>Feature sequence1 <1 8696 gene locus_tag LOCUS_00010 <1 8696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004552911.1:trimeric autotransporter adhesin BpaB 9042 10508 gene locus_tag LOCUS_00020 gene ccoN 9042 10508 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851405.1 protein_id gnl|my_center|LOCUS_00020 10520 11188 gene locus_tag LOCUS_00030 gene ccoO 10520 11188 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851187.1 protein_id gnl|my_center|LOCUS_00030 11203 11424 gene locus_tag LOCUS_00040 11203 11424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 11428 12342 gene locus_tag LOCUS_00050 11428 12342 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851306.1 protein_id gnl|my_center|LOCUS_00050 12354 12572 gene locus_tag LOCUS_00060 12354 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 12680 13330 gene locus_tag LOCUS_00070 12680 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851454.1 protein_id gnl|my_center|LOCUS_00070 13327 13815 gene locus_tag LOCUS_00080 13327 13815 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851150.1 protein_id gnl|my_center|LOCUS_00080 13815 16226 gene locus_tag LOCUS_00090 13815 16226 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891938.1 protein_id gnl|my_center|LOCUS_00090 16223 18994 gene locus_tag LOCUS_00100 16223 18994 CDS product RecB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864468.1 protein_id gnl|my_center|LOCUS_00100 19537 19370 gene locus_tag LOCUS_00110 19537 19370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 22143 20308 gene locus_tag LOCUS_00120 22143 20308 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852169.1 protein_id gnl|my_center|LOCUS_00120 22551 22150 gene locus_tag LOCUS_00130 22551 22150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 23407 22607 gene locus_tag LOCUS_00140 23407 22607 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852452.1 protein_id gnl|my_center|LOCUS_00140 24501 23404 gene locus_tag LOCUS_00150 24501 23404 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908758.1 protein_id gnl|my_center|LOCUS_00150 25144 24503 gene locus_tag LOCUS_00160 25144 24503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 25539 25141 gene locus_tag LOCUS_00170 gene mscL 25539 25141 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054763.1 protein_id gnl|my_center|LOCUS_00170 25638 26939 gene locus_tag LOCUS_00180 gene gltX 25638 26939 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871824.1 protein_id gnl|my_center|LOCUS_00180 26936 27229 gene locus_tag LOCUS_00190 26936 27229 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_00190 27207 28835 gene locus_tag LOCUS_00200 27207 28835 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864855.1 protein_id gnl|my_center|LOCUS_00200 30838 29513 gene locus_tag LOCUS_00210 gene hcp 30838 29513 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098308124.1 protein_id gnl|my_center|LOCUS_00210 31072 31824 gene locus_tag LOCUS_00220 31072 31824 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852646.1 protein_id gnl|my_center|LOCUS_00220 31825 33498 gene locus_tag LOCUS_00230 31825 33498 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852459.1 protein_id gnl|my_center|LOCUS_00230 33495 34568 gene locus_tag LOCUS_00240 gene trmA 33495 34568 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890843.1 protein_id gnl|my_center|LOCUS_00240 34565 36178 gene locus_tag LOCUS_00250 34565 36178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 36190 36906 gene locus_tag LOCUS_00260 36190 36906 CDS product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853237.1 protein_id gnl|my_center|LOCUS_00260 39131 37881 gene locus_tag LOCUS_00270 39131 37881 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851458.1 protein_id gnl|my_center|LOCUS_00270 39976 39128 gene locus_tag LOCUS_00280 gene hisS 39976 39128 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852541.1 protein_id gnl|my_center|LOCUS_00280 40121 41941 gene locus_tag LOCUS_00290 gene ciaB 40121 41941 CDS product invasion protein CiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858322.1 protein_id gnl|my_center|LOCUS_00290 42170 42721 gene locus_tag LOCUS_00300 42170 42721 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851269.1 protein_id gnl|my_center|LOCUS_00300 42721 43833 gene locus_tag LOCUS_00310 gene carA 42721 43833 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851156.1 protein_id gnl|my_center|LOCUS_00310 43830 44495 gene locus_tag LOCUS_00320 43830 44495 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851528.1 protein_id gnl|my_center|LOCUS_00320 44492 45706 gene locus_tag LOCUS_00330 44492 45706 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851243.1 protein_id gnl|my_center|LOCUS_00330 45703 46380 gene locus_tag LOCUS_00340 45703 46380 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_00340 47400 47215 gene locus_tag LOCUS_00350 47400 47215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 49397 48051 gene locus_tag LOCUS_00360 gene purF 49397 48051 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851896.1 protein_id gnl|my_center|LOCUS_00360 50161 49385 gene locus_tag LOCUS_00370 gene dapB 50161 49385 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851754.1 protein_id gnl|my_center|LOCUS_00370 53268 50191 gene locus_tag LOCUS_00380 53268 50191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 53338 54405 gene locus_tag LOCUS_00390 53338 54405 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858664.1 protein_id gnl|my_center|LOCUS_00390 54439 54876 gene locus_tag LOCUS_00400 gene fabZ 54439 54876 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857452.1 protein_id gnl|my_center|LOCUS_00400 54876 55658 gene locus_tag LOCUS_00410 gene lpxA 54876 55658 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851756.1 protein_id gnl|my_center|LOCUS_00410 55658 56893 gene locus_tag LOCUS_00420 gene clpX 55658 56893 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891849.1 protein_id gnl|my_center|LOCUS_00420 56884 57918 gene locus_tag LOCUS_00430 56884 57918 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891850.1 protein_id gnl|my_center|LOCUS_00430 57911 58657 gene locus_tag LOCUS_00440 gene mreC 57911 58657 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864583.1 protein_id gnl|my_center|LOCUS_00440 58657 61917 gene locus_tag LOCUS_00450 gene carB 58657 61917 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858661.1 protein_id gnl|my_center|LOCUS_00450 61942 62367 gene locus_tag LOCUS_00460 61942 62367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 65367 62956 gene locus_tag LOCUS_00470 65367 62956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 65665 66219 gene locus_tag LOCUS_00480 65665 66219 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_00480 67822 66455 gene locus_tag LOCUS_00490 gene ccoG 67822 66455 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858753.1 protein_id gnl|my_center|LOCUS_00490 67988 68767 gene locus_tag LOCUS_00500 67988 68767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 70188 68893 gene locus_tag LOCUS_00510 gene rho 70188 68893 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852852.1 protein_id gnl|my_center|LOCUS_00510 70674 70282 gene locus_tag LOCUS_00520 70674 70282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 71036 70671 gene locus_tag LOCUS_00530 71036 70671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 71470 71213 gene locus_tag LOCUS_00540 gene rpmA 71470 71213 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800974.1 protein_id gnl|my_center|LOCUS_00540 71790 71482 gene locus_tag LOCUS_00550 gene rplU 71790 71482 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002778820.1 protein_id gnl|my_center|LOCUS_00550 72275 71940 gene locus_tag LOCUS_00560 72275 71940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 72375 72244 gene locus_tag LOCUS_00570 72375 72244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 72618 73052 gene locus_tag LOCUS_00580 72618 73052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 73049 76102 gene locus_tag LOCUS_00590 gene ccsA 73049 76102 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852963.1 protein_id gnl|my_center|LOCUS_00590 76309 77097 gene locus_tag LOCUS_00600 76309 77097 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_00600 77173 77340 gene locus_tag LOCUS_00610 77173 77340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 78217 77660 gene locus_tag LOCUS_00620 78217 77660 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856055.1 protein_id gnl|my_center|LOCUS_00620 78783 78217 gene locus_tag LOCUS_00630 78783 78217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 80345 78792 gene locus_tag LOCUS_00640 gene rny 80345 78792 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858133.1 protein_id gnl|my_center|LOCUS_00640 80901 80278 gene locus_tag LOCUS_00650 80901 80278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 80949 81506 gene locus_tag LOCUS_00660 80949 81506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 81506 82372 gene locus_tag LOCUS_00670 gene ftsY 81506 82372 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864556.1 protein_id gnl|my_center|LOCUS_00670 83615 82617 gene locus_tag LOCUS_00680 83615 82617 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852104.1 protein_id gnl|my_center|LOCUS_00680 84128 83631 gene locus_tag LOCUS_00690 84128 83631 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858543.1 protein_id gnl|my_center|LOCUS_00690 84915 84130 gene locus_tag LOCUS_00700 gene trpC 84915 84130 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854779.1 protein_id gnl|my_center|LOCUS_00700 86153 84912 gene locus_tag LOCUS_00710 86153 84912 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855132.1 protein_id gnl|my_center|LOCUS_00710 86857 86150 gene locus_tag LOCUS_00720 86857 86150 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864161.1 protein_id gnl|my_center|LOCUS_00720 87807 86854 gene locus_tag LOCUS_00730 87807 86854 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856867.1 protein_id gnl|my_center|LOCUS_00730 87882 89105 gene locus_tag LOCUS_00740 87882 89105 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_00740 90483 89161 gene locus_tag LOCUS_00750 90483 89161 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 protein_id gnl|my_center|LOCUS_00750 92356 91676 gene locus_tag LOCUS_00760 92356 91676 