378990 gene locus_tag LOCUS_33590 3379526 3378990 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412536.1 protein_id gnl|my_center|LOCUS_33590 3380154 3379567 gene locus_tag LOCUS_33600 gene ahpC 3380154 3379567 CDS product peroxiredoxin AhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412529.1 protein_id gnl|my_center|LOCUS_33600 3380249 3381211 gene locus_tag LOCUS_33610 3380249 3381211 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908684.1 protein_id gnl|my_center|LOCUS_33610 3381246 3381959 gene locus_tag LOCUS_33620 3381246 3381959 CDS product EthD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904723.1 protein_id gnl|my_center|LOCUS_33620 3381956 3382237 gene locus_tag LOCUS_33630 3381956 3382237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33630 3382409 3383119 gene locus_tag LOCUS_33640 3382409 3383119 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729165.1 protein_id gnl|my_center|LOCUS_33640 3383374 3383198 gene locus_tag LOCUS_33650 3383374 3383198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 3383570 3383812 gene locus_tag LOCUS_33660 3383570 3383812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 3383825 3384859 gene locus_tag LOCUS_33670 3383825 3384859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 3385125 3385604 gene locus_tag LOCUS_33680 gene bfrA 3385125 3385604 CDS product bacterioferritin BfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409398.1 protein_id gnl|my_center|LOCUS_33680 3386046 3386540 gene locus_tag LOCUS_33690 3386046 3386540 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729161.1 protein_id gnl|my_center|LOCUS_33690 3387117 3386551 gene locus_tag LOCUS_33700 3387117 3386551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 3387241 3387032 gene locus_tag LOCUS_33710 3387241 3387032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33710 3387514 3388875 gene locus_tag LOCUS_33720 3387514 3388875 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409401.1 protein_id gnl|my_center|LOCUS_33720 3388879 3390033 gene locus_tag LOCUS_33730 3388879 3390033 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899061.1 protein_id gnl|my_center|LOCUS_33730 3390030 3391436 gene locus_tag LOCUS_33740 3390030 3391436 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_33740 3392118 3393374 gene locus_tag LOCUS_33750 3392118 3393374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 3393937 3393371 gene locus_tag LOCUS_33760 3393937 3393371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 3394241 3393852 gene locus_tag LOCUS_33770 3394241 3393852 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_33770 3394402 3394551 gene locus_tag LOCUS_33780 3394402 3394551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 3394548 3395360 gene locus_tag LOCUS_33790 gene istB 3394548 3395360 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_33790 3395558 3396172 gene locus_tag LOCUS_33800 3395558 3396172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33800 3396815 3397981 gene locus_tag LOCUS_33810 3396815 3397981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33810 3398430 3398804 gene locus_tag LOCUS_33820 3398430 3398804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33820 3398854 3399243 gene locus_tag LOCUS_33830 3398854 3399243 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_33830 3399158 3399724 gene locus_tag LOCUS_33840 3399158 3399724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 3399765 3400091 gene locus_tag LOCUS_33850 3399765 3400091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 3400141 3400530 gene locus_tag LOCUS_33860 3400141 3400530 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_33860 3400445 3401011 gene locus_tag LOCUS_33870 3400445 3401011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 3401032 3401889 gene locus_tag LOCUS_33880 3401032 3401889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 3402434 3401961 gene locus_tag LOCUS_33890 3402434 3401961 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082139.1 protein_id gnl|my_center|LOCUS_33890 3402822 3402523 gene locus_tag LOCUS_33900 3402822 3402523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33900 3403356 3402853 gene locus_tag LOCUS_33910 3403356 3402853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33910 3403839 3403375 gene locus_tag LOCUS_33920 3403839 3403375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33920 3404372 3403950 gene locus_tag LOCUS_33930 3404372 3403950 CDS product lipoprotein LpqH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409409.1 protein_id gnl|my_center|LOCUS_33930 3405247 3404414 gene locus_tag LOCUS_33940 3405247 3404414 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409413.1 protein_id gnl|my_center|LOCUS_33940 3405720 3405262 gene locus_tag LOCUS_33950 3405720 3405262 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409417.1 protein_id gnl|my_center|LOCUS_33950 3406189 3405776 gene locus_tag LOCUS_33960 3406189 3405776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 3406880 3406308 gene locus_tag LOCUS_33970 3406880 3406308 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899064.1 protein_id gnl|my_center|LOCUS_33970 3407313 3406933 gene locus_tag LOCUS_33980 3407313 3406933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 3407777 3407262 gene locus_tag LOCUS_33990 3407777 3407262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33990 3408276 3407857 gene locus_tag LOCUS_34000 3408276 3407857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 3408877 3408311 gene locus_tag LOCUS_34010 3408877 3408311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 3409181 3408792 gene locus_tag LOCUS_34020 3409181 3408792 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_34020 3409735 3409211 gene locus_tag LOCUS_34030 3409735 3409211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 3409921 3410511 gene locus_tag LOCUS_34040 3409921 3410511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410707.1 protein_id gnl|my_center|LOCUS_34040 3411245 3410595 gene locus_tag LOCUS_34050 3411245 3410595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34050 3411572 3411309 gene locus_tag LOCUS_34060 3411572 3411309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34060 3411862 3412251 gene locus_tag LOCUS_34070 3411862 3412251 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_34070 3412166 3412732 gene locus_tag LOCUS_34080 3412166 3412732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 3413422 3413243 gene locus_tag LOCUS_34090 3413422 3413243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 3413345 3414364 gene locus_tag LOCUS_34100 3413345 3414364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899065.1 protein_id gnl|my_center|LOCUS_34100 3414797 3414384 gene locus_tag LOCUS_34110 3414797 3414384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34110 3415001 3414828 gene locus_tag LOCUS_34120 3415001 3414828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34120 3415780 3415229 gene locus_tag LOCUS_34130 3415780 3415229 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409503.1 protein_id gnl|my_center|LOCUS_34130 3416823 3415900 gene locus_tag LOCUS_34140 3416823 3415900 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729088.1 protein_id gnl|my_center|LOCUS_34140 3418134 3416848 gene locus_tag LOCUS_34150 3418134 3416848 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877729.1 protein_id gnl|my_center|LOCUS_34150 3419632 3418598 gene locus_tag LOCUS_34160 3419632 3418598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 3419887 3419645 gene locus_tag LOCUS_34170 3419887 3419645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 3420047 3421162 gene locus_tag LOCUS_34180 3420047 3421162 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409518.1 protein_id gnl|my_center|LOCUS_34180 3421497 3421213 gene locus_tag LOCUS_34190 3421497 3421213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 3421798 3421505 gene locus_tag LOCUS_34200 3421798 3421505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409512.1 protein_id gnl|my_center|LOCUS_34200 3422219 3421803 gene locus_tag LOCUS_34210 3422219 3421803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409509.1 protein_id gnl|my_center|LOCUS_34210 3422364 3422606 gene locus_tag LOCUS_34220 3422364 3422606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 3422753 3423142 gene locus_tag LOCUS_34230 3422753 3423142 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_34230 3423057 3423623 gene locus_tag LOCUS_34240 3423057 3423623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 3423687 3424076 gene locus_tag LOCUS_34250 3423687 3424076 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_34250 3423991 3424557 gene locus_tag LOCUS_34260 3423991 3424557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 3424589 3425521 gene locus_tag LOCUS_34270 3424589 3425521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 3425768 3426253 gene locus_tag LOCUS_34280 3425768 3426253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34280 3426207 3426779 gene locus_tag LOCUS_34290 3426207 3426779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 3427277 3426825 gene locus_tag LOCUS_34300 3427277 3426825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 3427423 3428034 gene locus_tag LOCUS_34310 3427423 3428034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 3428085 3428654 gene locus_tag LOCUS_34320 3428085 3428654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34320 3428615 3430015 gene locus_tag LOCUS_34330 3428615 3430015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34330 3430026 3431051 gene locus_tag LOCUS_34340 3430026 3431051 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409522.1 protein_id gnl|my_center|LOCUS_34340 3431952 3431041 gene locus_tag LOCUS_34350 3431952 3431041 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409526.1 protein_id gnl|my_center|LOCUS_34350 3432425 3431994 gene locus_tag LOCUS_34360 gene dtd 3432425 3431994 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409533.1 protein_id gnl|my_center|LOCUS_34360 3432722 3433048 gene locus_tag LOCUS_34370 3432722 3433048 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409536.1 protein_id gnl|my_center|LOCUS_34370 3433539 3433045 gene locus_tag LOCUS_34380 3433539 3433045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34380 3434062 3433739 gene locus_tag LOCUS_34390 3434062 3433739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 3434182 3435459 gene locus_tag LOCUS_34400 3434182 3435459 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900426.1 protein_id gnl|my_center|LOCUS_34400 3436823 3435555 gene locus_tag LOCUS_34410 3436823 3435555 CDS product sialate:H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900427.1 protein_id gnl|my_center|LOCUS_34410 3436890 3437957 gene locus_tag LOCUS_34420 3436890 3437957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 3437974 3438375 gene locus_tag LOCUS_34430 3437974 3438375 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409542.1 protein_id gnl|my_center|LOCUS_34430 3438660 3439100 gene locus_tag LOCUS_34440 3438660 3439100 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409543.1 protein_id gnl|my_center|LOCUS_34440 3440098 3439115 gene locus_tag LOCUS_34450 3440098 3439115 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409545.1 protein_id gnl|my_center|LOCUS_34450 3440581 3440111 gene locus_tag LOCUS_34460 3440581 3440111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900428.1 protein_id gnl|my_center|LOCUS_34460 3441055 3440630 gene locus_tag LOCUS_34470 3441055 3440630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 3441768 3441043 gene locus_tag LOCUS_34480 3441768 3441043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 3442013 3442951 gene locus_tag LOCUS_34490 3442013 3442951 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095795.1 protein_id gnl|my_center|LOCUS_34490 3442951 3444084 gene locus_tag LOCUS_34500 3442951 3444084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095792.1 protein_id gnl|my_center|LOCUS_34500 3445071 3444472 gene locus_tag LOCUS_34510 3445071 3444472 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899717.1 protein_id gnl|my_center|LOCUS_34510 3446169 3445357 gene locus_tag LOCUS_34520 gene istB 3446169 3445357 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_34520 3446483 3446166 gene locus_tag LOCUS_34530 3446483 3446166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 3447003 3446437 gene locus_tag LOCUS_34540 3447003 3446437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 3447307 3446918 gene locus_tag LOCUS_34550 3447307 3446918 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_34550 3448599 3447337 gene locus_tag LOCUS_34560 3448599 3447337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 3448828 3450288 gene locus_tag LOCUS_34570 3448828 3450288 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899716.1 protein_id gnl|my_center|LOCUS_34570 3451343 3450339 gene locus_tag LOCUS_34580 3451343 3450339 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_34580 3451814 3451386 gene locus_tag LOCUS_34590 3451814 3451386 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226516.1 protein_id gnl|my_center|LOCUS_34590 3452137 3451811 gene locus_tag LOCUS_34600 3452137 3451811 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226515.1 protein_id gnl|my_center|LOCUS_34600 3453253 3452195 gene locus_tag LOCUS_34610 3453253 3452195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 3453369 3454091 gene locus_tag LOCUS_34620 3453369 3454091 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409574.1 protein_id gnl|my_center|LOCUS_34620 3454301 3454098 gene locus_tag LOCUS_34630 3454301 3454098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34630 3454608 3456896 gene locus_tag LOCUS_34640 gene aceA 3454608 3456896 CDS product isocitrate lyase ICL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409584.1 protein_id gnl|my_center|LOCUS_34640 3457473 3456907 gene locus_tag LOCUS_34650 3457473 3456907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 3457777 3457388 gene locus_tag LOCUS_34660 3457777 3457388 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_34660 3459644 3457926 gene locus_tag LOCUS_34670 3459644 3457926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34670 3460688 3459690 gene locus_tag LOCUS_34680 3460688 3459690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34680 3461164 3461526 gene locus_tag LOCUS_34690 3461164 3461526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 3462089 3463252 gene locus_tag LOCUS_34700 3462089 3463252 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113133.1 protein_id gnl|my_center|LOCUS_34700 3463778 3463311 gene locus_tag LOCUS_34710 3463778 3463311 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899082.1 protein_id gnl|my_center|LOCUS_34710 3463916 3464740 gene locus_tag LOCUS_34720 3463916 3464740 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900432.1 protein_id gnl|my_center|LOCUS_34720 3465145 3466200 gene locus_tag LOCUS_34730 3465145 3466200 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409667.1 protein_id gnl|my_center|LOCUS_34730 3466322 3467605 gene locus_tag LOCUS_34740 gene lipD 3466322 3467605 CDS product lipase LipD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900433.1 protein_id gnl|my_center|LOCUS_34740 3467982 3467626 gene locus_tag LOCUS_34750 3467982 3467626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 3468339 3468001 gene locus_tag LOCUS_34760 3468339 3468001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34760 3469493 3468594 gene locus_tag LOCUS_34770 3469493 3468594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 3471212 3469497 gene locus_tag LOCUS_34780 3471212 3469497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34780 3472199 3471819 gene locus_tag LOCUS_34790 3472199 3471819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900434.1 protein_id gnl|my_center|LOCUS_34790 3472354 3474228 gene locus_tag LOCUS_34800 gene fadD31 3472354 3474228 CDS product fatty-acid--AMP ligase FAAL31/FadD31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409680.1 protein_id gnl|my_center|LOCUS_34800 3476094 3474232 gene locus_tag LOCUS_34810 3476094 3474232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 3476780 3476175 gene locus_tag LOCUS_34820 3476780 3476175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895048.1 protein_id gnl|my_center|LOCUS_34820 3477161 3476871 gene locus_tag LOCUS_34830 3477161 3476871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 3477404 3477192 gene locus_tag LOCUS_34840 3477404 3477192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 3477942 3477463 gene locus_tag LOCUS_34850 gene mpt63 3477942 3477463 CDS product immunoprotective protein Mpt63 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409684.1 protein_id gnl|my_center|LOCUS_34850 3478174 3478650 gene locus_tag LOCUS_34860 3478174 3478650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34860 3479068 3480501 gene locus_tag LOCUS_34870 3479068 3480501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34870 3480568 3481356 gene locus_tag LOCUS_34880 3480568 3481356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 3481610 3481963 gene locus_tag LOCUS_34890 3481610 3481963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 3483318 3482320 gene locus_tag LOCUS_34900 3483318 3482320 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086660.1 protein_id gnl|my_center|LOCUS_34900 3483694 3485082 gene locus_tag LOCUS_34910 3483694 3485082 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727577.1 protein_id gnl|my_center|LOCUS_34910 3486235 3485504 gene locus_tag LOCUS_34920 3486235 3485504 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_34920 3486412 3487881 gene locus_tag LOCUS_34930 3486412 3487881 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674607.1 protein_id gnl|my_center|LOCUS_34930 3487952 3488365 gene locus_tag LOCUS_34940 3487952 3488365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 3488462 3489235 gene locus_tag LOCUS_34950 3488462 3489235 CDS product YqjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409685.1 protein_id gnl|my_center|LOCUS_34950 3490050 3489283 gene locus_tag LOCUS_34960 3490050 3489283 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409686.1 protein_id gnl|my_center|LOCUS_34960 3490098 3490583 gene locus_tag LOCUS_34970 3490098 3490583 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060706.1 protein_id gnl|my_center|LOCUS_34970 3490585 3491301 gene locus_tag LOCUS_34980 3490585 3491301 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948045.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34980 3491487 3491251 gene locus_tag LOCUS_34990 3491487 3491251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 3492060 3491500 gene locus_tag LOCUS_35000 3492060 3491500 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013844.1 protein_id gnl|my_center|LOCUS_35000 3492212 3492748 gene locus_tag LOCUS_35010 3492212 3492748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 3493630 3492887 gene locus_tag LOCUS_35020 3493630 3492887 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083146.1 protein_id gnl|my_center|LOCUS_35020 3494599 3493649 gene locus_tag LOCUS_35030 3494599 3493649 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083148.1 protein_id gnl|my_center|LOCUS_35030 3494686 3495075 gene locus_tag LOCUS_35040 3494686 3495075 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_35040 3494990 3495556 gene locus_tag LOCUS_35050 3494990 3495556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 3497074 3495821 gene locus_tag LOCUS_35060 3497074 3495821 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490027.1 protein_id gnl|my_center|LOCUS_35060 3497556 3497951 gene locus_tag LOCUS_35070 3497556 3497951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 3498076 3498432 gene locus_tag LOCUS_35080 3498076 3498432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35080 3498481 3499158 gene locus_tag LOCUS_35090 3498481 3499158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 3499246 3499743 gene locus_tag LOCUS_35100 gene tpx 3499246 3499743 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409700.1 protein_id gnl|my_center|LOCUS_35100 3500853 3499765 gene locus_tag LOCUS_35110 3500853 3499765 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900437.1 protein_id gnl|my_center|LOCUS_35110 3502084 3500855 gene locus_tag LOCUS_35120 3502084 3500855 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 protein_id gnl|my_center|LOCUS_35120 3503049 3502099 gene locus_tag LOCUS_35130 3503049 3502099 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409707.1 protein_id gnl|my_center|LOCUS_35130 3503281 3504786 gene locus_tag LOCUS_35140 3503281 3504786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 3504788 3506968 gene locus_tag LOCUS_35150 3504788 3506968 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409714.1 protein_id gnl|my_center|LOCUS_35150 3506980 3507300 gene locus_tag LOCUS_35160 3506980 3507300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35160 3507337 3508038 gene locus_tag LOCUS_35170 3507337 3508038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35170 3508035 3508568 gene locus_tag LOCUS_35180 3508035 3508568 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409718.1 protein_id gnl|my_center|LOCUS_35180 3508565 3509026 gene locus_tag LOCUS_35190 3508565 3509026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 3509056 3509445 gene locus_tag LOCUS_35200 3509056 3509445 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_35200 3509360 3509926 gene locus_tag LOCUS_35210 3509360 3509926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 3510000 3510452 gene locus_tag LOCUS_35220 3510000 3510452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35220 3510599 3511369 gene locus_tag LOCUS_35230 3510599 3511369 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409775.1 protein_id gnl|my_center|LOCUS_35230 3512221 3511388 gene locus_tag LOCUS_35240 3512221 3511388 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113060.1 protein_id gnl|my_center|LOCUS_35240 3512473 3512793 gene locus_tag LOCUS_35250 3512473 3512793 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225051.1 protein_id gnl|my_center|LOCUS_35250 3513129 3513491 gene locus_tag LOCUS_35260 3513129 3513491 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152231551.1 protein_id gnl|my_center|LOCUS_35260 3515020 3513818 gene locus_tag LOCUS_35270 gene mce3R 3515020 3513818 CDS product TetR family transcriptional regulator Mce3R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409919.1 protein_id gnl|my_center|LOCUS_35270 3515492 3515911 gene locus_tag LOCUS_35280 3515492 3515911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 3515908 3517431 gene locus_tag LOCUS_35290 3515908 3517431 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726847.1 protein_id gnl|my_center|LOCUS_35290 3518669 3517434 gene locus_tag LOCUS_35300 3518669 3517434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 3518747 3519526 gene locus_tag LOCUS_35310 3518747 3519526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35310 3519523 3520029 gene locus_tag LOCUS_35320 3519523 3520029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 3520026 3520490 gene locus_tag LOCUS_35330 3520026 3520490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 3520469 3520633 gene locus_tag LOCUS_35340 3520469 3520633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 3520943 3521656 gene locus_tag LOCUS_35350 3520943 3521656 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899101.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35350 3521669 3521791 gene locus_tag LOCUS_35360 3521669 3521791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35360 3521801 3522655 gene locus_tag LOCUS_35370 3521801 3522655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899102.1 protein_id gnl|my_center|LOCUS_35370 3522705 3523094 gene locus_tag LOCUS_35380 3522705 3523094 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_35380 3523009 3523575 gene locus_tag LOCUS_35390 3523009 3523575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 3523594 3524979 gene locus_tag LOCUS_35400 3523594 3524979 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900443.1 protein_id gnl|my_center|LOCUS_35400 3525055 3526083 gene locus_tag LOCUS_35410 3525055 3526083 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899104.1 protein_id gnl|my_center|LOCUS_35410 3526068 3527363 gene locus_tag LOCUS_35420 3526068 3527363 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904746.1 protein_id gnl|my_center|LOCUS_35420 3527360 3528643 gene locus_tag LOCUS_35430 3527360 3528643 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899106.1 protein_id gnl|my_center|LOCUS_35430 3528643 3529485 gene locus_tag LOCUS_35440 3528643 3529485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35440 3529498 3529812 gene locus_tag LOCUS_35450 3529498 3529812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35450 3529813 3530847 gene locus_tag LOCUS_35460 3529813 3530847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 3531787 3530825 gene locus_tag LOCUS_35470 3531787 3530825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35470 3532112 3531897 gene locus_tag LOCUS_35480 3532112 3531897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 3532205 3532744 gene locus_tag LOCUS_35490 3532205 3532744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 3532788 3533351 gene locus_tag LOCUS_35500 3532788 3533351 CDS product Mce associated membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899109.1 protein_id gnl|my_center|LOCUS_35500 3533348 3533920 gene locus_tag LOCUS_35510 3533348 3533920 CDS product Mce associated membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899110.1 protein_id gnl|my_center|LOCUS_35510 3533982 3534647 gene locus_tag LOCUS_35520 3533982 3534647 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899112.1 protein_id gnl|my_center|LOCUS_35520 3535096 3534728 gene locus_tag LOCUS_35530 3535096 3534728 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899111.1 protein_id gnl|my_center|LOCUS_35530 3535599 3535189 gene locus_tag LOCUS_35540 3535599 3535189 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899113.1 protein_id gnl|my_center|LOCUS_35540 3535955 3535677 gene locus_tag LOCUS_35550 3535955 3535677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 3536821 3536129 gene locus_tag LOCUS_35560 3536821 3536129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 3537363 3537668 gene locus_tag LOCUS_35570 3537363 3537668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 3538045 3538305 gene locus_tag LOCUS_35580 3538045 3538305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 3538441 3539751 gene locus_tag LOCUS_35590 3538441 3539751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 3540254 3541156 gene locus_tag LOCUS_35600 3540254 3541156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 3541335 3542150 gene locus_tag LOCUS_35610 3541335 3542150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 3542150 3542887 gene locus_tag LOCUS_35620 3542150 3542887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 3543265 3542999 gene locus_tag LOCUS_35630 3543265 3542999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 3543694 3543425 gene locus_tag LOCUS_35640 3543694 3543425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 3543804 3544127 gene locus_tag LOCUS_35650 3543804 3544127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 3544959 3544159 gene locus_tag LOCUS_35660 3544959 3544159 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896743.1 protein_id gnl|my_center|LOCUS_35660 3546074 3545061 gene locus_tag LOCUS_35670 3546074 3545061 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201735.1 protein_id gnl|my_center|LOCUS_35670 3546173 3547030 gene locus_tag LOCUS_35680 3546173 3547030 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047314084.1 protein_id gnl|my_center|LOCUS_35680 3547651 3548697 gene locus_tag LOCUS_35690 3547651 3548697 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899114.1 protein_id gnl|my_center|LOCUS_35690 3549861 3548707 gene locus_tag LOCUS_35700 3549861 3548707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 3550569 3549874 gene locus_tag LOCUS_35710 3550569 3549874 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411863.1 protein_id gnl|my_center|LOCUS_35710 3550701 3551120 gene locus_tag LOCUS_35720 3550701 3551120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 3551158 3551388 gene locus_tag LOCUS_35730 3551158 3551388 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409980.1 protein_id gnl|my_center|LOCUS_35730 3551432 3551782 gene locus_tag LOCUS_35740 3551432 3551782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 3551935 3552798 gene locus_tag LOCUS_35750 3551935 3552798 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136583.1 protein_id gnl|my_center|LOCUS_35750 3553158 3554954 gene locus_tag LOCUS_35760 3553158 3554954 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404749.1 protein_id gnl|my_center|LOCUS_35760 3557177 3555051 gene locus_tag LOCUS_35770 gene katG 3557177 3555051 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729086.1 protein_id gnl|my_center|LOCUS_35770 3557771 3557319 gene locus_tag LOCUS_35780 3557771 3557319 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899076.1 protein_id gnl|my_center|LOCUS_35780 3557914 3558129 gene locus_tag LOCUS_35790 3557914 3558129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 3558142 3559176 gene locus_tag LOCUS_35800 3558142 3559176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 3559544 3559993 gene locus_tag LOCUS_35810 3559544 3559993 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892444.1 protein_id gnl|my_center|LOCUS_35810 3560146 3561030 gene locus_tag LOCUS_35820 3560146 3561030 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082717.1 protein_id gnl|my_center|LOCUS_35820 3561918 3561064 gene locus_tag LOCUS_35830 3561918 3561064 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411722.1 protein_id gnl|my_center|LOCUS_35830 3562737 3562042 gene locus_tag LOCUS_35840 3562737 3562042 CDS product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730055.1 protein_id gnl|my_center|LOCUS_35840 3562864 3563847 gene locus_tag LOCUS_35850 gene mmaA2 3562864 3563847 CDS product cyclopropane mycolic acid synthase MmaA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900985.1 protein_id gnl|my_center|LOCUS_35850 3564381 3564659 gene locus_tag LOCUS_35860 3564381 3564659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077295.1 protein_id gnl|my_center|LOCUS_35860 3564897 3565448 gene locus_tag LOCUS_35870 3564897 3565448 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35870 3566175 3565429 gene locus_tag LOCUS_35880 3566175 3565429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35880 3566725 3566934 gene locus_tag LOCUS_35890 3566725 3566934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35890 3566849 3567415 gene locus_tag LOCUS_35900 3566849 3567415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 3567447 3567896 gene locus_tag LOCUS_35910 3567447 3567896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 3567893 3568705 gene locus_tag LOCUS_35920 gene istB 3567893 3568705 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_35920 3569016 3568702 gene locus_tag LOCUS_35930 3569016 3568702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 3569838 3570827 gene locus_tag LOCUS_35940 gene dcyD 3569838 3570827 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365903.1 protein_id gnl|my_center|LOCUS_35940 3571569 3571237 gene locus_tag LOCUS_35950 3571569 3571237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35950 3571742 3575683 gene locus_tag LOCUS_35960 gene hrpA 3571742 3575683 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731383.1 protein_id gnl|my_center|LOCUS_35960 3576608 3575943 gene locus_tag LOCUS_35970 3576608 3575943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 3576520 3578028 gene locus_tag LOCUS_35980 3576520 3578028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35980 3578068 3578391 gene locus_tag LOCUS_35990 3578068 3578391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 3579008 3578649 gene locus_tag LOCUS_36000 3579008 3578649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36000 3579434 3579120 gene locus_tag LOCUS_36010 3579434 3579120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 3579601 3580572 gene locus_tag LOCUS_36020 3579601 3580572 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_36020 3580744 3581193 gene locus_tag LOCUS_36030 3580744 3581193 CDS product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409992.1 protein_id gnl|my_center|LOCUS_36030 3581430 3582011 gene locus_tag LOCUS_36040 3581430 3582011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 3581926 3582492 gene locus_tag LOCUS_36050 3581926 3582492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 3582538 3583182 gene locus_tag LOCUS_36060 3582538 3583182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 3584102 3583275 gene locus_tag LOCUS_36070 3584102 3583275 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082750.1 protein_id gnl|my_center|LOCUS_36070 3586116 3584605 gene locus_tag LOCUS_36080 3586116 3584605 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083151429.1 protein_id gnl|my_center|LOCUS_36080 3586715 3586365 gene locus_tag LOCUS_36090 3586715 3586365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 3587048 3587254 gene locus_tag LOCUS_36100 3587048 3587254 CDS product antitoxin MazE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729843.1 protein_id gnl|my_center|LOCUS_36100 3587251 3587583 gene locus_tag LOCUS_36110 3587251 3587583 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895797.1 protein_id gnl|my_center|LOCUS_36110 3587992 3588531 gene locus_tag LOCUS_36120 3587992 3588531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 3588532 3589086 gene locus_tag LOCUS_36130 3588532 3589086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 3589364 3589597 gene locus_tag LOCUS_36140 3589364 3589597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 3589587 3589898 gene locus_tag LOCUS_36150 3589587 3589898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 3590876 3590151 gene locus_tag LOCUS_36160 3590876 3590151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 3590875 3591111 gene locus_tag LOCUS_36170 3590875 3591111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36170 3591129 3591947 gene locus_tag LOCUS_36180 3591129 3591947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36180 3593050 3592016 gene locus_tag LOCUS_36190 3593050 3592016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 3593278 3593063 gene locus_tag LOCUS_36200 3593278 3593063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 3593882 3593163 gene locus_tag LOCUS_36210 3593882 3593163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 3594205 3594996 gene locus_tag LOCUS_36220 3594205 3594996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36220 3595099 3595488 gene locus_tag LOCUS_36230 3595099 3595488 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_36230 3595403 3595969 gene locus_tag LOCUS_36240 3595403 3595969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 3596390 3595980 gene locus_tag LOCUS_36250 3596390 3595980 CDS product F420-dependent biliverdin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899157.1 protein_id gnl|my_center|LOCUS_36250 3596450 3597175 gene locus_tag LOCUS_36260 3596450 3597175 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900457.1 protein_id gnl|my_center|LOCUS_36260 3597172 3598344 gene locus_tag LOCUS_36270 3597172 3598344 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899155.1 protein_id gnl|my_center|LOCUS_36270 3598341 3599090 gene locus_tag LOCUS_36280 gene cobM 3598341 3599090 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410682.1 protein_id gnl|my_center|LOCUS_36280 3599087 3599815 gene locus_tag LOCUS_36290 3599087 3599815 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900455.1 protein_id gnl|my_center|LOCUS_36290 3600375 3599821 gene locus_tag LOCUS_36300 gene sigC 3600375 3599821 CDS product RNA polymerase sigma factor SigC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410678.1 protein_id gnl|my_center|LOCUS_36300 3600619 3601446 gene locus_tag LOCUS_36310 gene blaC 3600619 3601446 CDS product class A beta-lactamase BlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410677.1 protein_id gnl|my_center|LOCUS_36310 3601798 3602229 gene locus_tag LOCUS_36320 3601798 3602229 CDS product transport acessory protein MmpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296795.1 protein_id gnl|my_center|LOCUS_36320 3602226 3605222 gene locus_tag LOCUS_36330 3602226 3605222 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114814.1 protein_id gnl|my_center|LOCUS_36330 3605255 3606481 gene locus_tag LOCUS_36340 3605255 3606481 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901321.1 protein_id gnl|my_center|LOCUS_36340 3607947 3606478 gene locus_tag LOCUS_36350 3607947 3606478 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410659.1 protein_id gnl|my_center|LOCUS_36350 3608570 3607944 gene locus_tag LOCUS_36360 3608570 3607944 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410658.1 protein_id gnl|my_center|LOCUS_36360 3609697 3608588 gene locus_tag LOCUS_36370 gene cobG 3609697 3608588 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900454.1 protein_id gnl|my_center|LOCUS_36370 3612920 3609783 gene locus_tag LOCUS_36380 3612920 3609783 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445472.1 protein_id gnl|my_center|LOCUS_36380 3613193 3613864 gene locus_tag LOCUS_36390 3613193 3613864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 3614847 3613951 gene locus_tag LOCUS_36400 3614847 3613951 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084293.1 protein_id gnl|my_center|LOCUS_36400 3615584 3614844 gene locus_tag LOCUS_36410 3615584 3614844 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409355.1 protein_id gnl|my_center|LOCUS_36410 3615833 3617374 gene locus_tag LOCUS_36420 3615833 3617374 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728275.1 protein_id gnl|my_center|LOCUS_36420 3617578 3617378 gene locus_tag LOCUS_36430 3617578 3617378 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892088.1 protein_id gnl|my_center|LOCUS_36430 3617632 3621204 gene locus_tag LOCUS_36440 gene cobN 3617632 3621204 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410648.1 protein_id gnl|my_center|LOCUS_36440 3621310 3621699 gene locus_tag LOCUS_36450 3621310 3621699 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410645.1 protein_id gnl|my_center|LOCUS_36450 3621710 3622588 gene locus_tag LOCUS_36460 3621710 3622588 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255354.1 protein_id gnl|my_center|LOCUS_36460 3622725 3624311 gene locus_tag LOCUS_36470 3622725 3624311 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899660.1 protein_id gnl|my_center|LOCUS_36470 3625959 3624334 gene locus_tag LOCUS_36480 3625959 3624334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 3626887 3626177 gene locus_tag LOCUS_36490 3626887 3626177 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410610.1 protein_id gnl|my_center|LOCUS_36490 3626960 3627592 gene locus_tag LOCUS_36500 gene fxsA 3626960 3627592 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410608.1 protein_id gnl|my_center|LOCUS_36500 3627623 3629227 gene locus_tag LOCUS_36510 3627623 3629227 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410605.1 protein_id gnl|my_center|LOCUS_36510 3629220 3631316 gene locus_tag LOCUS_36520 3629220 3631316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36520 3631342 3632148 gene locus_tag LOCUS_36530 3631342 3632148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36530 3632504 3632169 gene locus_tag LOCUS_36540 gene rbpA 3632504 3632169 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410601.1 protein_id gnl|my_center|LOCUS_36540 3632787 3633020 gene locus_tag LOCUS_36550 3632787 3633020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410590.1 protein_id gnl|my_center|LOCUS_36550 3633384 3645950 gene locus_tag LOCUS_36560 3633384 3645950 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886138.1 protein_id gnl|my_center|LOCUS_36560 3646023 3648683 gene locus_tag LOCUS_36570 3646023 3648683 CDS product sugar epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410309.1 protein_id gnl|my_center|LOCUS_36570 3648816 3648652 gene locus_tag LOCUS_36580 3648816 3648652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 3649664 3648825 gene locus_tag LOCUS_36590 3649664 3648825 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058043.1 protein_id gnl|my_center|LOCUS_36590 3649834 3650061 gene locus_tag LOCUS_36600 3649834 3650061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 3650770 3650237 gene locus_tag LOCUS_36610 3650770 3650237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950650.1 protein_id gnl|my_center|LOCUS_36610 3650730 3650930 gene locus_tag LOCUS_36620 3650730 3650930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 3650996 3652501 gene locus_tag LOCUS_36630 3650996 3652501 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899145.1 protein_id gnl|my_center|LOCUS_36630 3652507 3654507 gene locus_tag LOCUS_36640 3652507 3654507 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729365.1 protein_id gnl|my_center|LOCUS_36640 3654546 3655019 gene locus_tag LOCUS_36650 3654546 3655019 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891774.1 protein_id gnl|my_center|LOCUS_36650 3655804 3655097 gene locus_tag LOCUS_36660 3655804 3655097 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728928.1 protein_id gnl|my_center|LOCUS_36660 3655915 3656487 gene locus_tag LOCUS_36670 3655915 3656487 CDS product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410243.1 protein_id gnl|my_center|LOCUS_36670 3656487 3657284 gene locus_tag LOCUS_36680 3656487 3657284 CDS product ketosteroid isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899143.1 protein_id gnl|my_center|LOCUS_36680 3657366 3658682 gene locus_tag LOCUS_36690 3657366 3658682 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908336.1 protein_id gnl|my_center|LOCUS_36690 3659247 3658954 gene locus_tag LOCUS_36700 3659247 3658954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 3659497 3659129 gene locus_tag LOCUS_36710 3659497 3659129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 3660196 3659630 gene locus_tag LOCUS_36720 3660196 3659630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 3660494 3660111 gene locus_tag LOCUS_36730 3660494 3660111 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_36730 3660553 3661395 gene locus_tag LOCUS_36740 3660553 3661395 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410221.1 protein_id gnl|my_center|LOCUS_36740 3662945 3662379 gene locus_tag LOCUS_36750 3662945 3662379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 3663249 3662860 gene locus_tag LOCUS_36760 3663249 3662860 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_36760 3663508 3664473 gene locus_tag LOCUS_36770 3663508 3664473 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410214.1 protein_id gnl|my_center|LOCUS_36770 3664645 3666417 gene locus_tag LOCUS_36780 3664645 3666417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 3666624 3667460 gene locus_tag LOCUS_36790 3666624 3667460 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410196.1 protein_id gnl|my_center|LOCUS_36790 3668221 3669327 gene locus_tag LOCUS_36800 3668221 3669327 CDS product PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899661.1 protein_id gnl|my_center|LOCUS_36800 3669766 3670002 gene locus_tag LOCUS_36810 3669766 3670002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 3670032 3670421 gene locus_tag LOCUS_36820 3670032 3670421 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_36820 3670336 3670902 gene locus_tag LOCUS_36830 3670336 3670902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36830 3671034 3671483 gene locus_tag LOCUS_36840 3671034 3671483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 3671542 3671778 gene locus_tag LOCUS_36850 3671542 3671778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36850 3671796 3672659 gene locus_tag LOCUS_36860 3671796 3672659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36860 3672716 3673546 gene locus_tag LOCUS_36870 3672716 3673546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 3673583 3673876 gene locus_tag LOCUS_36880 gene esxG 3673583 3673876 CDS product type VII secretion system protein EsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401503.1 protein_id gnl|my_center|LOCUS_36880 3673912 3674202 gene locus_tag LOCUS_36890 3673912 3674202 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415340.1 protein_id gnl|my_center|LOCUS_36890 3674779 3674213 gene locus_tag LOCUS_36900 3674779 3674213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 3675083 3674694 gene locus_tag LOCUS_36910 3675083 3674694 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_36910 3675718 3675113 gene locus_tag LOCUS_36920 3675718 3675113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 3675786 3676472 gene locus_tag LOCUS_36930 3675786 3676472 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111103.1 protein_id gnl|my_center|LOCUS_36930 3677812 3676901 gene locus_tag LOCUS_36940 3677812 3676901 CDS product universal stress protein TB31.7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413592.1 protein_id gnl|my_center|LOCUS_36940 3679247 3677979 gene locus_tag LOCUS_36950 3679247 3677979 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223158.1 protein_id gnl|my_center|LOCUS_36950 3680119 3679337 gene locus_tag LOCUS_36960 3680119 3679337 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410047.1 protein_id gnl|my_center|LOCUS_36960 3681266 3680160 gene locus_tag LOCUS_36970 3681266 3680160 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_36970 3681787 3681263 gene locus_tag LOCUS_36980 3681787 3681263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 3682017 3682232 gene locus_tag LOCUS_36990 3682017 3682232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 3682245 3683279 gene locus_tag LOCUS_37000 3682245 3683279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 3684970 3683618 gene locus_tag LOCUS_37010 3684970 3683618 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402992.1 protein_id gnl|my_center|LOCUS_37010 3686214 3685525 gene locus_tag LOCUS_37020 3686214 3685525 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900448.1 protein_id gnl|my_center|LOCUS_37020 3687591 3686224 gene locus_tag LOCUS_37030 3687591 3686224 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410042.1 protein_id gnl|my_center|LOCUS_37030 3687472 3687888 gene locus_tag LOCUS_37040 3687472 3687888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 3687946 3689358 gene locus_tag LOCUS_37050 3687946 3689358 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197085735.1 protein_id gnl|my_center|LOCUS_37050 3689355 3690188 gene locus_tag LOCUS_37060 3689355 3690188 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112858.1 protein_id gnl|my_center|LOCUS_37060 3691576 3690245 gene locus_tag LOCUS_37070 3691576 3690245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 3692786 3691722 gene locus_tag LOCUS_37080 3692786 3691722 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728257.1 protein_id gnl|my_center|LOCUS_37080 3693114 3693905 gene locus_tag LOCUS_37090 3693114 3693905 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079744.1 protein_id gnl|my_center|LOCUS_37090 3694794 3694123 gene locus_tag LOCUS_37100 3694794 3694123 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410019.1 protein_id gnl|my_center|LOCUS_37100 3695411 3694875 gene locus_tag LOCUS_37110 3695411 3694875 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893937.1 protein_id gnl|my_center|LOCUS_37110 3695879 3695466 gene locus_tag LOCUS_37120 3695879 3695466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37120 3697148 3695913 gene locus_tag LOCUS_37130 3697148 3695913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37130 3697929 3697252 gene locus_tag LOCUS_37140 3697929 3697252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37140 3698274 3698038 gene locus_tag LOCUS_37150 3698274 3698038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37150 3699424 3698690 gene locus_tag LOCUS_37160 3699424 3698690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 3700007 3699441 gene locus_tag LOCUS_37170 3700007 3699441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 3700305 3699922 gene locus_tag LOCUS_37180 3700305 3699922 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_37180 3702497 3700341 gene locus_tag LOCUS_37190 3702497 3700341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 3703681 3702647 gene locus_tag LOCUS_37200 3703681 3702647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 3703936 3703694 gene locus_tag LOCUS_37210 3703936 3703694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 3705597 3704176 gene locus_tag LOCUS_37220 3705597 3704176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 3705539 3705703 gene locus_tag LOCUS_37230 3705539 3705703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 3705700 3705924 gene locus_tag LOCUS_37240 3705700 3705924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 3706234 3709470 gene locus_tag LOCUS_37250 3706234 3709470 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401912.1 protein_id gnl|my_center|LOCUS_37250 3709849 3709517 gene locus_tag LOCUS_37260 3709849 3709517 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413663.1 protein_id gnl|my_center|LOCUS_37260 3710442 3709870 gene locus_tag LOCUS_37270 3710442 3709870 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894972.1 protein_id gnl|my_center|LOCUS_37270 3710606 3711634 gene locus_tag LOCUS_37280 3710606 3711634 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082704.1 protein_id gnl|my_center|LOCUS_37280 3712314 3712931 gene locus_tag LOCUS_37290 3712314 3712931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 3712956 3713198 gene locus_tag LOCUS_37300 3712956 3713198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 3713211 3714245 gene locus_tag LOCUS_37310 3713211 3714245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 3714448 3714729 gene locus_tag LOCUS_37320 3714448 3714729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37320 3714771 3715565 gene locus_tag LOCUS_37330 3714771 3715565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37330 3715562 3715759 gene locus_tag LOCUS_37340 3715562 3715759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 3717062 3716067 gene locus_tag LOCUS_37350 3717062 3716067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 3717714 3717148 gene locus_tag LOCUS_37360 3717714 3717148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 3718018 3717629 gene locus_tag LOCUS_37370 3718018 3717629 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_37370 3718404 3718048 gene locus_tag LOCUS_37380 3718404 3718048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 3718651 3718508 gene locus_tag LOCUS_37390 3718651 3718508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 3719104 3719403 gene locus_tag LOCUS_37400 3719104 3719403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 3720156 3719362 gene locus_tag LOCUS_37410 3720156 3719362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37410 3720479 3720198 gene locus_tag LOCUS_37420 3720479 3720198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37420 3721406 3721098 gene locus_tag LOCUS_37430 3721406 3721098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 3721786 3722484 gene locus_tag LOCUS_37440 3721786 3722484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 3722481 3723437 gene locus_tag LOCUS_37450 3722481 3723437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903746.1 protein_id gnl|my_center|LOCUS_37450 3726896 3723534 gene locus_tag LOCUS_37460 3726896 3723534 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726887.1 protein_id gnl|my_center|LOCUS_37460 3727383 3726889 gene locus_tag LOCUS_37470 3727383 3726889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37470 3729026 3727581 gene locus_tag LOCUS_37480 3729026 3727581 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726886.1 protein_id gnl|my_center|LOCUS_37480 3730479 3729997 gene locus_tag LOCUS_37490 3730479 3729997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 3730673 3730476 gene locus_tag LOCUS_37500 3730673 3730476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 3732590 3730869 gene locus_tag LOCUS_37510 3732590 3730869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 3734481 3732787 gene locus_tag LOCUS_37520 3734481 3732787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 3735030 3734491 gene locus_tag LOCUS_37530 3735030 3734491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 3736194 3735067 gene locus_tag LOCUS_37540 3736194 3735067 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410743.1 protein_id gnl|my_center|LOCUS_37540 3736354 3737274 gene locus_tag LOCUS_37550 3736354 3737274 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886139.