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860322.1 protein_id gnl|my_center|LOCUS_00760 93114 92341 gene locus_tag LOCUS_00770 gene surE 93114 92341 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854555.1 protein_id gnl|my_center|LOCUS_00770 93620 93111 gene locus_tag LOCUS_00780 93620 93111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 93695 94729 gene locus_tag LOCUS_00790 gene lpxB 93695 94729 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858730.1 protein_id gnl|my_center|LOCUS_00790 94831 95319 gene locus_tag LOCUS_00800 gene greA 94831 95319 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858660.1 protein_id gnl|my_center|LOCUS_00800 95330 96337 gene locus_tag LOCUS_00810 gene argC 95330 96337 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_00810 96327 97046 gene locus_tag LOCUS_00820 96327 97046 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858657.1 protein_id gnl|my_center|LOCUS_00820 97064 97687 gene locus_tag LOCUS_00830 gene serB 97064 97687 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851598.1 protein_id gnl|my_center|LOCUS_00830 97680 98684 gene locus_tag LOCUS_00840 97680 98684 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851728.1 protein_id gnl|my_center|LOCUS_00840 98687 99895 gene locus_tag LOCUS_00850 98687 99895 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_00850 99961 100497 gene locus_tag LOCUS_00860 99961 100497 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002791314.1 protein_id gnl|my_center|LOCUS_00860 100506 101168 gene locus_tag LOCUS_00870 gene pth 100506 101168 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858659.1 protein_id gnl|my_center|LOCUS_00870 101165 102226 gene locus_tag LOCUS_00880 101165 102226 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858697.1 protein_id gnl|my_center|LOCUS_00880 102383 103009 gene locus_tag LOCUS_00890 102383 103009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00890 103060 103566 gene locus_tag LOCUS_00900 103060 103566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00900 103563 104348 gene locus_tag LOCUS_00910 103563 104348 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858702.1 protein_id gnl|my_center|LOCUS_00910 104332 105411 gene locus_tag LOCUS_00920 gene pheA 104332 105411 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858741.1 protein_id gnl|my_center|LOCUS_00920 105408 106508 gene locus_tag LOCUS_00930 gene hisC 105408 106508 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858650.1 protein_id gnl|my_center|LOCUS_00930 106513 108336 gene locus_tag LOCUS_00940 gene dxs 106513 108336 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858717.1 protein_id gnl|my_center|LOCUS_00940 108404 108814 gene locus_tag LOCUS_00950 gene perR 108404 108814 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858684.1 protein_id gnl|my_center|LOCUS_00950 108862 110061 gene locus_tag LOCUS_00960 108862 110061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 110061 110777 gene locus_tag LOCUS_00970 gene ubiE 110061 110777 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858648.1 protein_id gnl|my_center|LOCUS_00970 110848 112011 gene locus_tag LOCUS_00980 gene xseA 110848 112011 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851089.1 protein_id gnl|my_center|LOCUS_00980 112021 113100 gene locus_tag LOCUS_00990 gene serC 112021 113100 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858670.1 protein_id gnl|my_center|LOCUS_00990 113191 113559 gene locus_tag LOCUS_01000 113191 113559 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858673.1 protein_id gnl|my_center|LOCUS_01000 114679 113579 gene locus_tag LOCUS_01010 114679 113579 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864601.1 protein_id gnl|my_center|LOCUS_01010 114700 115773 gene locus_tag LOCUS_01020 114700 115773 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858282.1 protein_id gnl|my_center|LOCUS_01020 115703 116923 gene locus_tag LOCUS_01030 115703 116923 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891920.1 protein_id gnl|my_center|LOCUS_01030 116923 118098 gene locus_tag LOCUS_01040 gene trmB 116923 118098 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858203.1 protein_id gnl|my_center|LOCUS_01040 118086 118775 gene locus_tag LOCUS_01050 118086 118775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853534.1 protein_id gnl|my_center|LOCUS_01050 118772 119587 gene locus_tag LOCUS_01060 118772 119587 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853622.1 protein_id gnl|my_center|LOCUS_01060 119584 120891 gene locus_tag LOCUS_01070 119584 120891 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853860.1 protein_id gnl|my_center|LOCUS_01070 120942 121655 gene locus_tag LOCUS_01080 gene pyrH 120942 121655 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858454.1 protein_id gnl|my_center|LOCUS_01080 121668 121892 gene locus_tag LOCUS_01090 121668 121892 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853464.1 protein_id gnl|my_center|LOCUS_01090 121864 124050 gene locus_tag LOCUS_01100 121864 124050 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858057.1 protein_id gnl|my_center|LOCUS_01100 124061 125272 gene locus_tag LOCUS_01110 gene tyrS 124061 125272 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858315.1 protein_id gnl|my_center|LOCUS_01110 125282 126373 gene locus_tag LOCUS_01120 125282 126373 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857924.1 protein_id gnl|my_center|LOCUS_01120 126357 127640 gene locus_tag LOCUS_01130 126357 127640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 127640 129643 gene locus_tag LOCUS_01140 gene mnmC 127640 129643 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853221.1 protein_id gnl|my_center|LOCUS_01140 131079 130102 gene locus_tag LOCUS_01150 131079 130102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 131825 131082 gene locus_tag LOCUS_01160 gene trpA 131825 131082 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854645.1 protein_id gnl|my_center|LOCUS_01160 132999 131818 gene locus_tag LOCUS_01170 gene trpB 132999 131818 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854204.1 protein_id gnl|my_center|LOCUS_01170 133655 133050 gene locus_tag LOCUS_01180 133655 133050 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858740.1 protein_id gnl|my_center|LOCUS_01180 133781 134095 gene locus_tag LOCUS_01190 133781 134095 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855637.1 protein_id gnl|my_center|LOCUS_01190 134080 134802 gene locus_tag LOCUS_01200 134080 134802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855633.1 protein_id gnl|my_center|LOCUS_01200 134807 135295 gene locus_tag LOCUS_01210 gene fldA 134807 135295 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855629.1 protein_id gnl|my_center|LOCUS_01210 136194 135292 gene locus_tag LOCUS_01220 136194 135292 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853222.1 protein_id gnl|my_center|LOCUS_01220 137213 136191 gene locus_tag LOCUS_01230 gene hemE 137213 136191 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853233.1 protein_id gnl|my_center|LOCUS_01230 137745 137260 gene locus_tag LOCUS_01240 137745 137260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 137841 138437 gene locus_tag LOCUS_01250 137841 138437 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174663.1 protein_id gnl|my_center|LOCUS_01250 138492 138971 gene locus_tag LOCUS_01260 gene leuD 138492 138971 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_01260 138981 140048 gene locus_tag LOCUS_01270 gene leuB 138981 140048 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769662.1 protein_id gnl|my_center|LOCUS_01270 140048 140290 gene locus_tag LOCUS_01280 140048 140290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 140287 140916 gene locus_tag LOCUS_01290 140287 140916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852635.1 protein_id gnl|my_center|LOCUS_01290 141011 142024 gene locus_tag LOCUS_01300 141011 142024 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868507.1 protein_id gnl|my_center|LOCUS_01300 142462 143190 gene locus_tag LOCUS_01310 142462 143190 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858695.1 protein_id gnl|my_center|LOCUS_01310 144212 143598 gene locus_tag LOCUS_01320 gene recO 144212 143598 CDS product recombination protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851895.1 protein_id gnl|my_center|LOCUS_01320 145684 144749 gene locus_tag LOCUS_01330 145684 144749 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853293.1 protein_id gnl|my_center|LOCUS_01330 147314 145734 gene locus_tag LOCUS_01340 147314 145734 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891914.1 protein_id gnl|my_center|LOCUS_01340 148891 147314 gene locus_tag LOCUS_01350 gene argS 148891 147314 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891916.1 protein_id gnl|my_center|LOCUS_01350 149089 148895 gene locus_tag LOCUS_01360 149089 148895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 149307 149116 gene locus_tag LOCUS_01370 149307 149116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 149925 149317 gene locus_tag LOCUS_01380 gene gmk 149925 149317 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860253.1 protein_id gnl|my_center|LOCUS_01380 151233 149935 gene locus_tag LOCUS_01390 151233 149935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 151380 152219 gene locus_tag LOCUS_01400 gene purU 151380 152219 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852510.1 protein_id gnl|my_center|LOCUS_01400 152219 152704 gene locus_tag LOCUS_01410 152219 152704 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852450.1 protein_id gnl|my_center|LOCUS_01410 152701 154014 gene locus_tag LOCUS_01420 152701 154014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 154028 156052 gene locus_tag LOCUS_01430 gene glyS 154028 156052 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858294.1 protein_id gnl|my_center|LOCUS_01430 157037 156231 gene locus_tag LOCUS_01440 157037 156231 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056925.1 protein_id gnl|my_center|LOCUS_01440 157247 159874 gene locus_tag LOCUS_01450 gene gyrA 157247 159874 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857904.1 protein_id gnl|my_center|LOCUS_01450 159861 160889 gene locus_tag LOCUS_01460 159861 160889 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852931.1 protein_id