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37550 3737616 3737287 gene locus_tag LOCUS_37560 3737616 3737287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 3737725 3738054 gene locus_tag LOCUS_37570 3737725 3738054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 3741022 3738230 gene locus_tag LOCUS_37580 3741022 3738230 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899167.1 protein_id gnl|my_center|LOCUS_37580 3741964 3741074 gene locus_tag LOCUS_37590 gene tatC 3741964 3741074 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410764.1 protein_id gnl|my_center|LOCUS_37590 3742336 3742070 gene locus_tag LOCUS_37600 gene tatA 3742336 3742070 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410768.1 protein_id gnl|my_center|LOCUS_37600 3743431 3742463 gene locus_tag LOCUS_37610 3743431 3742463 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410772.1 protein_id gnl|my_center|LOCUS_37610 3744479 3743481 gene locus_tag LOCUS_37620 3744479 3743481 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410775.1 protein_id gnl|my_center|LOCUS_37620 3745876 3744533 gene locus_tag LOCUS_37630 gene pafA 3745876 3744533 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908273.1 protein_id gnl|my_center|LOCUS_37630 3746752 3745949 gene locus_tag LOCUS_37640 gene prcA 3746752 3745949 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901330.1 protein_id gnl|my_center|LOCUS_37640 3747486 3746749 gene locus_tag LOCUS_37650 gene prcB 3747486 3746749 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411023.1 protein_id gnl|my_center|LOCUS_37650 3747809 3747615 gene locus_tag LOCUS_37660 3747809 3747615 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411026.1 protein_id gnl|my_center|LOCUS_37660 3749490 3747982 gene locus_tag LOCUS_37670 gene dop 3749490 3747982 CDS product pup deamidase/depupylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899176.1 protein_id gnl|my_center|LOCUS_37670 3749787 3751061 gene locus_tag LOCUS_37680 3749787 3751061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 3751102 3752292 gene locus_tag LOCUS_37690 3751102 3752292 CDS product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411031.1 protein_id gnl|my_center|LOCUS_37690 3752267 3752926 gene locus_tag LOCUS_37700 3752267 3752926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411033.1 protein_id gnl|my_center|LOCUS_37700 3754779 3752950 gene locus_tag LOCUS_37710 gene arc 3754779 3752950 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411035.1 protein_id gnl|my_center|LOCUS_37710 3755077 3755724 gene locus_tag LOCUS_37720 3755077 3755724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900470.1 protein_id gnl|my_center|LOCUS_37720 3755733 3756035 gene locus_tag LOCUS_37730 3755733 3756035 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075541644.1 protein_id gnl|my_center|LOCUS_37730 3757001 3756048 gene locus_tag LOCUS_37740 gene trmI 3757001 3756048 CDS product tRNA (adenine(58)-N(1))-methyltransferase TrmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411041.1 protein_id gnl|my_center|LOCUS_37740 3756964 3757845 gene locus_tag LOCUS_37750 3756964 3757845 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899178.1 protein_id gnl|my_center|LOCUS_37750 3757842 3758621 gene locus_tag LOCUS_37760 3757842 3758621 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895361.1 protein_id gnl|my_center|LOCUS_37760 3763780 3758642 gene locus_tag LOCUS_37770 3763780 3758642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 3764384 3763818 gene locus_tag LOCUS_37780 3764384 3763818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 3764688 3764299 gene locus_tag LOCUS_37790 3764688 3764299 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_37790 3769913 3764718 gene locus_tag LOCUS_37800 3769913 3764718 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900387.1 protein_id gnl|my_center|LOCUS_37800 3772001 3769944 gene locus_tag LOCUS_37810 3772001 3769944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37810 3772427 3774028 gene locus_tag LOCUS_37820 3772427 3774028 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 protein_id gnl|my_center|LOCUS_37820 3774532 3774068 gene locus_tag LOCUS_37830 3774532 3774068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37830 3775454 3774450 gene locus_tag LOCUS_37840 3775454 3774450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37840 3775660 3775451 gene locus_tag LOCUS_37850 3775660 3775451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37850 3776905 3776051 gene locus_tag LOCUS_37860 gene hisG 3776905 3776051 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411047.1 protein_id gnl|my_center|LOCUS_37860 3777189 3776908 gene locus_tag LOCUS_37870 3777189 3776908 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899180.1 protein_id gnl|my_center|LOCUS_37870 3778728 3777241 gene locus_tag LOCUS_37880 3778728 3777241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 3779107 3780756 gene locus_tag LOCUS_37890 3779107 3780756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 3780906 3780679 gene locus_tag LOCUS_37900 3780906 3780679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 3781114 3781992 gene locus_tag LOCUS_37910 3781114 3781992 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411060.1 protein_id gnl|my_center|LOCUS_37910 3783245 3782130 gene locus_tag LOCUS_37920 3783245 3782130 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227533.1 protein_id gnl|my_center|LOCUS_37920 3784166 3783285 gene locus_tag LOCUS_37930 3784166 3783285 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411086.1 protein_id gnl|my_center|LOCUS_37930 3785425 3784190 gene locus_tag LOCUS_37940 gene mshC 3785425 3784190 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411091.1 protein_id gnl|my_center|LOCUS_37940 3785691 3787244 gene locus_tag LOCUS_37950 3785691 3787244 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_37950 3788064 3787273 gene locus_tag LOCUS_37960 gene cysQ 3788064 3787273 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411096.1 protein_id gnl|my_center|LOCUS_37960 3788961 3788176 gene locus_tag LOCUS_37970 3788961 3788176 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411101.1 protein_id gnl|my_center|LOCUS_37970 3789562 3788975 gene locus_tag LOCUS_37980 3789562 3788975 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411102.1 protein_id gnl|my_center|LOCUS_37980 3790396 3789650 gene locus_tag LOCUS_37990 3790396 3789650 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411103.1 protein_id gnl|my_center|LOCUS_37990 3791223 3790393 gene locus_tag LOCUS_38000 3791223 3790393 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411105.1 protein_id gnl|my_center|LOCUS_38000 3791533 3791285 gene locus_tag LOCUS_38010 3791533 3791285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 3791752 3792768 gene locus_tag LOCUS_38020 3791752 3792768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411110.1 protein_id gnl|my_center|LOCUS_38020 3792765 3793028 gene locus_tag LOCUS_38030 3792765 3793028 CDS product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895584.1 protein_id gnl|my_center|LOCUS_38030 3793061 3794143 gene locus_tag LOCUS_38040 3793061 3794143 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411116.1 protein_id gnl|my_center|LOCUS_38040 3795006 3794155 gene locus_tag LOCUS_38050 3795006 3794155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38050 3795544 3795251 gene locus_tag LOCUS_38060 3795544 3795251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38060 3796198 3795671 gene locus_tag LOCUS_38070 3796198 3795671 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411119.1 protein_id gnl|my_center|LOCUS_38070 3797508 3796225 gene locus_tag LOCUS_38080 3797508 3796225 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411121.1 protein_id gnl|my_center|LOCUS_38080 3797730 3797816 gene locus_tag LOCUS_t00270 3797730 3797816 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3798336 3799277 gene locus_tag LOCUS_38090 3798336 3799277 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111446.1 protein_id gnl|my_center|LOCUS_38090 3799750 3800346 gene locus_tag LOCUS_38100 3799750 3800346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 3800813 3800418 gene locus_tag LOCUS_38110 3800813 3800418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411130.1 protein_id gnl|my_center|LOCUS_38110 3801692 3800898 gene locus_tag LOCUS_38120 gene wag31 3801692 3800898 CDS product cell wall synthesis protein Wag31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411131.1 protein_id gnl|my_center|LOCUS_38120 3802244 3801954 gene locus_tag LOCUS_38130 3802244 3801954 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900476.1 protein_id gnl|my_center|LOCUS_38130 3803093 3802422 gene locus_tag LOCUS_38140 gene sepF 3803093 3802422 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411133.1 protein_id gnl|my_center|LOCUS_38140 3803943 3803158 gene locus_tag LOCUS_38150 3803943 3803158 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411137.1 protein_id gnl|my_center|LOCUS_38150 3804602 3803940 gene locus_tag LOCUS_38160 gene pgeF 3804602 3803940 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411140.1 protein_id gnl|my_center|LOCUS_38160 3805902 3804739 gene locus_tag LOCUS_38170 gene ftsZ 3805902 3804739 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411144.1 protein_id gnl|my_center|LOCUS_38170 3807105 3806149 gene locus_tag LOCUS_38180 gene ftsQ 3807105 3806149 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411157.1 protein_id gnl|my_center|LOCUS_38180 3808526 3807102 gene locus_tag LOCUS_38190 gene murC 3808526 3807102 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411159.1 protein_id gnl|my_center|LOCUS_38190 3809779 3808565 gene locus_tag LOCUS_38200 gene murG 3809779 3808565 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950665.1 protein_id gnl|my_center|LOCUS_38200 3811407 3809776 gene locus_tag LOCUS_38210 gene ftsW 3811407 3809776 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411165.1 protein_id gnl|my_center|LOCUS_38210 3812889 3811414 gene locus_tag LOCUS_38220 gene murD 3812889 3811414 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014001157.1 protein_id gnl|my_center|LOCUS_38220 3813949 3812882 gene locus_tag LOCUS_38230 gene mraY 3813949 3812882 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411171.1 protein_id gnl|my_center|LOCUS_38230 3815535 3813958 gene locus_tag LOCUS_38240 3815535 3813958 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908017.1 protein_id gnl|my_center|LOCUS_38240 3817097 3815532 gene locus_tag LOCUS_38250 3817097 3815532 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411189.1 protein_id gnl|my_center|LOCUS_38250 3819054 3817513 gene locus_tag LOCUS_38260 3819054 3817513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38260 3819298 3818993 gene locus_tag LOCUS_38270 3819298 3818993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38270 3821624 3819549 gene locus_tag LOCUS_38280 gene pbpB 3821624 3819549 CDS product D,D-transpeptidase PbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411214.1 protein_id gnl|my_center|LOCUS_38280 3822892 3821621 gene locus_tag LOCUS_38290 3822892 3821621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899197.1 protein_id gnl|my_center|LOCUS_38290 3823926 3822889 gene locus_tag LOCUS_38300 gene rsmH 3823926 3822889 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175266365.1 protein_id gnl|my_center|LOCUS_38300 3824509 3824078 gene locus_tag LOCUS_38310 gene mraZ 3824509 3824078 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411225.1 protein_id gnl|my_center|LOCUS_38310 3825323 3824919 gene locus_tag LOCUS_38320 3825323 3824919 CDS product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411231.1 protein_id gnl|my_center|LOCUS_38320 3825626 3826264 gene locus_tag LOCUS_38330 3825626 3826264 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411235.1 protein_id gnl|my_center|LOCUS_38330 3826414 3827061 gene locus_tag LOCUS_38340 gene lppM 3826414 3827061 CDS product lipoprotein LppM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411238.1 protein_id gnl|my_center|LOCUS_38340 3828003 3827107 gene locus_tag LOCUS_38350 3828003 3827107 CDS product mycobacterial-type methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908008.1 protein_id gnl|my_center|LOCUS_38350 3828325 3829347 gene locus_tag LOCUS_38360 3828325 3829347 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411245.1 protein_id gnl|my_center|LOCUS_38360 3829388 3830932 gene locus_tag LOCUS_38370 3829388 3830932 CDS product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903784.1 protein_id gnl|my_center|LOCUS_38370 3831374 3830970 gene locus_tag LOCUS_38380 3831374 3830970 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900481.1 protein_id gnl|my_center|LOCUS_38380 3831549 3832760 gene locus_tag LOCUS_38390 3831549 3832760 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899202.1 protein_id gnl|my_center|LOCUS_38390 3833272 3832868 gene locus_tag LOCUS_38400 3833272 3832868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38400 3835056 3833890 gene locus_tag LOCUS_38410 3835056 3833890 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484775.1 protein_id gnl|my_center|LOCUS_38410 3836157 3835102 gene locus_tag LOCUS_38420 3836157 3835102 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957686.1 protein_id gnl|my_center|LOCUS_38420 3837293 3836181 gene locus_tag LOCUS_38430 3837293 3836181 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616885.1 protein_id gnl|my_center|LOCUS_38430 3838300 3837290 gene locus_tag LOCUS_38440 gene mvaD 3838300 3837290 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_38440 3838485 3838297 gene locus_tag LOCUS_38450 3838485 3838297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 3839296 3838400 gene locus_tag LOCUS_38460 gene mvk 3839296 3838400 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_38460 3839847 3839311 gene locus_tag LOCUS_38470 gene idi 3839847 3839311 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972247.1 protein_id gnl|my_center|LOCUS_38470 3841067 3840030 gene locus_tag LOCUS_38480 3841067 3840030 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900678.1 protein_id gnl|my_center|LOCUS_38480 3841680 3841868 gene locus_tag LOCUS_38490 3841680 3841868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 3842677 3841865 gene locus_tag LOCUS_38500 gene istB 3842677 3841865 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_38500 3842853 3842674 gene locus_tag LOCUS_38510 3842853 3842674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 3842984 3843373 gene locus_tag LOCUS_38520 3842984 3843373 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_38520 3843288 3843854 gene locus_tag LOCUS_38530 3843288 3843854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 3845107 3843851 gene locus_tag LOCUS_38540 3845107 3843851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 3845266 3846195 gene locus_tag LOCUS_38550 3845266 3846195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 3846563 3847564 gene locus_tag LOCUS_38560 3846563 3847564 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940962.1 protein_id gnl|my_center|LOCUS_38560 3849142 3847754 gene locus_tag LOCUS_38570 3849142 3847754 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911784.1 protein_id gnl|my_center|LOCUS_38570 3849670 3849191 gene locus_tag LOCUS_38580 3849670 3849191 CDS product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411331.1 protein_id gnl|my_center|LOCUS_38580 3850545 3849691 gene locus_tag LOCUS_38590 3850545 3849691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 3850661 3851932 gene locus_tag LOCUS_38600 3850661 3851932 CDS product alpha-(1-2)-phosphatidylinositol mannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411339.1 protein_id gnl|my_center|LOCUS_38600 3852664 3851933 gene locus_tag LOCUS_38610 3852664 3851933 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411341.1 protein_id gnl|my_center|LOCUS_38610 3853141 3852752 gene locus_tag LOCUS_38620 3853141 3852752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411344.1 protein_id gnl|my_center|LOCUS_38620 3854337 3853138 gene locus_tag LOCUS_38630 3854337 3853138 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411348.1 protein_id gnl|my_center|LOCUS_38630 3854843 3854409 gene locus_tag LOCUS_38640 3854843 3854409 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411354.1 protein_id gnl|my_center|LOCUS_38640 3855335 3854940 gene locus_tag LOCUS_38650 3855335 3854940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411357.1 protein_id gnl|my_center|LOCUS_38650 3855537 3855908 gene locus_tag LOCUS_38660 3855537 3855908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38660 3855927 3857339 gene locus_tag LOCUS_38670 3855927 3857339 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014001171.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38670 3858564 3857407 gene locus_tag LOCUS_38680 gene pimB 3858564 3857407 CDS product GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411369.1 protein_id gnl|my_center|LOCUS_38680 3859325 3858636 gene locus_tag LOCUS_38690 3859325 3858636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411371.1 protein_id gnl|my_center|LOCUS_38690 3860667 3859507 gene locus_tag LOCUS_38700 gene ripC 3860667 3859507 CDS product peptidoglycan hydrolase RipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411373.1 protein_id gnl|my_center|LOCUS_38700 3861096 3860842 gene locus_tag LOCUS_38710 3861096 3860842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104374.1 protein_id gnl|my_center|LOCUS_38710 3861249 3863273 gene locus_tag LOCUS_38720 3861249 3863273 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901350.1 protein_id gnl|my_center|LOCUS_38720 3863712 3864167 gene locus_tag LOCUS_38730 3863712 3864167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 3864477 3865019 gene locus_tag LOCUS_38740 3864477 3865019 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411389.1 protein_id gnl|my_center|LOCUS_38740 3865228 3865977 gene locus_tag LOCUS_38750 3865228 3865977 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411392.1 protein_id gnl|my_center|LOCUS_38750 3865974 3867158 gene locus_tag LOCUS_38760 3865974 3867158 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950672.1 protein_id gnl|my_center|LOCUS_38760 3867155 3868840 gene locus_tag LOCUS_38770 3867155 3868840 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899212.1 protein_id gnl|my_center|LOCUS_38770 3869925 3869287 gene locus_tag LOCUS_38780 3869925 3869287 CDS product DUF2561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899213.1 protein_id gnl|my_center|LOCUS_38780 3870884 3869925 gene locus_tag LOCUS_38790 3870884 3869925 CDS product MmpS family transport accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411405.1 protein_id gnl|my_center|LOCUS_38790 3871486 3871067 gene locus_tag LOCUS_38800 3871486 3871067 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411408.1 protein_id gnl|my_center|LOCUS_38800 3872598 3871495 gene locus_tag LOCUS_38810 3872598 3871495 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899214.1 protein_id gnl|my_center|LOCUS_38810 3872995 3874989 gene locus_tag LOCUS_38820 gene asnB 3872995 3874989 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411413.1 protein_id gnl|my_center|LOCUS_38820 3875976 3875002 gene locus_tag LOCUS_38830 3875976 3875002 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411414.1 protein_id gnl|my_center|LOCUS_38830 3876168 3876857 gene locus_tag LOCUS_38840 3876168 3876857 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411415.1 protein_id gnl|my_center|LOCUS_38840 3877254 3876898 gene locus_tag LOCUS_38850 3877254 3876898 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411418.1 protein_id gnl|my_center|LOCUS_38850 3878506 3877340 gene locus_tag LOCUS_38860 3878506 3877340 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411420.1 protein_id gnl|my_center|LOCUS_38860 3878578 3879282 gene locus_tag LOCUS_38870 3878578 3879282 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411425.1 protein_id gnl|my_center|LOCUS_38870 3879311 3879871 gene locus_tag LOCUS_38880 gene cobU 3879311 3879871 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163803955.1 protein_id gnl|my_center|LOCUS_38880 3879868 3880944 gene locus_tag LOCUS_38890 gene cobT 3879868 3880944 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411429.1 protein_id gnl|my_center|LOCUS_38890 3880941 3881699 gene locus_tag LOCUS_38900 3880941 3881699 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411433.1 protein_id gnl|my_center|LOCUS_38900 3881802 3882689 gene locus_tag LOCUS_38910 3881802 3882689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38910 3882608 3883384 gene locus_tag LOCUS_38920 3882608 3883384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38920 3884482 3883376 gene locus_tag LOCUS_38930 3884482 3883376 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411438.1 protein_id gnl|my_center|LOCUS_38930 3885640 3884537 gene locus_tag LOCUS_38940 gene gcvT 3885640 3884537 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899219.1 protein_id gnl|my_center|LOCUS_38940 3885685 3886830 gene locus_tag LOCUS_38950 3885685 3886830 CDS product adenylyl cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411442.1 protein_id gnl|my_center|LOCUS_38950 3886842 3888401 gene locus_tag LOCUS_38960 3886842 3888401 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411444.1 protein_id gnl|my_center|LOCUS_38960 3890648 3888864 gene locus_tag LOCUS_38970 3890648 3888864 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411445.1 protein_id gnl|my_center|LOCUS_38970 3890877 3892607 gene locus_tag LOCUS_38980 gene sucB 3890877 3892607 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110455.1 protein_id gnl|my_center|LOCUS_38980 3892651 3893523 gene locus_tag LOCUS_38990 3892651 3893523 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411454.1 protein_id gnl|my_center|LOCUS_38990 3893885 3893670 gene locus_tag LOCUS_39000 3893885 3893670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 3894435 3893803 gene locus_tag LOCUS_39010 3894435 3893803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39010 3895490 3894525 gene locus_tag LOCUS_39020 3895490 3894525 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467380.1 protein_id gnl|my_center|LOCUS_39020 3896829 3895630 gene locus_tag LOCUS_39030 3896829 3895630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 3896928 3897209 gene locus_tag LOCUS_39040 3896928 3897209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39040 3897251 3898045 gene locus_tag LOCUS_39050 3897251 3898045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39050 3898562 3898080 gene locus_tag LOCUS_39060 3898562 3898080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39060 3899176 3898454 gene locus_tag LOCUS_39070 3899176 3898454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39070 3899419 3899634 gene locus_tag LOCUS_39080 3899419 3899634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 3899647 3900681 gene locus_tag LOCUS_39090 3899647 3900681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 3902903 3900801 gene locus_tag LOCUS_39100 3902903 3900801 CDS product fatty acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406569.1 protein_id gnl|my_center|LOCUS_39100 3904972 3903131 gene locus_tag LOCUS_39110 3904972 3903131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730254.1 protein_id gnl|my_center|LOCUS_39110 3905133 3905858 gene locus_tag LOCUS_39120 gene lipB 3905133 3905858 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411458.1 protein_id gnl|my_center|LOCUS_39120 3905927 3906829 gene locus_tag LOCUS_39130 gene lipA 3905927 3906829 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411460.1 protein_id gnl|my_center|LOCUS_39130 3906856 3907608 gene locus_tag LOCUS_39140 3906856 3907608 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950675.1 protein_id gnl|my_center|LOCUS_39140 3908080 3907658 gene locus_tag LOCUS_39150 3908080 3907658 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411466.1 protein_id gnl|my_center|LOCUS_39150 3908323 3909759 gene locus_tag LOCUS_39160 gene glnA 3908323 3909759 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411475.1 protein_id gnl|my_center|LOCUS_39160 3910135 3909824 gene locus_tag LOCUS_39170 3910135 3909824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 3911038 3911861 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gactgttcggtgtcggcggc 3911972 3912169 gene locus_tag LOCUS_39180 3911972 3912169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 3913074 3912214 gene locus_tag LOCUS_39190 3913074 3912214 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_39190 3913709 3913071 gene locus_tag LOCUS_39200 3913709 3913071 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 protein_id gnl|my_center|LOCUS_39200 3916710 3913723 gene locus_tag LOCUS_39210 3916710 3913723 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411478.1 protein_id gnl|my_center|LOCUS_39210 3918121 3916781 gene locus_tag LOCUS_39220 3918121 3916781 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411482.1 protein_id gnl|my_center|LOCUS_39220 3919770 3918211 gene locus_tag LOCUS_39230 gene caeB 3919770 3918211 CDS product carboxylesterase CaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411484.1 protein_id gnl|my_center|LOCUS_39230 3921189 3919840 gene locus_tag LOCUS_39240 gene ctaD 3921189 3919840 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415946.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39240 3921152 3921364 gene locus_tag LOCUS_39250 3921152 3921364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 3923241 3921718 gene locus_tag LOCUS_39260 gene caeA 3923241 3921718 CDS product carboxylesterase CaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411486.1 protein_id gnl|my_center|LOCUS_39260 3924665 3923334 gene locus_tag LOCUS_39270 3924665 3923334 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729712.1 protein_id gnl|my_center|LOCUS_39270 3924873 3925766 gene locus_tag LOCUS_39280 gene panB 3924873 3925766 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411489.1 protein_id gnl|my_center|LOCUS_39280 3926202 3925774 gene locus_tag LOCUS_39290 3926202 3925774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 3926359 3927951 gene locus_tag LOCUS_39300 3926359 3927951 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911786.1 protein_id gnl|my_center|LOCUS_39300 3928543 3929082 gene locus_tag LOCUS_39310 3928543 3929082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39310 3929113 3929352 gene locus_tag LOCUS_39320 3929113 3929352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 3931446 3929998 gene locus_tag LOCUS_39330 3931446 3929998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39330 3933595 3932537 gene locus_tag LOCUS_39340 3933595 3932537 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899226.1 protein_id gnl|my_center|LOCUS_39340 3934395 3933658 gene locus_tag LOCUS_39350 3934395 3933658 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411501.1 protein_id gnl|my_center|LOCUS_39350 3935554 3934418 gene locus_tag LOCUS_39360 3935554 3934418 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908450.1 protein_id gnl|my_center|LOCUS_39360 3936606 3935551 gene locus_tag LOCUS_39370 gene cobC 3936606 3935551 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411503.1 protein_id gnl|my_center|LOCUS_39370 3936791 3937513 gene locus_tag LOCUS_39380 3936791 3937513 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411507.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39380 3937506 3938000 gene locus_tag LOCUS_39390 gene ptpA 3937506 3938000 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411510.1 protein_id gnl|my_center|LOCUS_39390 3938000 3938824 gene locus_tag LOCUS_39400 3938000 3938824 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411514.1 protein_id gnl|my_center|LOCUS_39400 3939747 3938806 gene locus_tag LOCUS_39410 3939747 3938806 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936469.1 protein_id gnl|my_center|LOCUS_39410 3940033 3940242 gene locus_tag LOCUS_39420 3940033 3940242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 3940157 3940408 gene locus_tag LOCUS_39430 3940157 3940408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39430 3940795 3941610 gene locus_tag LOCUS_39440 3940795 3941610 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901356.1 protein_id gnl|my_center|LOCUS_39440 3942560 3941631 gene locus_tag LOCUS_39450 3942560 3941631 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227634.1 protein_id gnl|my_center|LOCUS_39450 3943170 3942649 gene locus_tag LOCUS_39460 3943170 3942649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39460 3943772 3943149 gene locus_tag LOCUS_39470 3943772 3943149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39470 3944369 3943803 gene locus_tag LOCUS_39480 3944369 3943803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 3944673 3944284 gene locus_tag LOCUS_39490 3944673 3944284 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_39490 3944930 3944736 gene locus_tag LOCUS_39500 3944930 3944736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899229.1 protein_id gnl|my_center|LOCUS_39500 3945313 3945065 gene locus_tag LOCUS_39510 3945313 3945065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 3946074 3945310 gene locus_tag LOCUS_39520 3946074 3945310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39520 3946399 3946193 gene locus_tag LOCUS_39530 3946399 3946193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 3947006 3946440 gene locus_tag LOCUS_39540 3947006 3946440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 3947310 3946921 gene locus_tag LOCUS_39550 3947310 3946921 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_39550 3948202 3947408 gene locus_tag LOCUS_39560 3948202 3947408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 3948331 3948546 gene locus_tag LOCUS_39570 3948331 3948546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 3948656 3949618 gene locus_tag LOCUS_39580 3948656 3949618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39580 3949868 3950323 gene locus_tag LOCUS_39590 3949868 3950323 CDS product 2,4'-dihydroxyacetophenone dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479856.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39590 3950323 3951405 gene locus_tag LOCUS_39600 3950323 3951405 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085596.1 protein_id gnl|my_center|LOCUS_39600 3951442 3952914 gene locus_tag LOCUS_39610 3951442 3952914 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407366.1 protein_id gnl|my_center|LOCUS_39610 3952911 3954461 gene locus_tag LOCUS_39620 3952911 3954461 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407366.1 protein_id gnl|my_center|LOCUS_39620 3954543 3954469 gene locus_tag LOCUS_t00280 3954543 3954469 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3955061 3954600 gene locus_tag LOCUS_39630 gene ahpE 3955061 3954600 CDS product peroxiredoxin AhpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411527.1 protein_id gnl|my_center|LOCUS_39630 3955483 3955061 gene locus_tag LOCUS_39640 3955483 3955061 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411534.1 protein_id gnl|my_center|LOCUS_39640 3956070 3955564 gene locus_tag LOCUS_39650 3956070 3955564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031652337.1 protein_id gnl|my_center|LOCUS_39650 3956438 3959140 gene locus_tag LOCUS_39660 gene aceE 3956438 3959140 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911788.1 protein_id gnl|my_center|LOCUS_39660 3959274 3960584 gene locus_tag LOCUS_39670 3959274 3960584 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411543.1 protein_id gnl|my_center|LOCUS_39670 3960746 3961654 gene locus_tag LOCUS_39680 gene fabD 3960746 3961654 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411559.1 protein_id gnl|my_center|LOCUS_39680 3961727 3962074 gene locus_tag LOCUS_39690 gene acpM 3961727 3962074 CDS product meromycolate extension acyl carrier protein AcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908456.1 protein_id gnl|my_center|LOCUS_39690 3962071 3963321 gene locus_tag LOCUS_39700 gene kasA 3962071 3963321 CDS product 3-oxoacyl-ACP synthase KasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411571.1 protein_id gnl|my_center|LOCUS_39700 3963403 3964656 gene locus_tag LOCUS_39710 gene kasB 3963403 3964656 CDS product 3-oxoacyl-ACP synthase KasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411576.1 protein_id gnl|my_center|LOCUS_39710 3964703 3966115 gene locus_tag LOCUS_39720 3964703 3966115 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900487.1 protein_id gnl|my_center|LOCUS_39720 3966241 3967128 gene locus_tag LOCUS_39730 3966241 3967128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041179691.1 protein_id gnl|my_center|LOCUS_39730 3968744 3967209 gene locus_tag LOCUS_39740 3968744 3967209 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411591.1 protein_id gnl|my_center|LOCUS_39740 3969304 3968744 gene locus_tag LOCUS_39750 3969304 3968744 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411595.1 protein_id gnl|my_center|LOCUS_39750 3969361 3970941 gene locus_tag LOCUS_39760 3969361 3970941 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411596.1 protein_id gnl|my_center|LOCUS_39760 3970938 3971900 gene locus_tag LOCUS_39770 3970938 3971900 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411603.1 protein_id gnl|my_center|LOCUS_39770 3972423 3972136 gene locus_tag LOCUS_39780 3972423 3972136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 3972371 3972541 gene locus_tag LOCUS_39790 3972371 3972541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 3973059 3972547 gene locus_tag LOCUS_39800 3973059 3972547 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899235.1 protein_id gnl|my_center|LOCUS_39800 3974031 3973213 gene locus_tag LOCUS_39810 3974031 3973213 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411619.1 protein_id gnl|my_center|LOCUS_39810 3975114 3974044 gene locus_tag LOCUS_39820 3975114 3974044 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411622.1 protein_id gnl|my_center|LOCUS_39820 3975245 3976330 gene locus_tag LOCUS_39830 3975245 3976330 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908534.1 protein_id gnl|my_center|LOCUS_39830 3976330 3976953 gene locus_tag LOCUS_39840 3976330 3976953 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411632.1 protein_id gnl|my_center|LOCUS_39840 3977764 3977066 gene locus_tag LOCUS_39850 3977764 3977066 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729750.1 protein_id gnl|my_center|LOCUS_39850 3979155 3977761 gene locus_tag LOCUS_39860 gene lnt 3979155 3977761 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901363.1 protein_id gnl|my_center|LOCUS_39860 3979274 3980299 gene locus_tag LOCUS_39870 3979274 3980299 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899238.1 protein_id gnl|my_center|LOCUS_39870 3980301 3980876 gene locus_tag LOCUS_39880 3980301 3980876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39880 3980928 3981407 gene locus_tag LOCUS_39890 3980928 3981407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39890 3981498 3981854 gene locus_tag LOCUS_39900 3981498 3981854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 3983811 3981907 gene locus_tag LOCUS_39910 3983811 3981907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 3984776 3983943 gene locus_tag LOCUS_39920 3984776 3983943 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250320.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39920 3985028 3984861 gene locus_tag LOCUS_39930 3985028 3984861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39930 3985243 3985581 gene locus_tag LOCUS_39940 3985243 3985581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 3985687 3986781 gene locus_tag LOCUS_39950 gene cyp124 3985687 3986781 CDS product methyl-branched lipid omega-hydroxylase Cyp124 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411654.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39950 3986694 3986978 gene locus_tag LOCUS_39960 3986694 3986978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39960 3987021 3988394 gene locus_tag LOCUS_39970 3987021 3988394 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 protein_id gnl|my_center|LOCUS_39970 3989029 3988403 gene locus_tag LOCUS_39980 3989029 3988403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 3989404 3989123 gene locus_tag LOCUS_39990 3989404 3989123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 3990012 3989446 gene locus_tag LOCUS_40000 3990012 3989446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 3990316 3989927 gene locus_tag LOCUS_40010 3990316 3989927 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_40010 3991172 3990390 gene locus_tag LOCUS_40020 3991172 3990390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 3991433 3991990 gene locus_tag LOCUS_40030 3991433 3991990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 3992252 3992461 gene locus_tag LOCUS_40040 3992252 3992461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40040 3992376 3992942 gene locus_tag LOCUS_40050 3992376 3992942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40050 3993368 3993961 gene locus_tag LOCUS_40060 3993368 3993961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 3995404 3994208 gene locus_tag LOCUS_40070 3995404 3994208 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408476.1 protein_id gnl|my_center|LOCUS_40070 3996975 3995401 gene locus_tag LOCUS_40080 3996975 3995401 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950580.1 protein_id gnl|my_center|LOCUS_40080 3997186 3999039 gene locus_tag LOCUS_40090 gene fadD11 3997186 3999039 CDS product fatty acid--CoA ligase FadD11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083132908.1 protein_id gnl|my_center|LOCUS_40090 3999082 3999645 gene locus_tag LOCUS_40100 3999082 3999645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 3999904 4001205 gene locus_tag LOCUS_40110 3999904 4001205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727545.1 protein_id gnl|my_center|LOCUS_40110 4001376 4001098 gene locus_tag LOCUS_40120 4001376 4001098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 4001333 4001875 gene locus_tag LOCUS_40130 4001333 4001875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 4002040 4002693 gene locus_tag LOCUS_40140 4002040 4002693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 4002923 4004158 gene locus_tag LOCUS_40150 4002923 4004158 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651240.1 protein_id gnl|my_center|LOCUS_40150 4004186 4004692 gene locus_tag LOCUS_40160 4004186 4004692 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404044.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40160 4005268 4004867 gene locus_tag LOCUS_40170 4005268 4004867 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467875.1 protein_id gnl|my_center|LOCUS_40170 4005364 4005960 gene locus_tag LOCUS_40180 4005364 4005960 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_40180 4006063 4007931 gene locus_tag LOCUS_40190 gene pknD 4006063 4007931 CDS product serine/threonine protein kinase PknD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404782.1 protein_id gnl|my_center|LOCUS_40190 4008296 4008024 gene locus_tag LOCUS_40200 4008296 4008024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40200 4009405 4008419 gene locus_tag LOCUS_40210 4009405 4008419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40210 4010579 4011202 gene locus_tag LOCUS_40220 4010579 4011202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 4011232 4011621 gene locus_tag LOCUS_40230 4011232 4011621 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_40230 4011536 4012102 gene locus_tag LOCUS_40240 4011536 4012102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 4012261 4013445 gene locus_tag LOCUS_40250 4012261 4013445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 4013611 4014318 gene locus_tag LOCUS_40260 4013611 4014318 CDS product maleate cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064689.1 protein_id gnl|my_center|LOCUS_40260 4015136 4014405 gene locus_tag LOCUS_40270 4015136 4014405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 4015853 4015368 gene locus_tag LOCUS_40280 4015853 4015368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 4016225 4016461 gene locus_tag LOCUS_40290 4016225 4016461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 4016480 4017625 gene locus_tag LOCUS_40300 4016480 4017625 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878617.1 protein_id gnl|my_center|LOCUS_40300 4017865 4022667 gene locus_tag LOCUS_40310 4017865 4022667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 4023446 4022946 gene locus_tag LOCUS_40320 4023446 4022946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40320 4023897 4023424 gene locus_tag LOCUS_40330 4023897 4023424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40330 4024330 4023878 gene locus_tag LOCUS_40340 4024330 4023878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40340 4024578 4025066 gene locus_tag LOCUS_40350 4024578 4025066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40350 4025130 4026125 gene locus_tag LOCUS_40360 4025130 4026125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40360 4026164 4029703 gene locus_tag LOCUS_40370 gene nifJ 4026164 4029703 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 protein_id gnl|my_center|LOCUS_40370 4029703 4030713 gene locus_tag LOCUS_40380 4029703 4030713 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_40380 4030726 4031301 gene locus_tag LOCUS_40390 4030726 4031301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40390 4031311 4033146 gene locus_tag LOCUS_40400 gene ppsA 4031311 4033146 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022627.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40400 4033887 4034306 gene locus_tag LOCUS_40410 4033887 4034306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 4034667 4034407 gene locus_tag LOCUS_40420 4034667 4034407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 4034767 4036152 gene locus_tag LOCUS_40430 4034767 4036152 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411690.1 protein_id gnl|my_center|LOCUS_40430 4036724 4036215 gene locus_tag LOCUS_40440 4036724 4036215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 4037008 4037316 gene locus_tag LOCUS_40450 4037008 4037316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 4037669 4039288 gene locus_tag LOCUS_40460 4037669 4039288 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411694.1 protein_id gnl|my_center|LOCUS_40460 4039708 4041375 gene locus_tag LOCUS_40470 gene sirA 4039708 4041375 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899303.1 protein_id gnl|my_center|LOCUS_40470 4041405 4042139 gene locus_tag LOCUS_40480 4041405 4042139 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412303.1 protein_id gnl|my_center|LOCUS_40480 4042136 4042855 gene locus_tag LOCUS_40490 4042136 4042855 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412306.1 protein_id gnl|my_center|LOCUS_40490 4043814 4042876 gene locus_tag LOCUS_40500 4043814 4042876 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411696.1 protein_id gnl|my_center|LOCUS_40500 4043901 4045265 gene locus_tag LOCUS_40510 4043901 4045265 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907864.1 protein_id gnl|my_center|LOCUS_40510 4045288 4045614 gene locus_tag LOCUS_40520 4045288 4045614 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908368.1 protein_id gnl|my_center|LOCUS_40520 4046080 4046355 gene locus_tag LOCUS_40530 4046080 4046355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 4046371 4046859 gene locus_tag LOCUS_40540 4046371 4046859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 4047219 4047608 gene locus_tag LOCUS_40550 4047219 4047608 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_40550 4047523 4048089 gene locus_tag LOCUS_40560 4047523 4048089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 4048853 4048260 gene locus_tag LOCUS_40570 4048853 4048260 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731182.1 protein_id gnl|my_center|LOCUS_40570 4050330 4049038 gene locus_tag LOCUS_40580 4050330 4049038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 4050586 4051260 gene locus_tag LOCUS_40590 4050586 4051260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40590 4051285 4051818 gene locus_tag LOCUS_40600 4051285 4051818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40600 4052645 4051827 gene locus_tag LOCUS_40610 4052645 4051827 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726830.1 protein_id gnl|my_center|LOCUS_40610 4053241 4052936 gene locus_tag LOCUS_40620 4053241 4052936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40620 4054585 4053434 gene locus_tag LOCUS_40630 4054585 4053434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40630 4055322 4055023 gene locus_tag LOCUS_40640 4055322 4055023 CDS product ClpX C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226927.1 protein_id gnl|my_center|LOCUS_40640 4055499 4056761 gene locus_tag LOCUS_40650 4055499 4056761 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899248.1 protein_id gnl|my_center|LOCUS_40650 4056758 4057759 gene locus_tag LOCUS_40660 4056758 4057759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 4057939 4059288 gene locus_tag LOCUS_40670 4057939 4059288 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411704.1 protein_id gnl|my_center|LOCUS_40670 4059369 4060517 gene locus_tag LOCUS_40680 4059369 4060517 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728134.1 protein_id gnl|my_center|LOCUS_40680 4061215 4060523 gene locus_tag LOCUS_40690 4061215 4060523 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411707.1 protein_id gnl|my_center|LOCUS_40690 4061405 4061647 gene locus_tag LOCUS_40700 4061405 4061647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 4061660 4062694 gene locus_tag LOCUS_40710 4061660 4062694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 4063243 4062803 gene locus_tag LOCUS_40720 4063243 4062803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 4064302 4063736 gene locus_tag LOCUS_40730 4064302 4063736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 4064606 4064217 gene locus_tag LOCUS_40740 4064606 4064217 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_40740 4064692 4065756 gene locus_tag LOCUS_40750 4064692 4065756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 4065852 4067444 gene locus_tag LOCUS_40760 4065852 4067444 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411714.1 protein_id gnl|my_center|LOCUS_40760 4067904 4067545 gene locus_tag LOCUS_40770 4067904 4067545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416355.1 protein_id gnl|my_center|LOCUS_40770 4068578 4067856 gene locus_tag LOCUS_40780 4068578 4067856 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950834.1 protein_id gnl|my_center|LOCUS_40780 4068833 4068591 gene locus_tag LOCUS_40790 4068833 4068591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 4068949 4069800 gene locus_tag LOCUS_40800 4068949 4069800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 4069757 4071118 gene locus_tag LOCUS_40810 4069757 4071118 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727799.1 protein_id gnl|my_center|LOCUS_40810 4071202 4072068 gene locus_tag LOCUS_40820 4071202 4072068 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877522.1 protein_id gnl|my_center|LOCUS_40820 4072065 4072775 gene locus_tag LOCUS_40830 4072065 4072775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 4073277 4072792 gene locus_tag LOCUS_40840 4073277 4072792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 4074042 4075217 gene locus_tag LOCUS_40850 4074042 4075217 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419226.1 protein_id gnl|my_center|LOCUS_40850 4076087 4075293 gene locus_tag LOCUS_40860 4076087 4075293 CDS product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411717.1 protein_id gnl|my_center|LOCUS_40860 4076853 4076296 gene locus_tag LOCUS_40870 4076853 4076296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 4077404 4076892 gene locus_tag LOCUS_40880 4077404 4076892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 4078139 4077576 gene locus_tag LOCUS_40890 4078139 4077576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40890 4079747 4078953 gene locus_tag LOCUS_40900 4079747 4078953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40900 4080070 4079789 gene locus_tag LOCUS_40910 4080070 4079789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40910 4080192 4082816 gene locus_tag LOCUS_40920 4080192 4082816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 4082879 4083325 gene locus_tag LOCUS_40930 4082879 4083325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40930 4083775 4085109 gene locus_tag LOCUS_40940 4083775 4085109 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726776.1 protein_id gnl|my_center|LOCUS_40940 4085162 4086157 gene locus_tag LOCUS_40950 4085162 4086157 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950614.1 protein_id gnl|my_center|LOCUS_40950 4086187 4086540 gene locus_tag LOCUS_40960 4086187 4086540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 4086827 4087042 gene locus_tag LOCUS_40970 4086827 4087042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 4087055 4087774 gene locus_tag LOCUS_40980 4087055 4087774 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950834.1 protein_id gnl|my_center|LOCUS_40980 4087804 4088193 gene locus_tag LOCUS_40990 4087804 4088193 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_40990 4088108 4088674 gene locus_tag LOCUS_41000 4088108 4088674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 4088759 4089529 gene locus_tag LOCUS_41010 4088759 4089529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 4089887 4090966 gene locus_tag LOCUS_41020 4089887 4090966 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901532.1 protein_id gnl|my_center|LOCUS_41020 4091034 4092233 gene locus_tag LOCUS_41030 4091034 4092233 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899255.1 protein_id gnl|my_center|LOCUS_41030 4092782 4092237 gene locus_tag LOCUS_41040 4092782 4092237 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731136.1 protein_id gnl|my_center|LOCUS_41040 4092891 4093763 gene locus_tag LOCUS_41050 4092891 4093763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728690.1 protein_id gnl|my_center|LOCUS_41050 4094510 4093782 gene locus_tag LOCUS_41060 4094510 4093782 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_41060 4095790 4094612 gene locus_tag LOCUS_41070 4095790 4094612 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725028.1 protein_id gnl|my_center|LOCUS_41070 4096263 4095808 gene locus_tag LOCUS_41080 4096263 4095808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41080 4096832 4096449 gene locus_tag LOCUS_41090 4096832 4096449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41090 4097685 4097927 gene locus_tag LOCUS_41100 4097685 4097927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 4097940 4098974 gene locus_tag LOCUS_41110 4097940 4098974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 4099395 4098952 gene locus_tag LOCUS_41120 4099395 4098952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 4100007 4099414 gene locus_tag LOCUS_41130 4100007 4099414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 4100593 4100429 gene locus_tag LOCUS_41140 4100593 4100429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 4100792 4101280 gene locus_tag LOCUS_41150 4100792 4101280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 4101585 4101923 gene locus_tag LOCUS_41160 4101585 4101923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41160 4102278 4102129 gene locus_tag LOCUS_41170 4102278 4102129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 4102669 4102902 gene locus_tag LOCUS_41180 4102669 4102902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 4104592 4103450 gene locus_tag LOCUS_41190 4104592 4103450 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416376.1 protein_id gnl|my_center|LOCUS_41190 4105712 4105999 gene locus_tag LOCUS_41200 4105712 4105999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41200 4106018 4106251 gene locus_tag LOCUS_41210 4106018 4106251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 4106479 4106144 gene locus_tag LOCUS_41220 4106479 4106144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 4106604 4106864 gene locus_tag LOCUS_41230 4106604 4106864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41230 4108060 4107137 gene locus_tag LOCUS_41240 4108060 4107137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41240 4108599 4108931 gene locus_tag LOCUS_41250 4108599 4108931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 4110585 4110304 gene locus_tag LOCUS_41260 4110585 4110304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 4111431 4110646 gene locus_tag LOCUS_41270 gene bacC 4111431 4110646 CDS product dihydroanticapsin 7-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243359.1 protein_id gnl|my_center|LOCUS_41270 4111875 4111441 gene locus_tag LOCUS_41280 4111875 4111441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 4112310 4113203 gene locus_tag LOCUS_41290 4112310 4113203 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411849.1 protein_id gnl|my_center|LOCUS_41290 4113500 4113210 gene locus_tag LOCUS_41300 4113500 4113210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41300 4114103 4113603 gene locus_tag LOCUS_41310 4114103 4113603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41310 4114674 4114087 gene locus_tag LOCUS_41320 4114674 4114087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41320 4115789 4115217 gene locus_tag LOCUS_41330 4115789 4115217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41330 4116206 4115829 gene locus_tag LOCUS_41340 4116206 4115829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41340 4117536 4116310 gene locus_tag LOCUS_41350 4117536 4116310 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410057.1 protein_id gnl|my_center|LOCUS_41350 4118188 4117622 gene locus_tag LOCUS_41360 4118188 4117622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41360 4118492 4118103 gene locus_tag LOCUS_41370 4118492 4118103 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_41370 4118572 4119624 gene locus_tag LOCUS_41380 4118572 4119624 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090734.1 protein_id gnl|my_center|LOCUS_41380 4120602 4119670 gene locus_tag LOCUS_41390 4120602 4119670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 4120734 4121561 gene locus_tag LOCUS_41400 4120734 4121561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 4121728 4122234 gene locus_tag LOCUS_41410 4121728 4122234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 4123089 4122271 gene locus_tag LOCUS_41420 4123089 4122271 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728664.1 protein_id gnl|my_center|LOCUS_41420 4123160 4123936 gene locus_tag LOCUS_41430 4123160 4123936 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728650.1 protein_id gnl|my_center|LOCUS_41430 4123921 4125132 gene locus_tag LOCUS_41440 4123921 4125132 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728649.1 protein_id gnl|my_center|LOCUS_41440 4125129 4126157 gene locus_tag LOCUS_41450 4125129 4126157 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728648.1 protein_id gnl|my_center|LOCUS_41450 4126986 4126171 gene locus_tag LOCUS_41460 4126986 4126171 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_41460 4127648 4127037 gene locus_tag LOCUS_41470 4127648 4127037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41470 4130161 4128017 gene locus_tag LOCUS_41480 gene glgX 4130161 4128017 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_41480 4130371 4131591 gene locus_tag LOCUS_41490 4130371 4131591 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727945.1 protein_id gnl|my_center|LOCUS_41490 4131591 4131758 gene locus_tag LOCUS_41500 4131591 4131758 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893232.1 protein_id gnl|my_center|LOCUS_41500 4131760 4131945 gene locus_tag LOCUS_41510 gene rubB 4131760 4131945 CDS product rubredoxin RubB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417044.1 protein_id gnl|my_center|LOCUS_41510 4132156 4132554 gene locus_tag LOCUS_41520 4132156 4132554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 4132671 4133642 gene locus_tag LOCUS_41530 4132671 4133642 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902161.1 protein_id gnl|my_center|LOCUS_41530 4135589 4133643 gene locus_tag LOCUS_41540 gene htpG 4135589 4133643 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411855.1 protein_id gnl|my_center|LOCUS_41540 4135794 4136630 gene locus_tag LOCUS_41550 4135794 4136630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41550 4136521 4138416 gene locus_tag LOCUS_41560 4136521 4138416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41560 4139226 4138444 gene locus_tag LOCUS_41570 4139226 4138444 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899260.1 protein_id gnl|my_center|LOCUS_41570 4139427 4140587 gene locus_tag LOCUS_41580 4139427 4140587 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966278.1 protein_id gnl|my_center|LOCUS_41580 4141361 4140612 gene locus_tag LOCUS_41590 4141361 4140612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 4141548 4142576 gene locus_tag LOCUS_41600 4141548 4142576 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092846703.1 protein_id gnl|my_center|LOCUS_41600 4142899 4142606 gene locus_tag LOCUS_41610 4142899 4142606 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898315.1 protein_id gnl|my_center|LOCUS_41610 4143461 4143033 gene locus_tag LOCUS_41620 4143461 4143033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 4143755 4144753 gene locus_tag LOCUS_41630 4143755 4144753 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228993.1 protein_id gnl|my_center|LOCUS_41630 4145233 4144784 gene locus_tag LOCUS_41640 4145233 4144784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084229.1 protein_id gnl|my_center|LOCUS_41640 4145608 4147293 gene locus_tag LOCUS_41650 gene atzF 4145608 4147293 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728210.1 protein_id gnl|my_center|LOCUS_41650 4148396 4147362 gene locus_tag LOCUS_41660 4148396 4147362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 4148651 4148409 gene locus_tag LOCUS_41670 4148651 4148409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 4149130 4148780 gene locus_tag LOCUS_41680 4149130 4148780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 4149193 4149582 gene locus_tag LOCUS_41690 4149193 4149582 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_41690 4149497 4150063 gene locus_tag LOCUS_41700 4149497 4150063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 4150349 4150038 gene locus_tag LOCUS_41710 4150349 4150038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 4151278 4150346 gene locus_tag LOCUS_41720 4151278 4150346 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101528280.1 protein_id gnl|my_center|LOCUS_41720 4151190 4151375 gene locus_tag LOCUS_41730 4151190 4151375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 4151392 4151808 gene locus_tag LOCUS_41740 4151392 4151808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730320.1 protein_id gnl|my_center|LOCUS_41740 4152762 4151911 gene locus_tag LOCUS_41750 4152762 4151911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 4153350 4152784 gene locus_tag LOCUS_41760 4153350 4152784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 4154287 4153265 gene locus_tag LOCUS_41770 4154287 4153265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 4154407 4154835 gene locus_tag LOCUS_41780 4154407 4154835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 4154887 4155189 gene locus_tag LOCUS_41790 4154887 4155189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 4155728 4156354 gene locus_tag LOCUS_41800 4155728 4156354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 4156408 4156599 gene locus_tag LOCUS_41810 4156408 4156599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41810 4156599 4157126 gene locus_tag LOCUS_41820 4156599 4157126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41820 4157229 4158359 gene locus_tag LOCUS_41830 4157229 4158359 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462640.1 protein_id gnl|my_center|LOCUS_41830 4161362 4158411 gene locus_tag LOCUS_41840 4161362 4158411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 4161993 4161334 gene locus_tag LOCUS_41850 4161993 4161334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 4162303 4162605 gene locus_tag LOCUS_41860 4162303 4162605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 4162655 4163044 gene locus_tag LOCUS_41870 4162655 4163044 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_41870 4162959 4163525 gene locus_tag LOCUS_41880 4162959 4163525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41880 4163654 4164376 gene locus_tag LOCUS_41890 4163654 4164376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 4164426 4164815 gene locus_tag LOCUS_41900 4164426 4164815 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_41900 4164730 4165296 gene locus_tag LOCUS_41910 4164730 4165296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 4165913 4165293 gene locus_tag LOCUS_41920 4165913 4165293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 4166663 4166064 gene locus_tag LOCUS_41930 4166663 4166064 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414887.1 protein_id gnl|my_center|LOCUS_41930 4167601 4166711 gene locus_tag LOCUS_41940 4167601 4166711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 4168202 4167636 gene locus_tag LOCUS_41950 4168202 4167636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 4168506 4168117 gene locus_tag LOCUS_41960 4168506 4168117 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_41960 4169588 4168536 gene locus_tag LOCUS_41970 gene istA 4169588 4168536 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047902700.1 protein_id gnl|my_center|LOCUS_41970 4170205 4170600 gene locus_tag LOCUS_41980 4170205 4170600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 4171374 4170601 gene locus_tag LOCUS_41990 4171374 4170601 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172591949.1 protein_id gnl|my_center|LOCUS_41990 4171887 4172216 gene locus_tag LOCUS_42000 4171887 4172216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42000 4172352 4172645 gene locus_tag LOCUS_42010 4172352 4172645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42010 4174380 4172662 gene locus_tag LOCUS_42020 4174380 4172662 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081393.1 protein_id gnl|my_center|LOCUS_42020 4175708 4174521 gene locus_tag LOCUS_42030 4175708 4174521 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731196.1 protein_id gnl|my_center|LOCUS_42030 4177539 4176028 gene locus_tag LOCUS_42040 4177539 4176028 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877153.1 protein_id gnl|my_center|LOCUS_42040 4177640 4178155 gene locus_tag LOCUS_42050 4177640 4178155 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877152.1 protein_id gnl|my_center|LOCUS_42050 4178152 4179507 gene locus_tag LOCUS_42060 4178152 4179507 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093964.1 protein_id gnl|my_center|LOCUS_42060 4180449 4179619 gene locus_tag LOCUS_42070 4180449 4179619 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877271.1 protein_id gnl|my_center|LOCUS_42070 4181120 4180554 gene locus_tag LOCUS_42080 4181120 4180554 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095569.1 protein_id gnl|my_center|LOCUS_42080 4181191 4181532 gene locus_tag LOCUS_42090 4181191 4181532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 4182095 4181529 gene locus_tag LOCUS_42100 4182095 4181529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42100 4182399 4182010 gene locus_tag LOCUS_42110 4182399 4182010 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_42110 4182482 4182970 gene locus_tag LOCUS_42120 4182482 4182970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 4183001 4183429 gene locus_tag LOCUS_42130 4183001 4183429 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078828.1 protein_id gnl|my_center|LOCUS_42130 4184006 4183440 gene locus_tag LOCUS_42140 4184006 4183440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 4184310 4183921 gene locus_tag LOCUS_42150 4184310 4183921 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_42150 4184788 4184360 gene locus_tag LOCUS_42160 gene arr 4184788 4184360 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727512.1 protein_id gnl|my_center|LOCUS_42160 4185947 4184790 gene locus_tag LOCUS_42170 4185947 4184790 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_42170 4186051 4187487 gene locus_tag LOCUS_42180 4186051 4187487 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_42180 4189089 4187530 gene locus_tag LOCUS_42190 4189089 4187530 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899285.1 protein_id gnl|my_center|LOCUS_42190 4189902 4190891 gene locus_tag LOCUS_42200 4189902 4190891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 4191526 4190987 gene locus_tag LOCUS_42210 4191526 4190987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42210 4192173 4191445 gene locus_tag LOCUS_42220 4192173 4191445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42220 4192498 4195245 gene locus_tag LOCUS_42230 4192498 4195245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 4195687 4196568 gene locus_tag LOCUS_42240 4195687 4196568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 4196529 4197200 gene locus_tag LOCUS_42250 4196529 4197200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 4197242 4197508 gene locus_tag LOCUS_42260 4197242 4197508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 4198578 4197700 gene locus_tag LOCUS_42270 4198578 4197700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42270 4198907 4198575 gene locus_tag LOCUS_42280 4198907 4198575 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234794028.1 protein_id gnl|my_center|LOCUS_42280 4199312 4200574 gene locus_tag LOCUS_42290 4199312 4200574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 4200604 4200993 gene locus_tag LOCUS_42300 4200604 4200993 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_42300 4200908 4201474 gene locus_tag LOCUS_42310 4200908 4201474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 4201428 4201745 gene locus_tag LOCUS_42320 4201428 4201745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 4201742 4202554 gene locus_tag LOCUS_42330 gene istB 4201742 4202554 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_42330 4204079 4204234 gene locus_tag LOCUS_42340 4204079 4204234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 4204238 4204849 gene locus_tag LOCUS_42350 4204238 4204849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 4205116 4204925 gene locus_tag LOCUS_42360 4205116 4204925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 4205921 4206121 gene locus_tag LOCUS_42370 4205921 4206121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 4207870 4206455 gene locus_tag LOCUS_42380 4207870 4206455 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906341.1 protein_id gnl|my_center|LOCUS_42380 4209245 4207983 gene locus_tag LOCUS_42390 gene hisS 4209245 4207983 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413365.1 protein_id gnl|my_center|LOCUS_42390 4209916 4209242 gene locus_tag LOCUS_42400 4209916 4209242 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413366.1 protein_id gnl|my_center|LOCUS_42400 4210057 4210944 gene locus_tag LOCUS_42410 gene ppiB 4210057 4210944 CDS product peptidylprolyl isomerase PpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413367.1 protein_id gnl|my_center|LOCUS_42410 4211521 4210955 gene locus_tag LOCUS_42420 4211521 4210955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 4211825 4211436 gene locus_tag LOCUS_42430 4211825 4211436 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_42430 4212455 4211889 gene locus_tag LOCUS_42440 4212455 4211889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 4212759 4212370 gene locus_tag LOCUS_42450 4212759 4212370 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_42450 4215172 4212809 gene locus_tag LOCUS_42460 4215172 4212809 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413368.1 protein_id gnl|my_center|LOCUS_42460 4215818 4215249 gene locus_tag LOCUS_42470 4215818 4215249 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413369.1 protein_id gnl|my_center|LOCUS_42470 4217512 4215800 gene locus_tag LOCUS_42480 4217512 4215800 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413373.1 protein_id gnl|my_center|LOCUS_42480 4218858 4217518 gene locus_tag LOCUS_42490 gene secF 4218858 4217518 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899387.1 protein_id gnl|my_center|LOCUS_42490 4220710 4218863 gene locus_tag LOCUS_42500 gene secD 4220710 4218863 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413385.1 protein_id gnl|my_center|LOCUS_42500 4221163 4220822 gene locus_tag LOCUS_42510 gene yajC 4221163 4220822 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413391.1 protein_id gnl|my_center|LOCUS_42510 4221393 4222733 gene locus_tag LOCUS_42520 gene gabT 4221393 4222733 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413395.1 protein_id gnl|my_center|LOCUS_42520 4222913 4226437 gene locus_tag LOCUS_42530 4222913 4226437 CDS product thioester reductase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413409.1 protein_id gnl|my_center|LOCUS_42530 4226753 4228405 gene locus_tag LOCUS_42540 4226753 4228405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42540 4229419 4228721 gene locus_tag LOCUS_42550 4229419 4228721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728720.1 protein_id gnl|my_center|LOCUS_42550 4229898 4229509 gene locus_tag LOCUS_42560 4229898 4229509 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728710.1 protein_id gnl|my_center|LOCUS_42560 4229964 4231550 gene locus_tag LOCUS_42570 4229964 4231550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 4231771 4233504 gene locus_tag LOCUS_42580 4231771 4233504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 4234567 4233530 gene locus_tag LOCUS_42590 gene ruvB 4234567 4233530 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413416.1 protein_id gnl|my_center|LOCUS_42590 4235164 4234571 gene locus_tag LOCUS_42600 gene ruvA 4235164 4234571 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413421.1 protein_id gnl|my_center|LOCUS_42600 4235715 4235161 gene locus_tag LOCUS_42610 gene ruvC 4235715 4235161 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413426.1 protein_id gnl|my_center|LOCUS_42610 4235930 4236538 gene locus_tag LOCUS_42620 4235930 4236538 CDS product DUF4178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413441.1 protein_id gnl|my_center|LOCUS_42620 4236550 4237062 gene locus_tag LOCUS_42630 4236550 4237062 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413444.1 protein_id gnl|my_center|LOCUS_42630 4237050 4237184 gene locus_tag LOCUS_42640 4237050 4237184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42640 4237239 4237490 gene locus_tag LOCUS_42650 4237239 4237490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42650 4237593 4237994 gene locus_tag LOCUS_42660 4237593 4237994 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413451.1 protein_id gnl|my_center|LOCUS_42660 4237991 4239571 gene locus_tag LOCUS_42670 4237991 4239571 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899392.1 protein_id gnl|my_center|LOCUS_42670 4240322 4239612 gene locus_tag LOCUS_42680 4240322 4239612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 4240914 4240519 gene locus_tag LOCUS_42690 4240914 4240519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42690 4241409 4241197 gene locus_tag LOCUS_42700 4241409 4241197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 4241371 4241871 gene locus_tag LOCUS_42710 4241371 4241871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 4242010 4244841 gene locus_tag LOCUS_42720 4242010 4244841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42720 4245029 4246951 gene locus_tag LOCUS_42730 4245029 4246951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 4247722 4246967 gene locus_tag LOCUS_42740 4247722 4246967 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413464.1 protein_id gnl|my_center|LOCUS_42740 4248413 4247817 gene locus_tag LOCUS_42750 gene pdxT 4248413 4247817 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413465.1 protein_id gnl|my_center|LOCUS_42750 4249266 4248421 gene locus_tag LOCUS_42760 gene tesB 4249266 4248421 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413466.1 protein_id gnl|my_center|LOCUS_42760 4250229 4249276 gene locus_tag LOCUS_42770 gene pdxS 4250229 4249276 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728705.1 protein_id gnl|my_center|LOCUS_42770 4251383 4250316 gene locus_tag LOCUS_42780 4251383 4250316 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413475.1 protein_id gnl|my_center|LOCUS_42780 4252507 4251383 gene locus_tag LOCUS_42790 gene pimA 4252507 4251383 CDS product phosphatidyl-myo-inositol alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413478.1 protein_id gnl|my_center|LOCUS_42790 4253457 4252507 gene locus_tag LOCUS_42800 4253457 4252507 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900533.1 protein_id gnl|my_center|LOCUS_42800 4254158 4253454 gene locus_tag LOCUS_42810 gene pgsA1 4254158 4253454 CDS product phosphatidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413482.1 protein_id gnl|my_center|LOCUS_42810 4254738 4254166 gene locus_tag LOCUS_42820 4254738 4254166 CDS product ATP adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413484.1 protein_id gnl|my_center|LOCUS_42820 4256816 4254741 gene locus_tag LOCUS_42830 gene thrS 4256816 4254741 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413486.1 protein_id gnl|my_center|LOCUS_42830 4257567 4256944 gene locus_tag LOCUS_42840 4257567 4256944 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728697.1 protein_id gnl|my_center|LOCUS_42840 4258514 4257654 gene locus_tag LOCUS_42850 4258514 4257654 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907735.1 protein_id gnl|my_center|LOCUS_42850 4258594 4259097 gene locus_tag LOCUS_42860 4258594 4259097 CDS product DUF1990 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413569.1 protein_id gnl|my_center|LOCUS_42860 4260074 4259130 gene locus_tag LOCUS_42870 4260074 4259130 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727807.1 protein_id gnl|my_center|LOCUS_42870 4260421 4260077 gene locus_tag LOCUS_42880 4260421 4260077 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413583.1 protein_id gnl|my_center|LOCUS_42880 4260859 4260434 gene locus_tag LOCUS_42890 4260859 4260434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077089871.1 protein_id gnl|my_center|LOCUS_42890 4261527 4260856 gene locus_tag LOCUS_42900 4261527 4260856 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413588.1 protein_id gnl|my_center|LOCUS_42900 4261875 4261537 gene locus_tag LOCUS_42910 4261875 4261537 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727431.1 protein_id gnl|my_center|LOCUS_42910 4262069 4263487 gene locus_tag LOCUS_42920 4262069 4263487 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401360.1 protein_id gnl|my_center|LOCUS_42920 4263677 4264501 gene locus_tag LOCUS_42930 4263677 4264501 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413589.1 protein_id gnl|my_center|LOCUS_42930 4264631 4265524 gene locus_tag LOCUS_42940 4264631 4265524 CDS product universal stress protein TB31.7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413592.1 protein_id gnl|my_center|LOCUS_42940 4266101 4265535 gene locus_tag LOCUS_42950 4266101 4265535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42950 4266225 4266016 gene locus_tag LOCUS_42960 4266225 4266016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42960 4267249 4266455 gene locus_tag LOCUS_42970 4267249 4266455 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413594.1 protein_id gnl|my_center|LOCUS_42970 4268481 4267303 gene locus_tag LOCUS_42980 4268481 4267303 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 protein_id gnl|my_center|LOCUS_42980 4269251 4268571 gene locus_tag LOCUS_42990 4269251 4268571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 4270736 4269309 gene locus_tag LOCUS_43000 4270736 4269309 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878617.1 protein_id gnl|my_center|LOCUS_43000 4271585 4270752 gene locus_tag LOCUS_43010 4271585 4270752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43010 4272258 4274123 gene locus_tag LOCUS_43020 4272258 4274123 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 protein_id gnl|my_center|LOCUS_43020 4274242 4274496 gene locus_tag LOCUS_43030 4274242 4274496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43030 4274506 4275312 gene locus_tag LOCUS_43040 4274506 4275312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43040 4276361 4275429 gene locus_tag LOCUS_43050 4276361 4275429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 4276432 4276821 gene locus_tag LOCUS_43060 4276432 4276821 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_43060 4276736 4277302 gene locus_tag LOCUS_43070 4276736 4277302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 4277652 4277410 gene locus_tag LOCUS_43080 4277652 4277410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 4277789 4279099 gene locus_tag LOCUS_43090 4277789 4279099 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_43090 4279489 4279133 gene locus_tag LOCUS_43100 4279489 4279133 CDS product DUF1876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413619.1 protein_id gnl|my_center|LOCUS_43100 4281617 4279515 gene locus_tag LOCUS_43110 4281617 4279515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 4282245 4282748 gene locus_tag LOCUS_43120 4282245 4282748 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111791.1 protein_id gnl|my_center|LOCUS_43120 4283269 4283898 gene locus_tag LOCUS_43130 4283269 4283898 CDS product chloramphenicol phosphotransferase CPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899406.1 protein_id gnl|my_center|LOCUS_43130 4285545 4283908 gene locus_tag LOCUS_43140 4285545 4283908 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729261.1 protein_id gnl|my_center|LOCUS_43140 4285777 4286433 gene locus_tag LOCUS_43150 4285777 4286433 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413654.1 protein_id gnl|my_center|LOCUS_43150 4287049 4286444 gene locus_tag LOCUS_43160 4287049 4286444 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223539.1 protein_id gnl|my_center|LOCUS_43160 4287202 4287495 gene locus_tag LOCUS_43170 4287202 4287495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43170 4288599 4287616 gene locus_tag LOCUS_43180 4288599 4287616 CDS product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206279.1 protein_id gnl|my_center|LOCUS_43180 4288932 4288642 gene locus_tag LOCUS_43190 4288932 4288642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 4289389 4289030 gene locus_tag LOCUS_43200 4289389 4289030 CDS product Rv2640c family ArsR-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413665.1 protein_id gnl|my_center|LOCUS_43200 4290156 4289590 gene locus_tag LOCUS_43210 4290156 4289590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 4290460 4290071 gene locus_tag LOCUS_43220 4290460 4290071 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_43220 4290449 4290895 gene locus_tag LOCUS_43230 4290449 4290895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 4291011 4291352 gene locus_tag LOCUS_43240 4291011 4291352 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899407.1 protein_id gnl|my_center|LOCUS_43240 4291349 4292443 gene locus_tag LOCUS_43250 4291349 4292443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43250 4292440 4292871 gene locus_tag LOCUS_43260 4292440 4292871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43260 4292999 4293814 gene locus_tag LOCUS_43270 4292999 4293814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 4294355 4295863 gene locus_tag LOCUS_43280 4294355 4295863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 4296038 4295966 gene locus_tag LOCUS_t00290 4296038 4295966 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4296209 4296282 gene locus_tag LOCUS_t00300 4296209 4296282 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4296311 4296384 gene locus_tag LOCUS_t00310 4296311 4296384 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4296400 4296474 gene locus_tag LOCUS_t00320 4296400 4296474 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4296586 4297035 gene locus_tag LOCUS_43290 4296586 4297035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 4297601 4297894 gene locus_tag LOCUS_43300 4297601 4297894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 4297929 4298627 gene locus_tag LOCUS_43310 4297929 4298627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410100.1 protein_id gnl|my_center|LOCUS_43310 4298624 4299670 gene locus_tag LOCUS_43320 4298624 4299670 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410103.1 protein_id gnl|my_center|LOCUS_43320 4300169 4300384 gene locus_tag LOCUS_43330 4300169 4300384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 4300397 4301431 gene locus_tag LOCUS_43340 4300397 4301431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 4302249 4301500 gene locus_tag LOCUS_43350 4302249 4301500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43350 4302572 4302291 gene locus_tag LOCUS_43360 4302572 4302291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43360 4303850 4302744 gene locus_tag LOCUS_43370 4303850 4302744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 4305068 4304520 gene locus_tag LOCUS_43380 4305068 4304520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 4306075 4305068 gene locus_tag LOCUS_43390 4306075 4305068 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_43390 4306590 4307915 gene locus_tag LOCUS_43400 4306590 4307915 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110692.1 protein_id gnl|my_center|LOCUS_43400 4309560 4307893 gene locus_tag LOCUS_43410 4309560 4307893 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104548.1 protein_id gnl|my_center|LOCUS_43410 4310519 4309560 gene locus_tag LOCUS_43420 4310519 4309560 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208036286.1 protein_id gnl|my_center|LOCUS_43420 4310926 4310573 gene locus_tag LOCUS_43430 4310926 4310573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 4311006 4311749 gene locus_tag LOCUS_43440 4311006 4311749 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413845.1 protein_id gnl|my_center|LOCUS_43440 4311828 4312388 gene locus_tag LOCUS_43450 4311828 4312388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917048.1 protein_id gnl|my_center|LOCUS_43450 4312444 4312893 gene locus_tag LOCUS_43460 4312444 4312893 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413852.1 protein_id gnl|my_center|LOCUS_43460 4313911 4312871 gene locus_tag LOCUS_43470 gene zapE 4313911 4312871 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899426.1 protein_id gnl|my_center|LOCUS_43470 4314005 4314787 gene locus_tag LOCUS_43480 gene ribD 4314005 4314787 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413854.1 protein_id gnl|my_center|LOCUS_43480 4314836 4316407 gene locus_tag LOCUS_43490 4314836 4316407 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413857.1 protein_id gnl|my_center|LOCUS_43490 4316427 4317704 gene locus_tag LOCUS_43500 gene aftC 4316427 4317704 CDS product arabinofuranan 3-O-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413860.1 protein_id gnl|my_center|LOCUS_43500 4317736 4318164 gene locus_tag LOCUS_43510 gene msrB 4317736 4318164 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413865.1 protein_id gnl|my_center|LOCUS_43510 4318936 4318187 gene locus_tag LOCUS_43520 4318936 4318187 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413866.1 protein_id gnl|my_center|LOCUS_43520 4319628 4318933 gene locus_tag LOCUS_43530 4319628 4318933 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413869.1 protein_id gnl|my_center|LOCUS_43530 4321001 4319634 gene locus_tag LOCUS_43540 4321001 4319634 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413871.1 protein_id gnl|my_center|LOCUS_43540 4322059 4320998 gene locus_tag LOCUS_43550 gene hemE 4322059 4320998 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413873.1 protein_id gnl|my_center|LOCUS_43550 4322239 4322460 gene locus_tag LOCUS_43560 4322239 4322460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43560 4322444 4322989 gene locus_tag LOCUS_43570 4322444 4322989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43570 4323129 4323710 gene locus_tag LOCUS_43580 4323129 4323710 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413879.1 protein_id gnl|my_center|LOCUS_43580 4323712 4325019 gene locus_tag LOCUS_43590 4323712 4325019 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413889.1 protein_id gnl|my_center|LOCUS_43590 4325596 4325030 gene locus_tag LOCUS_43600 4325596 4325030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 4325900 4325511 gene locus_tag LOCUS_43610 4325900 4325511 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_43610 4327773 4325950 gene locus_tag LOCUS_43620 gene dxs 4327773 4325950 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413891.1 protein_id gnl|my_center|LOCUS_43620 4327678 4327980 gene locus_tag LOCUS_43630 4327678 4327980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 4328016 4328510 gene locus_tag LOCUS_43640 4328016 4328510 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899429.1 protein_id gnl|my_center|LOCUS_43640 4328566 4329855 gene locus_tag LOCUS_43650 4328566 4329855 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908088.1 protein_id gnl|my_center|LOCUS_43650 4329894 4331180 gene locus_tag LOCUS_43660 4329894 4331180 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899431.1 protein_id gnl|my_center|LOCUS_43660 4331950 4331186 gene locus_tag LOCUS_43670 4331950 4331186 CDS product fluoroquinolones efflux ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413897.1 protein_id gnl|my_center|LOCUS_43670 4332656 4331874 gene locus_tag LOCUS_43680 4332656 4331874 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413912.1 protein_id gnl|my_center|LOCUS_43680 4333552 4332653 gene locus_tag LOCUS_43690 4333552 4332653 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413913.1 protein_id gnl|my_center|LOCUS_43690 4334874 4333669 gene locus_tag LOCUS_43700 4334874 4333669 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900550.1 protein_id gnl|my_center|LOCUS_43700 4336877 4334871 gene locus_tag LOCUS_43710 4336877 4334871 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413917.1 protein_id gnl|my_center|LOCUS_43710 4337007 4337684 gene locus_tag LOCUS_43720 4337007 4337684 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413919.1 protein_id gnl|my_center|LOCUS_43720 4337737 4338399 gene locus_tag LOCUS_43730 4337737 4338399 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413921.1 protein_id gnl|my_center|LOCUS_43730 4339290 4338619 gene locus_tag LOCUS_43740 4339290 4338619 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413925.1 protein_id gnl|my_center|LOCUS_43740 4339686 4339318 gene locus_tag LOCUS_43750 4339686 4339318 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901453.1 protein_id gnl|my_center|LOCUS_43750 4339834 4340553 gene locus_tag LOCUS_43760 4339834 4340553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908087.1 protein_id gnl|my_center|LOCUS_43760 4341319 4340567 gene locus_tag LOCUS_43770 4341319 4340567 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413928.1 protein_id gnl|my_center|LOCUS_43770 4341651 4341319 gene locus_tag LOCUS_43780 4341651 4341319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 4341598 4341804 gene locus_tag LOCUS_43790 4341598 4341804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 4341884 4342288 gene locus_tag LOCUS_43800 4341884 4342288 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413931.1 protein_id gnl|my_center|LOCUS_43800 4342613 4342293 gene locus_tag LOCUS_43810 4342613 4342293 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899437.1 protein_id gnl|my_center|LOCUS_43810 4342779 4343432 gene locus_tag LOCUS_43820 gene cei 4342779 4343432 CDS product envelope integrity protein Cei inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413937.1 protein_id gnl|my_center|LOCUS_43820 4344307 4343438 gene locus_tag LOCUS_43830 gene suhB 4344307 4343438 CDS product inositol-1-monophosphatase SuhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413939.1 protein_id gnl|my_center|LOCUS_43830 4344481 4345275 gene locus_tag LOCUS_43840 4344481 4345275 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413941.1 protein_id gnl|my_center|LOCUS_43840 4345431 4346960 gene locus_tag LOCUS_43850 4345431 4346960 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413944.1 protein_id gnl|my_center|LOCUS_43850 4347168 4349105 gene locus_tag LOCUS_43860 4347168 4349105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 4349211 4349654 gene locus_tag LOCUS_43870 4349211 4349654 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899440.1 protein_id gnl|my_center|LOCUS_43870 4349962 4349582 gene locus_tag LOCUS_43880 4349962 4349582 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413947.1 protein_id gnl|my_center|LOCUS_43880 4350089 4350274 gene locus_tag LOCUS_43890 4350089 4350274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894140.1 protein_id gnl|my_center|LOCUS_43890 4350340 4351314 gene locus_tag LOCUS_43900 4350340 4351314 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413953.1 protein_id gnl|my_center|LOCUS_43900 4351563 4351315 gene locus_tag LOCUS_43910 4351563 4351315 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899441.1 protein_id gnl|my_center|LOCUS_43910 4351618 4352028 gene locus_tag LOCUS_43920 4351618 4352028 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899442.1 protein_id gnl|my_center|LOCUS_43920 4352193 4353164 gene locus_tag LOCUS_43930 gene sigB 4352193 4353164 CDS product sigma-70 family RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413958.1 protein_id gnl|my_center|LOCUS_43930 4353316 4354008 gene locus_tag LOCUS_43940 gene ideR 4353316 4354008 CDS product iron-dependent transcriptional regulator IdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413962.1 protein_id gnl|my_center|LOCUS_43940 4354999 4354010 gene locus_tag LOCUS_43950 4354999 4354010 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413965.1 protein_id gnl|my_center|LOCUS_43950 4355210 4356598 gene locus_tag LOCUS_43960 gene sthA 4355210 4356598 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900556.1 protein_id gnl|my_center|LOCUS_43960 4357427 4356606 gene locus_tag LOCUS_43970 4357427 4356606 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223253.1 protein_id gnl|my_center|LOCUS_43970 4357677 4358654 gene locus_tag LOCUS_43980 4357677 4358654 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413968.1 protein_id gnl|my_center|LOCUS_43980 4358702 4359727 gene locus_tag LOCUS_43990 4358702 4359727 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900558.1 protein_id gnl|my_center|LOCUS_43990 4359773 4360459 gene locus_tag LOCUS_44000 4359773 4360459 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413971.1 protein_id gnl|my_center|LOCUS_44000 4360954 4360469 gene locus_tag LOCUS_44010 4360954 4360469 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900559.1 protein_id gnl|my_center|LOCUS_44010 4361447 4360983 gene locus_tag LOCUS_44020 gene nrdR 4361447 4360983 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413973.1 protein_id gnl|my_center|LOCUS_44020 4362152 4361610 gene locus_tag LOCUS_44030 4362152 4361610 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413974.1 protein_id gnl|my_center|LOCUS_44030 4362460 4363194 gene locus_tag LOCUS_44040 gene lexA 4362460 4363194 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899448.1 protein_id gnl|my_center|LOCUS_44040 4365463 4363235 gene locus_tag LOCUS_44050 4365463 4363235 CDS product LGFP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900560.1 protein_id gnl|my_center|LOCUS_44050 4365827 4366561 gene locus_tag LOCUS_44060 4365827 4366561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44060 4366639 4367013 gene locus_tag LOCUS_44070 4366639 4367013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 4368238 4367042 gene locus_tag LOCUS_44080 4368238 4367042 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413981.1 protein_id gnl|my_center|LOCUS_44080 4369859 4368345 gene locus_tag LOCUS_44090 gene hflX 4369859 4368345 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413984.1 protein_id gnl|my_center|LOCUS_44090 4370778 4369906 gene locus_tag LOCUS_44100 gene dapF 4370778 4369906 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413987.1 protein_id gnl|my_center|LOCUS_44100 4371727 4370783 gene locus_tag LOCUS_44110 gene miaA 4371727 4370783 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413989.1 protein_id gnl|my_center|LOCUS_44110 4372419 4371724 gene locus_tag LOCUS_44120 4372419 4371724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899452.1 protein_id gnl|my_center|LOCUS_44120 4373443 4372466 gene locus_tag LOCUS_44130 4373443 4372466 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728549.1 protein_id gnl|my_center|LOCUS_44130 4374562 4373663 gene locus_tag LOCUS_44140 4374562 4373663 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911951.1 protein_id gnl|my_center|LOCUS_44140 4375026 4376693 gene locus_tag LOCUS_44150 4375026 4376693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 4376618 4376833 gene locus_tag LOCUS_44160 4376618 4376833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 4377194 4378420 gene locus_tag LOCUS_44170 4377194 4378420 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413997.1 protein_id gnl|my_center|LOCUS_44170 4379028 4378417 gene locus_tag LOCUS_44180 4379028 4378417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413999.1 protein_id gnl|my_center|LOCUS_44180 4380563 4379025 gene locus_tag LOCUS_44190 gene miaB 4380563 4379025 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414001.1 protein_id gnl|my_center|LOCUS_44190 4381219 4380698 gene locus_tag LOCUS_44200 gene recX 4381219 4380698 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900562.1 protein_id gnl|my_center|LOCUS_44200 4382225 4381185 gene locus_tag LOCUS_44210 gene recA 4382225 4381185 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057169.1 protein_id gnl|my_center|LOCUS_44210 4382396 4383043 gene locus_tag LOCUS_44220 4382396 4383043 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027474.