gnl|my_center|LOCUS_01460 161710 161315 gene locus_tag LOCUS_01470 161710 161315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 163720 162422 gene locus_tag LOCUS_01480 163720 162422 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249937.1 protein_id gnl|my_center|LOCUS_01480 164130 164054 gene locus_tag LOCUS_t00010 164130 164054 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 164441 164947 gene locus_tag LOCUS_01490 gene petA 164441 164947 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852880.1 protein_id gnl|my_center|LOCUS_01490 164957 166216 gene locus_tag LOCUS_01500 164957 166216 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852758.1 protein_id gnl|my_center|LOCUS_01500 166219 167322 gene locus_tag LOCUS_01510 166219 167322 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864542.1 protein_id gnl|my_center|LOCUS_01510 167440 167757 gene locus_tag LOCUS_01520 167440 167757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 169024 168353 gene locus_tag LOCUS_01530 169024 168353 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964303.1 protein_id gnl|my_center|LOCUS_01530 170049 169027 gene locus_tag LOCUS_01540 170049 169027 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852619.1 protein_id gnl|my_center|LOCUS_01540 170904 170176 gene locus_tag LOCUS_01550 170904 170176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 171485 171015 gene locus_tag LOCUS_01560 171485 171015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 171933 171565 gene locus_tag LOCUS_01570 171933 171565 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_01570 172745 171930 gene locus_tag LOCUS_01580 172745 171930 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233875.1 protein_id gnl|my_center|LOCUS_01580 173565 172738 gene locus_tag LOCUS_01590 173565 172738 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788527.1 protein_id gnl|my_center|LOCUS_01590 176186 173562 gene locus_tag LOCUS_01600 176186 173562 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864150.1 protein_id gnl|my_center|LOCUS_01600 181287 176260 gene locus_tag LOCUS_01610 181287 176260 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842746.1 protein_id gnl|my_center|LOCUS_01610 183484 181334 gene locus_tag LOCUS_01620 gene pbpC 183484 181334 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495148.1 protein_id gnl|my_center|LOCUS_01620 184138 183701 gene locus_tag LOCUS_01630 184138 183701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 184239 184808 gene locus_tag LOCUS_01640 184239 184808 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963243.1 protein_id gnl|my_center|LOCUS_01640 185458 184820 gene locus_tag LOCUS_01650 gene nth 185458 184820 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852225.1 protein_id gnl|my_center|LOCUS_01650 185532 186347 gene locus_tag LOCUS_01660 gene peb4 185532 186347 CDS product peptidylprolyl isomerase PEB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852119.1 protein_id gnl|my_center|LOCUS_01660 186359 187423 gene locus_tag LOCUS_01670 gene fbaA 186359 187423 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852272.1 protein_id gnl|my_center|LOCUS_01670 187433 188605 gene locus_tag LOCUS_01680 187433 188605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 188595 189608 gene locus_tag LOCUS_01690 188595 189608 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858561.1 protein_id gnl|my_center|LOCUS_01690 189614 190480 gene locus_tag LOCUS_01700 189614 190480 CDS product 1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852217.1 protein_id gnl|my_center|LOCUS_01700 190505 191791 gene locus_tag LOCUS_01710 gene hisD 190505 191791 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_01710 193013 192312 gene locus_tag LOCUS_01720 193013 192312 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852959.1 protein_id gnl|my_center|LOCUS_01720 193582 193010 gene locus_tag LOCUS_01730 193582 193010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 194506 193631 gene locus_tag LOCUS_01740 gene sppA 194506 193631 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851869.1 protein_id gnl|my_center|LOCUS_01740 195717 194494 gene locus_tag LOCUS_01750 195717 194494 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851913.1 protein_id gnl|my_center|LOCUS_01750 195803 196270 gene locus_tag LOCUS_01760 gene aroQ 195803 196270 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852001.1 protein_id gnl|my_center|LOCUS_01760 196263 197300 gene locus_tag LOCUS_01770 196263 197300 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677174.1 protein_id gnl|my_center|LOCUS_01770 197297 197803 gene locus_tag LOCUS_01780 gene folK 197297 197803 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851803.1 protein_id gnl|my_center|LOCUS_01780 197806 198564 gene locus_tag LOCUS_01790 gene flhG 197806 198564 CDS product flagella biosynthesis ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851985.1 protein_id gnl|my_center|LOCUS_01790 198574 199167 gene locus_tag LOCUS_01800 198574 199167 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867890.1 protein_id gnl|my_center|LOCUS_01800 199164 200270 gene locus_tag LOCUS_01810 gene mnmA 199164 200270 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851977.1 protein_id gnl|my_center|LOCUS_01810 200304 200591 gene locus_tag LOCUS_01820 200304 200591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 201070 201258 gene locus_tag LOCUS_01830 201070 201258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 201598 202224 gene locus_tag LOCUS_01840 201598 202224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 202257 202520 gene locus_tag LOCUS_01850 202257 202520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 202538 203671 gene locus_tag LOCUS_01860 202538 203671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 203782 204510 gene locus_tag LOCUS_01870 203782 204510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 204523 206121 gene locus_tag LOCUS_01880 204523 206121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 206223 207155 gene locus_tag LOCUS_01890 206223 207155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 207155 208543 gene locus_tag LOCUS_01900 207155 208543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 208715 209425 gene locus_tag LOCUS_01910 208715 209425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 209497 210270 gene locus_tag LOCUS_01920 209497 210270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 210267 213053 gene locus_tag LOCUS_01930 210267 213053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 213170 213505 gene locus_tag LOCUS_01940 213170 213505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 213579 213929 gene locus_tag LOCUS_01950 213579 213929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 213943 214719 gene locus_tag LOCUS_01960 213943 214719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01960 214719 216005 gene locus_tag LOCUS_01970 214719 216005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01970 216251 216997 gene locus_tag LOCUS_01980 216251 216997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 217009 217710 gene locus_tag LOCUS_01990 217009 217710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 217813 218031 gene locus_tag LOCUS_02000 217813 218031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 218043 218825 gene locus_tag LOCUS_02010 218043 218825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 218875 220731 gene locus_tag LOCUS_02020 218875 220731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 220866 221783 gene locus_tag LOCUS_02030 220866 221783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 221948 222850 gene locus_tag LOCUS_02040 221948 222850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 224747 223404 gene locus_tag LOCUS_02050 gene radA 224747 223404 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858434.1 protein_id gnl|my_center|LOCUS_02050 226299 224977 gene locus_tag LOCUS_02060 gene brnQ 226299 224977 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964918.1 protein_id gnl|my_center|LOCUS_02060 226396 227625 gene locus_tag LOCUS_02070 226396 227625 CDS product 2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851311.1 protein_id gnl|my_center|LOCUS_02070 227625 228404 gene locus_tag LOCUS_02080 227625 228404 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085948.1 protein_id gnl|my_center|LOCUS_02080 228397 228600 gene locus_tag LOCUS_02090 228397 228600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 228597 229400 gene locus_tag LOCUS_02100 gene thiF 228597 229400 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858442.1 protein_id gnl|my_center|LOCUS_02100 229402 230166 gene locus_tag LOCUS_02110 229402 230166 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891902.1 protein_id gnl|my_center|LOCUS_02110 230170 231309 gene locus_tag LOCUS_02120 gene thiH 230170 231309 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_02120 231302 231886 gene locus_tag LOCUS_02130 231302 231886 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015812.1 protein_id gnl|my_center|LOCUS_02130 234315 232648 gene locus_tag LOCUS_02140 234315 232648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 234503 235621 gene locus_tag LOCUS_02150 gene tgt 234503 235621 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853029.1 protein_id gnl|my_center|LOCUS_02150 236177 235740 gene locus_tag LOCUS_02160 236177 235740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 237279 236170 gene locus_tag LOCUS_02170 237279 236170 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761791.1 protein_id gnl|my_center|LOCUS_02170 238131 237340 gene locus_tag LOCUS_02180 238131 237340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 239262 238144 gene locus_tag LOCUS_02190 239262 238144 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696510.1 protein_id gnl|my_center|LOCUS_02190 240696 239752 gene locus_tag LOCUS_02200 gene lpxD 240696 239752 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852180.1 protein_id gnl|my_center|LOCUS_02200 241166 240696 gene locus_tag LOCUS_02210 gene ilvN 241166 240696 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852211.1 protein_id gnl|my_center|LOCUS_02210 242861 241176 gene locus_tag LOCUS_02220 242861 241176 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852093.1 protein_id gnl|my_center|LOCUS_02220 243593 243324 gene locus_tag