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44220 4383262 4383056 gene locus_tag LOCUS_44230 4383262 4383056 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414010.1 protein_id gnl|my_center|LOCUS_44230 4384526 4383285 gene locus_tag LOCUS_44240 4384526 4383285 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901461.1 protein_id gnl|my_center|LOCUS_44240 4384525 4384956 gene locus_tag LOCUS_44250 4384525 4384956 CDS product limonene-1,2-epoxide hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877467.1 protein_id gnl|my_center|LOCUS_44250 4385144 4384965 gene locus_tag LOCUS_44260 4385144 4384965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 4385733 4385167 gene locus_tag LOCUS_44270 4385733 4385167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 4386037 4385648 gene locus_tag LOCUS_44280 4386037 4385648 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_44280 4386348 4386067 gene locus_tag LOCUS_44290 4386348 4386067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44290 4387665 4386433 gene locus_tag LOCUS_44300 4387665 4386433 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406864.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44300 4388255 4387689 gene locus_tag LOCUS_44310 4388255 4387689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 4388559 4388170 gene locus_tag LOCUS_44320 4388559 4388170 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_44320 4389236 4388589 gene locus_tag LOCUS_44330 4389236 4388589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414026.1 protein_id gnl|my_center|LOCUS_44330 4390067 4389252 gene locus_tag LOCUS_44340 gene pspA 4390067 4389252 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414030.1 protein_id gnl|my_center|LOCUS_44340 4390566 4390225 gene locus_tag LOCUS_44350 gene clgR 4390566 4390225 CDS product transcriptional regulator ClgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414032.1 protein_id gnl|my_center|LOCUS_44350 4391260 4390691 gene locus_tag LOCUS_44360 gene pgsA 4391260 4390691 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414035.1 protein_id gnl|my_center|LOCUS_44360 4391375 4391869 gene locus_tag LOCUS_44370 4391375 4391869 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414037.1 protein_id gnl|my_center|LOCUS_44370 4394301 4391881 gene locus_tag LOCUS_44380 4394301 4391881 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414040.1 protein_id gnl|my_center|LOCUS_44380 4394670 4394984 gene locus_tag LOCUS_44390 4394670 4394984 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414042.1 protein_id gnl|my_center|LOCUS_44390 4394981 4395817 gene locus_tag LOCUS_44400 4394981 4395817 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894072.1 protein_id gnl|my_center|LOCUS_44400 4395821 4396693 gene locus_tag LOCUS_44410 4395821 4396693 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899463.1 protein_id gnl|my_center|LOCUS_44410 4398393 4396717 gene locus_tag LOCUS_44420 gene rnj 4398393 4396717 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414049.1 protein_id gnl|my_center|LOCUS_44420 4399315 4398413 gene locus_tag LOCUS_44430 gene dapA 4399315 4398413 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900564.1 protein_id gnl|my_center|LOCUS_44430 4400185 4399433 gene locus_tag LOCUS_44440 gene thyX 4400185 4399433 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899465.1 protein_id gnl|my_center|LOCUS_44440 4400642 4400196 gene locus_tag LOCUS_44450 4400642 4400196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44450 4401286 4400609 gene locus_tag LOCUS_44460 4401286 4400609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44460 4402731 4401277 gene locus_tag LOCUS_44470 4402731 4401277 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414057.1 protein_id gnl|my_center|LOCUS_44470 4403945 4402731 gene locus_tag LOCUS_44480 4403945 4402731 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728523.1 protein_id gnl|my_center|LOCUS_44480 4404439 4403942 gene locus_tag LOCUS_44490 4404439 4403942 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908384.1 protein_id gnl|my_center|LOCUS_44490 4405247 4404447 gene locus_tag LOCUS_44500 4405247 4404447 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414075.1 protein_id gnl|my_center|LOCUS_44500 4405346 4406086 gene locus_tag LOCUS_44510 4405346 4406086 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414079.1 protein_id gnl|my_center|LOCUS_44510 4407213 4406110 gene locus_tag LOCUS_44520 4407213 4406110 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225001.1 protein_id gnl|my_center|LOCUS_44520 4408403 4407210 gene locus_tag LOCUS_44530 4408403 4407210 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_44530 4409182 4408400 gene locus_tag LOCUS_44540 4409182 4408400 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_44540 4409792 4409316 gene locus_tag LOCUS_44550 4409792 4409316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 4413048 4409815 gene locus_tag LOCUS_44560 4413048 4409815 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112417.1 protein_id gnl|my_center|LOCUS_44560 4414192 4413080 gene locus_tag LOCUS_44570 4414192 4413080 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900568.1 protein_id gnl|my_center|LOCUS_44570 4414726 4414331 gene locus_tag LOCUS_44580 4414726 4414331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44580 4414909 4414730 gene locus_tag LOCUS_44590 4414909 4414730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44590 4415134 4414943 gene locus_tag LOCUS_44600 4415134 4414943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44600 4416980 4415433 gene locus_tag LOCUS_44610 4416980 4415433 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086825.1 protein_id gnl|my_center|LOCUS_44610 4417976 4417080 gene locus_tag LOCUS_44620 4417976 4417080 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414088.1 protein_id gnl|my_center|LOCUS_44620 4418030 4418419 gene locus_tag LOCUS_44630 4418030 4418419 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_44630 4418334 4418900 gene locus_tag LOCUS_44640 4418334 4418900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44640 4419093 4418911 gene locus_tag LOCUS_44650 4419093 4418911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 4419969 4419514 gene locus_tag LOCUS_44660 4419969 4419514 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414091.1 protein_id gnl|my_center|LOCUS_44660 4420430 4419966 gene locus_tag LOCUS_44670 4420430 4419966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414097.1 protein_id gnl|my_center|LOCUS_44670 4421159 4420437 gene locus_tag LOCUS_44680 gene dapB 4421159 4420437 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414099.1 protein_id gnl|my_center|LOCUS_44680 4421278 4422387 gene locus_tag LOCUS_44690 4421278 4422387 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44690 4422397 4422615 gene locus_tag LOCUS_44700 4422397 4422615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44700 4423710 4422622 gene locus_tag LOCUS_44710 4423710 4422622 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727153.1 protein_id gnl|my_center|LOCUS_44710 4424741 4423716 gene locus_tag LOCUS_44720 4424741 4423716 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462182.1 protein_id gnl|my_center|LOCUS_44720 4424865 4425506 gene locus_tag LOCUS_44730 4424865 4425506 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727155.1 protein_id gnl|my_center|LOCUS_44730 4426594 4425512 gene locus_tag LOCUS_44740 4426594 4425512 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414104.1 protein_id gnl|my_center|LOCUS_44740 4428371 4426608 gene locus_tag LOCUS_44750 4428371 4426608 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029339.1 protein_id gnl|my_center|LOCUS_44750 4429294 4428377 gene locus_tag LOCUS_44760 4429294 4428377 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414107.1 protein_id gnl|my_center|LOCUS_44760 4429863 4429399 gene locus_tag LOCUS_44770 4429863 4429399 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899475.1 protein_id gnl|my_center|LOCUS_44770 4430329 4429892 gene locus_tag LOCUS_44780 4430329 4429892 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899476.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44780 4430525 4431640 gene locus_tag LOCUS_44790 gene ald 4430525 4431640 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899477.1 protein_id gnl|my_center|LOCUS_44790 4432750 4431716 gene locus_tag LOCUS_44800 4432750 4431716 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899478.1 protein_id gnl|my_center|LOCUS_44800 4433972 4432755 gene locus_tag LOCUS_44810 4433972 4432755 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414119.1 protein_id gnl|my_center|LOCUS_44810 4436337 4434049 gene locus_tag LOCUS_44820 4436337 4434049 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907967.1 protein_id gnl|my_center|LOCUS_44820 4437124 4436708 gene locus_tag LOCUS_44830 4437124 4436708 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014074.1 protein_id gnl|my_center|LOCUS_44830 4437692 4437159 gene locus_tag LOCUS_44840 4437692 4437159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899480.1 protein_id gnl|my_center|LOCUS_44840 4437973 4437704 gene locus_tag LOCUS_44850 gene rpsO 4437973 4437704 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414128.1 protein_id gnl|my_center|LOCUS_44850 4439073 4438099 gene locus_tag LOCUS_44860 4439073 4438099 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414131.1 protein_id gnl|my_center|LOCUS_44860 4439254 4439946 gene locus_tag LOCUS_44870 gene mntR 4439254 4439946 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414136.1 protein_id gnl|my_center|LOCUS_44870 4441201 4439963 gene locus_tag LOCUS_44880 4441201 4439963 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414139.1 protein_id gnl|my_center|LOCUS_44880 4442432 4441230 gene locus_tag LOCUS_44890 4442432 4441230 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_44890 4443444 4442539 gene locus_tag LOCUS_44900 gene truB 4443444 4442539 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908397.1 protein_id gnl|my_center|LOCUS_44900 4444112 4443441 gene locus_tag LOCUS_44910 gene pptT 4444112 4443441 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414149.1 protein_id gnl|my_center|LOCUS_44910 4445086 4444121 gene locus_tag LOCUS_44920 4445086 4444121 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414151.1 protein_id gnl|my_center|LOCUS_44920 4445443 4445177 gene locus_tag LOCUS_44930 4445443 4445177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44930 4445749 4445456 gene locus_tag LOCUS_44940 4445749 4445456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44940 4447437 4445980 gene locus_tag LOCUS_44950 4447437 4445980 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414155.1 protein_id gnl|my_center|LOCUS_44950 4447739 4447428 gene locus_tag LOCUS_44960 4447739 4447428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414157.1 protein_id gnl|my_center|LOCUS_44960 4447933 4448508 gene locus_tag LOCUS_44970 4447933 4448508 CDS product DUF3558 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414158.1 protein_id gnl|my_center|LOCUS_44970 4448540 4450252 gene locus_tag LOCUS_44980 4448540 4450252 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899485.1 protein_id gnl|my_center|LOCUS_44980 4450549 4450899 gene locus_tag LOCUS_44990 4450549 4450899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 4450896 4453547 gene locus_tag LOCUS_45000 4450896 4453547 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257888.1 protein_id gnl|my_center|LOCUS_45000 4453577 4453966 gene locus_tag LOCUS_45010 4453577 4453966 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_45010 4453881 4454447 gene locus_tag LOCUS_45020 4453881 4454447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45020 4455116 4454571 gene locus_tag LOCUS_45030 4455116 4454571 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899500.1 protein_id gnl|my_center|LOCUS_45030 4455388 4455113 gene locus_tag LOCUS_45040 4455388 4455113 CDS product DUF2277 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414489.1 protein_id gnl|my_center|LOCUS_45040 4456601 4455426 gene locus_tag LOCUS_45050 4456601 4455426 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414680.1 protein_id gnl|my_center|LOCUS_45050 4457930 4456734 gene locus_tag LOCUS_45060 4457930 4456734 CDS product type VII secretion system ESX-5 target PPE26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950602.1 protein_id gnl|my_center|LOCUS_45060 4458098 4458973 gene locus_tag LOCUS_45070 4458098 4458973 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414497.1 protein_id gnl|my_center|LOCUS_45070 4459364 4459149 gene locus_tag LOCUS_45080 4459364 4459149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 4459287 4459967 gene locus_tag LOCUS_45090 4459287 4459967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 4460806 4459997 gene locus_tag LOCUS_45100 4460806 4459997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45100 4461079 4460828 gene locus_tag LOCUS_45110 4461079 4460828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45110 4462007 4461072 gene locus_tag LOCUS_45120 4462007 4461072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45120 4462386 4462027 gene locus_tag LOCUS_45130 4462386 4462027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45130 4463238 4462393 gene locus_tag LOCUS_45140 4463238 4462393 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414504.1 protein_id gnl|my_center|LOCUS_45140 4463648 4463235 gene locus_tag LOCUS_45150 4463648 4463235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45150 4464071 4463667 gene locus_tag LOCUS_45160 4464071 4463667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45160 4465536 4464199 gene locus_tag LOCUS_45170 4465536 4464199 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414506.1 protein_id gnl|my_center|LOCUS_45170 4466526 4465552 gene locus_tag LOCUS_45180 gene nrnA 4466526 4465552 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414507.1 protein_id gnl|my_center|LOCUS_45180 4467058 4466531 gene locus_tag LOCUS_45190 gene rbfA 4467058 4466531 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414508.1 protein_id gnl|my_center|LOCUS_45190 4469914 4467071 gene locus_tag LOCUS_45200 4469914 4467071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 4471488 4470445 gene locus_tag LOCUS_45210 gene nusA 4471488 4470445 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414511.1 protein_id gnl|my_center|LOCUS_45210 4472018 4471485 gene locus_tag LOCUS_45220 gene rimP 4472018 4471485 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899507.1 protein_id gnl|my_center|LOCUS_45220 4472270 4472779 gene locus_tag LOCUS_45230 4472270 4472779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414516.1 protein_id gnl|my_center|LOCUS_45230 4472776 4473264 gene locus_tag LOCUS_45240 4472776 4473264 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414522.1 protein_id gnl|my_center|LOCUS_45240 4475025 4473277 gene locus_tag LOCUS_45250 4475025 4473277 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899508.1 protein_id gnl|my_center|LOCUS_45250 4476724 4475132 gene locus_tag LOCUS_45260 gene efpA 4476724 4475132 CDS product multidrug efflux MFS transporter EfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414532.1 protein_id gnl|my_center|LOCUS_45260 4477963 4476758 gene locus_tag LOCUS_45270 gene cobA 4477963 4476758 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414535.1 protein_id gnl|my_center|LOCUS_45270 4479401 4478025 gene locus_tag LOCUS_45280 4479401 4478025 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899509.1 protein_id gnl|my_center|LOCUS_45280 4480110 4479496 gene locus_tag LOCUS_45290 gene cobO 4480110 4479496 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414539.1 protein_id gnl|my_center|LOCUS_45290 4481982 4480132 gene locus_tag LOCUS_45300 4481982 4480132 CDS product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901481.1 protein_id gnl|my_center|LOCUS_45300 4482449 4481979 gene locus_tag LOCUS_45310 4482449 4481979 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414543.1 protein_id gnl|my_center|LOCUS_45310 4483900 4482446 gene locus_tag LOCUS_45320 gene mqo 4483900 4482446 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414545.1 protein_id gnl|my_center|LOCUS_45320 4484125 4485147 gene locus_tag LOCUS_45330 4484125 4485147 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414553.1 protein_id gnl|my_center|LOCUS_45330 4486674 4485124 gene locus_tag LOCUS_45340 4486674 4485124 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898791.1 protein_id gnl|my_center|LOCUS_45340 4488407 4488000 gene locus_tag LOCUS_45350 4488407 4488000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 4488580 4488365 gene locus_tag LOCUS_45360 4488580 4488365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 4488841 4489932 gene locus_tag LOCUS_45370 4488841 4489932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45370 4489932 4490783 gene locus_tag LOCUS_45380 4489932 4490783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45380 4490985 4490770 gene locus_tag LOCUS_45390 4490985 4490770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 4493694 4491058 gene locus_tag LOCUS_45400 4493694 4491058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 4494370 4494759 gene locus_tag LOCUS_45410 4494370 4494759 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_45410 4494674 4495240 gene locus_tag LOCUS_45420 4494674 4495240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 4495301 4496680 gene locus_tag LOCUS_45430 gene mtr 4495301 4496680 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414557.1 protein_id gnl|my_center|LOCUS_45430 4497181 4496687 gene locus_tag LOCUS_45440 4497181 4496687 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 protein_id gnl|my_center|LOCUS_45440 4497324 4497539 gene locus_tag LOCUS_45450 4497324 4497539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 4497552 4498586 gene locus_tag LOCUS_45460 4497552 4498586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 4498775 4499893 gene locus_tag LOCUS_45470 4498775 4499893 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414559.1 protein_id gnl|my_center|LOCUS_45470 4499985 4500320 gene locus_tag LOCUS_45480 4499985 4500320 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728272.1 protein_id gnl|my_center|LOCUS_45480 4500349 4501116 gene locus_tag LOCUS_45490 gene hypB 4500349 4501116 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728271.1 protein_id gnl|my_center|LOCUS_45490 4501523 4502491 gene locus_tag LOCUS_45500 4501523 4502491 CDS product hydrogenase expression protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728543.1 protein_id gnl|my_center|LOCUS_45500 4502541 4503980 gene locus_tag LOCUS_45510 4502541 4503980 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894103.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45510 4504032 4504340 gene locus_tag LOCUS_45520 4504032 4504340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45520 4504344 4504604 gene locus_tag LOCUS_45530 4504344 4504604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 4505167 4504601 gene locus_tag LOCUS_45540 4505167 4504601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 4505471 4505082 gene locus_tag LOCUS_45550 4505471 4505082 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_45550 4505563 4505712 gene locus_tag LOCUS_45560 4505563 4505712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45560 4505871 4505990 gene locus_tag LOCUS_45570 4505871 4505990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 4506006 4506506 gene locus_tag LOCUS_45580 4506006 4506506 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894097.1 protein_id gnl|my_center|LOCUS_45580 4506521 4506784 gene locus_tag LOCUS_45590 4506521 4506784 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894096.1 protein_id gnl|my_center|LOCUS_45590 4506786 4506962 gene locus_tag LOCUS_45600 4506786 4506962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45600 4507005 4507322 gene locus_tag LOCUS_45610 4507005 4507322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45610 4507372 4507587 gene locus_tag LOCUS_45620 4507372 4507587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 4507502 4508068 gene locus_tag LOCUS_45630 4507502 4508068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 4508293 4509936 gene locus_tag LOCUS_45640 4508293 4509936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 4509933 4510502 gene locus_tag LOCUS_45650 4509933 4510502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894092.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45650 4510527 4510655 gene locus_tag LOCUS_45660 4510527 4510655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 4510775 4511326 gene locus_tag LOCUS_45670 4510775 4511326 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894091.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45670 4511323 4512021 gene locus_tag LOCUS_45680 4511323 4512021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45680 4512046 4512435 gene locus_tag LOCUS_45690 4512046 4512435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45690 4512459 4512731 gene locus_tag LOCUS_45700 gene hypC 4512459 4512731 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894089.1 protein_id gnl|my_center|LOCUS_45700 4512743 4513891 gene locus_tag LOCUS_45710 gene hypD 4512743 4513891 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 protein_id gnl|my_center|LOCUS_45710 4514024 4514632 gene locus_tag LOCUS_45720 4514024 4514632 CDS product DUF6390 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894094.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45720 4514654 4515766 gene locus_tag LOCUS_45730 4514654 4515766 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_45730 4516501 4517916 gene locus_tag LOCUS_45740 4516501 4517916 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911784.1 protein_id gnl|my_center|LOCUS_45740 4518642 4519286 gene locus_tag LOCUS_45750 4518642 4519286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 4519349 4519879 gene locus_tag LOCUS_45760 4519349 4519879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 4519967 4520917 gene locus_tag LOCUS_45770 4519967 4520917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 4520967 4521356 gene locus_tag LOCUS_45780 4520967 4521356 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_45780 4521271 4521837 gene locus_tag LOCUS_45790 4521271 4521837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 4522125 4524701 gene locus_tag LOCUS_45800 4522125 4524701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 4525038 4527626 gene locus_tag LOCUS_45810 4525038 4527626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 4528439 4529695 gene locus_tag LOCUS_45820 4528439 4529695 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409179.1 protein_id gnl|my_center|LOCUS_45820 4530544 4531611 gene locus_tag LOCUS_45830 4530544 4531611 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409179.1 protein_id gnl|my_center|LOCUS_45830 4532486 4533454 gene locus_tag LOCUS_45840 4532486 4533454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 4534267 4533512 gene locus_tag LOCUS_45850 4534267 4533512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 4534936 4534382 gene locus_tag LOCUS_45860 4534936 4534382 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728457.1 protein_id gnl|my_center|LOCUS_45860 4535958 4535143 gene locus_tag LOCUS_45870 gene map 4535958 4535143 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899513.1 protein_id gnl|my_center|LOCUS_45870 4536725 4536105 gene locus_tag LOCUS_45880 4536725 4536105 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950792.1 protein_id gnl|my_center|LOCUS_45880 4538558 4536801 gene locus_tag LOCUS_45890 4538558 4536801 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414596.1 protein_id gnl|my_center|LOCUS_45890 4539580 4538726 gene locus_tag LOCUS_45900 4539580 4538726 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899516.1 protein_id gnl|my_center|LOCUS_45900 4540795 4539632 gene locus_tag LOCUS_45910 gene ispG 4540795 4539632 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899517.1 protein_id gnl|my_center|LOCUS_45910 4542032 4540818 gene locus_tag LOCUS_45920 gene rip 4542032 4540818 CDS product zinc metalloprotease Rip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414610.1 protein_id gnl|my_center|LOCUS_45920 4543260 4542052 gene locus_tag LOCUS_45930 gene dxr 4543260 4542052 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414613.1 protein_id gnl|my_center|LOCUS_45930 4543896 4543330 gene locus_tag LOCUS_45940 4543896 4543330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 4544020 4543811 gene locus_tag LOCUS_45950 4544020 4543811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45950 4544288 4546033 gene locus_tag LOCUS_45960 4544288 4546033 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936521.1 protein_id gnl|my_center|LOCUS_45960 4546121 4546714 gene locus_tag LOCUS_45970 gene mpt83 4546121 4546714 CDS product cell surface glycolipoprotein Mpt83 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414630.1 protein_id gnl|my_center|LOCUS_45970 4546879 4547133 gene locus_tag LOCUS_45980 4546879 4547133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 4548036 4547164 gene locus_tag LOCUS_45990 4548036 4547164 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904947.1 protein_id gnl|my_center|LOCUS_45990 4548523 4548050 gene locus_tag LOCUS_46000 4548523 4548050 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414654.1 protein_id gnl|my_center|LOCUS_46000 4549848 4548703 gene locus_tag LOCUS_46010 gene rlmN 4549848 4548703 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414658.1 protein_id gnl|my_center|LOCUS_46010 4549976 4551145 gene locus_tag LOCUS_46020 4549976 4551145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 4551445 4551179 gene locus_tag LOCUS_46030 4551445 4551179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_46030 4552728 4551814 gene locus_tag LOCUS_46040 4552728 4551814 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414661.1 protein_id gnl|my_center|LOCUS_46040 4553318 4552761 gene locus_tag LOCUS_46050 gene frr 4553318 4552761 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414663.1 protein_id gnl|my_center|LOCUS_46050 4554180 4553383 gene locus_tag LOCUS_46060 gene pyrH 4554180 4553383 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908419.1 protein_id gnl|my_center|LOCUS_46060 4554446 4554967 gene locus_tag LOCUS_46070 4554446 4554967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 4554882 4555448 gene locus_tag LOCUS_46080 4554882 4555448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 4555703 4556320 gene locus_tag LOCUS_46090 4555703 4556320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 4557181 4556321 gene locus_tag LOCUS_46100 4557181 4556321 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_46100 4557872 4557390 gene locus_tag LOCUS_46110 4557872 4557390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_46110 4558210 4558629 gene locus_tag LOCUS_46120 4558210 4558629 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899525.1 protein_id gnl|my_center|LOCUS_46120 4560063 4558645 gene locus_tag LOCUS_46130 4560063 4558645 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908420.1 protein_id gnl|my_center|LOCUS_46130 4560899 4560084 gene locus_tag LOCUS_46140 gene tsf 4560899 4560084 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899527.1 protein_id gnl|my_center|LOCUS_46140 4561731 4560901 gene locus_tag LOCUS_46150 gene rpsB 4561731 4560901 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899528.1 protein_id gnl|my_center|LOCUS_46150 4562328 4562023 gene locus_tag LOCUS_46160 4562328 4562023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 4562213 4562542 gene locus_tag LOCUS_46170 4562213 4562542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46170 4563472 4562564 gene locus_tag LOCUS_46180 4563472 4562564 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414689.1 protein_id gnl|my_center|LOCUS_46180 4563980 4563504 gene locus_tag LOCUS_46190 4563980 4563504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46190 4564665 4563868 gene locus_tag LOCUS_46200 4564665 4563868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46200 4565375 4564689 gene locus_tag LOCUS_46210 4565375 4564689 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900590.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46210 4565536 4565351 gene locus_tag LOCUS_46220 4565536 4565351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46220 4566744 4565569 gene locus_tag LOCUS_46230 gene dprA 4566744 4565569 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414694.1 protein_id gnl|my_center|LOCUS_46230 4568252 4566741 gene locus_tag LOCUS_46240 4568252 4566741 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414700.1 protein_id gnl|my_center|LOCUS_46240 4568497 4568252 gene locus_tag LOCUS_46250 4568497 4568252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 4568644 4568859 gene locus_tag LOCUS_46260 4568644 4568859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 4568872 4569906 gene locus_tag LOCUS_46270 4568872 4569906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 4571000 4570179 gene locus_tag LOCUS_46280 gene fdhD 4571000 4570179 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414705.1 protein_id gnl|my_center|LOCUS_46280 4572115 4571135 gene locus_tag LOCUS_46290 4572115 4571135 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229229.1 protein_id gnl|my_center|LOCUS_46290 4572233 4573591 gene locus_tag LOCUS_46300 4572233 4573591 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878617.1 protein_id gnl|my_center|LOCUS_46300 4573669 4574454 gene locus_tag LOCUS_46310 4573669 4574454 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228008.1 protein_id gnl|my_center|LOCUS_46310 4574765 4574460 gene locus_tag LOCUS_46320 4574765 4574460 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414710.1 protein_id gnl|my_center|LOCUS_46320 4575604 4574885 gene locus_tag LOCUS_46330 4575604 4574885 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414713.1 protein_id gnl|my_center|LOCUS_46330 4576470 4575607 gene locus_tag LOCUS_46340 gene lepB 4576470 4575607 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950797.1 protein_id gnl|my_center|LOCUS_46340 4576923 4576582 gene locus_tag LOCUS_46350 gene rplS 4576923 4576582 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908433.1 protein_id gnl|my_center|LOCUS_46350 4577281 4578240 gene locus_tag LOCUS_46360 4577281 4578240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414720.1 protein_id gnl|my_center|LOCUS_46360 4579044 4578352 gene locus_tag LOCUS_46370 gene trmD 4579044 4578352 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414722.1 protein_id gnl|my_center|LOCUS_46370 4579577 4579053 gene locus_tag LOCUS_46380 gene rimM 4579577 4579053 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323871.1 protein_id gnl|my_center|LOCUS_46380 4579844 4579602 gene locus_tag LOCUS_46390 4579844 4579602 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414728.1 protein_id gnl|my_center|LOCUS_46390 4580338 4579853 gene locus_tag LOCUS_46400 gene rpsP 4580338 4579853 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414731.1 protein_id gnl|my_center|LOCUS_46400 4580963 4580544 gene locus_tag LOCUS_46410 4580963 4580544 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414734.1 protein_id gnl|my_center|LOCUS_46410 4581035 4581907 gene locus_tag LOCUS_46420 gene dacB2 4581035 4581907 CDS product D-alanyl-D-alanine carboxypeptidase DacB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414736.1 protein_id gnl|my_center|LOCUS_46420 4582529 4581927 gene locus_tag LOCUS_46430 4582529 4581927 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414739.1 protein_id gnl|my_center|LOCUS_46430 4582800 4582531 gene locus_tag LOCUS_46440 4582800 4582531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46440 4583178 4582849 gene locus_tag LOCUS_46450 4583178 4582849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46450 4584324 4583200 gene locus_tag LOCUS_46460 4584324 4583200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_46460 4586232 4584430 gene locus_tag LOCUS_46470 gene pknI 4586232 4584430 CDS product serine/threonine protein kinase PknI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900593.1 protein_id gnl|my_center|LOCUS_46470 4587372 4586281 gene locus_tag LOCUS_46480 4587372 4586281 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899537.1 protein_id gnl|my_center|LOCUS_46480 4588941 4587379 gene locus_tag LOCUS_46490 gene ffh 4588941 4587379 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414748.1 protein_id gnl|my_center|LOCUS_46490 4589080 4589295 gene locus_tag LOCUS_46500 4589080 4589295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730739.1 protein_id gnl|my_center|LOCUS_46500 4589511 4591247 gene locus_tag LOCUS_46510 4589511 4591247 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917105.1 protein_id gnl|my_center|LOCUS_46510 4593713 4591275 gene locus_tag LOCUS_46520 4593713 4591275 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899539.1 protein_id gnl|my_center|LOCUS_46520 4594145 4593807 gene locus_tag LOCUS_46530 gene glnB 4594145 4593807 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414756.1 protein_id gnl|my_center|LOCUS_46530 4595575 4594142 gene locus_tag LOCUS_46540 4595575 4594142 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899540.1 protein_id gnl|my_center|LOCUS_46540 4597065 4595719 gene locus_tag LOCUS_46550 gene ftsY 4597065 4595719 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899541.1 protein_id gnl|my_center|LOCUS_46550 4598490 4597237 gene locus_tag LOCUS_46560 4598490 4597237 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727502.1 protein_id gnl|my_center|LOCUS_46560 4598761 4598552 gene locus_tag LOCUS_46570 4598761 4598552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 4599699 4600451 gene locus_tag LOCUS_46580 4599699 4600451 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029394.1 protein_id gnl|my_center|LOCUS_46580 4601775 4600843 gene locus_tag LOCUS_46590 4601775 4600843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 4601846 4602235 gene locus_tag LOCUS_46600 4601846 4602235 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_46600 4602150 4602716 gene locus_tag LOCUS_46610 4602150 4602716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 4603039 4602713 gene locus_tag LOCUS_46620 4603039 4602713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 4603676 4604203 gene locus_tag LOCUS_46630 4603676 4604203 CDS product DUF5994 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728985.1 protein_id gnl|my_center|LOCUS_46630 4604535 4605338 gene locus_tag LOCUS_46640 4604535 4605338 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078164.1 protein_id gnl|my_center|LOCUS_46640 4609095 4605475 gene locus_tag LOCUS_46650 gene smc 4609095 4605475 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950799.1 protein_id gnl|my_center|LOCUS_46650 4609859 4609167 gene locus_tag LOCUS_46660 4609859 4609167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 4610827 4609949 gene locus_tag LOCUS_46670 gene mutM 4610827 4609949 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414814.1 protein_id gnl|my_center|LOCUS_46670 4611559 4610828 gene locus_tag LOCUS_46680 gene rnc 4611559 4610828 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414820.1 protein_id gnl|my_center|LOCUS_46680 4612101 4611556 gene locus_tag LOCUS_46690 4612101 4611556 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414824.1 protein_id gnl|my_center|LOCUS_46690 4612970 4612227 gene locus_tag LOCUS_46700 4612970 4612227 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414826.1 protein_id gnl|my_center|LOCUS_46700 4613049 4613273 gene locus_tag LOCUS_46710 4613049 4613273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 4613270 4614019 gene locus_tag LOCUS_46720 gene tesA 4613270 4614019 CDS product thioesterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414828.1 protein_id gnl|my_center|LOCUS_46720 4614699 4616453 gene locus_tag LOCUS_46730 gene fadD26 4614699 4616453 CDS product long-chain-fatty-acid--AMP ligase FAAL26/FadD26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904960.1 protein_id gnl|my_center|LOCUS_46730 4616450 4621258 gene locus_tag LOCUS_46740 4616450 4621258 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908855.1 protein_id gnl|my_center|LOCUS_46740 4621258 4625832 gene locus_tag LOCUS_46750 gene ppsB 4621258 4625832 CDS product phthiocerol type I polyketide synthase PpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414835.1 protein_id gnl|my_center|LOCUS_46750 4625832 4632437 gene locus_tag LOCUS_46760 gene ppsC 4625832 4632437 CDS product phthiocerol type I polyketide synthase PpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414837.1 protein_id gnl|my_center|LOCUS_46760 4632437 4637857 gene locus_tag LOCUS_46770 gene ppsD 4632437 4637857 CDS product phthiocerol type I polyketide synthase PpsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950801.1 protein_id gnl|my_center|LOCUS_46770 4637863 4642308 gene locus_tag LOCUS_46780 gene ppsE 4637863 4642308 CDS product phthiocerol type I polyketide synthase PpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900602.1 protein_id gnl|my_center|LOCUS_46780 4642319 4643314 gene locus_tag LOCUS_46790 gene drrB 4642319 4643314 CDS product daunorubicin ABC transporter permease DrrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414846.1 protein_id gnl|my_center|LOCUS_46790 4643311 4644180 gene locus_tag LOCUS_46800 4643311 4644180 CDS product antibiotic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908850.1 protein_id gnl|my_center|LOCUS_46800 4644177 4645007 gene locus_tag LOCUS_46810 4644177 4645007 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414851.1 protein_id gnl|my_center|LOCUS_46810 4645041 4646285 gene locus_tag LOCUS_46820 4645041 4646285 CDS product phthiocerol/phthiodiolone dimycocerosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908848.1 protein_id gnl|my_center|LOCUS_46820 4652783 4646484 gene locus_tag LOCUS_46830 gene mas 4652783 4646484 CDS product mycocerosate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899551.1 protein_id gnl|my_center|LOCUS_46830 4653037 4653417 gene locus_tag LOCUS_46840 4653037 4653417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 4653711 4653364 gene locus_tag LOCUS_46850 4653711 4653364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46850 4654190 4654471 gene locus_tag LOCUS_46860 4654190 4654471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 4654594 4656336 gene locus_tag LOCUS_46870 gene fadD28 4654594 4656336 CDS product fatty-acid--AMP ligase FAAL28/FadD28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414857.1 protein_id gnl|my_center|LOCUS_46870 4656338 4659097 gene locus_tag LOCUS_46880 gene mmpL7 4656338 4659097 CDS product phthiocerol dimycocerosate RND transporter MmpL7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414861.1 protein_id gnl|my_center|LOCUS_46880 4659258 4659094 gene locus_tag LOCUS_46890 4659258 4659094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 4659963 4659412 gene locus_tag LOCUS_46900 4659963 4659412 CDS product LppX_LprAFG lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414872.1 protein_id gnl|my_center|LOCUS_46900 4666834 4660520 gene locus_tag LOCUS_46910 4666834 4660520 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041180293.1 protein_id gnl|my_center|LOCUS_46910 4662719 4662636 gene locus_tag LOCUS_t00330 4662719 4662636 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4668959 4666851 gene locus_tag LOCUS_46920 4668959 4666851 CDS product p-hydroxybenzoic acid--AMP ligase FadD22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414884.1 protein_id gnl|my_center|LOCUS_46920 4669587 4669078 gene locus_tag LOCUS_46930 4669587 4669078 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907552.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46930 4669504 4669704 gene locus_tag LOCUS_46940 4669504 4669704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 4671583 4669721 gene locus_tag LOCUS_46950 gene fadD29 4671583 4669721 CDS product 4-hydroxyphenylalkanoate adenylyltransferase FadD29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899553.1 protein_id gnl|my_center|LOCUS_46950 4673470 4672418 gene locus_tag LOCUS_46960 4673470 4672418 CDS product phthiodiolone/phenolphthiodiolone dimycocerosates ketoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414891.1 protein_id gnl|my_center|LOCUS_46960 4673788 4675044 gene locus_tag LOCUS_46970 4673788 4675044 CDS product trans-acting enoyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414903.1 protein_id gnl|my_center|LOCUS_46970 4675892 4675095 gene locus_tag LOCUS_46980 4675892 4675095 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907545.1 protein_id gnl|my_center|LOCUS_46980 4677315 4675945 gene locus_tag LOCUS_46990 4677315 4675945 CDS product PGL/p-HBAD biosynthesis rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414922.1 protein_id gnl|my_center|LOCUS_46990 4677813 4678994 gene locus_tag LOCUS_47000 4677813 4678994 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414924.1 protein_id gnl|my_center|LOCUS_47000 4679571 4679005 gene locus_tag LOCUS_47010 4679571 4679005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 4679875 4679486 gene locus_tag LOCUS_47020 4679875 4679486 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_47020 4679962 4680858 gene locus_tag LOCUS_47030 gene purU 4679962 4680858 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899559.1 protein_id gnl|my_center|LOCUS_47030 4681015 4681197 gene locus_tag LOCUS_47040 4681015 4681197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 4681744 4681271 gene locus_tag LOCUS_47050 gene coaD 4681744 4681271 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414998.1 protein_id gnl|my_center|LOCUS_47050 4682291 4681818 gene locus_tag LOCUS_47060 gene rsmD 4682291 4681818 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415001.1 protein_id gnl|my_center|LOCUS_47060 4685764 4682369 gene locus_tag LOCUS_47070 4685764 4682369 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415003.1 protein_id gnl|my_center|LOCUS_47070 4686385 4685807 gene locus_tag LOCUS_47080 4686385 4685807 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415007.1 protein_id gnl|my_center|LOCUS_47080 4687218 4686451 gene locus_tag LOCUS_47090 4687218 4686451 CDS product mycothiol-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415010.1 protein_id gnl|my_center|LOCUS_47090 4688466 4687405 gene locus_tag LOCUS_47100 gene lipN 4688466 4687405 CDS product lipase/esterase LipN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415015.1 protein_id gnl|my_center|LOCUS_47100 4689090 4689938 gene locus_tag LOCUS_47110 4689090 4689938 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415022.1 protein_id gnl|my_center|LOCUS_47110 4690644 4689943 gene locus_tag LOCUS_47120 4690644 4689943 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415024.1 protein_id gnl|my_center|LOCUS_47120 4692892 4690661 gene locus_tag LOCUS_47130 gene recG 4692892 4690661 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415026.1 protein_id gnl|my_center|LOCUS_47130 4694589 4692895 gene locus_tag LOCUS_47140 4694589 4692895 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902383.1 protein_id gnl|my_center|LOCUS_47140 4694872 4695066 gene locus_tag LOCUS_47150 gene rpmB 4694872 4695066 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415030.1 protein_id gnl|my_center|LOCUS_47150 4695872 4695222 gene locus_tag LOCUS_47160 4695872 4695222 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728289.1 protein_id gnl|my_center|LOCUS_47160 4696845 4695922 gene locus_tag LOCUS_47170 4696845 4695922 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730772.1 protein_id gnl|my_center|LOCUS_47170 4697543 4696860 gene locus_tag LOCUS_47180 4697543 4696860 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899565.1 protein_id gnl|my_center|LOCUS_47180 4697830 4697540 gene locus_tag LOCUS_47190 4697830 4697540 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965080.1 protein_id gnl|my_center|LOCUS_47190 4698821 4697856 gene locus_tag LOCUS_47200 4698821 4697856 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908471.1 protein_id gnl|my_center|LOCUS_47200 4699029 4699613 gene locus_tag LOCUS_47210 4699029 4699613 CDS product DUF3515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172591914.1 protein_id gnl|my_center|LOCUS_47210 4700686 4699610 gene locus_tag LOCUS_47220 gene ddlA 4700686 4699610 CDS product D-alanine--D-alanine ligase DdlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950808.1 protein_id gnl|my_center|LOCUS_47220 4701828 4700821 gene locus_tag LOCUS_47230 4701828 4700821 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415091.1 protein_id gnl|my_center|LOCUS_47230 4702021 4701839 gene locus_tag LOCUS_47240 4702021 4701839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 4702020 4702673 gene locus_tag LOCUS_47250 gene cofC 4702020 4702673 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908475.1 protein_id gnl|my_center|LOCUS_47250 4702773 4704968 gene locus_tag LOCUS_47260 4702773 4704968 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415097.1 protein_id gnl|my_center|LOCUS_47260 4705048 4705986 gene locus_tag LOCUS_47270 4705048 4705986 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899569.1 protein_id gnl|my_center|LOCUS_47270 4706683 4706048 gene locus_tag LOCUS_47280 4706683 4706048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 4707504 4706908 gene locus_tag LOCUS_47290 gene leuD 4707504 4706908 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893754.1 protein_id gnl|my_center|LOCUS_47290 4708950 4707529 gene locus_tag LOCUS_47300 gene leuC 4708950 4707529 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899570.1 protein_id gnl|my_center|LOCUS_47300 4709033 4709734 gene locus_tag LOCUS_47310 4709033 4709734 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728309.1 protein_id gnl|my_center|LOCUS_47310 4710285 4711502 gene locus_tag LOCUS_47320 4710285 4711502 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_47320 4711754 4712047 gene locus_tag LOCUS_47330 4711754 4712047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47330 4712179 4715040 gene locus_tag LOCUS_47340 gene mmpL1 4712179 4715040 CDS product RND transporter MmpL1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898435.1 protein_id gnl|my_center|LOCUS_47340 4716031 4715066 gene locus_tag LOCUS_47350 4716031 4715066 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112881.1 protein_id gnl|my_center|LOCUS_47350 4716184 4716759 gene locus_tag LOCUS_47360 4716184 4716759 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899572.1 protein_id gnl|my_center|LOCUS_47360 4716794 4716721 gene locus_tag LOCUS_t00340 4716794 4716721 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4716938 4716866 gene locus_tag LOCUS_t00350 4716938 4716866 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4718488 4717082 gene locus_tag LOCUS_47370 gene gltX 4718488 4717082 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415122.1 protein_id gnl|my_center|LOCUS_47370 4719345 4718548 gene locus_tag LOCUS_47380 4719345 4718548 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041322908.1 protein_id gnl|my_center|LOCUS_47380 4719817 4721064 gene locus_tag LOCUS_47390 4719817 4721064 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415142.1 protein_id gnl|my_center|LOCUS_47390 4721983 4720964 gene locus_tag LOCUS_47400 4721983 4720964 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899576.1 protein_id gnl|my_center|LOCUS_47400 4723550 4722039 gene locus_tag LOCUS_47410 gene serA 4723550 4722039 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899578.1 protein_id gnl|my_center|LOCUS_47410 4723656 4725086 gene locus_tag LOCUS_47420 4723656 4725086 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415150.1 protein_id gnl|my_center|LOCUS_47420 4725083 4725685 gene locus_tag LOCUS_47430 gene wrbA 4725083 4725685 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728300.1 protein_id gnl|my_center|LOCUS_47430 4726803 4725772 gene locus_tag LOCUS_47440 gene ilvC 4726803 4725772 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899581.1 protein_id gnl|my_center|LOCUS_47440 4727355 4726846 gene locus_tag LOCUS_47450 gene ilvN 4727355 4726846 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415167.1 protein_id gnl|my_center|LOCUS_47450 4729211 4727355 gene locus_tag LOCUS_47460 4729211 4727355 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415168.1 protein_id gnl|my_center|LOCUS_47460 4729540 4729917 gene locus_tag LOCUS_47470 4729540 4729917 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415170.1 protein_id gnl|my_center|LOCUS_47470 4730774 4729926 gene locus_tag LOCUS_47480 4730774 4729926 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415171.1 protein_id gnl|my_center|LOCUS_47480 4730957 4732126 gene locus_tag LOCUS_47490 4730957 4732126 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415173.1 protein_id gnl|my_center|LOCUS_47490 4732194 4732583 gene locus_tag LOCUS_47500 4732194 4732583 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_47500 4732498 4733064 gene locus_tag LOCUS_47510 4732498 4733064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 4733649 4733086 gene locus_tag LOCUS_47520 4733649 4733086 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415174.1 protein_id gnl|my_center|LOCUS_47520 4735230 4733722 gene locus_tag LOCUS_47530 gene gatB 4735230 4733722 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415248.1 protein_id gnl|my_center|LOCUS_47530 4736320 4735289 gene locus_tag LOCUS_47540 4736320 4735289 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908491.1 protein_id gnl|my_center|LOCUS_47540 4737901 4736420 gene locus_tag LOCUS_47550 gene gatA 4737901 4736420 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950812.1 protein_id gnl|my_center|LOCUS_47550 4738197 4737898 gene locus_tag LOCUS_47560 gene gatC 4738197 4737898 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415256.1 protein_id gnl|my_center|LOCUS_47560 4738349 4739011 gene locus_tag LOCUS_47570 4738349 4739011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901515.1 protein_id gnl|my_center|LOCUS_47570 4739075 4739464 gene locus_tag LOCUS_47580 4739075 4739464 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_47580 4739379 4739945 gene locus_tag LOCUS_47590 4739379 4739945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 4740987 4739956 gene locus_tag LOCUS_47600 4740987 4739956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47600 4742462 4740984 gene locus_tag LOCUS_47610 4742462 4740984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47610 4742866 4742570 gene locus_tag LOCUS_47620 4742866 4742570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47620 4743117 4742863 gene locus_tag LOCUS_47630 4743117 4742863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47630 4744065 4743469 gene locus_tag LOCUS_47640 4744065 4743469 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407773.1 protein_id gnl|my_center|LOCUS_47640 4746198 4744135 gene locus_tag LOCUS_47650 gene ligA 4746198 4744135 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415263.1 protein_id gnl|my_center|LOCUS_47650 4747309 4746488 gene locus_tag LOCUS_47660 4747309 4746488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47660 4747975 4747337 gene locus_tag LOCUS_47670 4747975 4747337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47670 4749323 4748310 gene locus_tag LOCUS_47680 4749323 4748310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415268.1 protein_id gnl|my_center|LOCUS_47680 4749419 4750048 gene locus_tag LOCUS_47690 4749419 4750048 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415270.1 protein_id gnl|my_center|LOCUS_47690 4751094 4750045 gene locus_tag LOCUS_47700 gene mnmA 4751094 4750045 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415909.1 protein_id gnl|my_center|LOCUS_47700 4752314 4751133 gene locus_tag LOCUS_47710 4752314 4751133 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415911.1 protein_id gnl|my_center|LOCUS_47710 4752917 4752375 gene locus_tag LOCUS_47720 4752917 4752375 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 protein_id gnl|my_center|LOCUS_47720 4753790 4752954 gene locus_tag LOCUS_47730 4753790 4752954 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415914.1 protein_id gnl|my_center|LOCUS_47730 4754650 4753790 gene locus_tag LOCUS_47740 4754650 4753790 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900617.1 protein_id gnl|my_center|LOCUS_47740 4755750 4754794 gene locus_tag LOCUS_47750 4755750 4754794 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899889.1 protein_id gnl|my_center|LOCUS_47750 4756589 4755798 gene locus_tag LOCUS_47760 4756589 4755798 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415921.1 protein_id gnl|my_center|LOCUS_47760 4756862 4757680 gene locus_tag LOCUS_47770 4756862 4757680 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415922.1 protein_id gnl|my_center|LOCUS_47770 4757677 4759272 gene locus_tag LOCUS_47780 4757677 4759272 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899891.1 protein_id gnl|my_center|LOCUS_47780 4759307 4760569 gene locus_tag LOCUS_47790 4759307 4760569 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415928.1 protein_id gnl|my_center|LOCUS_47790 4761552 4760566 gene locus_tag LOCUS_47800 4761552 4760566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 4761715 4762965 gene locus_tag LOCUS_47810 4761715 4762965 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462762.1 protein_id gnl|my_center|LOCUS_47810 4763623 4762970 gene locus_tag LOCUS_47820 4763623 4762970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 4764495 4763854 gene locus_tag LOCUS_47830 4764495 4763854 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_47830 4764669 4765076 gene locus_tag LOCUS_47840 4764669 4765076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415930.1 protein_id gnl|my_center|LOCUS_47840 4765582 4765079 gene locus_tag LOCUS_47850 4765582 4765079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 4766769 4765693 gene locus_tag LOCUS_47860 gene ampC 4766769 4765693 CDS product class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729443.1 protein_id gnl|my_center|LOCUS_47860 4767114 4769228 gene locus_tag LOCUS_47870 4767114 4769228 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876865.1 protein_id gnl|my_center|LOCUS_47870 4769225 4769704 gene locus_tag LOCUS_47880 4769225 4769704 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892495.1 protein_id gnl|my_center|LOCUS_47880 4769713 4771056 gene locus_tag LOCUS_47890 4769713 4771056 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728446.1 protein_id gnl|my_center|LOCUS_47890 4771183 4771728 gene locus_tag LOCUS_47900 4771183 4771728 CDS product DUF4333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415932.1 protein_id gnl|my_center|LOCUS_47900 4771805 4772584 gene locus_tag LOCUS_47910 4771805 4772584 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921271.1 protein_id gnl|my_center|LOCUS_47910 4773342 4772605 gene locus_tag LOCUS_47920 4773342 4772605 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908505.1 protein_id gnl|my_center|LOCUS_47920 4773519 4774835 gene locus_tag LOCUS_47930 4773519 4774835 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041180139.1 protein_id gnl|my_center|LOCUS_47930 4774852 4775241 gene locus_tag LOCUS_47940 4774852 4775241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 4775928 4775245 gene locus_tag LOCUS_47950 4775928 4775245 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415939.1 protein_id gnl|my_center|LOCUS_47950 4777040 4776003 gene locus_tag LOCUS_47960 4777040 4776003 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415940.1 protein_id gnl|my_center|LOCUS_47960 4778188 4777205 gene locus_tag LOCUS_47970 4778188 4777205 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415941.1 protein_id gnl|my_center|LOCUS_47970 4778972 4778199 gene locus_tag LOCUS_47980 4778972 4778199 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415942.1 protein_id gnl|my_center|LOCUS_47980 4779757 4778969 gene locus_tag LOCUS_47990 4779757 4778969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415943.1 protein_id gnl|my_center|LOCUS_47990 4780611 4779808 gene locus_tag LOCUS_48000 4780611 4779808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415944.1 protein_id gnl|my_center|LOCUS_48000 4782245 4780749 gene locus_tag LOCUS_48010 4782245 4780749 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950337.1 protein_id gnl|my_center|LOCUS_48010 4783711 4782245 gene locus_tag LOCUS_48020 4783711 4782245 CDS product hydrogenase HycQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400662.1 protein_id gnl|my_center|LOCUS_48020 4783962 4783711 gene locus_tag LOCUS_48030 4783962 4783711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48030 4784373 4783972 gene locus_tag LOCUS_48040 4784373 4783972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48040 4785337 4784378 gene locus_tag LOCUS_48050 4785337 4784378 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_48050 4787310 4785334 gene locus_tag LOCUS_48060 4787310 4785334 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907280.1 protein_id gnl|my_center|LOCUS_48060 4787786 4787307 gene locus_tag LOCUS_48070 4787786 4787307 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400658.1 protein_id gnl|my_center|LOCUS_48070 4788145 4787801 gene locus_tag LOCUS_48080 4788145 4787801 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_48080 4789562 4788327 gene locus_tag LOCUS_48090 gene serB 4789562 4788327 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950818.1 protein_id gnl|my_center|LOCUS_48090 4791349 4789616 gene locus_tag LOCUS_48100 gene ctaD 4791349 4789616 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415946.1 protein_id gnl|my_center|LOCUS_48100 4791627 4792610 gene locus_tag LOCUS_48110 4791627 4792610 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415959.1 protein_id gnl|my_center|LOCUS_48110 4792744 4793784 gene locus_tag LOCUS_48120 4792744 4793784 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415965.1 protein_id gnl|my_center|LOCUS_48120 4794117 4793773 gene locus_tag LOCUS_48130 4794117 4793773 CDS product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415968.1 protein_id gnl|my_center|LOCUS_48130 4795257 4794283 gene locus_tag LOCUS_48140 gene nrdF 4795257 4794283 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415973.1 protein_id gnl|my_center|LOCUS_48140 4795458 4795904 gene locus_tag LOCUS_48150 4795458 4795904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 4795882 4796427 gene locus_tag LOCUS_48160 4795882 4796427 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228137.1 protein_id gnl|my_center|LOCUS_48160 4797967 4796417 gene locus_tag LOCUS_48170 4797967 4796417 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899895.1 protein_id gnl|my_center|LOCUS_48170 4798829 4798086 gene locus_tag LOCUS_48180 4798829 4798086 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415979.1 protein_id gnl|my_center|LOCUS_48180 4801100 4798935 gene locus_tag LOCUS_48190 gene nrdE 4801100 4798935 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003914457.1 protein_id gnl|my_center|LOCUS_48190 4801531 4801070 gene locus_tag LOCUS_48200 gene nrdI 4801531 4801070 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415981.1 protein_id gnl|my_center|LOCUS_48200 4801814 4801575 gene locus_tag LOCUS_48210 gene nrdH 4801814 4801575 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415982.1 protein_id gnl|my_center|LOCUS_48210 4805419 4802333 gene locus_tag LOCUS_48220 4805419 4802333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 4806460 4805903 gene locus_tag LOCUS_48230 4806460 4805903 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415983.1 protein_id gnl|my_center|LOCUS_48230 4806491 4807153 gene locus_tag LOCUS_48240 4806491 4807153 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415984.1 protein_id gnl|my_center|LOCUS_48240 4808069 4807194 gene locus_tag LOCUS_48250 4808069 4807194 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415986.1 protein_id gnl|my_center|LOCUS_48250 4808795 4808142 gene locus_tag LOCUS_48260 4808795 4808142 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415987.1 protein_id gnl|my_center|LOCUS_48260 4808906 4810384 gene locus_tag LOCUS_48270 4808906 4810384 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415988.1 protein_id gnl|my_center|LOCUS_48270 4810942 4810412 gene locus_tag LOCUS_48280 4810942 4810412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013472216.1 protein_id gnl|my_center|LOCUS_48280 4811213 4811428 gene locus_tag LOCUS_48290 4811213 4811428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 4812102 4811536 gene locus_tag LOCUS_48300 4812102 4811536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 4812400 4812017 gene locus_tag LOCUS_48310 4812400 4812017 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_48310 4812477 4813409 gene locus_tag LOCUS_48320 4812477 4813409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 4813681 4813478 gene locus_tag LOCUS_48330 4813681 4813478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 4815896 4814004 gene locus_tag LOCUS_48340 4815896 4814004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 4815998 4816909 gene locus_tag LOCUS_48350 4815998 4816909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 4817514 4816903 gene locus_tag LOCUS_48360 4817514 4816903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 4817793 4817521 gene locus_tag LOCUS_48370 4817793 4817521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 4819206 4817800 gene locus_tag LOCUS_48380 4819206 4817800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 4819103 4819450 gene locus_tag LOCUS_48390 4819103 4819450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 4820160 4819447 gene locus_tag LOCUS_48400 4820160 4819447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 4820102 4820254 gene locus_tag LOCUS_48410 4820102 4820254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48410 4820683 4820610 gene locus_tag LOCUS_t00360 4820683 4820610 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4822389 4820749 gene locus_tag LOCUS_48420 gene pgm 4822389 4820749 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899902.1 protein_id gnl|my_center|LOCUS_48420 4823040 4822474 gene locus_tag LOCUS_48430 4823040 4822474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 4823344 4822955 gene locus_tag LOCUS_48440 4823344 4822955 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_48440 4823442 4823837 gene locus_tag LOCUS_48450 gene crcB 4823442 4823837 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416045.1 protein_id gnl|my_center|LOCUS_48450 4823837 4824211 gene locus_tag LOCUS_48460 gene crcB 4823837 4824211 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416046.1 protein_id gnl|my_center|LOCUS_48460 4824208 4825314 gene locus_tag LOCUS_48470 4824208 4825314 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901532.1 protein_id gnl|my_center|LOCUS_48470 4825400 4825618 gene locus_tag LOCUS_48480 4825400 4825618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 4825779 4825994 gene locus_tag LOCUS_48490 4825779 4825994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 4826007 4827041 gene locus_tag LOCUS_48500 4826007 4827041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 4827305 4828222 gene locus_tag LOCUS_48510 4827305 4828222 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891984.1 protein_id gnl|my_center|LOCUS_48510 4829042 4828239 gene locus_tag LOCUS_48520 4829042 4828239 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728236.1 protein_id gnl|my_center|LOCUS_48520 4829842 4829075 gene locus_tag LOCUS_48530 4829842 4829075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 4830540 4829896 gene locus_tag LOCUS_48540 4830540 4829896 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917120.1 protein_id gnl|my_center|LOCUS_48540 4832282 4830591 gene locus_tag LOCUS_48550 4832282 4830591 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900628.1 protein_id gnl|my_center|LOCUS_48550 4833209 4832319 gene locus_tag LOCUS_48560 4833209 4832319 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416086.1 protein_id gnl|my_center|LOCUS_48560 4834833 4833370 gene locus_tag LOCUS_48570 4834833 4833370 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728345.1 protein_id gnl|my_center|LOCUS_48570 4834913 4835311 gene locus_tag LOCUS_48580 4834913 4835311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 4836498 4835932 gene locus_tag LOCUS_48590 4836498 4835932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 4836622 4836413 gene locus_tag LOCUS_48600 4836622 4836413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48600 4837575 4836832 gene locus_tag LOCUS_48610 4837575 4836832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 4837987 4837568 gene locus_tag LOCUS_48620 4837987 4837568 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416053.1 protein_id gnl|my_center|LOCUS_48620 4839804 4838131 gene locus_tag LOCUS_48630 4839804 4838131 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 protein_id gnl|my_center|LOCUS_48630 4841292 4839868 gene locus_tag LOCUS_48640 4841292 4839868 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082635.1 protein_id gnl|my_center|LOCUS_48640 4841612 4841289 gene locus_tag LOCUS_48650 4841612 4841289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 4842723 4841689 gene locus_tag LOCUS_48660 4842723 4841689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 4842978 4842736 gene locus_tag LOCUS_48670 4842978 4842736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 4843422 4843967 gene locus_tag LOCUS_48680 4843422 4843967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48680 4844037 4845011 gene locus_tag LOCUS_48690 4844037 4845011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48690 4845228 4845884 gene locus_tag LOCUS_48700 4845228 4845884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 4846159 4846614 gene locus_tag LOCUS_48710 4846159 4846614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 4846624 4847382 gene locus_tag LOCUS_48720 4846624 4847382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48720 4847481 4847840 gene locus_tag LOCUS_48730 4847481 4847840 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030037.1 protein_id gnl|my_center|LOCUS_48730 4847837 4848604 gene locus_tag LOCUS_48740 4847837 4848604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 4848773 4849717 gene locus_tag LOCUS_48750 gene miaA 4848773 4849717 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413989.1 protein_id gnl|my_center|LOCUS_48750 4849846 4850784 gene locus_tag LOCUS_48760 4849846 4850784 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405276.1 protein_id gnl|my_center|LOCUS_48760 4850850 4851131 gene locus_tag LOCUS_48770 4850850 4851131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 4851140 4851946 gene locus_tag LOCUS_48780 4851140 4851946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48780 4851861 4852325 gene locus_tag LOCUS_48790 4851861 4852325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48790 4853354 4852347 gene locus_tag LOCUS_48800 4853354 4852347 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_48800 4854328 4853351 gene locus_tag LOCUS_48810 4854328 4853351 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416094.1 protein_id gnl|my_center|LOCUS_48810 4855434 4854325 gene locus_tag LOCUS_48820 4855434 4854325 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416097.1 protein_id gnl|my_center|LOCUS_48820 4855565 4856041 gene locus_tag LOCUS_48830 4855565 4856041 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416099.1 protein_id gnl|my_center|LOCUS_48830 4856302 4857438 gene locus_tag LOCUS_48840 4856302 4857438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904991.1 protein_id gnl|my_center|LOCUS_48840 4857940 4857452 gene locus_tag LOCUS_48850 4857940 4857452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 4858461 4858147 gene locus_tag LOCUS_48860 4858461 4858147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 4858602 4859465 gene locus_tag LOCUS_48870 4858602 4859465 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_48870 4860072 4861334 gene locus_tag LOCUS_48880 4860072 4861334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 4861364 4861753 gene locus_tag LOCUS_48890 4861364 4861753 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_48890 4861668 4862234 gene locus_tag LOCUS_48900 4861668 4862234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 4862188 4862505 gene locus_tag LOCUS_48910 4862188 4862505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 4862502 4863314 gene locus_tag LOCUS_48920 gene istB 4862502 4863314 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_48920 4863427 4863657 gene locus_tag LOCUS_48930 4863427 4863657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 4864327 4863716 gene locus_tag LOCUS_48940 4864327 4863716 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047314267.1 protein_id gnl|my_center|LOCUS_48940 4864426 4866096 gene locus_tag LOCUS_48950 4864426 4866096 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031577.1 protein_id gnl|my_center|LOCUS_48950 4866247 4866957 gene locus_tag LOCUS_48960 gene prrA 4866247 4866957 CDS product two-component system response regulator PrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172591973.1 protein_id gnl|my_center|LOCUS_48960 4866954 4868312 gene locus_tag LOCUS_48970 gene prrB 4866954 4868312 CDS product two-component system sensor histidine kinase PrrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404689.1 protein_id gnl|my_center|LOCUS_48970 4868362 4868751 gene locus_tag LOCUS_48980 4868362 4868751 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_48980 4868666 4869232 gene locus_tag LOCUS_48990 4868666 4869232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48990 4869904 4869266 gene locus_tag LOCUS_49000 4869904 4869266 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404688.1 protein_id gnl|my_center|LOCUS_49000 4870128 4869904 gene locus_tag LOCUS_49010 4870128 4869904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 4870818 4870141 gene locus_tag LOCUS_49020 4870818 4870141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49020 4871037 4870837 gene locus_tag LOCUS_49030 4871037 4870837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49030 4871251 4871514 gene locus_tag LOCUS_49040 4871251 4871514 CDS product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404673.1 protein_id gnl|my_center|LOCUS_49040 4871538 4873112 gene locus_tag LOCUS_49050 4871538 4873112 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900230.1 protein_id gnl|my_center|LOCUS_49050 4874412 4873117 gene locus_tag LOCUS_49060 4874412 4873117 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901040.1 protein_id gnl|my_center|LOCUS_49060 4876212 4874800 gene locus_tag LOCUS_49070 4876212 4874800 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404651.1 protein_id gnl|my_center|LOCUS_49070 4877192 4876533 gene locus_tag LOCUS_49080 gene pdxH 4877192 4876533 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045843615.1 protein_id gnl|my_center|LOCUS_49080 4877490 4877218 gene locus_tag LOCUS_49090 4877490 4877218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 4877401 4878384 gene locus_tag LOCUS_49100 4877401 4878384 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898633.1 protein_id gnl|my_center|LOCUS_49100 4879984 4878443 gene locus_tag LOCUS_49110 gene spmT 4879984 4878443 CDS product sphingomyelinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901038.1 protein_id gnl|my_center|LOCUS_49110 4880348 4880563 gene locus_tag LOCUS_49120 4880348 4880563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 4880576 4881610 gene locus_tag LOCUS_49130 4880576 4881610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 4881816 4882946 gene locus_tag LOCUS_49140 gene serC 4881816 4882946 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908729.1 protein_id gnl|my_center|LOCUS_49140 4883068 4883859 gene locus_tag LOCUS_49150 gene sepH 4883068 4883859 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404617.1 protein_id gnl|my_center|LOCUS_49150 4884143 4883856 gene locus_tag LOCUS_49160 4884143 4883856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 4884979 4884140 gene locus_tag LOCUS_49170 4884979 4884140 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916735.1 protein_id gnl|my_center|LOCUS_49170 4885263 4884976 gene locus_tag LOCUS_49180 4885263 4884976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 4885666 4885953 gene locus_tag LOCUS_49190 4885666 4885953 CDS product DUF2530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404603.1 protein_id gnl|my_center|LOCUS_49190 4885974 4886429 gene locus_tag LOCUS_49200 4885974 4886429 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897102.1 protein_id gnl|my_center|LOCUS_49200 4887229 4886426 gene locus_tag LOCUS_49210 4887229 4886426 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404596.1 protein_id gnl|my_center|LOCUS_49210 4887366 4889042 gene locus_tag LOCUS_49220 4887366 4889042 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950465.1 protein_id gnl|my_center|LOCUS_49220 4889051 4889527 gene locus_tag LOCUS_49230 4889051 4889527 CDS product DUF2771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404591.1 protein_id gnl|my_center|LOCUS_49230 4889636 4890187 gene locus_tag LOCUS_49240 4889636 4890187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49240 4890200 4890490 gene locus_tag LOCUS_49250 4890200 4890490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49250 4891491 4890487 gene locus_tag LOCUS_49260 4891491 4890487 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878423.1 protein_id gnl|my_center|LOCUS_49260 4893456 4891504 gene locus_tag LOCUS_49270 4893456 4891504 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898626.1 protein_id gnl|my_center|LOCUS_49270 4894046 4893642 gene locus_tag LOCUS_49280 4894046 4893642 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908736.1 protein_id gnl|my_center|LOCUS_49280 4894210 4894614 gene locus_tag LOCUS_49290 4894210 4894614 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404566.1 protein_id gnl|my_center|LOCUS_49290 4894611 4895693 gene locus_tag LOCUS_49300 gene moaA 4894611 4895693 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404564.1 protein_id gnl|my_center|LOCUS_49300 4895707 4895976 gene locus_tag LOCUS_49310 gene moaD2 4895707 4895976 CDS product molybdopterin synthase subunit MoaD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404559.1 protein_id gnl|my_center|LOCUS_49310 4896412 4897341 gene locus_tag LOCUS_49320 4896412 4897341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 4897811 4897386 gene locus_tag LOCUS_49330 gene moaE2 4897811 4897386 CDS product molybdopterin synthase subunit MoaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404552.1 protein_id gnl|my_center|LOCUS_49330 4898293 4897808 gene locus_tag LOCUS_49340 4898293 4897808 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404549.1 protein_id gnl|my_center|LOCUS_49340 4898826 4898290 gene locus_tag LOCUS_49350 gene moaC 4898826 4898290 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404544.1 protein_id gnl|my_center|LOCUS_49350 4899044 4898835 gene locus_tag LOCUS_49360 4899044 4898835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911329.1 protein_id gnl|my_center|LOCUS_49360 4899108 4901366 gene locus_tag LOCUS_49370 4899108 4901366 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404512.1 protein_id gnl|my_center|LOCUS_49370 4901449 4903098 gene locus_tag LOCUS_49380 4901449 4903098 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404428.1 protein_id gnl|my_center|LOCUS_49380 4903949 4904269 gene locus_tag LOCUS_49390 4903949 4904269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 4905244 4904297 gene locus_tag LOCUS_49400 4905244 4904297 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897127.1 protein_id gnl|my_center|LOCUS_49400 4905799 4905350 gene locus_tag LOCUS_49410 4905799 4905350 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104389.1 protein_id gnl|my_center|LOCUS_49410 4905966 4907177 gene locus_tag LOCUS_49420 4905966 4907177 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226545.1 protein_id gnl|my_center|LOCUS_49420 4909396 4907252 gene locus_tag LOCUS_49430 gene fadB 4909396 4907252 CDS product fatty oxidation protein FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404426.1 protein_id gnl|my_center|LOCUS_49430 4910612 4909401 gene locus_tag LOCUS_49440 4910612 4909401 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404423.1 protein_id gnl|my_center|LOCUS_49440 4910816 4912012 gene locus_tag LOCUS_49450 4910816 4912012 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404420.1 protein_id gnl|my_center|LOCUS_49450 4912589 4912023 gene locus_tag LOCUS_49460 4912589 4912023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49460 4912893 4912504 gene locus_tag LOCUS_49470 4912893 4912504 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_49470 4913383 4913042 gene locus_tag LOCUS_49480 4913383 4913042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_49480 4913885 4913430 gene locus_tag LOCUS_49490 4913885 4913430 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903201.1 protein_id gnl|my_center|LOCUS_49490 4915023 4913944 gene locus_tag LOCUS_49500 gene far 4915023 4913944 CDS product fatty-acid-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404414.1 protein_id gnl|my_center|LOCUS_49500 4915503 4915033 gene locus_tag LOCUS_49510 4915503 4915033 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404412.1 protein_id gnl|my_center|LOCUS_49510 4915537 4917237 gene locus_tag LOCUS_49520 gene pdc 4915537 4917237 CDS product alpha-keto-acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900222.1 protein_id gnl|my_center|LOCUS_49520 4918080 4917505 gene locus_tag LOCUS_49530 4918080 4917505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003913008.1 protein_id gnl|my_center|LOCUS_49530 4918713 4918132 gene locus_tag LOCUS_49540 4918713 4918132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 4919165 4918710 gene locus_tag LOCUS_49550 4919165 4918710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 4919536 4919925 gene locus_tag LOCUS_49560 4919536 4919925 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_49560 4919840 4920406 gene locus_tag LOCUS_49570 4919840 4920406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 4920627 4920403 gene locus_tag LOCUS_49580 4920627 4920403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 4922225 4920900 gene locus_tag LOCUS_49590 4922225 4920900 CDS product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083087609.1 protein_id gnl|my_center|LOCUS_49590 4922283 4922672 gene locus_tag LOCUS_49600 4922283 4922672 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_49600 4922587 4923153 gene locus_tag LOCUS_49610 4922587 4923153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 4924705 4923233 gene locus_tag LOCUS_49620 4924705 4923233 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727675.1 protein_id gnl|my_center|LOCUS_49620 4926256 4925069 gene locus_tag LOCUS_49630 4926256 4925069 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730097.1 protein_id gnl|my_center|LOCUS_49630 4926381 4927100 gene locus_tag LOCUS_49640 4926381 4927100 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036453560.1 protein_id gnl|my_center|LOCUS_49640 4927334 4928536 gene locus_tag LOCUS_49650 4927334 4928536 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730165.1 protein_id gnl|my_center|LOCUS_49650 4928567 4929418 gene locus_tag LOCUS_49660 4928567 4929418 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730130.1 protein_id gnl|my_center|LOCUS_49660 4929430 4930260 gene locus_tag LOCUS_49670 4929430 4930260 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950459.1 protein_id gnl|my_center|LOCUS_49670 4931063 4930257 gene locus_tag LOCUS_49680 4931063 4930257 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730131.1 protein_id gnl|my_center|LOCUS_49680 4932301 4931072 gene locus_tag LOCUS_49690 4932301 4931072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49690 4932942 4932361 gene locus_tag LOCUS_49700 4932942 4932361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49700 4933505 4933107 gene locus_tag LOCUS_49710 4933505 4933107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49710 4934476 4933505 gene locus_tag LOCUS_49720 4934476 4933505 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730133.1 protein_id gnl|my_center|LOCUS_49720 4934721 4934500 gene locus_tag LOCUS_49730 4934721 4934500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49730 4935549 4934749 gene locus_tag LOCUS_49740 4935549 4934749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49740 4936843 4935608 gene locus_tag LOCUS_49750 4936843 4935608 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730135.1 protein_id gnl|my_center|LOCUS_49750 4937062 4936853 gene locus_tag LOCUS_49760 4937062 4936853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49760 4938028 4937093 gene locus_tag LOCUS_49770 4938028 4937093 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730136.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49770 4938710 4938063 gene locus_tag LOCUS_49780 4938710 4938063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49780 4939307 4938741 gene locus_tag LOCUS_49790 4939307 4938741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49790 4939546 4939310 gene locus_tag LOCUS_49800 4939546 4939310 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228974.1 protein_id gnl|my_center|LOCUS_49800 4940181 4939516 gene locus_tag LOCUS_49810 4940181 4939516 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896256.1 protein_id gnl|my_center|LOCUS_49810 4940309 4941427 gene locus_tag LOCUS_49820 4940309 4941427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_49820 4941498 4943693 gene locus_tag LOCUS_49830 4941498 4943693 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886092.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_49830 4944537 4943734 gene locus_tag LOCUS_49840 4944537 4943734 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730139.1 protein_id gnl|my_center|LOCUS_49840 4944694 4945485 gene locus_tag LOCUS_49850 4944694 4945485 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729824.1 protein_id gnl|my_center|LOCUS_49850 4946118 4945552 gene locus_tag LOCUS_49860 4946118 4945552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 4946992 4946033 gene locus_tag LOCUS_49870 4946992 4946033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49870 4947748 4947011 gene locus_tag LOCUS_49880 4947748 4947011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49880 4948782 4947748 gene locus_tag LOCUS_49890 gene cysK2 4948782 4947748 CDS product S-sulfocysteine synthase CysK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935595.1 protein_id gnl|my_center|LOCUS_49890 4949463 4949071 gene locus_tag LOCUS_49900 gene lpqs 4949463 4949071 CDS product lipoprotein LpqS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901025.1 protein_id gnl|my_center|LOCUS_49900 4949608 4951266 gene locus_tag LOCUS_49910 gene mmcO 4949608 4951266 CDS product multicopper oxidase MmcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404392.1 protein_id gnl|my_center|LOCUS_49910 4952115 4951297 gene locus_tag LOCUS_49920 4952115 4951297 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730140.1 protein_id gnl|my_center|LOCUS_49920 4953104 4952115 gene locus_tag LOCUS_49930 4953104 4952115 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878166.1 protein_id gnl|my_center|LOCUS_49930 4953898 4953104 gene locus_tag LOCUS_49940 4953898 4953104 CDS product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730142.1 protein_id gnl|my_center|LOCUS_49940 4956426 4953961 gene locus_tag LOCUS_49950 4956426 4953961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 4957020 4956511 gene locus_tag LOCUS_49960 4957020 4956511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49960 4957937 4957017 gene locus_tag LOCUS_49970 4957937 4957017 CDS product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124712479.1 protein_id gnl|my_center|LOCUS_49970 4959601 4957967 gene locus_tag LOCUS_49980 4959601 4957967 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878169.1 protein_id gnl|my_center|LOCUS_49980 4960029 4959601 gene locus_tag LOCUS_49990 4960029 4959601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49990 4960467 4960093 gene locus_tag LOCUS_50000 4960467 4960093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50000 4960596 4961273 gene locus_tag LOCUS_50010 4960596 4961273 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730148.1 protein_id gnl|my_center|LOCUS_50010 4961652 4962902 gene locus_tag LOCUS_50020 4961652 4962902 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730149.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50020 4964129 4962909 gene locus_tag LOCUS_50030 4964129 4962909 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898611.1 protein_id gnl|my_center|LOCUS_50030 4964509 4964330 gene locus_tag LOCUS_50040 4964509 4964330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 4964420 4965001 gene locus_tag LOCUS_50050 gene narL 4964420 4965001 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404388.1 protein_id gnl|my_center|LOCUS_50050 4966340 4964946 gene locus_tag LOCUS_50060 4966340 4964946 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898611.1 protein_id gnl|my_center|LOCUS_50060 4967385 4966471 gene locus_tag LOCUS_50070 4967385 4966471 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950455.1 protein_id gnl|my_center|LOCUS_50070 4969162 4967630 gene locus_tag LOCUS_50080 4969162 4967630 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404382.1 protein_id gnl|my_center|LOCUS_50080 4969520 4969293 gene locus_tag LOCUS_50090 4969520 4969293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50090 4970560 4969682 gene locus_tag LOCUS_50100 gene meaB 4970560 4969682 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730150.1 protein_id gnl|my_center|LOCUS_50100 4971733 4970582 gene locus_tag LOCUS_50110 4971733 4970582 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228962.1 protein_id gnl|my_center|LOCUS_50110 4971848 4972714 gene locus_tag LOCUS_50120 4971848 4972714 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404376.1 protein_id gnl|my_center|LOCUS_50120 4972796 4973185 gene locus_tag LOCUS_50130 4972796 4973185 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_50130 4973100 4973666 gene locus_tag LOCUS_50140 4973100 4973666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50140 4974282 4973677 gene locus_tag LOCUS_50150 4974282 4973677 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878171.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50150 4975109 4974444 gene locus_tag LOCUS_50160 4975109 4974444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50160 4975540 4975142 gene locus_tag LOCUS_50170 4975540 4975142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50170 4976432 4975527 gene locus_tag LOCUS_50180 4976432 4975527 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730155.1 protein_id gnl|my_center|LOCUS_50180 4977150 4976410 gene locus_tag LOCUS_50190 4977150 4976410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50190 4977812 4977153 gene locus_tag LOCUS_50200 4977812 4977153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50200 4977928 4978209 gene locus_tag LOCUS_50210 4977928 4978209 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104195.1 protein_id gnl|my_center|LOCUS_50210 4979279 4978239 gene locus_tag LOCUS_50220 4979279 4978239 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730158.1 protein_id gnl|my_center|LOCUS_50220 4979911 4979276 gene locus_tag LOCUS_50230 4979911 4979276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50230 4980655 4980218 gene locus_tag LOCUS_50240 4980655 4980218 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896278.1 protein_id gnl|my_center|LOCUS_50240 4982233 4980656 gene locus_tag LOCUS_50250 4982233 4980656 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730160.1 protein_id gnl|my_center|LOCUS_50250 4983171 4982359 gene locus_tag LOCUS_50260 4983171 4982359 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_50260 4983858 4983232 gene locus_tag LOCUS_50270 4983858 4983232 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898609.