LOCUS_02230 243593 243324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 243737 245173 gene locus_tag LOCUS_02240 gene pta 243737 245173 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891877.1 protein_id gnl|my_center|LOCUS_02240 245173 246372 gene locus_tag LOCUS_02250 245173 246372 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891878.1 protein_id gnl|my_center|LOCUS_02250 246540 248015 gene locus_tag LOCUS_02260 246540 248015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 248127 248462 gene locus_tag LOCUS_02270 248127 248462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 248490 249836 gene locus_tag LOCUS_02280 248490 249836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 249857 250972 gene locus_tag LOCUS_02290 249857 250972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 252000 252518 gene locus_tag LOCUS_02300 252000 252518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 252633 253601 gene locus_tag LOCUS_02310 252633 253601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 258669 253636 gene locus_tag LOCUS_02320 258669 253636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 258863 258726 gene locus_tag LOCUS_02330 258863 258726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 259220 259044 gene locus_tag LOCUS_02340 259220 259044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 259367 259498 gene locus_tag LOCUS_02350 259367 259498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 261268 260189 gene locus_tag LOCUS_02360 gene dnaJ 261268 260189 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853203.1 protein_id gnl|my_center|LOCUS_02360 261376 262050 gene locus_tag LOCUS_02370 261376 262050 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853168.1 protein_id gnl|my_center|LOCUS_02370 262047 263318 gene locus_tag LOCUS_02380 262047 263318 CDS product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857920.1 protein_id gnl|my_center|LOCUS_02380 263308 263877 gene locus_tag LOCUS_02390 gene recR 263308 263877 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853214.1 protein_id gnl|my_center|LOCUS_02390 264221 264442 gene locus_tag LOCUS_02400 264221 264442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 264462 264671 gene locus_tag LOCUS_02410 264462 264671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 265522 264971 gene locus_tag LOCUS_02420 265522 264971 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388051.1 protein_id gnl|my_center|LOCUS_02420 266364 265519 gene locus_tag LOCUS_02430 266364 265519 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854895.1 protein_id gnl|my_center|LOCUS_02430 267488 266367 gene locus_tag LOCUS_02440 267488 266367 CDS product 2-oxoglutarate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858560.1 protein_id gnl|my_center|LOCUS_02440 267801 267493 gene locus_tag LOCUS_02450 267801 267493 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851088.1 protein_id gnl|my_center|LOCUS_02450 268686 267811 gene locus_tag LOCUS_02460 gene sucD 268686 267811 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002872006.1 protein_id gnl|my_center|LOCUS_02460 269849 268686 gene locus_tag LOCUS_02470 gene sucC 269849 268686 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858590.1 protein_id gnl|my_center|LOCUS_02470 270739 269846 gene locus_tag LOCUS_02480 gene mdh 270739 269846 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020863.1 protein_id gnl|my_center|LOCUS_02480 272934 270736 gene locus_tag LOCUS_02490 272934 270736 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858520.1 protein_id gnl|my_center|LOCUS_02490 273972 273034 gene locus_tag LOCUS_02500 gene mltG 273972 273034 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859067.1 protein_id gnl|my_center|LOCUS_02500 274050 276572 gene locus_tag LOCUS_02510 274050 276572 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858480.1 protein_id gnl|my_center|LOCUS_02510 276582 277640 gene locus_tag LOCUS_02520 276582 277640 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852607.1 protein_id gnl|my_center|LOCUS_02520 277743 278258 gene locus_tag LOCUS_02530 277743 278258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 278731 280299 gene locus_tag LOCUS_02540 278731 280299 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411694.1 protein_id gnl|my_center|LOCUS_02540 281742 281293 gene locus_tag LOCUS_02550 281742 281293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 282302 281754 gene locus_tag LOCUS_02560 282302 281754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 283542 282532 gene locus_tag LOCUS_02570 283542 282532 CDS product N-carbamoylputrescine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853261.1 protein_id gnl|my_center|LOCUS_02570 284511 283642 gene locus_tag LOCUS_02580 284511 283642 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853697.1 protein_id gnl|my_center|LOCUS_02580 284668 286002 gene locus_tag LOCUS_02590 284668 286002 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858451.1 protein_id gnl|my_center|LOCUS_02590 286384 287172 gene locus_tag LOCUS_02600 286384 287172 CDS product HrcA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891884.1 protein_id gnl|my_center|LOCUS_02600 287169 287753 gene locus_tag LOCUS_02610 gene grpE 287169 287753 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650844.1 protein_id gnl|my_center|LOCUS_02610 287827 289731 gene locus_tag LOCUS_02620 gene dnaK 287827 289731 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826316.1 protein_id gnl|my_center|LOCUS_02620 291196 290177 gene locus_tag LOCUS_02630 291196 290177 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170771.1 protein_id gnl|my_center|LOCUS_02630 291520 291293 gene locus_tag LOCUS_02640 gene ccoS 291520 291293 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852798.1 protein_id gnl|my_center|LOCUS_02640 293904 291523 gene locus_tag LOCUS_02650 293904 291523 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891913.1 protein_id gnl|my_center|LOCUS_02650 295691 293964 gene locus_tag LOCUS_02660 295691 293964 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858598.1 protein_id gnl|my_center|LOCUS_02660 297972 295783 gene locus_tag LOCUS_02670 297972 295783 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852743.1 protein_id gnl|my_center|LOCUS_02670 298265 297972 gene locus_tag LOCUS_02680 298265 297972 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852892.1 protein_id gnl|my_center|LOCUS_02680 298858 298265 gene locus_tag LOCUS_02690 298858 298265 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852711.1 protein_id gnl|my_center|LOCUS_02690 299320 298859 gene locus_tag LOCUS_02700 gene smpB 299320 298859 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852861.1 protein_id gnl|my_center|LOCUS_02700 300069 299320 gene locus_tag LOCUS_02710 300069 299320 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859130.1 protein_id gnl|my_center|LOCUS_02710 300884 300066 gene locus_tag LOCUS_02720 gene truB 300884 300066 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891909.1 protein_id gnl|my_center|LOCUS_02720 302941 300881 gene locus_tag LOCUS_02730 302941 300881 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891908.1 protein_id gnl|my_center|LOCUS_02730 303404 303000 gene locus_tag LOCUS_02740 303404 303000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 305197 303416 gene locus_tag LOCUS_02750 305197 303416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 306890 305190 gene locus_tag LOCUS_02760 306890 305190 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891907.1 protein_id gnl|my_center|LOCUS_02760 308188 306944 gene locus_tag LOCUS_02770 gene sstT 308188 306944 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263624.1 protein_id gnl|my_center|LOCUS_02770 308323 309531 gene locus_tag LOCUS_02780 gene metK 308323 309531 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852836.1 protein_id gnl|my_center|LOCUS_02780 309929 309669 gene locus_tag LOCUS_02790 309929 309669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 310187 311278 gene locus_tag LOCUS_02800 310187 311278 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857221.1 protein_id gnl|my_center|LOCUS_02800 311384 312604 gene locus_tag LOCUS_02810 311384 312604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02810 313454 312651 gene locus_tag LOCUS_02820 313454 312651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 313749 313447 gene locus_tag LOCUS_02830 313749 313447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 314544 314422 gene locus_tag LOCUS_02840 314544 314422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 314758 315204 gene locus_tag LOCUS_02850 gene tatB 314758 315204 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852097.1 protein_id gnl|my_center|LOCUS_02850 315197 315922 gene locus_tag LOCUS_02860 gene tatC 315197 315922 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852171.1 protein_id gnl|my_center|LOCUS_02860 315915 316934 gene locus_tag LOCUS_02870 gene queA 315915 316934 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852279.1 protein_id gnl|my_center|LOCUS_02870 317942 317109 gene locus_tag LOCUS_02880 317942 317109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693980.1 protein_id gnl|my_center|LOCUS_02880 318753 318208 gene locus_tag LOCUS_02890 318753 318208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 319520 318936 gene locus_tag LOCUS_02900 319520 318936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 319662 320375 gene locus_tag LOCUS_02910 319662 320375 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858436.1 protein_id gnl|my_center|LOCUS_02910 321475 320537 gene locus_tag LOCUS_02920 gene msrAB 321475 320537 CDS product bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995985.1 protein_id gnl|my_center|LOCUS_02920 322026 321535 gene locus_tag LOCUS_02930 322026 321535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852223.1 protein_id gnl|my_center|LOCUS_02930 322128 322988 gene locus_tag LOCUS_02940 322128 322988 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967356.1 protein_id gnl|my_center|LOCUS_02940 324648 323305 gene locus_tag LOCUS_02950 324648 323305 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891866.1 protein_id gnl|my_center|LOCUS_02950 326575 324653 gene locus_tag LOCUS_02960 326575 324653 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247530.1 protein_id gnl|my_center|LOCUS_02960 327756 326572 gene locus_tag LOCUS_02970 327756 326572 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852311.1 protein_id gnl|my_center|LOCUS_02970 327856 328506 gene locus_tag LOCUS_02980 327856 328506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 328536 329105 gene locus_tag LOCUS_02990 328536 329105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 329677 329090 gene locus_tag LOCUS_03000 329677 329090 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_03000 330558 329731 gene locus_tag LOCUS_03010 gene peb4 330558 329731 CDS product peptidylprolyl isomerase PEB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852119.1 protein_id gnl|my_center|LOCUS_03010 330702 332141 gene locus_tag LOCUS_03020 330702 332141 CDS product COG3400 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857878.1 protein_id gnl|my_center|LOCUS_03020 332191 333225 gene locus_tag LOCUS_03030 gene aroB 332191 333225 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852978.1 protein_id gnl|my_center|LOCUS_03030 333222 334829 gene locus_tag LOCUS_03040 333222 334829 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852957.1 protein_id gnl|my_center|LOCUS_03040 334826 336070 gene locus_tag LOCUS_03050 gene mtaB 334826 336070 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858158.1 protein_id gnl|my_center|LOCUS_03050 336126 337718 gene locus_tag LOCUS_03060 336126 337718 CDS product ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852990.1 protein_id gnl|my_center|LOCUS_03060 337715 338242 gene locus_tag LOCUS_03070 gene mog 337715 338242 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002842823.1 protein_id gnl|my_center|LOCUS_03070 338306 339091 gene locus_tag LOCUS_03080 338306 339091 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852410.1 protein_id gnl|my_center|LOCUS_03080 340354 339626 gene locus_tag LOCUS_03090 gene lptB 340354 339626 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855252.1 protein_id gnl|my_center|LOCUS_03090 340757 340347 gene locus_tag LOCUS_03100 gene tsaE 340757 340347 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852319.1 protein_id gnl|my_center|LOCUS_03100 340986 340741 gene locus_tag LOCUS_03110 340986 340741 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890722.1 protein_id gnl|my_center|LOCUS_03110 341470 341736 gene locus_tag LOCUS_03120 341470 341736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 341861 343081 gene locus_tag LOCUS_03130 341861 343081 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852200.1 protein_id gnl|my_center|LOCUS_03130 343101 343544 gene locus_tag LOCUS_03140 gene rplI 343101 343544 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781628.1 protein_id gnl|my_center|LOCUS_03140 343544 344089 gene locus_tag LOCUS_03150 gene hslV 343544 344089 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781630.1 protein_id gnl|my_center|LOCUS_03150 344086 345405 gene locus_tag LOCUS_03160 gene hslU 344086 345405 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852226.1 protein_id gnl|my_center|LOCUS_03160 345402 346271 gene locus_tag LOCUS_03170 gene era 345402 346271 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852114.1 protein_id gnl|my_center|LOCUS_03170 346327 347865 gene locus_tag LOCUS_03180 346327 347865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 347855 348517 gene locus_tag LOCUS_03190 347855 348517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 348514 348807 gene locus_tag LOCUS_03200 348514 348807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 348792 348923 gene locus_tag LOCUS_03210 348792 348923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 348901 350526 gene locus_tag LOCUS_03220 gene mshL 348901 350526 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851309.1 protein_id gnl|my_center|LOCUS_03220 350519 351352 gene locus_tag LOCUS_03230 350519 351352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 351345 352409 gene locus_tag LOCUS_03240 351345 352409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 352406 352948 gene locus_tag LOCUS_03250 352406 352948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 352953 354710 gene locus_tag LOCUS_03260 352953 354710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 354707 355948 gene locus_tag LOCUS_03270 354707 355948 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 protein_id gnl|my_center|LOCUS_03270 356120 358159 gene locus_tag LOCUS_03280 356120 358159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 358221 359384 gene locus_tag LOCUS_03290 gene ftsW 358221 359384 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858324.1 protein_id gnl|my_center|LOCUS_03290 359404 360429 gene locus_tag LOCUS_03300 gene murG 359404 360429 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856115.1 protein_id gnl|my_center|LOCUS_03300 362373 361270 gene locus_tag LOCUS_03310 gene ychF 362373 361270 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858396.1 protein_id gnl|my_center|LOCUS_03310 363833 362373 gene locus_tag LOCUS_03320 363833 362373 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853317.1 protein_id gnl|my_center|LOCUS_03320 364425 363811 gene locus_tag LOCUS_03330 364425 363811 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853249.1 protein_id gnl|my_center|LOCUS_03330 364974 364426 gene locus_tag LOCUS_03340 gene apt 364974 364426 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853297.1 protein_id gnl|my_center|LOCUS_03340 365231 364962 gene locus_tag LOCUS_03350 365231 364962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 365674 365228 gene locus_tag LOCUS_03360 gene rpiB 365674 365228 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853308.1 protein_id gnl|my_center|LOCUS_03360 366618 365791 gene locus_tag LOCUS_03370 366618 365791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 367146 366637 gene locus_tag LOCUS_03380 367146 366637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 367660 367328 gene locus_tag LOCUS_03390 367660 367328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 368047 367865 gene locus_tag LOCUS_03400 368047 367865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 368965 368129 gene locus_tag LOCUS_03410 gene lepB 368965 368129 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852457.1 protein_id gnl|my_center|LOCUS_03410 369820 368966 gene locus_tag LOCUS_03420 gene folD 369820 368966 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864845.1 protein_id gnl|my_center|LOCUS_03420 369935 370294 gene locus_tag LOCUS_03430 369935 370294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 370291 371643 gene locus_tag LOCUS_03440 gene hemL 370291 371643 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864846.1 protein_id gnl|my_center|LOCUS_03440 371640 371921 gene locus_tag LOCUS_03450 371640 371921 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010071.1 protein_id gnl|my_center|LOCUS_03450 371918 372319 gene locus_tag LOCUS_03460 371918 372319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 372322 373239 gene locus_tag LOCUS_03470 372322 373239 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964370.1 protein_id gnl|my_center|LOCUS_03470 373241 373642 gene locus_tag LOCUS_03480 373241 373642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 374136 375215 gene locus_tag LOCUS_03490 374136 375215 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851090.1 protein_id gnl|my_center|LOCUS_03490 375212 376444 gene locus_tag LOCUS_03500 375212 376444 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858609.1 protein_id gnl|my_center|LOCUS_03500 376437 378272 gene locus_tag LOCUS_03510 gene recG 376437 378272 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858588.1 protein_id gnl|my_center|LOCUS_03510 379203 378556 gene locus_tag LOCUS_03520 379203 378556 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852433.1 protein_id gnl|my_center|LOCUS_03520 379287 380030 gene locus_tag LOCUS_03530 379287 380030 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852555.1 protein_id gnl|my_center|LOCUS_03530 380034 381170 gene locus_tag LOCUS_03540 gene pseC 380034 381170 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_03540 381163 382098 gene locus_tag LOCUS_03550 381163 382098 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852582.1 protein_id gnl|my_center|LOCUS_03550 382123 382974 gene locus_tag LOCUS_03560 gene argB 382123 382974 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082330.1 protein_id gnl|my_center|LOCUS_03560 382978 383661 gene locus_tag LOCUS_03570 382978 383661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 383671 385101 gene locus_tag LOCUS_03580 gene thrC 383671 385101 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852451.1 protein_id gnl|my_center|LOCUS_03580 385098 385811 gene locus_tag LOCUS_03590 gene kdsB 385098 385811 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852502.1 protein_id gnl|my_center|LOCUS_03590 385808 386161 gene locus_tag LOCUS_03600 385808 386161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 386158 388095 gene locus_tag LOCUS_03610 gene ligA 386158 388095 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852062.1 protein_id gnl|my_center|LOCUS_03610 388092 388829 gene locus_tag LOCUS_03620 388092 388829 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852328.1 protein_id gnl|my_center|LOCUS_03620 388822 389337 gene locus_tag LOCUS_03630 388822 389337 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003041577.1 protein_id gnl|my_center|LOCUS_03630 389346 390182 gene locus_tag LOCUS_03640 389346 390182 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852206.1 protein_id gnl|my_center|LOCUS_03640 390172 390876 gene locus_tag LOCUS_03650 gene cmoA 390172 390876 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859101.1 protein_id gnl|my_center|LOCUS_03650 391609 392205 gene locus_tag LOCUS_03660 391609 392205 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854219.1 protein_id gnl|my_center|LOCUS_03660 394697 393600 gene locus_tag LOCUS_03670 gene truD 394697 393600 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851259.1 protein_id gnl|my_center|LOCUS_03670 394797 395813 gene locus_tag LOCUS_03680 394797 395813 CDS product DUF5644 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851142.1 protein_id gnl|my_center|LOCUS_03680 395852 396232 gene locus_tag LOCUS_03690 gene crcB 395852 396232 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858490.1 