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50270 4984128 4984712 gene locus_tag LOCUS_50280 4984128 4984712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 4984734 4985552 gene locus_tag LOCUS_50290 4984734 4985552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 4985862 4985572 gene locus_tag LOCUS_50300 4985862 4985572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 4986507 4985941 gene locus_tag LOCUS_50310 4986507 4985941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 4986631 4986422 gene locus_tag LOCUS_50320 4986631 4986422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50320 4987123 4986677 gene locus_tag LOCUS_50330 4987123 4986677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50330 4987541 4988662 gene locus_tag LOCUS_50340 4987541 4988662 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225925.1 protein_id gnl|my_center|LOCUS_50340 4989061 4988738 gene locus_tag LOCUS_50350 4989061 4988738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 4989219 4989656 gene locus_tag LOCUS_50360 4989219 4989656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50360 4989753 4990217 gene locus_tag LOCUS_50370 4989753 4990217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50370 4990214 4991173 gene locus_tag LOCUS_50380 4990214 4991173 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728282.1 protein_id gnl|my_center|LOCUS_50380 4991170 4991493 gene locus_tag LOCUS_50390 4991170 4991493 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225087.1 protein_id gnl|my_center|LOCUS_50390 4991490 4991864 gene locus_tag LOCUS_50400 4991490 4991864 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742202.1 protein_id gnl|my_center|LOCUS_50400 4991858 4994167 gene locus_tag LOCUS_50410 4991858 4994167 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730364.1 protein_id gnl|my_center|LOCUS_50410 4994213 4994764 gene locus_tag LOCUS_50420 4994213 4994764 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978019.1 protein_id gnl|my_center|LOCUS_50420 4995820 4994774 gene locus_tag LOCUS_50430 gene fni 4995820 4994774 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049747543.1 protein_id gnl|my_center|LOCUS_50430 4996644 4995937 gene locus_tag LOCUS_50440 4996644 4995937 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141332.1 protein_id gnl|my_center|LOCUS_50440 4997240 4996638 gene locus_tag LOCUS_50450 4997240 4996638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 4998806 4997322 gene locus_tag LOCUS_50460 4998806 4997322 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899182.1 protein_id gnl|my_center|LOCUS_50460 4999092 4998850 gene locus_tag LOCUS_50470 4999092 4998850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 4999842 4999234 gene locus_tag LOCUS_50480 4999842 4999234 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918753.1 protein_id gnl|my_center|LOCUS_50480 5000018 5001022 gene locus_tag LOCUS_50490 5000018 5001022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 5000964 5001779 gene locus_tag LOCUS_50500 5000964 5001779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 5002351 5001713 gene locus_tag LOCUS_50510 5002351 5001713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 5002791 5002564 gene locus_tag LOCUS_50520 5002791 5002564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 5002726 5002995 gene locus_tag LOCUS_50530 5002726 5002995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 5003009 5004274 gene locus_tag LOCUS_50540 5003009 5004274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50540 5004559 5006280 gene locus_tag LOCUS_50550 5004559 5006280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 5006753 5006550 gene locus_tag LOCUS_50560 5006753 5006550 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891980.1 protein_id gnl|my_center|LOCUS_50560 5008135 5006846 gene locus_tag LOCUS_50570 5008135 5006846 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080124.1 protein_id gnl|my_center|LOCUS_50570 5009187 5012921 gene locus_tag LOCUS_50580 gene metH 5009187 5012921 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021268943.1 protein_id gnl|my_center|LOCUS_50580 5013349 5013639 gene locus_tag LOCUS_50590 5013349 5013639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50590 5014433 5013897 gene locus_tag LOCUS_50600 5014433 5013897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 5015027 5014443 gene locus_tag LOCUS_50610 5015027 5014443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 5015400 5015038 gene locus_tag LOCUS_50620 5015400 5015038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 5015549 5016811 gene locus_tag LOCUS_50630 5015549 5016811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 5016841 5017230 gene locus_tag LOCUS_50640 5016841 5017230 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_50640 5017145 5017711 gene locus_tag LOCUS_50650 5017145 5017711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 5017665 5017982 gene locus_tag LOCUS_50660 5017665 5017982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 5017979 5018791 gene locus_tag LOCUS_50670 gene istB 5017979 5018791 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_50670 5019339 5020172 gene locus_tag LOCUS_50680 5019339 5020172 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389782.1 protein_id gnl|my_center|LOCUS_50680 5020597 5022054 gene locus_tag LOCUS_50690 5020597 5022054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 5022734 5022300 gene locus_tag LOCUS_50700 5022734 5022300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 5023442 5022864 gene locus_tag LOCUS_50710 5023442 5022864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 5024447 5023731 gene locus_tag LOCUS_50720 5024447 5023731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 5024970 5026142 gene locus_tag LOCUS_50730 5024970 5026142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 5026278 5026574 gene locus_tag LOCUS_50740 5026278 5026574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 5027971 5026487 gene locus_tag LOCUS_50750 5027971 5026487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 5028237 5028659 gene locus_tag LOCUS_50760 5028237 5028659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 5029606 5030010 gene locus_tag LOCUS_50770 5029606 5030010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50770 5030021 5030242 gene locus_tag LOCUS_50780 5030021 5030242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 5030243 5031535 gene locus_tag LOCUS_50790 5030243 5031535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 5031509 5031433 gene locus_tag LOCUS_t00370 5031509 5031433 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5031613 5031538 gene locus_tag LOCUS_t00380 5031613 5031538 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5031724 5031651 gene locus_tag LOCUS_t00390 5031724 5031651 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5031848 5031921 gene locus_tag LOCUS_t00400 5031848 5031921 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5032125 5032937 gene locus_tag LOCUS_50800 5032125 5032937 CDS product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404352.1 protein_id gnl|my_center|LOCUS_50800 5033860 5032955 gene locus_tag LOCUS_50810 5033860 5032955 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404349.1 protein_id gnl|my_center|LOCUS_50810 5033954 5034454 gene locus_tag LOCUS_50820 5033954 5034454 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112830.1 protein_id gnl|my_center|LOCUS_50820 5034504 5034893 gene locus_tag LOCUS_50830 5034504 5034893 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_50830 5034808 5035374 gene locus_tag LOCUS_50840 5034808 5035374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 5035991 5035371 gene locus_tag LOCUS_50850 5035991 5035371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 5036741 5036142 gene locus_tag LOCUS_50860 5036741 5036142 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414887.1 protein_id gnl|my_center|LOCUS_50860 5037679 5036789 gene locus_tag LOCUS_50870 5037679 5036789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 5038280 5037714 gene locus_tag LOCUS_50880 5038280 5037714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 5038584 5038195 gene locus_tag LOCUS_50890 5038584 5038195 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_50890 5038799 5039875 gene locus_tag LOCUS_50900 5038799 5039875 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50900 5040850 5039870 gene locus_tag LOCUS_50910 5040850 5039870 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416610.1 protein_id gnl|my_center|LOCUS_50910 5041011 5042117 gene locus_tag LOCUS_50920 5041011 5042117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50920 5042014 5042403 gene locus_tag LOCUS_50930 5042014 5042403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50930 5042818 5042414 gene locus_tag LOCUS_50940 5042818 5042414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 5043265 5042855 gene locus_tag LOCUS_50950 5043265 5042855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 5043940 5043374 gene locus_tag LOCUS_50960 5043940 5043374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 5045171 5043855 gene locus_tag LOCUS_50970 5045171 5043855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50970 5045512 5045168 gene locus_tag LOCUS_50980 5045512 5045168 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234794028.1 protein_id gnl|my_center|LOCUS_50980 5046252 5045509 gene locus_tag LOCUS_50990 5046252 5045509 CDS product DUF2652 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950737.1 protein_id gnl|my_center|LOCUS_50990 5046556 5046323 gene locus_tag LOCUS_51000 5046556 5046323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 5047084 5046686 gene locus_tag LOCUS_51010 5047084 5046686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 5047613 5048002 gene locus_tag LOCUS_51020 5047613 5048002 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_51020 5047917 5048483 gene locus_tag LOCUS_51030 5047917 5048483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 5049639 5048494 gene locus_tag LOCUS_51040 5049639 5048494 CDS product bifunctional 2-methylcitrate synthase/citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079735.1 protein_id gnl|my_center|LOCUS_51040 5050553 5049636 gene locus_tag LOCUS_51050 gene prpB 5050553 5049636 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731425.1 protein_id gnl|my_center|LOCUS_51050 5052052 5050553 gene locus_tag LOCUS_51060 5052052 5050553 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104208.1 protein_id gnl|my_center|LOCUS_51060 5052178 5053599 gene locus_tag LOCUS_51070 5052178 5053599 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731423.1 protein_id gnl|my_center|LOCUS_51070 5054582 5053650 gene locus_tag LOCUS_51080 5054582 5053650 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112994.1 protein_id gnl|my_center|LOCUS_51080 5054935 5054579 gene locus_tag LOCUS_51090 5054935 5054579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 5055009 5055398 gene locus_tag LOCUS_51100 5055009 5055398 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_51100 5055313 5055879 gene locus_tag LOCUS_51110 5055313 5055879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 5055914 5057419 gene locus_tag LOCUS_51120 5055914 5057419 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974287.1 protein_id gnl|my_center|LOCUS_51120 5057416 5057853 gene locus_tag LOCUS_51130 5057416 5057853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 5057992 5059134 gene locus_tag LOCUS_51140 5057992 5059134 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990855.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_51140 5060643 5059150 gene locus_tag LOCUS_51150 5060643 5059150 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_51150 5061084 5060662 gene locus_tag LOCUS_51160 5061084 5060662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 5061938 5061081 gene locus_tag LOCUS_51170 5061938 5061081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 5062988 5062296 gene locus_tag LOCUS_51180 5062988 5062296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_51180 5064160 5062985 gene locus_tag LOCUS_51190 5064160 5062985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 5066880 5064310 gene locus_tag LOCUS_51200 5066880 5064310 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_51200 5066866 5067162 gene locus_tag LOCUS_51210 5066866 5067162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 5067380 5067676 gene locus_tag LOCUS_51220 5067380 5067676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 5069232 5068420 gene locus_tag LOCUS_51230 gene istB 5069232 5068420 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_51230 5069408 5069229 gene locus_tag LOCUS_51240 5069408 5069229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 5069539 5069928 gene locus_tag LOCUS_51250 5069539 5069928 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_51250 5069843 5070409 gene locus_tag LOCUS_51260 5069843 5070409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 5071662 5070406 gene locus_tag LOCUS_51270 5071662 5070406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 5072148 5071927 gene locus_tag LOCUS_51280 5072148 5071927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 5072350 5072532 gene locus_tag LOCUS_51290 5072350 5072532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 5072529 5072744 gene locus_tag LOCUS_51300 5072529 5072744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 5072871 5073857 gene locus_tag LOCUS_51310 5072871 5073857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 5073904 5074257 gene locus_tag LOCUS_51320 5073904 5074257 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899954.1 protein_id gnl|my_center|LOCUS_51320 5074260 5074475 gene locus_tag LOCUS_51330 5074260 5074475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51330 5076176 5074803 gene locus_tag LOCUS_51340 5076176 5074803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 5076809 5076243 gene locus_tag LOCUS_51350 5076809 5076243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 5077113 5076724 gene locus_tag LOCUS_51360 5077113 5076724 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_51360 5078083 5077298 gene locus_tag LOCUS_51370 5078083 5077298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 5078852 5078100 gene locus_tag LOCUS_51380 5078852 5078100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51380 5079189 5079115 gene locus_tag LOCUS_t00410 5079189 5079115 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5079418 5080431 gene locus_tag LOCUS_51390 5079418 5080431 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_51390 5083563 5080576 gene locus_tag LOCUS_51400 5083563 5080576 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416795.1 protein_id gnl|my_center|LOCUS_51400 5084683 5083685 gene locus_tag LOCUS_51410 5084683 5083685 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907855.1 protein_id gnl|my_center|LOCUS_51410 5084598 5084789 gene locus_tag LOCUS_51420 5084598 5084789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 5084804 5086204 gene locus_tag LOCUS_51430 5084804 5086204 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416804.1 protein_id gnl|my_center|LOCUS_51430 5086243 5087082 gene locus_tag LOCUS_51440 5086243 5087082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416809.1 protein_id gnl|my_center|LOCUS_51440 5087275 5087102 gene locus_tag LOCUS_51450 5087275 5087102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416812.1 protein_id gnl|my_center|LOCUS_51450 5087467 5088810 gene locus_tag LOCUS_51460 5087467 5088810 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416815.1 protein_id gnl|my_center|LOCUS_51460 5089182 5088913 gene locus_tag LOCUS_51470 gene whiB7 5089182 5088913 CDS product transcriptional regulator WhiB7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899963.1 protein_id gnl|my_center|LOCUS_51470 5089476 5089324 gene locus_tag LOCUS_51480 5089476 5089324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 5091704 5089605 gene locus_tag LOCUS_51490 gene uvrD2 5091704 5089605 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416822.1 protein_id gnl|my_center|LOCUS_51490 5091879 5092133 gene locus_tag LOCUS_51500 gene mrx1 5091879 5092133 CDS product mycoredoxin Mrx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416827.1 protein_id gnl|my_center|LOCUS_51500 5092351 5093043 gene locus_tag LOCUS_51510 5092351 5093043 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404362.1 protein_id gnl|my_center|LOCUS_51510 5093973 5093047 gene locus_tag LOCUS_51520 gene nudC 5093973 5093047 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416829.1 protein_id gnl|my_center|LOCUS_51520 5095161 5094091 gene locus_tag LOCUS_51530 5095161 5094091 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416831.1 protein_id gnl|my_center|LOCUS_51530 5098528 5095223 gene locus_tag LOCUS_51540 gene adnB 5098528 5095223 CDS product ATP-dependent DNA helicase AdnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416833.1 protein_id gnl|my_center|LOCUS_51540 5101686 5098525 gene locus_tag LOCUS_51550 gene adnA 5101686 5098525 CDS product ATP-dependent DNA helicase AdnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003905015.1 protein_id gnl|my_center|LOCUS_51550 5102674 5101832 gene locus_tag LOCUS_51560 5102674 5101832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 5102844 5103065 gene locus_tag LOCUS_51570 5102844 5103065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907005.1 protein_id gnl|my_center|LOCUS_51570 5103130 5103915 gene locus_tag LOCUS_51580 gene lipV 5103130 5103915 CDS product lipase LipV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899968.1 protein_id gnl|my_center|LOCUS_51580 5103918 5104226 gene locus_tag LOCUS_51590 5103918 5104226 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416847.1 protein_id gnl|my_center|LOCUS_51590 5105077 5104223 gene locus_tag LOCUS_51600 5105077 5104223 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899969.1 protein_id gnl|my_center|LOCUS_51600 5105196 5105585 gene locus_tag LOCUS_51610 5105196 5105585 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_51610 5105500 5106066 gene locus_tag LOCUS_51620 5105500 5106066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 5107258 5106077 gene locus_tag LOCUS_51630 gene moeZ 5107258 5106077 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416855.1 protein_id gnl|my_center|LOCUS_51630 5108414 5107431 gene locus_tag LOCUS_51640 5108414 5107431 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907946.1 protein_id gnl|my_center|LOCUS_51640 5108642 5109325 gene locus_tag LOCUS_51650 5108642 5109325 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416861.1 protein_id gnl|my_center|LOCUS_51650 5109567 5109322 gene locus_tag LOCUS_51660 5109567 5109322 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416863.1 protein_id gnl|my_center|LOCUS_51660 5109618 5110562 gene locus_tag LOCUS_51670 5109618 5110562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 5111270 5110575 gene locus_tag LOCUS_51680 5111270 5110575 CDS product ferritin-like fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416873.1 protein_id gnl|my_center|LOCUS_51680 5111533 5113086 gene locus_tag LOCUS_51690 5111533 5113086 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416875.1 protein_id gnl|my_center|LOCUS_51690 5113101 5114315 gene locus_tag LOCUS_51700 5113101 5114315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416876.1 protein_id gnl|my_center|LOCUS_51700 5115138 5114338 gene locus_tag LOCUS_51710 5115138 5114338 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901572.1 protein_id gnl|my_center|LOCUS_51710 5115215 5115814 gene locus_tag LOCUS_51720 5115215 5115814 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416878.1 protein_id gnl|my_center|LOCUS_51720 5115811 5116911 gene locus_tag LOCUS_51730 5115811 5116911 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416879.1 protein_id gnl|my_center|LOCUS_51730 5116908 5117390 gene locus_tag LOCUS_51740 5116908 5117390 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015288476.1 protein_id gnl|my_center|LOCUS_51740 5117734 5117342 gene locus_tag LOCUS_51750 5117734 5117342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416881.1 protein_id gnl|my_center|LOCUS_51750 5117898 5118863 gene locus_tag LOCUS_51760 5117898 5118863 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416883.1 protein_id gnl|my_center|LOCUS_51760 5119148 5119402 gene locus_tag LOCUS_51770 gene whiB1 5119148 5119402 CDS product transcriptional regulator WhiB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416884.1 protein_id gnl|my_center|LOCUS_51770 5120964 5119465 gene locus_tag LOCUS_51780 5120964 5119465 CDS product histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416886.1 protein_id gnl|my_center|LOCUS_51780 5121397 5121014 gene locus_tag LOCUS_51790 5121397 5121014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 5121896 5121591 gene locus_tag LOCUS_51800 gene rsrA 5121896 5121591 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416891.1 protein_id gnl|my_center|LOCUS_51800 5122660 5121893 gene locus_tag LOCUS_51810 gene sigH 5122660 5121893 CDS product sigma-70 family RNA polymerase sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416897.1 protein_id gnl|my_center|LOCUS_51810 5122859 5123707 gene locus_tag LOCUS_51820 5122859 5123707 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416899.1 protein_id gnl|my_center|LOCUS_51820 5123719 5124174 gene locus_tag LOCUS_51830 5123719 5124174 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180917183.1 protein_id gnl|my_center|LOCUS_51830 5125435 5124200 gene locus_tag LOCUS_51840 5125435 5124200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 5126327 5125821 gene locus_tag LOCUS_51850 5126327 5125821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51850 5126852 5126505 gene locus_tag LOCUS_51860 5126852 5126505 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891413.1 protein_id gnl|my_center|LOCUS_51860 5127196 5126849 gene locus_tag LOCUS_51870 5127196 5126849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 5128368 5127181 gene locus_tag LOCUS_51880 5128368 5127181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51880 5129043 5128447 gene locus_tag LOCUS_51890 5129043 5128447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 5129943 5129266 gene locus_tag LOCUS_51900 5129943 5129266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726637.1 protein_id gnl|my_center|LOCUS_51900 5130276 5129962 gene locus_tag LOCUS_51910 5130276 5129962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 5131650 5130352 gene locus_tag LOCUS_51920 5131650 5130352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 5135167 5132438 gene locus_tag LOCUS_51930 5135167 5132438 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 protein_id gnl|my_center|LOCUS_51930 5135782 5135958 gene locus_tag LOCUS_51940 5135782 5135958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 5137259 5135979 gene locus_tag LOCUS_51950 5137259 5135979 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226953.1 protein_id gnl|my_center|LOCUS_51950 5138160 5137324 gene locus_tag LOCUS_51960 5138160 5137324 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092523.1 protein_id gnl|my_center|LOCUS_51960 5139079 5138306 gene locus_tag LOCUS_51970 5139079 5138306 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416907.1 protein_id gnl|my_center|LOCUS_51970 5139179 5140429 gene locus_tag LOCUS_51980 gene aroA 5139179 5140429 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416914.1 protein_id gnl|my_center|LOCUS_51980 5140426 5141418 gene locus_tag LOCUS_51990 gene rsgA 5140426 5141418 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416916.1 protein_id gnl|my_center|LOCUS_51990 5141887 5141405 gene locus_tag LOCUS_52000 5141887 5141405 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728757.1 protein_id gnl|my_center|LOCUS_52000 5141966 5143147 gene locus_tag LOCUS_52010 5141966 5143147 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894393.1 protein_id gnl|my_center|LOCUS_52010 5144471 5143185 gene locus_tag LOCUS_52020 gene desA3 5144471 5143185 CDS product NADPH-dependent stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416919.1 protein_id gnl|my_center|LOCUS_52020 5145990 5144701 gene locus_tag LOCUS_52030 gene desA3 5145990 5144701 CDS product NADPH-dependent stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416919.1 protein_id gnl|my_center|LOCUS_52030 5147230 5146076 gene locus_tag LOCUS_52040 5147230 5146076 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416922.1 protein_id gnl|my_center|LOCUS_52040 5147872 5147372 gene locus_tag LOCUS_52050 5147872 5147372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416925.1 protein_id gnl|my_center|LOCUS_52050 5148810 5147938 gene locus_tag LOCUS_52060 gene ppk2 5148810 5147938 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416928.1 protein_id gnl|my_center|LOCUS_52060 5150271 5148853 gene locus_tag LOCUS_52070 5150271 5148853 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416930.1 protein_id gnl|my_center|LOCUS_52070 5150478 5151017 gene locus_tag LOCUS_52080 5150478 5151017 CDS product Rv3235 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416932.1 protein_id gnl|my_center|LOCUS_52080 5152180 5151035 gene locus_tag LOCUS_52090 5152180 5151035 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416933.1 protein_id gnl|my_center|LOCUS_52090 5152667 5152185 gene locus_tag LOCUS_52100 5152667 5152185 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907928.1 protein_id gnl|my_center|LOCUS_52100 5153331 5152777 gene locus_tag LOCUS_52110 5153331 5152777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 5156495 5153388 gene locus_tag LOCUS_52120 5156495 5153388 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900661.1 protein_id gnl|my_center|LOCUS_52120 5159396 5156580 gene locus_tag LOCUS_52130 gene secA 5159396 5156580 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901576.1 protein_id gnl|my_center|LOCUS_52130 5160218 5159529 gene locus_tag LOCUS_52140 gene raiA 5160218 5159529 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901577.1 protein_id gnl|my_center|LOCUS_52140 5161195 5160560 gene locus_tag LOCUS_52150 5161195 5160560 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054881065.1 protein_id gnl|my_center|LOCUS_52150 5162068 5161238 gene locus_tag LOCUS_52160 5162068 5161238 CDS product LmeA family phospholipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416966.1 protein_id gnl|my_center|LOCUS_52160 5163919 5162129 gene locus_tag LOCUS_52170 gene lpqB 5163919 5162129 CDS product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618314.1 protein_id gnl|my_center|LOCUS_52170 5165532 5163907 gene locus_tag LOCUS_52180 gene mtrB 5165532 5163907 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416988.1 protein_id gnl|my_center|LOCUS_52180 5166322 5165636 gene locus_tag LOCUS_52190 gene mtrA 5166322 5165636 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899985.1 protein_id gnl|my_center|LOCUS_52190 5167045 5166377 gene locus_tag LOCUS_52200 5167045 5166377 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417036.1 protein_id gnl|my_center|LOCUS_52200 5169193 5167109 gene locus_tag LOCUS_52210 5169193 5167109 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904469.1 protein_id gnl|my_center|LOCUS_52210 5170949 5169594 gene locus_tag LOCUS_52220 5170949 5169594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52220 5171279 5171004 gene locus_tag LOCUS_52230 5171279 5171004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52230 5173303 5171825 gene locus_tag LOCUS_52240 gene ahcY 5173303 5171825 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417039.1 protein_id gnl|my_center|LOCUS_52240 5174013 5173408 gene locus_tag LOCUS_52250 5174013 5173408 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417042.1 protein_id gnl|my_center|LOCUS_52250 5174238 5174056 gene locus_tag LOCUS_52260 5174238 5174056 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056265.1 protein_id gnl|my_center|LOCUS_52260 5174409 5174239 gene locus_tag LOCUS_52270 5174409 5174239 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417045.1 protein_id gnl|my_center|LOCUS_52270 5175659 5174409 gene locus_tag LOCUS_52280 5175659 5174409 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417047.1 protein_id gnl|my_center|LOCUS_52280 5177254 5175770 gene locus_tag LOCUS_52290 5177254 5175770 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417049.1 protein_id gnl|my_center|LOCUS_52290 5177311 5178738 gene locus_tag LOCUS_52300 5177311 5178738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899988.1 protein_id gnl|my_center|LOCUS_52300 5178840 5179253 gene locus_tag LOCUS_52310 5178840 5179253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52310 5179279 5180157 gene locus_tag LOCUS_52320 5179279 5180157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52320 5181361 5180135 gene locus_tag LOCUS_52330 gene manA 5181361 5180135 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417054.1 protein_id gnl|my_center|LOCUS_52330 5182478 5181369 gene locus_tag LOCUS_52340 5182478 5181369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907917.1 protein_id gnl|my_center|LOCUS_52340 5183875 5182475 gene locus_tag LOCUS_52350 5183875 5182475 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901581.1 protein_id gnl|my_center|LOCUS_52350 5184118 5184528 gene locus_tag LOCUS_52360 5184118 5184528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 5184642 5185064 gene locus_tag LOCUS_52370 5184642 5185064 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417076.1 protein_id gnl|my_center|LOCUS_52370 5185513 5185130 gene locus_tag LOCUS_52380 5185513 5185130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 5185895 5186884 gene locus_tag LOCUS_52390 gene cofD 5185895 5186884 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417087.1 protein_id gnl|my_center|LOCUS_52390 5186881 5188245 gene locus_tag LOCUS_52400 5186881 5188245 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900663.1 protein_id gnl|my_center|LOCUS_52400 5188274 5189860 gene locus_tag LOCUS_52410 5188274 5189860 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417095.1 protein_id gnl|my_center|LOCUS_52410 5189857 5190405 gene locus_tag LOCUS_52420 5189857 5190405 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727936.1 protein_id gnl|my_center|LOCUS_52420 5191510 5190434 gene locus_tag LOCUS_52430 5191510 5190434 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907907.1 protein_id gnl|my_center|LOCUS_52430 5192396 5191512 gene locus_tag LOCUS_52440 5192396 5191512 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907906.1 protein_id gnl|my_center|LOCUS_52440 5193255 5192389 gene locus_tag LOCUS_52450 gene rfbD 5193255 5192389 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417101.1 protein_id gnl|my_center|LOCUS_52450 5193383 5194840 gene locus_tag LOCUS_52460 gene lcp1 5193383 5194840 CDS product phosphotransferase Lcp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417107.1 protein_id gnl|my_center|LOCUS_52460 5194828 5195550 gene locus_tag LOCUS_52470 5194828 5195550 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417112.1 protein_id gnl|my_center|LOCUS_52470 5195666 5195944 gene locus_tag LOCUS_52480 5195666 5195944 CDS product DUF1490 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417115.1 protein_id gnl|my_center|LOCUS_52480 5195954 5198152 gene locus_tag LOCUS_52490 gene ctpC 5195954 5198152 CDS product manganese-exporting P-type ATPase CtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899995.1 protein_id gnl|my_center|LOCUS_52490 5198915 5198196 gene locus_tag LOCUS_52500 5198915 5198196 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417119.1 protein_id gnl|my_center|LOCUS_52500 5199251 5198976 gene locus_tag LOCUS_52510 5199251 5198976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52510 5199686 5199270 gene locus_tag LOCUS_52520 5199686 5199270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52520 5200682 5199738 gene locus_tag LOCUS_52530 5200682 5199738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52530 5200800 5201411 gene locus_tag LOCUS_52540 5200800 5201411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 5201588 5202403 gene locus_tag LOCUS_52550 5201588 5202403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52550 5202494 5202775 gene locus_tag LOCUS_52560 5202494 5202775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52560 5203052 5205298 gene locus_tag LOCUS_52570 5203052 5205298 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417121.1 protein_id gnl|my_center|LOCUS_52570 5205521 5205378 gene locus_tag LOCUS_52580 5205521 5205378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_52580 5207106 5205937 gene locus_tag LOCUS_52590 5207106 5205937 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893212.1 protein_id gnl|my_center|LOCUS_52590 5207646 5207131 gene locus_tag LOCUS_52600 gene purE 5207646 5207131 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417123.1 protein_id gnl|my_center|LOCUS_52600 5208814 5207639 gene locus_tag LOCUS_52610 5208814 5207639 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417126.1 protein_id gnl|my_center|LOCUS_52610 5208953 5209636 gene locus_tag LOCUS_52620 5208953 5209636 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899998.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_52620 5210172 5209591 gene locus_tag LOCUS_52630 5210172 5209591 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417130.1 protein_id gnl|my_center|LOCUS_52630 5210972 5210172 gene locus_tag LOCUS_52640 5210972 5210172 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172591953.1 protein_id gnl|my_center|LOCUS_52640 5211153 5212793 gene locus_tag LOCUS_52650 5211153 5212793 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417136.1 protein_id gnl|my_center|LOCUS_52650 5212790 5213092 gene locus_tag LOCUS_52660 5212790 5213092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 5213089 5213739 gene locus_tag LOCUS_52670 5213089 5213739 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950862.1 protein_id gnl|my_center|LOCUS_52670 5213779 5214684 gene locus_tag LOCUS_52680 5213779 5214684 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417149.1 protein_id gnl|my_center|LOCUS_52680 5214687 5215100 gene locus_tag LOCUS_52690 5214687 5215100 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417152.1 protein_id gnl|my_center|LOCUS_52690 5215211 5217004 gene locus_tag LOCUS_52700 5215211 5217004 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417156.1 protein_id gnl|my_center|LOCUS_52700 5222368 5217026 gene locus_tag LOCUS_52710 5222368 5217026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52710 5223955 5222399 gene locus_tag LOCUS_52720 5223955 5222399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_52720 5225531 5223861 gene locus_tag LOCUS_52730 5225531 5223861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52730 5225891 5226205 gene locus_tag LOCUS_52740 5225891 5226205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 5227126 5227695 gene locus_tag LOCUS_52750 5227126 5227695 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730835.1 protein_id gnl|my_center|LOCUS_52750 5227966 5227757 gene locus_tag LOCUS_52760 5227966 5227757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52760 5228545 5228006 gene locus_tag LOCUS_52770 5228545 5228006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52770 5228979 5228542 gene locus_tag LOCUS_52780 gene rsbW 5228979 5228542 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417160.1 protein_id gnl|my_center|LOCUS_52780 5229784 5229473 gene locus_tag LOCUS_52790 5229784 5229473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52790 5230273 5229896 gene locus_tag LOCUS_52800 5230273 5229896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417165.1 protein_id gnl|my_center|LOCUS_52800 5231636 5230362 gene locus_tag LOCUS_52810 gene lat 5231636 5230362 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900004.1 protein_id gnl|my_center|LOCUS_52810 5232209 5231757 gene locus_tag LOCUS_52820 gene lrpA 5232209 5231757 CDS product transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417179.1 protein_id gnl|my_center|LOCUS_52820 5232243 5233514 gene locus_tag LOCUS_52830 5232243 5233514 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417184.1 protein_id gnl|my_center|LOCUS_52830 5233592 5235106 gene locus_tag LOCUS_52840 5233592 5235106 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417187.1 protein_id gnl|my_center|LOCUS_52840 5235137 5235829 gene locus_tag LOCUS_52850 5235137 5235829 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907890.1 protein_id gnl|my_center|LOCUS_52850 5235862 5240481 gene locus_tag LOCUS_52860 5235862 5240481 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912132.1 protein_id gnl|my_center|LOCUS_52860 5240485 5241249 gene locus_tag LOCUS_52870 gene nei2 5240485 5241249 CDS product endonuclease VIII Nei2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900006.1 protein_id gnl|my_center|LOCUS_52870 5242181 5241264 gene locus_tag LOCUS_52880 5242181 5241264 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_52880 5243325 5242234 gene locus_tag LOCUS_52890 5243325 5242234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 5244526 5243444 gene locus_tag LOCUS_52900 gene pstS 5244526 5243444 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908715.1 protein_id gnl|my_center|LOCUS_52900 5244823 5245143 gene locus_tag LOCUS_52910 5244823 5245143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 5248068 5245165 gene locus_tag LOCUS_52920 gene atsB 5248068 5245165 CDS product arylsulfatase AtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417213.1 protein_id gnl|my_center|LOCUS_52920 5248956 5248090 gene locus_tag LOCUS_52930 5248956 5248090 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950868.1 protein_id gnl|my_center|LOCUS_52930 5249020 5249409 gene locus_tag LOCUS_52940 5249020 5249409 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_52940 5249324 5249890 gene locus_tag LOCUS_52950 5249324 5249890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 5250336 5250094 gene locus_tag LOCUS_52960 5250336 5250094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52960 5251092 5250343 gene locus_tag LOCUS_52970 5251092 5250343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52970 5251745 5251134 gene locus_tag LOCUS_52980 gene phoU 5251745 5251134 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417216.1 protein_id gnl|my_center|LOCUS_52980 5251804 5252193 gene locus_tag LOCUS_52990 5251804 5252193 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_52990 5252108 5252674 gene locus_tag LOCUS_53000 5252108 5252674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53000 5252726 5253628 gene locus_tag LOCUS_53010 5252726 5253628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53010 5254524 5254183 gene locus_tag LOCUS_53020 5254524 5254183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 5255694 5255200 gene locus_tag LOCUS_53030 5255694 5255200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 5256301 5255912 gene locus_tag LOCUS_53040 5256301 5255912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 5256303 5257202 gene locus_tag LOCUS_53050 5256303 5257202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_53050 5257424 5257972 gene locus_tag LOCUS_53060 5257424 5257972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 5259509 5257980 gene locus_tag LOCUS_53070 5259509 5257980 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_53070 5259736 5259918 gene locus_tag LOCUS_53080 5259736 5259918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 5261689 5259932 gene locus_tag LOCUS_53090 5261689 5259932 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417217.1 protein_id gnl|my_center|LOCUS_53090 5263186 5261774 gene locus_tag LOCUS_53100 5263186 5261774 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936266.1 protein_id gnl|my_center|LOCUS_53100 5263328 5263807 gene locus_tag LOCUS_53110 5263328 5263807 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417219.1 protein_id gnl|my_center|LOCUS_53110 5264786 5263899 gene locus_tag LOCUS_53120 5264786 5263899 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727857.1 protein_id gnl|my_center|LOCUS_53120 5266067 5264898 gene locus_tag LOCUS_53130 5266067 5264898 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417220.1 protein_id gnl|my_center|LOCUS_53130 5267245 5266064 gene locus_tag LOCUS_53140 5267245 5266064 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900009.1 protein_id gnl|my_center|LOCUS_53140 5267328 5268149 gene locus_tag LOCUS_53150 5267328 5268149 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417233.1 protein_id gnl|my_center|LOCUS_53150 5268139 5269719 gene locus_tag LOCUS_53160 5268139 5269719 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323714.1 protein_id gnl|my_center|LOCUS_53160 5270344 5269721 gene locus_tag LOCUS_53170 gene upp 5270344 5269721 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417245.1 protein_id gnl|my_center|LOCUS_53170 5270484 5271323 gene locus_tag LOCUS_53180 gene sapM 5270484 5271323 CDS product phosphatidylinositol-3-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417249.1 protein_id gnl|my_center|LOCUS_53180 5271372 5272679 gene locus_tag LOCUS_53190 5271372 5272679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417251.1 protein_id gnl|my_center|LOCUS_53190 5273594 5272698 gene locus_tag LOCUS_53200 5273594 5272698 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 protein_id gnl|my_center|LOCUS_53200 5273664 5275163 gene locus_tag LOCUS_53210 5273664 5275163 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906341.1 protein_id gnl|my_center|LOCUS_53210 5275272 5277086 gene locus_tag LOCUS_53220 5275272 5277086 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730746.1 protein_id gnl|my_center|LOCUS_53220 5278644 5277685 gene locus_tag LOCUS_53230 gene alc 5278644 5277685 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730744.1 protein_id gnl|my_center|LOCUS_53230 5279798 5278641 gene locus_tag LOCUS_53240 5279798 5278641 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730743.1 protein_id gnl|my_center|LOCUS_53240 5280180 5279983 gene locus_tag LOCUS_53250 5280180 5279983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 5280074 5281168 gene locus_tag LOCUS_53260 5280074 5281168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 5281198 5281587 gene locus_tag LOCUS_53270 5281198 5281587 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_53270 5281502 5282068 gene locus_tag LOCUS_53280 5281502 5282068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 5283078 5282107 gene locus_tag LOCUS_53290 5283078 5282107 CDS product IS481-like element IS1649 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026842.1 protein_id gnl|my_center|LOCUS_53290 5283986 5283186 gene locus_tag LOCUS_53300 5283986 5283186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 5284690 5283986 gene locus_tag LOCUS_53310 5284690 5283986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 5284805 5285452 gene locus_tag LOCUS_53320 gene orn 5284805 5285452 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899361.1 protein_id gnl|my_center|LOCUS_53320 5285503 5285578 gene locus_tag LOCUS_t00420 5285503 5285578 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5286340 5285567 gene locus_tag LOCUS_53330 5286340 5285567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 5286691 5286473 gene locus_tag LOCUS_53340 5286691 5286473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 5287072 5286713 gene locus_tag LOCUS_53350 5287072 5286713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 5288271 5287237 gene locus_tag LOCUS_53360 5288271 5287237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 5288499 5288284 gene locus_tag LOCUS_53370 5288499 5288284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 5288696 5289631 gene locus_tag LOCUS_53380 5288696 5289631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53380 5289689 5290009 gene locus_tag LOCUS_53390 5289689 5290009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53390 5290006 5290794 gene locus_tag LOCUS_53400 5290006 5290794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53400 5290849 5291061 gene locus_tag LOCUS_53410 5290849 5291061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53410 5291054 5292091 gene locus_tag LOCUS_53420 5291054 5292091 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066067.1 protein_id gnl|my_center|LOCUS_53420 5292106 5293221 gene locus_tag LOCUS_53430 5292106 5293221 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113394.1 protein_id gnl|my_center|LOCUS_53430 5293221 5294162 gene locus_tag LOCUS_53440 5293221 5294162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53440 5294163 5294426 gene locus_tag LOCUS_53450 5294163 5294426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53450 5294423 5295673 gene locus_tag LOCUS_53460 5294423 5295673 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073462.1 protein_id gnl|my_center|LOCUS_53460 5295701 5296084 gene locus_tag LOCUS_53470 5295701 5296084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 5296017 5296394 gene locus_tag LOCUS_53480 5296017 5296394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53480 5296413 5297192 gene locus_tag LOCUS_53490 5296413 5297192 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104495.1 protein_id gnl|my_center|LOCUS_53490 5298393 5297194 gene locus_tag LOCUS_53500 gene ldtMt2 5298393 5297194 CDS product L,D-transpeptidase LdtMt2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412938.1 protein_id gnl|my_center|LOCUS_53500 5298599 5298672 gene locus_tag LOCUS_t00430 5298599 5298672 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5299255 5298674 gene locus_tag LOCUS_53510 5299255 5298674 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974031.1 protein_id gnl|my_center|LOCUS_53510 5299331 5300215 gene locus_tag LOCUS_53520 5299331 5300215 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211155436.1 protein_id gnl|my_center|LOCUS_53520 5300327 5300791 gene locus_tag LOCUS_53530 5300327 5300791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 5301130 5300903 gene locus_tag LOCUS_53540 5301130 5300903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 5301238 5301711 gene locus_tag LOCUS_53550 gene bcp 5301238 5301711 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412944.1 protein_id gnl|my_center|LOCUS_53550 5302768 5301791 gene locus_tag LOCUS_53560 gene bioH 5302768 5301791 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035639.1 protein_id gnl|my_center|LOCUS_53560 5304183 5302858 gene locus_tag LOCUS_53570 5304183 5302858 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412946.1 protein_id gnl|my_center|LOCUS_53570 5304067 5305368 gene locus_tag LOCUS_53580 5304067 5305368 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728916.1 protein_id gnl|my_center|LOCUS_53580 5305365 5306021 gene locus_tag LOCUS_53590 5305365 5306021 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877615.1 protein_id gnl|my_center|LOCUS_53590 5306289 5307944 gene locus_tag LOCUS_53600 5306289 5307944 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728918.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_53600 5308410 5308018 gene locus_tag LOCUS_53610 5308410 5308018 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412952.1 protein_id gnl|my_center|LOCUS_53610 5317657 5308439 gene locus_tag LOCUS_53620 5317657 5308439 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908189.1 protein_id gnl|my_center|LOCUS_53620 5318891 5318169 gene locus_tag LOCUS_53630 5318891 5318169 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412957.1 protein_id gnl|my_center|LOCUS_53630 5319168 5319383 gene locus_tag LOCUS_53640 5319168 5319383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 5319396 5320430 gene locus_tag LOCUS_53650 5319396 5320430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 5321345 5320632 gene locus_tag LOCUS_53660 5321345 5320632 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893583.1 protein_id gnl|my_center|LOCUS_53660 5322552 5321359 gene locus_tag LOCUS_53670 5322552 5321359 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728223.1 protein_id gnl|my_center|LOCUS_53670 5323778 5322549 gene locus_tag LOCUS_53680 5323778 5322549 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728360.1 protein_id gnl|my_center|LOCUS_53680 5325004 5323781 gene locus_tag LOCUS_53690 5325004 5323781 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877333.1 protein_id gnl|my_center|LOCUS_53690 5325747 5325136 gene locus_tag LOCUS_53700 gene fabG 5325747 5325136 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406963.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53700 5325863 5327026 gene locus_tag LOCUS_53710 5325863 5327026 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728221.1 protein_id gnl|my_center|LOCUS_53710 5328096 5327029 gene locus_tag LOCUS_53720 5328096 5327029 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 protein_id gnl|my_center|LOCUS_53720 5329889 5328150 gene locus_tag LOCUS_53730 gene irtB 5329889 5328150 CDS product iron ABC transporter ATP-binding protein/permease IrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900322.1 protein_id gnl|my_center|LOCUS_53730 5332435 5329886 gene locus_tag LOCUS_53740 gene irtA 5332435 5329886 CDS product iron ABC transporter ATP-binding protein/permease IrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406958.1 protein_id gnl|my_center|LOCUS_53740 5333097 5333012 gene locus_tag LOCUS_t00440 5333097 5333012 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5333247 5333639 gene locus_tag LOCUS_53750 5333247 5333639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898833.1 protein_id gnl|my_center|LOCUS_53750 5333636 5333998 gene locus_tag LOCUS_53760 5333636 5333998 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406937.1 protein_id gnl|my_center|LOCUS_53760 5334634 5334020 gene locus_tag LOCUS_53770 gene rdgB 5334634 5334020 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406931.1 protein_id gnl|my_center|LOCUS_53770 5335329 5334787 gene locus_tag LOCUS_53780 5335329 5334787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 5336389 5335610 gene locus_tag LOCUS_53790 gene rph 5336389 5335610 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406926.1 protein_id gnl|my_center|LOCUS_53790 5337264 5336491 gene locus_tag LOCUS_53800 5337264 5336491 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406922.1 protein_id gnl|my_center|LOCUS_53800 5337443 5337264 gene locus_tag LOCUS_53810 5337443 5337264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 5337642 5338367 gene locus_tag LOCUS_53820 5337642 5338367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624115.1 protein_id gnl|my_center|LOCUS_53820 5341006 5338679 gene locus_tag LOCUS_53830 5341006 5338679 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510635.1 protein_id gnl|my_center|LOCUS_53830 5341145 5341633 gene locus_tag LOCUS_53840 5341145 5341633 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728364.1 protein_id gnl|my_center|LOCUS_53840 5341998 5342498 gene locus_tag LOCUS_53850 5341998 5342498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53850 5342934 5342527 gene locus_tag LOCUS_53860 5342934 5342527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 5343258 5344025 gene locus_tag LOCUS_53870 5343258 5344025 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167316264.1 protein_id gnl|my_center|LOCUS_53870 5344022 5344150 gene locus_tag LOCUS_53880 5344022 5344150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 5344151 5344876 gene locus_tag LOCUS_53890 5344151 5344876 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726865.1 protein_id gnl|my_center|LOCUS_53890 5344881 5346341 gene locus_tag LOCUS_53900 5344881 5346341 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726866.1 protein_id gnl|my_center|LOCUS_53900 5346421 5347071 gene locus_tag LOCUS_53910 5346421 5347071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53910 5347105 5347452 gene locus_tag LOCUS_53920 5347105 5347452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53920 5347449 5348765 gene locus_tag LOCUS_53930 5347449 5348765 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876746.1 protein_id gnl|my_center|LOCUS_53930 5348762 5350093 gene locus_tag LOCUS_53940 5348762 5350093 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899106.1 protein_id gnl|my_center|LOCUS_53940 5350090 5351235 gene locus_tag LOCUS_53950 5350090 5351235 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726870.1 protein_id gnl|my_center|LOCUS_53950 5351237 5352718 gene locus_tag LOCUS_53960 5351237 5352718 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726871.1 protein_id gnl|my_center|LOCUS_53960 5352685 5353428 gene locus_tag LOCUS_53970 5352685 5353428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 5354286 5353471 gene locus_tag LOCUS_53980 gene murI 5354286 5353471 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406919.1 protein_id gnl|my_center|LOCUS_53980 5354951 5354283 gene locus_tag LOCUS_53990 5354951 5354283 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898831.1 protein_id gnl|my_center|LOCUS_53990 5355404 5355132 gene locus_tag LOCUS_54000 gene cysO 5355404 5355132 CDS product sulfur carrier protein CysO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406910.1 protein_id gnl|my_center|LOCUS_54000 5355839 5355426 gene locus_tag LOCUS_54010 gene mec 5355839 5355426 CDS product CysO-cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898830.1 protein_id gnl|my_center|LOCUS_54010 5356929 5355841 gene locus_tag LOCUS_54020 5356929 5355841 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406908.1 protein_id gnl|my_center|LOCUS_54020 5357513 5356926 gene locus_tag LOCUS_54030 5357513 5356926 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898829.1 protein_id gnl|my_center|LOCUS_54030 5357843 5357538 gene locus_tag LOCUS_54040 gene clpS 5357843 5357538 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406906.1 protein_id gnl|my_center|LOCUS_54040 5357967 5358182 gene locus_tag LOCUS_54050 5357967 5358182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 5358856 5358290 gene locus_tag LOCUS_54060 5358856 5358290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 5359160 5358771 gene locus_tag LOCUS_54070 5359160 5358771 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_54070 5359231 5360163 gene locus_tag LOCUS_54080 5359231 5360163 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911958.1 protein_id gnl|my_center|LOCUS_54080 5360286 5361341 gene locus_tag LOCUS_54090 5360286 5361341 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911483.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_54090 5361638 5363659 gene locus_tag LOCUS_54100 gene dinG 5361638 5363659 CDS product ATP-dependent helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898827.1 protein_id gnl|my_center|LOCUS_54100 5366259 5363656 gene locus_tag LOCUS_54110 5366259 5363656 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901135.1 protein_id gnl|my_center|LOCUS_54110 5366518 5368524 gene locus_tag LOCUS_54120 gene glgE 5366518 5368524 CDS product alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406897.1 protein_id gnl|my_center|LOCUS_54120 5368531 5370726 gene locus_tag LOCUS_54130 gene glgB 5368531 5370726 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406892.1 protein_id gnl|my_center|LOCUS_54130 5371303 5370737 gene locus_tag LOCUS_54140 5371303 5370737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 5371607 5371218 gene locus_tag LOCUS_54150 5371607 5371218 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_54150 5372642 5371728 gene locus_tag LOCUS_54160 5372642 5371728 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406887.1 protein_id gnl|my_center|LOCUS_54160 5374000 5372819 gene locus_tag LOCUS_54170 5374000 5372819 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898824.1 protein_id gnl|my_center|LOCUS_54170 5374083 5374550 gene locus_tag LOCUS_54180 gene mce 5374083 5374550 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406879.1 protein_id gnl|my_center|LOCUS_54180 5375534 5374863 gene locus_tag LOCUS_54190 gene nucS 5375534 5374863 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886111.1 protein_id gnl|my_center|LOCUS_54190 5375580 5377220 gene locus_tag LOCUS_54200 5375580 5377220 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406864.1 protein_id gnl|my_center|LOCUS_54200 5377352 5378971 gene locus_tag LOCUS_54210 5377352 5378971 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406864.1 protein_id gnl|my_center|LOCUS_54210 5379054 5380541 gene locus_tag LOCUS_54220 gene alkA 5379054 5380541 CDS product bifunctional regulatory protein/DNA repair enzyme AlkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900313.1 protein_id gnl|my_center|LOCUS_54220 5380538 5381056 gene locus_tag LOCUS_54230 gene ogt 5380538 5381056 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406857.1 protein_id gnl|my_center|LOCUS_54230 5381209 5381134 gene locus_tag LOCUS_r00010 5381209 5381134 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 63 percent of the 5S ribosomal RNA 5384405 5381309 gene locus_tag LOCUS_r00020 5384405 5381309 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5386211 5384684 gene locus_tag LOCUS_r00030 5386211 5384684 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5387760 5386507 gene locus_tag LOCUS_54240 gene murA 5387760 5386507 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406845.1 protein_id gnl|my_center|LOCUS_54240 5387831 5388424 gene locus_tag LOCUS_54250 5387831 5388424 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406839.1 protein_id gnl|my_center|LOCUS_54250 5388946 5388515 gene locus_tag LOCUS_54260 5388946 5388515 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406722.1 protein_id gnl|my_center|LOCUS_54260 5389331 5388966 gene locus_tag LOCUS_54270 5389331 5388966 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406708.1 protein_id gnl|my_center|LOCUS_54270 5390819 5389368 gene locus_tag LOCUS_54280 gene atpD 5390819 5389368 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406701.1 protein_id gnl|my_center|LOCUS_54280 5391762 5390848 gene locus_tag LOCUS_54290 5391762 5390848 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898819.1 protein_id gnl|my_center|LOCUS_54290 5393430 5391781 gene locus_tag LOCUS_54300 gene atpA 5393430 5391781 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406699.1 protein_id gnl|my_center|LOCUS_54300 5394829 5393492 gene locus_tag LOCUS_54310 5394829 5393492 CDS product F0F1 ATP synthase subunit B/delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406697.1 protein_id gnl|my_center|LOCUS_54310 5395348 5394836 gene locus_tag LOCUS_54320 5395348 5394836 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898818.1 protein_id gnl|my_center|LOCUS_54320 5395635 5395390 gene locus_tag LOCUS_54330 5395635 5395390 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406686.1 protein_id gnl|my_center|LOCUS_54330 5396478 5395726 gene locus_tag LOCUS_54340 gene atpB 5396478 5395726 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406681.1 protein_id gnl|my_center|LOCUS_54340 5396941 5396540 gene locus_tag LOCUS_54350 5396941 5396540 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406680.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_54350 5398402 5397221 gene locus_tag LOCUS_54360 gene rfe 5398402 5397221 CDS product UDP-N-acetylglucosamine--decaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898816.1 protein_id gnl|my_center|LOCUS_54360 5399131 5398481 gene locus_tag LOCUS_54370 5399131 5398481 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898815.1 protein_id gnl|my_center|LOCUS_54370 5400032 5399184 gene locus_tag LOCUS_54380 5400032 5399184 CDS product HemK/PrmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911420.1 protein_id gnl|my_center|LOCUS_54380 5401102 5400029 gene locus_tag LOCUS_54390 gene prfA 5401102 5400029 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406670.1 protein_id gnl|my_center|LOCUS_54390 5401435 5401190 gene locus_tag LOCUS_54400 gene rpmE 5401435 5401190 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406668.1 protein_id gnl|my_center|LOCUS_54400 5403492 5401627 gene locus_tag LOCUS_54410 gene rho 5403492 5401627 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898814.1 protein_id gnl|my_center|LOCUS_54410 5403843 5404058 gene locus_tag LOCUS_54420 5403843 5404058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 5404071 5405105 gene locus_tag LOCUS_54430 5404071 5405105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 5406146 5405202 gene locus_tag LOCUS_54440 gene thrB 5406146 5405202 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618321.1 protein_id gnl|my_center|LOCUS_54440 5407284 5406202 gene locus_tag LOCUS_54450 gene thrC 5407284 5406202 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406652.1 protein_id gnl|my_center|LOCUS_54450 5408606 5407281 gene locus_tag LOCUS_54460 5408606 5407281 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406648.1 protein_id gnl|my_center|LOCUS_54460 5410028 5408610 gene locus_tag LOCUS_54470 gene lysA 5410028 5408610 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406632.1 protein_id gnl|my_center|LOCUS_54470 5411677 5410025 gene locus_tag LOCUS_54480 gene argS 5411677 5410025 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406630.1 protein_id gnl|my_center|LOCUS_54480 5411812 5411887 gene locus_tag LOCUS_t00450 5411812 5411887 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5411947 5412135 gene locus_tag LOCUS_54490 5411947 5412135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 5412777 5413067 gene locus_tag LOCUS_54500 5412777 5413067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410695.1 protein_id gnl|my_center|LOCUS_54500 5413644 5413078 gene locus_tag LOCUS_54510 5413644 5413078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_54510 5413948 5413559 gene locus_tag LOCUS_54520 5413948 5413559 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_54520 5414002 5414946 gene locus_tag LOCUS_54530 5414002 5414946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899159.1 protein_id gnl|my_center|LOCUS_54530 5414933 5415208 gene locus_tag LOCUS_54540 5414933 5415208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410693.1 protein_id gnl|my_center|LOCUS_54540 5416000 5415482 gene locus_tag LOCUS_54550 5416000 5415482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54550 5416517 5418637 gene locus_tag LOCUS_54560 gene adhE 5416517 5418637 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035380749.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_54560 5418644 5419186 gene locus_tag LOCUS_54570 5418644 5419186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_54570 5419236 5419625 gene locus_tag LOCUS_54580 5419236 5419625 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_54580 5419540 5420106 gene locus_tag LOCUS_54590 5419540 5420106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 5420553 5420834 gene locus_tag LOCUS_54600 5420553 5420834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54600 5420876 5421670 gene locus_tag LOCUS_54610 5420876 5421670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54610 5422162 5421803 gene locus_tag LOCUS_54620 5422162 5421803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 5423081 5422155 gene locus_tag LOCUS_54630 5423081 5422155 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413363.1 protein_id gnl|my_center|LOCUS_54630 5424868 5423078 gene locus_tag LOCUS_54640 5424868 5423078 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_54640 5425010 5425657 gene locus_tag LOCUS_54650 5425010 5425657 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730440.1 protein_id gnl|my_center|LOCUS_54650 5426179 5425667 gene locus_tag LOCUS_54660 5426179 5425667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 5427206 5426310 gene locus_tag LOCUS_54670 5427206 5426310 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775749.1 protein_id gnl|my_center|LOCUS_54670 5427386 5427601 gene locus_tag LOCUS_54680 5427386 5427601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 5427614 5428711 gene locus_tag LOCUS_54690 5427614 5428711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 5428749 5430077 gene locus_tag LOCUS_54700 5428749 5430077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 5429962 5430606 gene locus_tag LOCUS_54710 5429962 5430606 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568500.1 protein_id gnl|my_center|LOCUS_54710 5430844 5431233 gene locus_tag LOCUS_54720 5430844 5431233 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_54720 5431148 5431714 gene locus_tag LOCUS_54730 5431148 5431714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54730 5432140 5431871 gene locus_tag LOCUS_54740 5432140 5431871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 5432359 5433621 gene locus_tag LOCUS_54750 5432359 5433621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 5433651 5434040 gene locus_tag LOCUS_54760 5433651 5434040 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_54760 5433955 5434521 gene locus_tag LOCUS_54770 5433955 5434521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 5434475 5434792 gene locus_tag LOCUS_54780 5434475 5434792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54780 5434789 5435601 gene locus_tag LOCUS_54790 gene istB 5434789 5435601 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_54790 5436521 5437357 gene locus_tag LOCUS_54800 5436521 5437357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_54800 5437672 5437262 gene locus_tag LOCUS_54810 5437672 5437262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 5438038 5437715 gene locus_tag LOCUS_54820 5438038 5437715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 5439752 5438373 gene locus_tag LOCUS_54830 5439752 5438373 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075509875.1 protein_id gnl|my_center|LOCUS_54830 5440149 5441306 gene locus_tag LOCUS_54840 5440149 5441306 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898727.1 protein_id gnl|my_center|LOCUS_54840 5441712 5441284 gene locus_tag LOCUS_54850 5441712 5441284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54850 5442083 5441709 gene locus_tag LOCUS_54860 5442083 5441709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54860 5442692 5442111 gene locus_tag LOCUS_54870 5442692 5442111 CDS product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405815.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54870 5442827 5443915 gene locus_tag LOCUS_54880 gene glpX 5442827 5443915 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898726.1 protein_id gnl|my_center|LOCUS_54880 5443953 5445383 gene locus_tag LOCUS_54890 5443953 5445383 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405805.1 protein_id gnl|my_center|LOCUS_54890 5445960 5445394 gene locus_tag LOCUS_54900 5445960 5445394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 5446264 5445875 gene locus_tag LOCUS_54910 5446264 5445875 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_54910 5446414 5447394 gene locus_tag LOCUS_54920 5446414 5447394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950492.1 protein_id gnl|my_center|LOCUS_54920 5448809 5447424 gene locus_tag LOCUS_54930 5448809 5447424 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064937.1 protein_id gnl|my_center|LOCUS_54930 5449799 5448924 gene locus_tag LOCUS_54940 5449799 5448924 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898725.1 protein_id gnl|my_center|LOCUS_54940 5451172 5449871 gene locus_tag LOCUS_54950 5451172 5449871 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405802.1 protein_id gnl|my_center|LOCUS_54950 5451372 5451169 gene locus_tag LOCUS_54960 5451372 5451169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 5452338 5451487 gene locus_tag LOCUS_54970 5452338 5451487 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405801.1 protein_id gnl|my_center|LOCUS_54970 5453651 5452371 gene locus_tag LOCUS_54980 5453651 5452371 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916776.1 protein_id gnl|my_center|LOCUS_54980 5453813 5454751 gene locus_tag LOCUS_54990 gene coaA 5453813 5454751 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405790.1 protein_id gnl|my_center|LOCUS_54990 5456180 5454723 gene locus_tag LOCUS_55000 5456180 5454723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 5456829 5456416 gene locus_tag LOCUS_55010 5456829 5456416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730420.1 protein_id gnl|my_center|LOCUS_55010 5458410 5457019 gene locus_tag LOCUS_55020 5458410 5457019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730421.1 protein_id gnl|my_center|LOCUS_55020 5459680 5458892 gene locus_tag LOCUS_55030 5459680 5458892 CDS product (2Z,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903314.1 protein_id gnl|my_center|LOCUS_55030 5459845 5460567 gene locus_tag LOCUS_55040 5459845 5460567 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901993.1 protein_id gnl|my_center|LOCUS_55040 5460987 5460595 gene locus_tag LOCUS_55050 5460987 5460595 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730423.1 protein_id gnl|my_center|LOCUS_55050 5463016 5460992 gene locus_tag LOCUS_55060 5463016 5460992 CDS product DUF255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405750.1 protein_id gnl|my_center|LOCUS_55060 5463302 5463003 gene locus_tag LOCUS_55070 5463302 5463003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405749.1 protein_id gnl|my_center|LOCUS_55070 5464171 5463299 gene locus_tag LOCUS_55080 gene mca 5464171 5463299 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405746.1 protein_id gnl|my_center|LOCUS_55080 5464412 5464744 gene locus_tag LOCUS_55090 5464412 5464744 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405744.1 protein_id gnl|my_center|LOCUS_55090 5464976 5465470 gene locus_tag LOCUS_55100 gene greA 5464976 5465470 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405742.1 protein_id gnl|my_center|LOCUS_55100 5466719 5465553 gene locus_tag LOCUS_55110 5466719 5465553 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405736.1 protein_id gnl|my_center|LOCUS_55110 5467259 5466819 gene locus_tag LOCUS_55120 5467259 5466819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 5469206 5467812 gene locus_tag LOCUS_55130 5469206 5467812 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405730.1 protein_id gnl|my_center|LOCUS_55130 5470332 5469265 gene locus_tag LOCUS_55140 5470332 5469265 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769636.1 protein_id gnl|my_center|LOCUS_55140 5470566 5471537 gene locus_tag LOCUS_55150 5470566 5471537 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405726.1 protein_id gnl|my_center|LOCUS_55150 5472114 5471548 gene locus_tag LOCUS_55160 5472114 5471548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 5472418 5472029 gene locus_tag LOCUS_55170 5472418 5472029 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_55170 5472636 5473781 gene locus_tag LOCUS_55180 5472636 5473781 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405724.1 protein_id gnl|my_center|LOCUS_55180 5474849 5473962 gene locus_tag LOCUS_55190 5474849 5473962 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405719.1 protein_id gnl|my_center|LOCUS_55190 5475040 5476089 gene locus_tag LOCUS_55200 5475040 5476089 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405716.1 protein_id gnl|my_center|LOCUS_55200 5476101 5476874 gene locus_tag LOCUS_55210 5476101 5476874 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405712.1 protein_id gnl|my_center|LOCUS_55210 5476886 5478631 gene locus_tag LOCUS_55220 5476886 5478631 CDS product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405708.1 protein_id gnl|my_center|LOCUS_55220 5478883 5481276 gene locus_tag LOCUS_55230 5478883 5481276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55230 5481270 5481389 gene locus_tag LOCUS_55240 5481270 5481389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 5481615 5481947 gene locus_tag LOCUS_55250 5481615 5481947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55250 5482101 5482838 gene locus_tag LOCUS_55260 5482101 5482838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55260 5482973 5483347 gene locus_tag LOCUS_55270 5482973 5483347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 5483377 5483766 gene locus_tag LOCUS_55280 5483377 5483766 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_55280 5483681 5484247 gene locus_tag LOCUS_55290 5483681 5484247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 5484201 5484881 gene locus_tag LOCUS_55300 5484201 5484881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 5485297 5484914 gene locus_tag LOCUS_55310 5485297 5484914 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405651.1 protein_id gnl|my_center|LOCUS_55310 5485791 5485297 gene locus_tag LOCUS_55320 5485791 5485297 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405649.1 protein_id gnl|my_center|LOCUS_55320 5486045 5486464 gene locus_tag LOCUS_55330 5486045 5486464 CDS product lipoprotein LpqV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405645.1 protein_id gnl|my_center|LOCUS_55330 5486567 5487631 gene locus_tag LOCUS_55340 5486567 5487631 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405642.1 protein_id gnl|my_center|LOCUS_55340 5487982 5487632 gene locus_tag LOCUS_55350 5487982 5487632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55350 5488509 5487943 gene locus_tag LOCUS_55360 5488509 5487943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55360 5489405 5488533 gene locus_tag LOCUS_55370 5489405 5488533 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405636.1 protein_id gnl|my_center|LOCUS_55370 5489911 5489438 gene locus_tag LOCUS_55380 5489911 5489438 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405633.1 protein_id gnl|my_center|LOCUS_55380 5490456 5491547 gene locus_tag LOCUS_55390 5490456 5491547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 5493268 5492783 gene locus_tag LOCUS_55400 5493268 5492783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 5493350 5493583 gene locus_tag LOCUS_55410 5493350 5493583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 5493786 5494175 gene locus_tag LOCUS_55420 5493786 5494175 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_55420 5494090 5494656 gene locus_tag LOCUS_55430 5494090 5494656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55430 5494967 5494653 gene locus_tag LOCUS_55440 5494967 5494653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 5496798 5495917 gene locus_tag LOCUS_55450 5496798 5495917 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_55450 5497687 5496791 gene locus_tag LOCUS_55460 5497687 5496791 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967889.1 protein_id gnl|my_center|LOCUS_55460 5498158 5497688 gene locus_tag LOCUS_55470 5498158 5497688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55470 5499245 5498064 gene locus_tag LOCUS_55480 5499245 5498064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55480 5500415 5499357 gene locus_tag LOCUS_55490 5500415 5499357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405629.1 protein_id gnl|my_center|LOCUS_55490 5502154 5500523 gene locus_tag LOCUS_55500 5502154 5500523 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405625.1 protein_id gnl|my_center|LOCUS_55500 5503475 5502276 gene locus_tag LOCUS_55510 5503475 5502276 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405622.1 protein_id gnl|my_center|LOCUS_55510 5504031 5503870 gene locus_tag LOCUS_55520 5504031 5503870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55520 5504655 5504149 gene locus_tag LOCUS_55530 5504655 5504149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55530 5504836 5505309 gene locus_tag LOCUS_55540 5504836 5505309 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467644.1 protein_id gnl|my_center|LOCUS_55540 5506819 5505329 gene locus_tag LOCUS_55550 5506819 5505329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 5506707 5506937 gene locus_tag LOCUS_55560 5506707 5506937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 5507751 5506975 gene locus_tag LOCUS_55570 5507751 5506975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729097.1 protein_id gnl|my_center|LOCUS_55570 5508457 5507834 gene locus_tag LOCUS_55580 5508457 5507834 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086856.1 protein_id gnl|my_center|LOCUS_55580 5508555 5509322 gene locus_tag LOCUS_55590 5508555 5509322 CDS product Coq4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083453.1 protein_id gnl|my_center|LOCUS_55590 5509519 5511963 gene locus_tag LOCUS_55600 5509519 5511963 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_55600 5511970 5512230 gene locus_tag LOCUS_55610 5511970 5512230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55610 5512321 5512500 gene locus_tag LOCUS_55620 5512321 5512500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 5512519 5513112 gene locus_tag LOCUS_55630 5512519 5513112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55630 5513109 5514257 gene locus_tag LOCUS_55640 5513109 5514257 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 protein_id gnl|my_center|LOCUS_55640 5514296 5515099 gene locus_tag LOCUS_55650 5514296 5515099 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_55650 5515265 5515981 gene locus_tag LOCUS_55660 5515265 5515981 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898800.1 protein_id gnl|my_center|LOCUS_55660 5516821 5516078 gene locus_tag LOCUS_55670 5516821 5516078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 5517685 5516882 gene locus_tag LOCUS_55680 5517685 5516882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 5517789 5518004 gene locus_tag LOCUS_55690 5517789 5518004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 5518017 5519051 gene locus_tag LOCUS_55700 5518017 5519051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 5519670 5521226 gene locus_tag LOCUS_55710 5519670 5521226 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726806.1 protein_id gnl|my_center|LOCUS_55710 5522106 5521228 gene locus_tag LOCUS_55720 5522106 5521228 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115911.1 protein_id gnl|my_center|LOCUS_55720 5525348 5522520 gene locus_tag LOCUS_55730 gene mmpL4 5525348 5522520 CDS product siderophore RND transporter MmpL4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898458.1 protein_id gnl|my_center|LOCUS_55730 5526818 5526159 gene locus_tag LOCUS_55740 5526818 5526159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55740 5527274 5526870 gene locus_tag LOCUS_55750 5527274 5526870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55750 5527685 5527308 gene locus_tag LOCUS_55760 5527685 5527308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 5528257 5527649 gene locus_tag LOCUS_55770 5528257 5527649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 5528978 5528280 gene locus_tag LOCUS_55780 5528978 5528280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 5530130 5529027 gene locus_tag LOCUS_55790 5530130 5529027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 5530552 5530959 gene locus_tag LOCUS_55800 5530552 5530959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 5531179 5531358 gene locus_tag LOCUS_55810 5531179 5531358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55810 5531994 5531614 gene locus_tag LOCUS_55820 5531994 5531614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 5532212 5532715 gene locus_tag LOCUS_55830 5532212 5532715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 5533025 5533585 gene locus_tag LOCUS_55840 5533025 5533585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 5535256 5533724 gene locus_tag LOCUS_55850 5535256 5533724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55850 5535703 5535629 gene locus_tag LOCUS_t00460 5535703 5535629 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5536063 5536887 gene locus_tag LOCUS_55860 5536063 5536887 CDS product PE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405370.1 protein_id gnl|my_center|LOCUS_55860 5537117 5537326 gene locus_tag LOCUS_55870 5537117 5537326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 5537241 5537807 gene locus_tag LOCUS_55880 5537241 5537807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 5537898 5539235 gene locus_tag LOCUS_55890 5537898 5539235 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405368.1 protein_id gnl|my_center|LOCUS_55890 5539217 5539513 gene locus_tag LOCUS_55900 gene esxJ 5539217 5539513 CDS product type VII secretion system ESX-5 protein EsxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900502.1 protein_id gnl|my_center|LOCUS_55900 5539552 5539836 gene locus_tag LOCUS_55910 gene esxN 5539552 5539836 CDS product effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408840.1 protein_id gnl|my_center|LOCUS_55910 5540196 5540870 gene locus_tag LOCUS_55920 gene trcR 5540196 5540870 CDS product two-component system response regulator TrcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405328.1 protein_id gnl|my_center|LOCUS_55920 5540920 5542419 gene locus_tag LOCUS_55930 5540920 5542419 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405324.1 protein_id gnl|my_center|LOCUS_55930 5542502 5543200 gene locus_tag LOCUS_55940 5542502 5543200 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730745.1 protein_id gnl|my_center|LOCUS_55940 5543580 5543287 gene locus_tag LOCUS_55950 5543580 5543287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 5544648 5543683 gene locus_tag LOCUS_55960 gene ppx2 5544648 5543683 CDS product exopolyphosphatase Ppx2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405299.1 protein_id gnl|my_center|LOCUS_55960 5545141 5544650 gene locus_tag LOCUS_55970 5545141 5544650 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907636.1 protein_id gnl|my_center|LOCUS_55970 5545835 5545134 gene locus_tag LOCUS_55980 5545835 5545134 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405293.1 protein_id gnl|my_center|LOCUS_55980 5547155 5545869 gene locus_tag LOCUS_55990 gene eno 5547155 5545869 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405290.1 protein_id gnl|my_center|LOCUS_55990 5547949 5547236 gene locus_tag LOCUS_56000 5547949 5547236 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405288.1 protein_id gnl|my_center|LOCUS_56000 5549422 5548322 gene locus_tag LOCUS_56010 5549422 5548322 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405276.1 protein_id gnl|my_center|LOCUS_56010 5553087 5549419 gene locus_tag LOCUS_56020 gene mfd 5553087 5549419 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405273.1 protein_id gnl|my_center|LOCUS_56020 5553801 5553154 gene locus_tag LOCUS_56030 5553801 5553154 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405271.1 protein_id gnl|my_center|LOCUS_56030 5555003 5554041 gene locus_tag LOCUS_56040 5555003 5554041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_56040 5555328 5555113 gene locus_tag LOCUS_56050 5555328 5555113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 5555509 5555581 gene locus_tag LOCUS_t00470 5555509 5555581 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5555692 5557170 gene locus_tag LOCUS_56060 gene glmU 5555692 5557170 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950485.1 protein_id gnl|my_center|LOCUS_56060 5557283 5558263 gene locus_tag LOCUS_56070 5557283 5558263 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405263.1 protein_id gnl|my_center|LOCUS_56070 5558264 5558632 gene locus_tag LOCUS_56080 gene arsC 5558264 5558632 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896825.1 protein_id gnl|my_center|LOCUS_56080 5558629 5559285 gene locus_tag LOCUS_56090 5558629 5559285 CDS product LpqN/LpqT family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907629.1 protein_id gnl|my_center|LOCUS_56090 5559285 5560166 gene locus_tag LOCUS_56100 5559285 5560166 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730529.1 protein_id gnl|my_center|LOCUS_56100 5560414 5561058 gene locus_tag LOCUS_56110 5560414 5561058 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405254.1 protein_id gnl|my_center|LOCUS_56110 5561071 5561646 gene locus_tag LOCUS_56120 gene pth 5561071 5561646 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405251.1 protein_id gnl|my_center|LOCUS_56120 5562634 5561660 gene locus_tag LOCUS_56130 5562634 5561660 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236073176.1 protein_id gnl|my_center|LOCUS_56130 5562985 5562737 gene locus_tag LOCUS_56140 5562985 5562737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 5562912 5563355 gene locus_tag LOCUS_56150 5562912 5563355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_56150 5563425 5564162 gene locus_tag LOCUS_56160 5563425 5564162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 5565882 5564248 gene locus_tag LOCUS_56170 5565882 5564248 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405202.1 protein_id gnl|my_center|LOCUS_56170 5567177 5566248 gene locus_tag LOCUS_56180 5567177 5566248 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405199.1 protein_id gnl|my_center|LOCUS_56180 5568093 5567269 gene locus_tag LOCUS_56190 gene rsmA 5568093 5567269 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405191.1 protein_id gnl|my_center|LOCUS_56190 5569286 5568198 gene locus_tag LOCUS_56200 gene rpfB 5569286 5568198 CDS product resuscitation-promoting factor protein RpfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405187.1 protein_id gnl|my_center|LOCUS_56200 5570344 5569496 gene locus_tag LOCUS_56210 5570344 5569496 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041180038.1 protein_id gnl|my_center|LOCUS_56210 5570378 5571934 gene locus_tag LOCUS_56220 gene metG 5570378 5571934 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405183.1 protein_id gnl|my_center|LOCUS_56220 5572209 5572895 gene locus_tag LOCUS_56230 5572209 5572895 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028084.1 protein_id gnl|my_center|LOCUS_56230 5572995 5573384 gene locus_tag LOCUS_56240 5572995 5573384 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_56240 5573299 5573865 gene locus_tag LOCUS_56250 5573299 5573865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_56250 5575249 5573876 gene locus_tag LOCUS_56260 5575249 5573876 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402992.1 protein_id gnl|my_center|LOCUS_56260 5576449 5577015 gene locus_tag LOCUS_56270 5576449 5577015 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107351.1 protein_id gnl|my_center|LOCUS_56270 5578657 5577083 gene locus_tag LOCUS_56280 5578657 5577083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405180.1 protein_id gnl|my_center|LOCUS_56280 5579284 5580468 gene locus_tag LOCUS_56290 5579284 5580468 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896840.1 protein_id gnl|my_center|LOCUS_56290 5580465 5581370 gene locus_tag LOCUS_56300 gene sigJ 5580465 5581370 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112241.1 protein_id gnl|my_center|LOCUS_56300 5581471 5582745 gene locus_tag LOCUS_56310 5581471 5582745 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003905428.1 protein_id gnl|my_center|LOCUS_56310 5582870 5584165 gene locus_tag LOCUS_56320 5582870 5584165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003910253.1 protein_id gnl|my_center|LOCUS_56320 5585027 5584173 gene locus_tag LOCUS_56330 gene rsmI 5585027 5584173 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405173.1 protein_id gnl|my_center|LOCUS_56330 5585053 5586609 gene locus_tag LOCUS_56340 5585053 5586609 CDS product dolichyl-phosphate-mannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898685.1 protein_id gnl|my_center|LOCUS_56340 5587810 5586545 gene locus_tag LOCUS_56350 gene arcA 5587810 5586545 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405169.1 protein_id gnl|my_center|LOCUS_56350 5587827 5588486 gene locus_tag LOCUS_56360 5587827 5588486 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898684.1 protein_id gnl|my_center|LOCUS_56360 5589092 5588511 gene locus_tag LOCUS_56370 5589092 5588511 CDS product DUF5642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405165.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_56370 5589079 5589300 gene locus_tag LOCUS_56380 5589079 5589300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 5589869 5589192 gene locus_tag LOCUS_56390 5589869 5589192 CDS product DUF5642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730545.1 protein_id gnl|my_center|LOCUS_56390 5590933 5589941 gene locus_tag LOCUS_56400 5590933 5589941 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405164.1 protein_id gnl|my_center|LOCUS_56400 5591122 5591337 gene locus_tag LOCUS_56410 5591122 5591337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56410 5591350 5592384 gene locus_tag LOCUS_56420 5591350 5592384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 5592575 5593747 gene locus_tag LOCUS_56430 5592575 5593747 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408416.1 protein_id gnl|my_center|LOCUS_56430 5593936 5594697 gene locus_tag LOCUS_56440 5593936 5594697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 5594737 5596281 gene locus_tag LOCUS_56450 5594737 5596281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 5596166 5596381 gene locus_tag LOCUS_56460 5596166 5596381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 5596394 5597428 gene locus_tag LOCUS_56470 5596394 5597428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 5597502 5597765 gene locus_tag LOCUS_56480 5597502 5597765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56480 5597780 5598694 gene locus_tag LOCUS_56490 5597780 5598694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56490 5598598 5598900 gene locus_tag LOCUS_56500 5598598 5598900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 5599912 5598878 gene locus_tag LOCUS_56510 5599912 5598878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 5600140 5599925 gene locus_tag LOCUS_56520 5600140 5599925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 5600947 5600363 gene locus_tag LOCUS_56530 5600947 5600363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 5601690 5600932 gene locus_tag LOCUS_56540 5601690 5600932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 5602386 5603087 gene locus_tag LOCUS_56550 5602386 5603087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 5603864 5603067 gene locus_tag LOCUS_56560 5603864 5603067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 5604445 5603879 gene locus_tag LOCUS_56570 5604445 5603879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 5604569 5604360 gene locus_tag LOCUS_56580 5604569 5604360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 5604925 5605401 gene locus_tag LOCUS_56590 5604925 5605401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 5606141 5605380 gene locus_tag LOCUS_56600 5606141 5605380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 5606792 5606235 gene locus_tag LOCUS_56610 5606792 5606235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56610 5607355 5606738 gene locus_tag LOCUS_56620 5607355 5606738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56620 5607855 5607352 gene locus_tag LOCUS_56630 5607855 5607352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56630 5608827 5607877 gene locus_tag LOCUS_56640 5608827 5607877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 5610209 5608824 gene locus_tag LOCUS_56650 5610209 5608824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 5610545 5611327 gene locus_tag LOCUS_56660 5610545 5611327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 5611509 5611436 gene locus_tag LOCUS_t00480 5611509 5611436 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5612746 5611562 gene locus_tag LOCUS_56670 5612746 5611562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901065.1 protein_id gnl|my_center|LOCUS_56670 5613564 5612953 gene locus_tag LOCUS_56680 5613564 5612953 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405148.1 protein_id gnl|my_center|LOCUS_56680 5614918 5613629 gene locus_tag LOCUS_56690 5614918 5613629 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405146.1 protein_id gnl|my_center|LOCUS_56690 5615887 5614970 gene locus_tag LOCUS_56700 5615887 5614970 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405145.1 protein_id gnl|my_center|LOCUS_56700 5615965 5616558 gene locus_tag LOCUS_56710 5615965 5616558 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901063.1 protein_id gnl|my_center|LOCUS_56710 5616633 5616968 gene locus_tag LOCUS_56720 5616633 5616968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 5617035 5617709 gene locus_tag LOCUS_56730 5617035 5617709 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405138.1 protein_id gnl|my_center|LOCUS_56730 5617786 5618241 gene locus_tag LOCUS_56740 gene mscL 5617786 5618241 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405128.1 protein_id gnl|my_center|LOCUS_56740 5618806 5618261 gene locus_tag LOCUS_56750 5618806 5618261 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158018051.1 protein_id gnl|my_center|LOCUS_56750 5620173 5618803 gene locus_tag LOCUS_56760 gene pepD 5620173 5618803 CDS product serine protease PepD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901059.1 protein_id gnl|my_center|LOCUS_56760 5621877 5620342 gene locus_tag LOCUS_56770 gene mprB 5621877 5620342 CDS product two-component system sensor histidine kinase MprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405123.1 protein_id gnl|my_center|LOCUS_56770 5622575 5621877 gene locus_tag LOCUS_56780 gene mprA 5622575 5621877 CDS product two-component system response regulator MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014588181.1 protein_id gnl|my_center|LOCUS_56780 5623281 5624993 gene locus_tag LOCUS_56790 5623281 5624993 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404960.1 protein_id gnl|my_center|LOCUS_56790 5624990 5626138 gene locus_tag LOCUS_56800 5624990 5626138 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898670.1 protein_id gnl|my_center|LOCUS_56800 5626188 5627783 gene locus_tag LOCUS_56810 5626188 5627783 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900245.1 protein_id gnl|my_center|LOCUS_56810 5627789 5629771 gene locus_tag LOCUS_56820 5627789 5629771 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900244.1 protein_id gnl|my_center|LOCUS_56820 5629771 5630937 gene locus_tag LOCUS_56830 5629771 5630937 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898667.1 protein_id gnl|my_center|LOCUS_56830 5630948 5631721 gene locus_tag LOCUS_56840 5630948 5631721 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404949.1 protein_id gnl|my_center|LOCUS_56840 5632184 5632786 gene locus_tag LOCUS_56850 5632184 5632786 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886096.1 protein_id gnl|my_center|LOCUS_56850 5634811 5632814 gene locus_tag LOCUS_56860 5634811 5632814 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404895.1 protein_id gnl|my_center|LOCUS_56860 5636198 5634804 gene locus_tag LOCUS_56870 5636198 5634804 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404892.1 protein_id gnl|my_center|LOCUS_56870 5637846 5636275 gene locus_tag LOCUS_56880 gene purH 5637846 5636275 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404890.1 protein_id gnl|my_center|LOCUS_56880 5638490 5637843 gene locus_tag LOCUS_56890 gene purN 5638490 5637843 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898661.1 protein_id gnl|my_center|LOCUS_56890 5639961 5638543 gene locus_tag LOCUS_56900 5639961 5638543 CDS product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901049.1 protein_id gnl|my_center|LOCUS_56900 5640915 5640001 gene locus_tag LOCUS_56910 5640915 5640001 CDS product DUF5336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404875.1 protein_id gnl|my_center|LOCUS_56910 5641121 5640927 gene locus_tag LOCUS_56920 5641121 5640927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56920 5641136 5641990 gene locus_tag LOCUS_56930 5641136 5641990 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404873.1 protein_id gnl|my_center|LOCUS_56930 5643518 5641998 gene locus_tag LOCUS_56940 5643518 5641998 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730593.1 protein_id gnl|my_center|LOCUS_56940 5643682 5644956 gene locus_tag LOCUS_56950 5643682 5644956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 5645949 5645047 gene locus_tag LOCUS_56960 gene sucD 5645949 5645047 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900240.1 protein_id gnl|my_center|LOCUS_56960 5647127 5645964 gene locus_tag LOCUS_56970 gene sucC 5647127 5645964 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898659.1 protein_id gnl|my_center|LOCUS_56970 5647403 5648470 gene locus_tag LOCUS_56980 5647403 5648470 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404862.1 protein_id gnl|my_center|LOCUS_56980 5648868 5648458 gene locus_tag LOCUS_56990 5648868 5648458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 5648756 5649058 gene locus_tag LOCUS_57000 5648756 5649058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57000 5651446 5649137 gene locus_tag LOCUS_57010 gene pcrA 5651446 5649137 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404859.1 protein_id gnl|my_center|LOCUS_57010 5653503 5651527 gene locus_tag LOCUS_57020 5653503 5651527 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906993.1 protein_id gnl|my_center|LOCUS_57020 5654831 5653797 gene locus_tag LOCUS_57030 5654831 5653797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57030 5655086 5654844 gene locus_tag LOCUS_57040 5655086 5654844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57040 5656536 5655280 gene locus_tag LOCUS_57050 5656536 5655280 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898584.1 protein_id gnl|my_center|LOCUS_57050 5657960 5656533 gene locus_tag LOCUS_57060 gene purB 5657960 5656533 