protein_id gnl|my_center|LOCUS_03690 396342 398180 gene locus_tag LOCUS_03700 gene htpG 396342 398180 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858566.1 protein_id gnl|my_center|LOCUS_03700 400061 399585 gene locus_tag LOCUS_03710 400061 399585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 401802 400582 gene locus_tag LOCUS_03720 gene folP 401802 400582 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858587.1 protein_id gnl|my_center|LOCUS_03720 402416 401799 gene locus_tag LOCUS_03730 402416 401799 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852167.1 protein_id gnl|my_center|LOCUS_03730 402949 402413 gene locus_tag LOCUS_03740 402949 402413 CDS product HobA family DNA replication regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852154.1 protein_id gnl|my_center|LOCUS_03740 404154 402949 gene locus_tag LOCUS_03750 404154 402949 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891865.1 protein_id gnl|my_center|LOCUS_03750 404618 404154 gene locus_tag LOCUS_03760 404618 404154 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852091.1 protein_id gnl|my_center|LOCUS_03760 404705 405739 gene locus_tag LOCUS_03770 gene hemW 404705 405739 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852262.1 protein_id gnl|my_center|LOCUS_03770 405733 406857 gene locus_tag LOCUS_03780 gene ispG 405733 406857 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852250.1 protein_id gnl|my_center|LOCUS_03780 406850 408307 gene locus_tag LOCUS_03790 406850 408307 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858532.1 protein_id gnl|my_center|LOCUS_03790 408504 409019 gene locus_tag LOCUS_03800 408504 409019 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851418.1 protein_id gnl|my_center|LOCUS_03800 409820 409383 gene locus_tag LOCUS_03810 409820 409383 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851546.1 protein_id gnl|my_center|LOCUS_03810 410353 412377 gene locus_tag LOCUS_03820 410353 412377 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852419.1 protein_id gnl|my_center|LOCUS_03820 412441 414993 gene locus_tag LOCUS_03830 412441 414993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852788.1 protein_id gnl|my_center|LOCUS_03830 416621 415683 gene locus_tag LOCUS_03840 gene hemH 416621 415683 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858523.1 protein_id gnl|my_center|LOCUS_03840 417478 416615 gene locus_tag LOCUS_03850 417478 416615 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858502.1 protein_id gnl|my_center|LOCUS_03850 417596 420133 gene locus_tag LOCUS_03860 gene alaS 417596 420133 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858583.1 protein_id gnl|my_center|LOCUS_03860 420130 420606 gene locus_tag LOCUS_03870 420130 420606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 420603 421151 gene locus_tag LOCUS_03880 gene maf 420603 421151 CDS product septum formation inhibitor Maf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855005.1 protein_id gnl|my_center|LOCUS_03880 421145 423061 gene locus_tag LOCUS_03890 421145 423061 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858576.1 protein_id gnl|my_center|LOCUS_03890 424303 423515 gene locus_tag LOCUS_03900 gene ppk2 424303 423515 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_03900 424417 426114 gene locus_tag LOCUS_03910 424417 426114 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852245.1 protein_id gnl|my_center|LOCUS_03910 427600 426362 gene locus_tag LOCUS_03920 427600 426362 CDS product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853241.1 protein_id gnl|my_center|LOCUS_03920 428277 427597 gene locus_tag LOCUS_03930 428277 427597 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853196.1 protein_id gnl|my_center|LOCUS_03930 429776 428361 gene locus_tag LOCUS_03940 gene htrA 429776 428361 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853235.1 protein_id gnl|my_center|LOCUS_03940 429951 430823 gene locus_tag LOCUS_03950 429951 430823 CDS product DnaJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853234.1 protein_id gnl|my_center|LOCUS_03950 430834 431211 gene locus_tag LOCUS_03960 gene hspR 430834 431211 CDS product heat shock transcriptional regulator HspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853230.1 protein_id gnl|my_center|LOCUS_03960 431215 432846 gene locus_tag LOCUS_03970 431215 432846 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853239.1 protein_id gnl|my_center|LOCUS_03970 433890 433054 gene locus_tag LOCUS_03980 gene truA 433890 433054 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852636.1 protein_id gnl|my_center|LOCUS_03980 434896 433874 gene locus_tag LOCUS_03990 434896 433874 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852624.1 protein_id gnl|my_center|LOCUS_03990 435653 434889 gene locus_tag LOCUS_04000 435653 434889 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583389.1 protein_id gnl|my_center|LOCUS_04000 436352 435675 gene locus_tag LOCUS_04010 436352 435675 CDS product di-trans,poly-cis-decaprenylcistransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370674.1 protein_id gnl|my_center|LOCUS_04010 437530 436352 gene locus_tag LOCUS_04020 gene coaBC 437530 436352 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852470.1 protein_id gnl|my_center|LOCUS_04020 438825 437527 gene locus_tag LOCUS_04030 gene glmU 438825 437527 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852530.1 protein_id gnl|my_center|LOCUS_04030 440806 439526 gene locus_tag LOCUS_04040 440806 439526 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_04040 441735 440809 gene locus_tag LOCUS_04050 441735 440809 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_04050 441857 442312 gene locus_tag LOCUS_04060 gene eco 441857 442312 CDS product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299572.1 protein_id gnl|my_center|LOCUS_04060 442312 443847 gene locus_tag LOCUS_04070 442312 443847 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176627.1 protein_id gnl|my_center|LOCUS_04070 443844 445067 gene locus_tag LOCUS_04080 443844 445067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 445064 446110 gene locus_tag LOCUS_04090 445064 446110 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039963.1 protein_id gnl|my_center|LOCUS_04090 446107 447027 gene locus_tag LOCUS_04100 446107 447027 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020707.1 protein_id gnl|my_center|LOCUS_04100 447024 448100 gene locus_tag LOCUS_04110 447024 448100 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531351.1 protein_id gnl|my_center|LOCUS_04110 448084 449061 gene locus_tag LOCUS_04120 448084 449061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 449058 450101 gene locus_tag LOCUS_04130 gene pglH 449058 450101 CDS product GalNAc-alpha-(1->4)-GalNAc-alpha-(1->3)-diNAcBac-PP-undecaprenol alpha-1,4-N-acetyl-D-galactosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891911.1 protein_id gnl|my_center|LOCUS_04130 450098 451216 gene locus_tag LOCUS_04140 gene pglJ 450098 451216 CDS product N-acetylgalactosamine-N,N'-diacetylbacillosaminyl-diphospho-undecaprenol 4-alpha-N-acetylgalactosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852870.1 protein_id gnl|my_center|LOCUS_04140 451203 453392 gene locus_tag LOCUS_04150 gene pglB 451203 453392 CDS product undecaprenyl-diphosphooligosaccharide--protein glycotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852780.1 protein_id gnl|my_center|LOCUS_04150 453519 454571 gene locus_tag LOCUS_04160 gene pglA 453519 454571 CDS product N,N'-diacetylbacillosaminyl-diphospho-undecaprenol alpha-1,3-N-acetylgalactosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852885.1 protein_id gnl|my_center|LOCUS_04160 454564 455169 gene locus_tag LOCUS_04170 gene pglC 454564 455169 CDS product undecaprenyl phosphate N,N'-diacetylbacillosamine 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852766.1 protein_id gnl|my_center|LOCUS_04170 455156 455743 gene locus_tag LOCUS_04180 gene pglD 455156 455743 CDS product UDP-N-acetylbacillosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852865.1 protein_id gnl|my_center|LOCUS_04180 455804 456901 gene locus_tag LOCUS_04190 gene pglE 455804 456901 CDS product UDP-N-acetylbacillosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852877.1 protein_id gnl|my_center|LOCUS_04190 456898 458691 gene locus_tag LOCUS_04200 gene pglF 456898 458691 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (configuration-retaining) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858054.1 protein_id gnl|my_center|LOCUS_04200 458685 459584 gene locus_tag LOCUS_04210 458685 459584 CDS product PDC sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852871.1 protein_id gnl|my_center|LOCUS_04210 459578 460189 gene locus_tag LOCUS_04220 gene hisH 459578 460189 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496519.1 protein_id gnl|my_center|LOCUS_04220 460189 460899 gene locus_tag LOCUS_04230 gene hisA 460189 460899 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242559.1 protein_id gnl|my_center|LOCUS_04230 461096 462517 gene locus_tag LOCUS_04240 gene gatB 461096 462517 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858123.1 protein_id gnl|my_center|LOCUS_04240 462514 463404 gene locus_tag LOCUS_04250 462514 463404 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859277.1 protein_id gnl|my_center|LOCUS_04250 465812 464475 gene locus_tag LOCUS_04260 gene pif1 465812 464475 CDS product ATP-dependent DNA helicase Pif1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853306.1 protein_id gnl|my_center|LOCUS_04260 465857 467122 gene locus_tag LOCUS_04270 465857 467122 CDS product SH3 domain-containing C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853331.1 protein_id gnl|my_center|LOCUS_04270 468904 467714 gene locus_tag LOCUS_04280 468904 467714 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853329.1 protein_id gnl|my_center|LOCUS_04280 471763 469109 gene locus_tag LOCUS_04290 gene secA 471763 469109 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858134.1 protein_id gnl|my_center|LOCUS_04290 472138 471866 gene locus_tag LOCUS_04300 gene rpsO 472138 471866 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852579.1 protein_id gnl|my_center|LOCUS_04300 472302 472715 gene locus_tag LOCUS_04310 472302 472715 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852609.1 protein_id gnl|my_center|LOCUS_04310 