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898583.1 protein_id gnl|my_center|LOCUS_57060 5658079 5658840 gene locus_tag LOCUS_57070 5658079 5658840 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403949.1 protein_id gnl|my_center|LOCUS_57070 5659361 5658837 gene locus_tag LOCUS_57080 5659361 5658837 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403945.1 protein_id gnl|my_center|LOCUS_57080 5659528 5660427 gene locus_tag LOCUS_57090 5659528 5660427 CDS product iron-stress inducible esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403938.1 protein_id gnl|my_center|LOCUS_57090 5660495 5662096 gene locus_tag LOCUS_57100 gene ggtA 5660495 5662096 CDS product gamma-glutamyltranspeptidase GgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403933.1 protein_id gnl|my_center|LOCUS_57100 5662556 5664670 gene locus_tag LOCUS_57110 5662556 5664670 CDS product Rv1355c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908521.1 protein_id gnl|my_center|LOCUS_57110 5664917 5664699 gene locus_tag LOCUS_57120 5664917 5664699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57120 5665613 5665092 gene locus_tag LOCUS_57130 5665613 5665092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57130 5665931 5667481 gene locus_tag LOCUS_57140 5665931 5667481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57140 5668789 5667521 gene locus_tag LOCUS_57150 gene purD 5668789 5667521 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898580.1 protein_id gnl|my_center|LOCUS_57150 5669265 5668828 gene locus_tag LOCUS_57160 5669265 5668828 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897257.1 protein_id gnl|my_center|LOCUS_57160 5670131 5669265 gene locus_tag LOCUS_57170 5670131 5669265 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403924.1 protein_id gnl|my_center|LOCUS_57170 5670930 5670178 gene locus_tag LOCUS_57180 5670930 5670178 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898579.1 protein_id gnl|my_center|LOCUS_57180 5672410 5670971 gene locus_tag LOCUS_57190 5672410 5670971 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403919.1 protein_id gnl|my_center|LOCUS_57190 5672616 5673284 gene locus_tag LOCUS_57200 5672616 5673284 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403915.1 protein_id gnl|my_center|LOCUS_57200 5673281 5673919 gene locus_tag LOCUS_57210 5673281 5673919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57210 5673828 5674517 gene locus_tag LOCUS_57220 5673828 5674517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57220 5674517 5675341 gene locus_tag LOCUS_57230 5674517 5675341 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730852.1 protein_id gnl|my_center|LOCUS_57230 5675338 5676600 gene locus_tag LOCUS_57240 gene cyp51 5675338 5676600 CDS product lanosterol 14-alpha demethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898577.1 protein_id gnl|my_center|LOCUS_57240 5676708 5676914 gene locus_tag LOCUS_57250 5676708 5676914 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403890.1 protein_id gnl|my_center|LOCUS_57250 5676920 5677465 gene locus_tag LOCUS_57260 5676920 5677465 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403887.1 protein_id gnl|my_center|LOCUS_57260 5677628 5678755 gene locus_tag LOCUS_57270 5677628 5678755 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403885.1 protein_id gnl|my_center|LOCUS_57270 5680933 5679116 gene locus_tag LOCUS_57280 5680933 5679116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 5681361 5682752 gene locus_tag LOCUS_57290 5681361 5682752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57290 5682757 5683161 gene locus_tag LOCUS_57300 5682757 5683161 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897271.1 protein_id gnl|my_center|LOCUS_57300 5684613 5683168 gene locus_tag LOCUS_57310 gene phoR 5684613 5683168 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916717.1 protein_id gnl|my_center|LOCUS_57310 5685376 5684654 gene locus_tag LOCUS_57320 gene phoP 5685376 5684654 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403867.1 protein_id gnl|my_center|LOCUS_57320 5685538 5686266 gene locus_tag LOCUS_57330 5685538 5686266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403862.1 protein_id gnl|my_center|LOCUS_57330 5686294 5686368 gene locus_tag LOCUS_t00490 5686294 5686368 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5686571 5686732 gene locus_tag LOCUS_57340 5686571 5686732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57340 5686781 5687107 gene locus_tag LOCUS_57350 5686781 5687107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57350 5687117 5687737 gene locus_tag LOCUS_57360 5687117 5687737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57360 5690423 5687721 gene locus_tag LOCUS_57370 5690423 5687721 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727571.1 protein_id gnl|my_center|LOCUS_57370 5691244 5690420 gene locus_tag LOCUS_57380 5691244 5690420 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877026.1 protein_id gnl|my_center|LOCUS_57380 5691564 5691244 gene locus_tag LOCUS_57390 gene uraH 5691564 5691244 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057392.1 protein_id gnl|my_center|LOCUS_57390 5692105 5691602 gene locus_tag LOCUS_57400 gene uraD 5692105 5691602 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727574.1 protein_id gnl|my_center|LOCUS_57400 5694043 5692106 gene locus_tag LOCUS_57410 5694043 5692106 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727573.1 protein_id gnl|my_center|LOCUS_57410 5694357 5694088 gene locus_tag LOCUS_57420 5694357 5694088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 5696502 5694379 gene locus_tag LOCUS_57430 gene atsD 5696502 5694379 CDS product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_57430 5696739 5697953 gene locus_tag LOCUS_57440 5696739 5697953 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111191.1 protein_id gnl|my_center|LOCUS_57440 5698770 5697964 gene locus_tag LOCUS_57450 5698770 5697964 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809109.1 protein_id gnl|my_center|LOCUS_57450 5700529 5698796 gene locus_tag LOCUS_57460 5700529 5698796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57460 5700742 5701860 gene locus_tag LOCUS_57470 5700742 5701860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57470 5701766 5702236 gene locus_tag LOCUS_57480 5701766 5702236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57480 5702427 5702257 gene locus_tag LOCUS_57490 5702427 5702257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57490 5703746 5702373 gene locus_tag LOCUS_57500 5703746 5702373 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418921.1 protein_id gnl|my_center|LOCUS_57500 5704061 5703750 gene locus_tag LOCUS_57510 5704061 5703750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 5703957 5705594 gene locus_tag LOCUS_57520 5703957 5705594 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 protein_id gnl|my_center|LOCUS_57520 5706110 5705643 gene locus_tag LOCUS_57530 5706110 5705643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 5706258 5706644 gene locus_tag LOCUS_57540 5706258 5706644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 5706669 5707028 gene locus_tag LOCUS_57550 5706669 5707028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 5707882 5707097 gene locus_tag LOCUS_57560 5707882 5707097 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418777.1 protein_id gnl|my_center|LOCUS_57560 5707868 5708161 gene locus_tag LOCUS_57570 5707868 5708161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 5708799 5708149 gene locus_tag LOCUS_57580 5708799 5708149 CDS product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418922.1 protein_id gnl|my_center|LOCUS_57580 5710072 5708921 gene locus_tag LOCUS_57590 5710072 5708921 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027886.1 protein_id gnl|my_center|LOCUS_57590 5710917 5710123 gene locus_tag LOCUS_57600 5710917 5710123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57600 5711240 5710959 gene locus_tag LOCUS_57610 5711240 5710959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57610 5712396 5711818 gene locus_tag LOCUS_57620 5712396 5711818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 5713013 5712630 gene locus_tag LOCUS_57630 5713013 5712630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57630 5712994 5713290 gene locus_tag LOCUS_57640 5712994 5713290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57640 5713676 5715136 gene locus_tag LOCUS_57650 5713676 5715136 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900866.1 protein_id gnl|my_center|LOCUS_57650 5715713 5715147 gene locus_tag LOCUS_57660 5715713 5715147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57660 5716017 5715628 gene locus_tag LOCUS_57670 5716017 5715628 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_57670 5716868 5716077 gene locus_tag LOCUS_57680 5716868 5716077 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226182.1 protein_id gnl|my_center|LOCUS_57680 5717705 5716872 gene locus_tag LOCUS_57690 5717705 5716872 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900075.1 protein_id gnl|my_center|LOCUS_57690 5718039 5717797 gene locus_tag LOCUS_57700 5718039 5717797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 5718476 5718036 gene locus_tag LOCUS_57710 5718476 5718036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57710 5719439 5718483 gene locus_tag LOCUS_57720 5719439 5718483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_57720 5721053 5719827 gene locus_tag LOCUS_57730 gene bioF 5721053 5719827 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_57730 5722196 5721261 gene locus_tag LOCUS_57740 5722196 5721261 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104400.1 protein_id gnl|my_center|LOCUS_57740 5723096 5722263 gene locus_tag LOCUS_57750 gene fetB 5723096 5722263 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_57750 5723776 5723096 gene locus_tag LOCUS_57760 5723776 5723096 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405169.1 protein_id gnl|my_center|LOCUS_57760 5724480 5727419 gene locus_tag LOCUS_57770 5724480 5727419 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093082.1 protein_id gnl|my_center|LOCUS_57770 5727510 5727812 gene locus_tag LOCUS_57780 5727510 5727812 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950901.1 protein_id gnl|my_center|LOCUS_57780 5727862 5728044 gene locus_tag LOCUS_57790 5727862 5728044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418950.1 protein_id gnl|my_center|LOCUS_57790 5728045 5729547 gene locus_tag LOCUS_57800 gene otsA 5728045 5729547 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418951.1 protein_id gnl|my_center|LOCUS_57800 5729597 5729986 gene locus_tag LOCUS_57810 5729597 5729986 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_57810 5729901 5730467 gene locus_tag LOCUS_57820 5729901 5730467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 5730569 5731150 gene locus_tag LOCUS_57830 5730569 5731150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418954.1 protein_id gnl|my_center|LOCUS_57830 5731695 5731195 gene locus_tag LOCUS_57840 5731695 5731195 CDS product Mce associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418958.1 protein_id gnl|my_center|LOCUS_57840 5732426 5731695 gene locus_tag LOCUS_57850 5732426 5731695 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418960.1 protein_id gnl|my_center|LOCUS_57850 5734141 5732459 gene locus_tag LOCUS_57860 5734141 5732459 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418963.1 protein_id gnl|my_center|LOCUS_57860 5735304 5734153 gene locus_tag LOCUS_57870 gene lprN 5735304 5734153 CDS product Mce family lipoprotein LprN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418964.1 protein_id gnl|my_center|LOCUS_57870 5736734 5735301 gene locus_tag LOCUS_57880 5736734 5735301 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418966.1 protein_id gnl|my_center|LOCUS_57880 5737792 5736731 gene locus_tag LOCUS_57890 5737792 5736731 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418967.1 protein_id gnl|my_center|LOCUS_57890 5738834 5737782 gene locus_tag LOCUS_57900 5738834 5737782 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418972.1 protein_id gnl|my_center|LOCUS_57900 5740036 5738834 gene locus_tag LOCUS_57910 gene mce4A 5740036 5738834 CDS product virulence factor Mce4A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418979.1 protein_id gnl|my_center|LOCUS_57910 5740894 5740052 gene locus_tag LOCUS_57920 5740894 5740052 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418983.1 protein_id gnl|my_center|LOCUS_57920 5741693 5740929 gene locus_tag LOCUS_57930 5741693 5740929 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418986.1 protein_id gnl|my_center|LOCUS_57930 5742823 5741930 gene locus_tag LOCUS_57940 5742823 5741930 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418990.1 protein_id gnl|my_center|LOCUS_57940 5743163 5742912 gene locus_tag LOCUS_57950 5743163 5742912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 5743328 5744506 gene locus_tag LOCUS_57960 5743328 5744506 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418997.1 protein_id gnl|my_center|LOCUS_57960 5744537 5745634 gene locus_tag LOCUS_57970 5744537 5745634 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950903.1 protein_id gnl|my_center|LOCUS_57970 5745697 5746815 gene locus_tag LOCUS_57980 5745697 5746815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57980 5747453 5746887 gene locus_tag LOCUS_57990 5747453 5746887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 5747757 5747368 gene locus_tag LOCUS_58000 5747757 5747368 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_58000 5747819 5748160 gene locus_tag LOCUS_58010 5747819 5748160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 5748268 5751681 gene locus_tag LOCUS_58020 5748268 5751681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 5751681 5752406 gene locus_tag LOCUS_58030 5751681 5752406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58030 5753950 5752403 gene locus_tag LOCUS_58040 5753950 5752403 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900872.1 protein_id gnl|my_center|LOCUS_58040 5754793 5753963 gene locus_tag LOCUS_58050 5754793 5753963 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_58050 5755613 5754846 gene locus_tag LOCUS_58060 5755613 5754846 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777040.1 protein_id gnl|my_center|LOCUS_58060 5757279 5755627 gene locus_tag LOCUS_58070 5757279 5755627 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901660.1 protein_id gnl|my_center|LOCUS_58070 5757326 5758276 gene locus_tag LOCUS_58080 5757326 5758276 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419179.1 protein_id gnl|my_center|LOCUS_58080 5759395 5758190 gene locus_tag LOCUS_58090 gene cyp142 5759395 5758190 CDS product steroid C26-monooxygenase Cyp142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900082.1 protein_id gnl|my_center|LOCUS_58090 5759425 5760135 gene locus_tag LOCUS_58100 5759425 5760135 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419190.1 protein_id gnl|my_center|LOCUS_58100 5761233 5760196 gene locus_tag LOCUS_58110 5761233 5760196 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900084.1 protein_id gnl|my_center|LOCUS_58110 5761268 5761996 gene locus_tag LOCUS_58120 5761268 5761996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_58120 5762024 5762293 gene locus_tag LOCUS_58130 5762024 5762293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_58130 5762309 5763370 gene locus_tag LOCUS_58140 5762309 5763370 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419199.1 protein_id gnl|my_center|LOCUS_58140 5763370 5763618 gene locus_tag LOCUS_58150 5763370 5763618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58150 5763775 5763581 gene locus_tag LOCUS_58160 5763775 5763581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58160 5763859 5764296 gene locus_tag LOCUS_58170 5763859 5764296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_58170 5764342 5764539 gene locus_tag LOCUS_58180 5764342 5764539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_58180 5764536 5764748 gene locus_tag LOCUS_58190 5764536 5764748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 5764885 5765778 gene locus_tag LOCUS_58200 5764885 5765778 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419207.1 protein_id gnl|my_center|LOCUS_58200 5765985 5766923 gene locus_tag LOCUS_58210 5765985 5766923 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419207.1 protein_id gnl|my_center|LOCUS_58210 5767027 5767353 gene locus_tag LOCUS_58220 5767027 5767353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58220 5767403 5767792 gene locus_tag LOCUS_58230 5767403 5767792 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_58230 5767707 5768273 gene locus_tag LOCUS_58240 5767707 5768273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58240 5768294 5769319 gene locus_tag LOCUS_58250 5768294 5769319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 5769850 5769326 gene locus_tag LOCUS_58260 5769850 5769326 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419208.1 protein_id gnl|my_center|LOCUS_58260 5769964 5771148 gene locus_tag LOCUS_58270 gene kshA 5769964 5771148 CDS product 3-ketosteroid-9-alpha-hydroxylase subunit KshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419211.1 protein_id gnl|my_center|LOCUS_58270 5771154 5771603 gene locus_tag LOCUS_58280 5771154 5771603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419215.1 protein_id gnl|my_center|LOCUS_58280 5772752 5771607 gene locus_tag LOCUS_58290 5772752 5771607 CDS product TLR2-mediated response inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419222.1 protein_id gnl|my_center|LOCUS_58290 5773534 5772752 gene locus_tag LOCUS_58300 5773534 5772752 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419223.1 protein_id gnl|my_center|LOCUS_58300 5774699 5773548 gene locus_tag LOCUS_58310 5774699 5773548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900087.1 protein_id gnl|my_center|LOCUS_58310 5774931 5775881 gene locus_tag LOCUS_58320 5774931 5775881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58320 5775878 5777515 gene locus_tag LOCUS_58330 5775878 5777515 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087741.1 protein_id gnl|my_center|LOCUS_58330 5778545 5777502 gene locus_tag LOCUS_58340 gene dmpG 5778545 5777502 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419250.1 protein_id gnl|my_center|LOCUS_58340 5779468 5778542 gene locus_tag LOCUS_58350 5779468 5778542 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419251.1 protein_id gnl|my_center|LOCUS_58350 5780297 5779512 gene locus_tag LOCUS_58360 5780297 5779512 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419252.1 protein_id gnl|my_center|LOCUS_58360 5780372 5782075 gene locus_tag LOCUS_58370 gene kstD 5780372 5782075 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419253.1 protein_id gnl|my_center|LOCUS_58370 5782077 5782946 gene locus_tag LOCUS_58380 5782077 5782946 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419285.1 protein_id gnl|my_center|LOCUS_58380 5783879 5783034 gene locus_tag LOCUS_58390 5783879 5783034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419184.1 protein_id gnl|my_center|LOCUS_58390 5785170 5784010 gene locus_tag LOCUS_58400 5785170 5784010 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419287.1 protein_id gnl|my_center|LOCUS_58400 5785571 5785170 gene locus_tag LOCUS_58410 5785571 5785170 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730956.1 protein_id gnl|my_center|LOCUS_58410 5786518 5785568 gene locus_tag LOCUS_58420 gene chsH2 5786518 5785568 CDS product 3-oxo-23,24-bisnorchol-4,17(20)-dien-22-oyl-CoA hydratase subunit alpha ChsH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419293.1 protein_id gnl|my_center|LOCUS_58420 5787678 5786515 gene locus_tag LOCUS_58430 5787678 5786515 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419296.1 protein_id gnl|my_center|LOCUS_58430 5788694 5787663 gene locus_tag LOCUS_58440 gene fadE28 5788694 5787663 CDS product acyl-CoA dehydrogenase FadE28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419299.1 protein_id gnl|my_center|LOCUS_58440 5789965 5788712 gene locus_tag LOCUS_58450 gene cyp125 5789965 5788712 CDS product steroid C26-monooxygenase Cyp125 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419304.1 protein_id gnl|my_center|LOCUS_58450 5790136 5791311 gene locus_tag LOCUS_58460 5790136 5791311 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419307.1 protein_id gnl|my_center|LOCUS_58460 5791319 5791705 gene locus_tag LOCUS_58470 5791319 5791705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730962.1 protein_id gnl|my_center|LOCUS_58470 5791769 5792224 gene locus_tag LOCUS_58480 gene ddn 5791769 5792224 CDS product deazaflavin-dependent nitroreductase Ddn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419309.1 protein_id gnl|my_center|LOCUS_58480 5793175 5792270 gene locus_tag LOCUS_58490 5793175 5792270 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900711.1 protein_id gnl|my_center|LOCUS_58490 5793975 5793196 gene locus_tag LOCUS_58500 5793975 5793196 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419313.1 protein_id gnl|my_center|LOCUS_58500 5794118 5794333 gene locus_tag LOCUS_58510 5794118 5794333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 5795035 5795379 gene locus_tag LOCUS_58520 5795035 5795379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 5797342 5795507 gene locus_tag LOCUS_58530 5797342 5795507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 5797640 5798383 gene locus_tag LOCUS_58540 5797640 5798383 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419315.1 protein_id gnl|my_center|LOCUS_58540 5798380 5799258 gene locus_tag LOCUS_58550 5798380 5799258 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419318.1 protein_id gnl|my_center|LOCUS_58550 5799255 5799998 gene locus_tag LOCUS_58560 5799255 5799998 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419321.1 protein_id gnl|my_center|LOCUS_58560 5799995 5801059 gene locus_tag LOCUS_58570 5799995 5801059 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419324.1 protein_id gnl|my_center|LOCUS_58570 5802161 5801064 gene locus_tag LOCUS_58580 5802161 5801064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58580 5802416 5802174 gene locus_tag LOCUS_58590 5802416 5802174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 5802535 5804556 gene locus_tag LOCUS_58600 5802535 5804556 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419325.1 protein_id gnl|my_center|LOCUS_58600 5805092 5804643 gene locus_tag LOCUS_58610 5805092 5804643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58610 5805397 5805089 gene locus_tag LOCUS_58620 5805397 5805089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58620 5805832 5805515 gene locus_tag LOCUS_58630 5805832 5805515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 5805765 5806634 gene locus_tag LOCUS_58640 5805765 5806634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 5808297 5807137 gene locus_tag LOCUS_58650 5808297 5807137 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419328.1 protein_id gnl|my_center|LOCUS_58650 5808857 5808300 gene locus_tag LOCUS_58660 gene kstR2 5808857 5808300 CDS product TetR family transcriptional regulator KstR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419329.1 protein_id gnl|my_center|LOCUS_58660 5809078 5810697 gene locus_tag LOCUS_58670 5809078 5810697 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950840.1 protein_id gnl|my_center|LOCUS_58670 5811560 5810772 gene locus_tag LOCUS_58680 5811560 5810772 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900097.1 protein_id gnl|my_center|LOCUS_58680 5812705 5811557 gene locus_tag LOCUS_58690 5812705 5811557 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419340.1 protein_id gnl|my_center|LOCUS_58690 5812776 5814299 gene locus_tag LOCUS_58700 gene fadD3 5812776 5814299 CDS product 3-((3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl)propanoate--CoA ligase FadD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900098.1 protein_id gnl|my_center|LOCUS_58700 5814300 5815433 gene locus_tag LOCUS_58710 5814300 5815433 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419346.1 protein_id gnl|my_center|LOCUS_58710 5815437 5816372 gene locus_tag LOCUS_58720 5815437 5816372 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950910.1 protein_id gnl|my_center|LOCUS_58720 5816422 5817384 gene locus_tag LOCUS_58730 5816422 5817384 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419352.1 protein_id gnl|my_center|LOCUS_58730 5817381 5818556 gene locus_tag LOCUS_58740 5817381 5818556 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419356.1 protein_id gnl|my_center|LOCUS_58740 5819412 5818570 gene locus_tag LOCUS_58750 gene nat 5819412 5818570 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419364.1 protein_id gnl|my_center|LOCUS_58750 5819565 5820176 gene locus_tag LOCUS_58760 5819565 5820176 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730011.1 protein_id gnl|my_center|LOCUS_58760 5820476 5821021 gene locus_tag LOCUS_58770 5820476 5821021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 5821018 5821905 gene locus_tag LOCUS_58780 5821018 5821905 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112261.1 protein_id gnl|my_center|LOCUS_58780 5822832 5821900 gene locus_tag LOCUS_58790 5822832 5821900 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112734.1 protein_id gnl|my_center|LOCUS_58790 5823206 5822829 gene locus_tag LOCUS_58800 5823206 5822829 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112732.1 protein_id gnl|my_center|LOCUS_58800 5823370 5823675 gene locus_tag LOCUS_58810 5823370 5823675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58810 5824238 5823672 gene locus_tag LOCUS_58820 5824238 5823672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 5824542 5824153 gene locus_tag LOCUS_58830 5824542 5824153 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_58830 5825351 5824785 gene locus_tag LOCUS_58840 gene hsaB 5825351 5824785 CDS product flavin-dependent monooxygenase reductase subunit HsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419374.1 protein_id gnl|my_center|LOCUS_58840 5826265 5825363 gene locus_tag LOCUS_58850 gene hsaC 5826265 5825363 CDS product iron-dependent extradiol dioxygenase HsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419378.1 protein_id gnl|my_center|LOCUS_58850 5827149 5826262 gene locus_tag LOCUS_58860 5827149 5826262 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419381.1 protein_id gnl|my_center|LOCUS_58860 5828333 5827149 gene locus_tag LOCUS_58870 gene hsaA 5828333 5827149 CDS product flavin-dependent monooxygenase oxygenase subunit HsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419383.1 protein_id gnl|my_center|LOCUS_58870 5828527 5829603 gene locus_tag LOCUS_58880 gene kshB 5828527 5829603 CDS product 3-ketosteroid-9-alpha-hydroxylase reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900102.1 protein_id gnl|my_center|LOCUS_58880 5829649 5830179 gene locus_tag LOCUS_58890 5829649 5830179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419389.1 protein_id gnl|my_center|LOCUS_58890 5832330 5830195 gene locus_tag LOCUS_58900 5832330 5830195 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419394.1 protein_id gnl|my_center|LOCUS_58900 5832612 5833214 gene locus_tag LOCUS_58910 gene kstR 5832612 5833214 CDS product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419397.1 protein_id gnl|my_center|LOCUS_58910 5834300 5833221 gene locus_tag LOCUS_58920 5834300 5833221 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419400.1 protein_id gnl|my_center|LOCUS_58920 5835463 5834312 gene locus_tag LOCUS_58930 5835463 5834312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58930 5835718 5835476 gene locus_tag LOCUS_58940 5835718 5835476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 5835835 5836743 gene locus_tag LOCUS_58950 5835835 5836743 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907680.1 protein_id gnl|my_center|LOCUS_58950 5836752 5837570 gene locus_tag LOCUS_58960 5836752 5837570 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175266318.1 protein_id gnl|my_center|LOCUS_58960 5837567 5838418 gene locus_tag LOCUS_58970 5837567 5838418 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907678.1 protein_id gnl|my_center|LOCUS_58970 5838505 5839221 gene locus_tag LOCUS_58980 5838505 5839221 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900105.1 protein_id gnl|my_center|LOCUS_58980 5839236 5839985 gene locus_tag LOCUS_58990 5839236 5839985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58990 5840004 5840762 gene locus_tag LOCUS_59000 5840004 5840762 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907677.1 protein_id gnl|my_center|LOCUS_59000 5840762 5841253 gene locus_tag LOCUS_59010 5840762 5841253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59010 5841250 5841681 gene locus_tag LOCUS_59020 5841250 5841681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59020 5841704 5842945 gene locus_tag LOCUS_59030 5841704 5842945 CDS product arsenic transport integral membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419420.1 protein_id gnl|my_center|LOCUS_59030 5843900 5842968 gene locus_tag LOCUS_59040 gene rlmB 5843900 5842968 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900107.1 protein_id gnl|my_center|LOCUS_59040 5845259 5843901 gene locus_tag LOCUS_59050 gene cysS 5845259 5843901 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900108.1 protein_id gnl|my_center|LOCUS_59050 5845790 5845365 gene locus_tag LOCUS_59060 gene ispF 5845790 5845365 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419432.1 protein_id gnl|my_center|LOCUS_59060 5846542 5845859 gene locus_tag LOCUS_59070 gene ispD 5846542 5845859 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419436.1 protein_id gnl|my_center|LOCUS_59070 5847047 5846559 gene locus_tag LOCUS_59080 gene carD 5847047 5846559 CDS product RNA polymerase-binding transcription factor CarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419482.1 protein_id gnl|my_center|LOCUS_59080 5847490 5848047 gene locus_tag LOCUS_59090 5847490 5848047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900715.1 protein_id gnl|my_center|LOCUS_59090 5848089 5849564 gene locus_tag LOCUS_59100 gene radA 5848089 5849564 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419487.1 protein_id gnl|my_center|LOCUS_59100 5849583 5850659 gene locus_tag LOCUS_59110 gene disA 5849583 5850659 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950916.1 protein_id gnl|my_center|LOCUS_59110 5851492 5850671 gene locus_tag LOCUS_59120 5851492 5850671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419490.1 protein_id gnl|my_center|LOCUS_59120 5852208 5851582 gene locus_tag LOCUS_59130 gene canB 5852208 5851582 CDS product beta-carbonic anhydrase CanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419492.1 protein_id gnl|my_center|LOCUS_59130 5852186 5853109 gene locus_tag LOCUS_59140 5852186 5853109 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419495.1 protein_id gnl|my_center|LOCUS_59140 5853548 5854948 gene locus_tag LOCUS_59150 5853548 5854948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59150 5854974 5857571 gene locus_tag LOCUS_59160 5854974 5857571 CDS product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234917.1 protein_id gnl|my_center|LOCUS_59160 5857562 5857885 gene locus_tag LOCUS_59170 5857562 5857885 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404784.1 protein_id gnl|my_center|LOCUS_59170 5858223 5858525 gene locus_tag LOCUS_59180 5858223 5858525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59180 5858600 5859469 gene locus_tag LOCUS_59190 5858600 5859469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444911.1 protein_id gnl|my_center|LOCUS_59190 5859570 5860811 gene locus_tag LOCUS_59200 5859570 5860811 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085251832.1 protein_id gnl|my_center|LOCUS_59200 5861021 5860704 gene locus_tag LOCUS_59210 5861021 5860704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 5861282 5861100 gene locus_tag LOCUS_59220 5861282 5861100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 5861634 5861398 gene locus_tag LOCUS_59230 5861634 5861398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 5862349 5861585 gene locus_tag LOCUS_59240 5862349 5861585 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419499.1 protein_id gnl|my_center|LOCUS_59240 5862405 5862722 gene locus_tag LOCUS_59250 gene mhuD 5862405 5862722 CDS product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419501.1 protein_id gnl|my_center|LOCUS_59250 5862697 5864067 gene locus_tag LOCUS_59260 5862697 5864067 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886178.1 protein_id gnl|my_center|LOCUS_59260 5864093 5864578 gene locus_tag LOCUS_59270 5864093 5864578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 5864887 5864594 gene locus_tag LOCUS_59280 5864887 5864594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59280 5866452 5864884 gene locus_tag LOCUS_59290 5866452 5864884 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811563.1 protein_id gnl|my_center|LOCUS_59290 5866999 5866517 gene locus_tag LOCUS_59300 5866999 5866517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59300 5868317 5867784 gene locus_tag LOCUS_59310 5868317 5867784 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897489.1 protein_id gnl|my_center|LOCUS_59310 5869116 5868325 gene locus_tag LOCUS_59320 5869116 5868325 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731030.1 protein_id gnl|my_center|LOCUS_59320 5869316 5869107 gene locus_tag LOCUS_59330 5869316 5869107 CDS product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897491.1 protein_id gnl|my_center|LOCUS_59330 5869890 5869678 gene locus_tag LOCUS_59340 5869890 5869678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 5870073 5869900 gene locus_tag LOCUS_59350 5870073 5869900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59350 5870675 5870178 gene locus_tag LOCUS_59360 5870675 5870178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59360 5873424 5870878 gene locus_tag LOCUS_59370 gene clpC1 5873424 5870878 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419511.1 protein_id gnl|my_center|LOCUS_59370 5874143 5873802 gene locus_tag LOCUS_59380 gene lsr2 5874143 5873802 CDS product iron-regulated nucleoid-associated protein Lsr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419513.1 protein_id gnl|my_center|LOCUS_59380 5875754 5874258 gene locus_tag LOCUS_59390 gene lysS 5875754 5874258 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419514.1 protein_id gnl|my_center|LOCUS_59390 5876694 5875876 gene locus_tag LOCUS_59400 5876694 5875876 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419517.1 protein_id gnl|my_center|LOCUS_59400 5877116 5876697 gene locus_tag LOCUS_59410 5877116 5876697 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907615.1 protein_id gnl|my_center|LOCUS_59410 5878075 5877128 gene locus_tag LOCUS_59420 gene panC 5878075 5877128 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419526.1 protein_id gnl|my_center|LOCUS_59420 5878983 5878072 gene locus_tag LOCUS_59430 5878983 5878072 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419533.1 protein_id gnl|my_center|LOCUS_59430 5880381 5879086 gene locus_tag LOCUS_59440 5880381 5879086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899595.1 protein_id gnl|my_center|LOCUS_59440 5881026 5880550 gene locus_tag LOCUS_59450 5881026 5880550 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419535.1 protein_id gnl|my_center|LOCUS_59450 5881553 5881026 gene locus_tag LOCUS_59460 gene folK 5881553 5881026 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419536.1 protein_id gnl|my_center|LOCUS_59460 5881951 5881550 gene locus_tag LOCUS_59470 gene folB 5881951 5881550 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419537.1 protein_id gnl|my_center|LOCUS_59470 5882762 5881944 gene locus_tag LOCUS_59480 gene folP 5882762 5881944 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907608.1 protein_id gnl|my_center|LOCUS_59480 5883391 5882783 gene locus_tag LOCUS_59490 gene folE 5883391 5882783 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899597.1 protein_id gnl|my_center|LOCUS_59490 5885630 5883408 gene locus_tag LOCUS_59500 gene ftsH 5885630 5883408 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419543.1 protein_id gnl|my_center|LOCUS_59500 5885752 5886855 gene locus_tag LOCUS_59510 gene ephA 5885752 5886855 CDS product epoxide hydrolase EphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899600.1 protein_id gnl|my_center|LOCUS_59510 5886849 5887943 gene locus_tag LOCUS_59520 5886849 5887943 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899601.1 protein_id gnl|my_center|LOCUS_59520 5888042 5889055 gene locus_tag LOCUS_59530 5888042 5889055 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731043.1 protein_id gnl|my_center|LOCUS_59530 5889140 5889529 gene locus_tag LOCUS_59540 5889140 5889529 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_59540 5889444 5890010 gene locus_tag LOCUS_59550 5889444 5890010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 5891277 5890021 gene locus_tag LOCUS_59560 5891277 5890021 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900723.1 protein_id gnl|my_center|LOCUS_59560 5891589 5891290 gene locus_tag LOCUS_59570 5891589 5891290 CDS product PE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899605.1 protein_id gnl|my_center|LOCUS_59570 5892569 5892285 gene locus_tag LOCUS_59580 gene esxN 5892569 5892285 CDS product effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408840.1 protein_id gnl|my_center|LOCUS_59580 5892904 5892608 gene locus_tag LOCUS_59590 gene esxJ 5892904 5892608 CDS product type VII secretion system ESX-5 protein EsxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900502.1 protein_id gnl|my_center|LOCUS_59590 5893242 5893036 gene locus_tag LOCUS_59600 5893242 5893036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59600 5894276 5893239 gene locus_tag LOCUS_59610 5894276 5893239 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900723.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59610 5894589 5894290 gene locus_tag LOCUS_59620 5894589 5894290 CDS product PE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899605.1 protein_id gnl|my_center|LOCUS_59620 5895460 5896158 gene locus_tag LOCUS_59630 5895460 5896158 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899606.1 protein_id gnl|my_center|LOCUS_59630 5896792 5896184 gene locus_tag LOCUS_59640 gene hpt 5896792 5896184 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419558.1 protein_id gnl|my_center|LOCUS_59640 5897817 5896846 gene locus_tag LOCUS_59650 gene tilS 5897817 5896846 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899608.1 protein_id gnl|my_center|LOCUS_59650 5898875 5897796 gene locus_tag LOCUS_59660 5898875 5897796 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419571.1 protein_id gnl|my_center|LOCUS_59660 5900236 5898851 gene locus_tag LOCUS_59670 gene dacB 5900236 5898851 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899610.1 protein_id gnl|my_center|LOCUS_59670 5900377 5900865 gene locus_tag LOCUS_59680 5900377 5900865 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907600.1 protein_id gnl|my_center|LOCUS_59680 5901950 5900874 gene locus_tag LOCUS_59690 5901950 5900874 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419580.1 protein_id gnl|my_center|LOCUS_59690 5902181 5903389 gene locus_tag LOCUS_59700 5902181 5903389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419582.1 protein_id gnl|my_center|LOCUS_59700 5903437 5904138 gene locus_tag LOCUS_59710 5903437 5904138 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419585.1 protein_id gnl|my_center|LOCUS_59710 5904135 5904476 gene locus_tag LOCUS_59720 5904135 5904476 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419590.1 protein_id gnl|my_center|LOCUS_59720 5905358 5904492 gene locus_tag LOCUS_59730 gene galE1 5905358 5904492 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419610.1 protein_id gnl|my_center|LOCUS_59730 5905287 5905466 gene locus_tag LOCUS_59740 5905287 5905466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 5905469 5907253 gene locus_tag LOCUS_59750 5905469 5907253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419613.1 protein_id gnl|my_center|LOCUS_59750 5907395 5908591 gene locus_tag LOCUS_59760 5907395 5908591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_59760 5908588 5909196 gene locus_tag LOCUS_59770 5908588 5909196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59770 5909665 5910921 gene locus_tag LOCUS_59780 5909665 5910921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59780 5911484 5910918 gene locus_tag LOCUS_59790 5911484 5910918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59790 5911788 5911399 gene locus_tag LOCUS_59800 5911788 5911399 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_59800 5911949 5912098 gene locus_tag LOCUS_59810 5911949 5912098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59810 5912095 5912907 gene locus_tag LOCUS_59820 gene istB 5912095 5912907 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_59820 5913147 5912956 gene locus_tag LOCUS_59830 5913147 5912956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 5915842 5913563 gene locus_tag LOCUS_59840 gene espK 5915842 5913563 CDS product type VII secretion system ESX-1 associated protein EspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950952.1 protein_id gnl|my_center|LOCUS_59840 5916598 5916251 gene locus_tag LOCUS_59850 gene espL 5916598 5916251 CDS product type VII secretion system ESX-1 associated protein EspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399988.1 protein_id gnl|my_center|LOCUS_59850 5917999 5916635 gene locus_tag LOCUS_59860 gene espB 5917999 5916635 CDS product type VII secretion system ESX-1 target EspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950953.1 protein_id gnl|my_center|LOCUS_59860 5919496 5918099 gene locus_tag LOCUS_59870 gene eccE1 5919496 5918099 CDS product type VII secretion system ESX-1 subunit EccE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400000.1 protein_id gnl|my_center|LOCUS_59870 5920833 5919493 gene locus_tag LOCUS_59880 gene mycP1 5920833 5919493 CDS product type VII secretion system ESX-1 serine protease mycosin MycP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400004.1 protein_id gnl|my_center|LOCUS_59880 5922928 5921090 gene locus_tag LOCUS_59890 gene eccA2 5922928 5921090 CDS product type VII secretion system ESX-2 AAA family ATPase EccA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400005.1 protein_id gnl|my_center|LOCUS_59890 5924614 5923073 gene locus_tag LOCUS_59900 gene eccE2 5924614 5923073 CDS product type VII secretion system ESX-2 subunit EccE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902572.1 protein_id gnl|my_center|LOCUS_59900 5926041 5924674 gene locus_tag LOCUS_59910 5926041 5924674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59910 5926939 5926397 gene locus_tag LOCUS_59920 5926939 5926397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59920 5927848 5926949 gene locus_tag LOCUS_59930 5927848 5926949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59930 5928639 5927845 gene locus_tag LOCUS_59940 5928639 5927845 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899748.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59940 5929419 5928964 gene locus_tag LOCUS_59950 5929419 5928964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59950 5929408 5929797 gene locus_tag LOCUS_59960 5929408 5929797 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422389.1 protein_id gnl|my_center|LOCUS_59960 5929712 5930278 gene locus_tag LOCUS_59970 5929712 5930278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59970 5930750 5930313 gene locus_tag LOCUS_59980 5930750 5930313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59980 5931198 5930824 gene locus_tag LOCUS_59990 5931198 5930824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59990 5931493 5931203 gene locus_tag LOCUS_60000 gene esxE 5931493 5931203 CDS product pore-forming CpnT exporter EsxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400094.1 protein_id gnl|my_center|LOCUS_60000 5931797 5931486 gene locus_tag LOCUS_60010 gene esxF 5931797 5931486 CDS product pore-forming CpnT exporter EsxF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400100.1 protein_id gnl|my_center|LOCUS_60010 5932396 5931908 gene locus_tag LOCUS_60020 5932396 5931908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60020 5934431 5932476 gene locus_tag LOCUS_60030 5934431 5932476 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950653.1 protein_id gnl|my_center|LOCUS_60030 5935156 5934842 gene locus_tag LOCUS_60040 5935156 5934842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60040 5935485 5935348 gene locus_tag LOCUS_60050 5935485 5935348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_60050 5935797 5935558 gene locus_tag LOCUS_60060 5935797 5935558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_60060 5937267 5935822 gene locus_tag LOCUS_60070 5937267 5935822 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400120.1 protein_id gnl|my_center|LOCUS_60070 5937604 5938179 gene locus_tag LOCUS_60080 5937604 5938179 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400124.1 protein_id gnl|my_center|LOCUS_60080 5938206 5940557 gene locus_tag LOCUS_60090 5938206 5940557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950965.1 protein_id gnl|my_center|LOCUS_60090 5940554 5944216 gene locus_tag LOCUS_60100 gene murJ 5940554 5944216 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902580.1 protein_id gnl|my_center|LOCUS_60100 5944401 5944213 gene locus_tag LOCUS_60110 5944401 5944213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60110 5944342 5945001 gene locus_tag LOCUS_60120 gene sigM 5944342 5945001 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400144.1 protein_id gnl|my_center|LOCUS_60120 5946013 5944979 gene locus_tag LOCUS_60130 5946013 5944979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60130 5946268 5946026 gene locus_tag LOCUS_60140 5946268 5946026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60140 5946435 5947655 gene locus_tag LOCUS_60150 gene cwlM 5946435 5947655 CDS product N-acetylmuramoyl-L-alanine amidase CwlM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400168.1 protein_id gnl|my_center|LOCUS_60150 5948459 5947695 gene locus_tag LOCUS_60160 5948459 5947695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400171.1 protein_id gnl|my_center|LOCUS_60160 5949881 5948898 gene locus_tag LOCUS_60170 5949881 5948898 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400175.1 protein_id gnl|my_center|LOCUS_60170 5951011 5949878 gene locus_tag LOCUS_60180 gene parA 5951011 5949878 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400180.1 protein_id gnl|my_center|LOCUS_60180 5951694 5951008 gene locus_tag LOCUS_60190 gene rsmG 5951694 5951008 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899763.1 protein_id gnl|my_center|LOCUS_60190 5952395 5951847 gene locus_tag LOCUS_60200 5952395 5951847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899764.1 protein_id gnl|my_center|LOCUS_60200 5953624 5952509 gene locus_tag LOCUS_60210 gene yidC 5953624 5952509 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899765.1 protein_id gnl|my_center|LOCUS_60210 5954305 5953943 gene locus_tag LOCUS_60220 gene rnpA 5954305 5953943 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899767.1 protein_id gnl|my_center|LOCUS_60220 5954754 5954969 gene locus_tag LOCUS_60230 5954754 5954969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 5954982 5956016 gene locus_tag LOCUS_60240 5954982 5956016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240