472712 473725 gene locus_tag LOCUS_04320 472712 473725 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852576.1 protein_id gnl|my_center|LOCUS_04320 473725 473949 gene locus_tag LOCUS_04330 473725 473949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852415.1 protein_id gnl|my_center|LOCUS_04330 475711 474596 gene locus_tag LOCUS_04340 475711 474596 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851397.1 protein_id gnl|my_center|LOCUS_04340 477161 475722 gene locus_tag LOCUS_04350 477161 475722 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852462.1 protein_id gnl|my_center|LOCUS_04350 478216 477155 gene locus_tag LOCUS_04360 478216 477155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 478427 478206 gene locus_tag LOCUS_04370 478427 478206 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852622.1 protein_id gnl|my_center|LOCUS_04370 479705 478527 gene locus_tag LOCUS_04380 479705 478527 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852601.1 protein_id gnl|my_center|LOCUS_04380 480442 479750 gene locus_tag LOCUS_04390 480442 479750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 482288 480447 gene locus_tag LOCUS_04400 gene speA 482288 480447 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891885.1 protein_id gnl|my_center|LOCUS_04400 483517 482285 gene locus_tag LOCUS_04410 gene hisS 483517 482285 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852541.1 protein_id gnl|my_center|LOCUS_04410 484101 483514 gene locus_tag LOCUS_04420 gene tmk 484101 483514 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852526.1 protein_id gnl|my_center|LOCUS_04420 484574 484095 gene locus_tag LOCUS_04430 gene coaD 484574 484095 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852633.1 protein_id gnl|my_center|LOCUS_04430 485116 484571 gene locus_tag LOCUS_04440 485116 484571 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852466.1 protein_id gnl|my_center|LOCUS_04440 485210 485136 gene locus_tag LOCUS_t00020 485210 485136 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 486431 485244 gene locus_tag LOCUS_04450 486431 485244 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856962.1 protein_id gnl|my_center|LOCUS_04450 487684 486428 gene locus_tag LOCUS_04460 gene murA 487684 486428 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857102.1 protein_id gnl|my_center|LOCUS_04460 487799 488464 gene locus_tag LOCUS_04470 487799 488464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 488474 489007 gene locus_tag LOCUS_04480 488474 489007 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853058.1 protein_id gnl|my_center|LOCUS_04480 488994 489806 gene locus_tag LOCUS_04490 488994 489806 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890476.1 protein_id gnl|my_center|LOCUS_04490 489927 490406 gene locus_tag LOCUS_04500 489927 490406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 492098 490902 gene locus_tag LOCUS_04510 492098 490902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 492819 492475 gene locus_tag LOCUS_04520 gene hypA 492819 492475 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864538.1 protein_id gnl|my_center|LOCUS_04520 493338 492913 gene locus_tag LOCUS_04530 493338 492913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 494169 493342 gene locus_tag LOCUS_04540 494169 493342 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853489.1 protein_id gnl|my_center|LOCUS_04540 494366 494166 gene locus_tag LOCUS_04550 494366 494166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 495460 494354 gene locus_tag LOCUS_04560 495460 494354 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943101.1 protein_id gnl|my_center|LOCUS_04560 496917 495460 gene locus_tag LOCUS_04570 gene guaB 496917 495460 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852968.1 protein_id gnl|my_center|LOCUS_04570 498281 496923 gene locus_tag LOCUS_04580 gene gatA 498281 496923 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853884.1 protein_id gnl|my_center|LOCUS_04580 501137 498372 gene locus_tag LOCUS_04590 gene ileS 501137 498372 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907389.1 protein_id gnl|my_center|LOCUS_04590 501232 502326 gene locus_tag LOCUS_04600 501232 502326 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853490.1 protein_id gnl|my_center|LOCUS_04600 503197 502985 gene locus_tag LOCUS_04610 503197 502985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 505311 503503 gene locus_tag LOCUS_04620 505311 503503 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865770.1 protein_id gnl|my_center|LOCUS_04620 505782 505384 gene locus_tag LOCUS_04630 505782 505384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 506709 505783 gene locus_tag LOCUS_04640 gene hemC 506709 505783 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856753.1 protein_id gnl|my_center|LOCUS_04640 507089 506706 gene locus_tag LOCUS_04650 507089 506706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 508792 507083 gene locus_tag LOCUS_04660 508792 507083 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891863.1 protein_id gnl|my_center|LOCUS_04660 510071 508782 gene locus_tag LOCUS_04670 gene hemA 510071 508782 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878972.1 protein_id gnl|my_center|LOCUS_04670 510964 510071 gene locus_tag LOCUS_04680 510964 510071 CDS product hexaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864642.1 protein_id gnl|my_center|LOCUS_04680 511218 510967 gene locus_tag LOCUS_04690 511218 510967 CDS product DUF2018 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206044.1 protein_id gnl|my_center|LOCUS_04690 512045 511416 gene locus_tag LOCUS_04700 512045 511416 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853160.1 protein_id gnl|my_center|LOCUS_04700 512371 512042 gene locus_tag LOCUS_04710 512371 512042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 512622 513893 gene locus_tag LOCUS_04720 512622 513893 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853122.1 protein_id gnl|my_center|LOCUS_04720 513890 514303 gene locus_tag LOCUS_04730 513890 514303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 514313 515227 gene locus_tag LOCUS_04740 gene cysK 514313 515227 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_04740 515886 516545 gene locus_tag LOCUS_04750 515886 516545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 517082 518323 gene locus_tag LOCUS_04760 517082 518323 CDS product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666700.1 protein_id gnl|my_center|LOCUS_04760 519814 518642 gene locus_tag LOCUS_04770 gene hypE 519814 518642 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776344.1 protein_id gnl|my_center|LOCUS_04770 520074 520496 gene locus_tag LOCUS_04780 gene exbB 520074 520496 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851166.1 protein_id gnl|my_center|LOCUS_04780 520493 520876 gene locus_tag LOCUS_04790 gene exbD 520493 520876 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851470.1 protein_id gnl|my_center|LOCUS_04790 520869 521615 gene locus_tag LOCUS_04800 520869 521615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 521642 521914 gene locus_tag LOCUS_04810 521642 521914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 521911 522780 gene locus_tag LOCUS_04820 521911 522780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 522826 524397 gene locus_tag LOCUS_04830 522826 524397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04830 526023 525049 gene locus_tag LOCUS_04840 526023 525049 CDS product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761173.1 protein_id gnl|my_center|LOCUS_04840 527118 526033 gene locus_tag LOCUS_04850 gene hypD 527118 526033 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776343.1 protein_id gnl|my_center|LOCUS_04850 527395 527102 gene locus_tag LOCUS_04860 527395 527102 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776342.1 protein_id gnl|my_center|LOCUS_04860 528246 527395 gene locus_tag LOCUS_04870 gene hypB 528246 527395 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_04870 528937 528521 gene locus_tag LOCUS_04880 gene nikR 528937 528521 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380787.1 protein_id gnl|my_center|LOCUS_04880 529335 530711 gene locus_tag LOCUS_04890 529335 530711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 530704 531711 gene locus_tag LOCUS_04900 530704 531711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 535670 532296 gene locus_tag LOCUS_04910 535670 532296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 537186 535654 gene locus_tag LOCUS_04920 537186 535654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826526.1 protein_id gnl|my_center|LOCUS_04920 537728 537183 gene locus_tag LOCUS_04930 537728 537183 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859319.1 protein_id gnl|my_center|LOCUS_04930 538394 537729 gene locus_tag LOCUS_04940 gene cybH 538394 537729 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853164.1 protein_id gnl|my_center|LOCUS_04940 540136 538415 gene locus_tag LOCUS_04950 540136 538415 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853190.1 protein_id gnl|my_center|LOCUS_04950 541284 540139 gene locus_tag LOCUS_04960 541284 540139 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853195.1 protein_id gnl|my_center|LOCUS_04960 543209 541404 gene locus_tag LOCUS_04970 543209 541404 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858743.1 protein_id gnl|my_center|LOCUS_04970 545278 543200 gene locus_tag LOCUS_04980 545278 543200 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857319.1 protein_id gnl|my_center|LOCUS_04980 546387 545656 gene locus_tag LOCUS_04990 546387 545656 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854302.1 protein_id gnl|my_center|LOCUS_04990 548368 546380 gene locus_tag LOCUS_05000 548368 546380 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854193.1 protein_id gnl|my_center|LOCUS_05000 549068 548388 gene locus_tag LOCUS_05010 549068 548388 CDS product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854660.1 protein_id gnl|my_center|LOCUS_05010 549964 549125 gene locus_tag LOCUS_05020 gene lgt 549964 549125 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854600.1 protein_id gnl|my_center|LOCUS_05020 550521 549961 gene locus_tag LOCUS_05030 550521 549961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 551395 550526 gene locus_tag LOCUS_05040 551395 550526 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891824.1 protein_id gnl|my_center|LOCUS_05040 552751 551396 gene locus_tag LOCUS_05050 552751 551396 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852215.1 protein_id gnl|my_center|LOCUS_05050 552863 553741 gene locus_tag LOCUS_05060 gene rarD 552863 553741 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269178.1 protein_id gnl|my_center|LOCUS_05060 553734 554162 gene locus_tag LOCUS_05070 553734 554162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858595.1 protein_id gnl|my_center|LOCUS_05070 556891 554315 gene locus_tag LOCUS_05080 556891 554315 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858618.1 protein_id gnl|my_center|LOCUS_05080 557071 558330 gene locus_tag LOCUS_05090 557071 558330 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856815.1 protein_id gnl|my_center|LOCUS_05090 558355 559074 gene locus_tag LOCUS_05100 558355 559074 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858572.1 protein_id gnl|my_center|LOCUS_05100 559085 559321 gene locus_tag LOCUS_05110 gene purS 559085 559321 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858611.1 protein_id gnl|my_center|LOCUS_05110 559318 559986 gene locus_tag LOCUS_05120 gene purQ 559318 559986 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858528.1 protein_id gnl|my_center|LOCUS_05120 559980 561254 gene locus_tag LOCUS_05130 559980 561254 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858517.1 protein_id gnl|my_center|LOCUS_05130 561266 562012 gene locus_tag LOCUS_05140 561266 562012 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858620.1 protein_id gnl|my_center|LOCUS_05140 562009 562977 gene locus_tag LOCUS_05150 562009 562977 CDS product agamatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855829.1 protein_id gnl|my_center|LOCUS_05150 563056 564096 gene locus_tag LOCUS_05160 563056 564096 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_05160 564244 565047 gene locus_tag LOCUS_05170 gene rpsB 564244 565047 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002892710.1 protein_id gnl|my_center|LOCUS_05170 565047 566105 gene locus_tag LOCUS_05180 gene tsf 565047 566105 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864836.1 protein_id gnl|my_center|LOCUS_05180 566108 566752 gene locus_tag LOCUS_05190 566108 566752 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891917.1 protein_id gnl|my_center|LOCUS_05190 566944 567492 gene locus_tag LOCUS_05200 566944 567492 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619532.1 protein_id gnl|my_center|LOCUS_05200 568187 567489 gene locus_tag LOCUS_05210 568187 567489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 569425 568211 gene locus_tag LOCUS_05220 569425 568211 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858667.1 protein_id gnl|my_center|LOCUS_05220 570560 569400 gene locus_tag LOCUS_05230 570560 569400 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545276.1 protein_id gnl|my_center|LOCUS_05230 571003 570557 gene locus_tag LOCUS_05240 571003 570557 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852389.1 protein_id gnl|my_center|LOCUS_05240 572064 571003 gene locus_tag LOCUS_05250 gene mqnE 572064 571003 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858079.1 protein_id gnl|my_center|LOCUS_05250 572130 572522 gene locus_tag LOCUS_05260 572130 572522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 572612 574432 gene locus_tag LOCUS_05270 gene glmS 572612 574432 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858421.1 protein_id gnl|my_center|LOCUS_05270 574436 576163 gene locus_tag LOCUS_05280 574436 576163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 576454 577458 gene locus_tag LOCUS_05290 576454 577458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 577616 578254 gene locus_tag LOCUS_05300 577616 578254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 578330 578932 gene locus_tag LOCUS_05310 578330 578932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 580070 579456 gene locus_tag LOCUS_05320 580070 579456 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_05320 581325 580147 gene locus_tag LOCUS_05330 581325 580147 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851835.1 protein_id gnl|my_center|LOCUS_05330 581903 581385 gene locus_tag LOCUS_05340 581903 581385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 583094 581952 gene locus_tag LOCUS_05350 gene ftsZ 583094 581952 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852071.1 protein_id gnl|my_center|LOCUS_05350 584455 583106 gene locus_tag LOCUS_05360 gene ftsA 584455 583106 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891881.1 protein_id gnl|my_center|LOCUS_05360 585911 584448 gene locus_tag LOCUS_05370 585911 584448 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852128.1 protein_id gnl|my_center|LOCUS_05370 586615 586046 gene locus_tag LOCUS_05380 586615 586046 CDS product class II aldolase and adducin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933670.1 protein_id gnl|my_center|LOCUS_05380 586680 587612 gene locus_tag LOCUS_05390 gene rsmH 586680 587612 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891880.1 protein_id gnl|my_center|LOCUS_05390 587615 587989 gene locus_tag LOCUS_05400 587615 587989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 587992 588828 gene locus_tag LOCUS_05410 587992 588828 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166554.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05410 590413 589598 gene locus_tag LOCUS_05420 590413 589598 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056925.1 protein_id gnl|my_center|LOCUS_05420 591747 590890 gene locus_tag LOCUS_05430 gene cmoB 591747 590890 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864121.1 protein_id gnl|my_center|LOCUS_05430 591802 593064 gene locus_tag LOCUS_05440 591802 593064 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853369.1 protein_id gnl|my_center|LOCUS_05440 593524 594954 gene locus_tag LOCUS_05450 593524 594954 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223903.1 protein_id gnl|my_center|LOCUS_05450 595555 595175 gene locus_tag LOCUS_05460 595555 595175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 595948 595875 gene locus_tag LOCUS_t00030 595948 595875 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 597696 596458 gene locus_tag LOCUS_05470 gene nhaA 597696 596458 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851220.1 protein_id gnl|my_center|LOCUS_05470 599597 598509 gene locus_tag LOCUS_05480 599597 598509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 599858 599616 gene locus_tag LOCUS_05490 599858 599616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 601300 599858 gene locus_tag LOCUS_05500 601300 599858 CDS product acetyl-CoA carboxylase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856595.1 protein_id gnl|my_center|LOCUS_05500 601430 601506 gene locus_tag LOCUS_t00040 601430 601506 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 601524 602261 gene locus_tag LOCUS_05510 601524 602261 CDS product YaaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853346.1 protein_id gnl|my_center|LOCUS_05510 602413 602736 gene locus_tag LOCUS_05520 602413 602736 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859562.1 protein_id gnl|my_center|LOCUS_05520 602850 602936 gene locus_tag LOCUS_t00050 602850 602936 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 603369 607883 gene locus_tag LOCUS_05530 603369 607883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 607939 608355 gene locus_tag LOCUS_05540 607939 608355 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225802.1 protein_id gnl|my_center|LOCUS_05540 609120 610676 gene locus_tag LOCUS_05550 609120 610676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 610693 611871 gene locus_tag LOCUS_05560 610693 611871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 611868 613682 gene locus_tag LOCUS_05570 611868 613682 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858743.1 protein_id gnl|my_center|LOCUS_05570 613685 615652 gene locus_tag LOCUS_05580 613685 615652 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857319.1 protein_id gnl|my_center|LOCUS_05580 615642 616076 gene locus_tag LOCUS_05590 615642 616076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 616073 616264 gene locus_tag LOCUS_05600 616073 616264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 618117 617128 gene locus_tag LOCUS_05610 gene galE 618117 617128 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858414.1 protein_id gnl|my_center|LOCUS_05610 618964 618137 gene locus_tag LOCUS_05620 618964 618137 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951387.1 protein_id gnl|my_center|LOCUS_05620 619883 618951 gene locus_tag LOCUS_05630 619883 618951 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853812.1 protein_id gnl|my_center|LOCUS_05630 620701 619880 gene locus_tag LOCUS_05640 gene fabI 620701 619880 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780456.1 protein_id gnl|my_center|LOCUS_05640 621396 620698 gene locus_tag LOCUS_05650 621396 620698 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855528.1 protein_id gnl|my_center|LOCUS_05650 622613 621396 gene locus_tag LOCUS_05660 622613 621396 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891932.1 protein_id gnl|my_center|LOCUS_05660 623624 622629 gene locus_tag LOCUS_05670 gene gap 623624 622629 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780453.1 protein_id gnl|my_center|LOCUS_05670 623690 624577 gene locus_tag LOCUS_05680 623690 624577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 624725 626089 gene locus_tag LOCUS_05690 624725 626089 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852070.1 protein_id gnl|my_center|LOCUS_05690 627811 626129 gene locus_tag LOCUS_05700 627811 626129 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112847.1 protein_id gnl|my_center|LOCUS_05700 627905 628441 gene locus_tag LOCUS_05710 627905 628441 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851622.1 protein_id gnl|my_center|LOCUS_05710 630048 628867 gene locus_tag LOCUS_05720 gene argJ 630048 628867 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330363.1 protein_id gnl|my_center|LOCUS_05720 631042 630041 gene locus_tag LOCUS_05730 631042 630041 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461981.1 protein_id gnl|my_center|LOCUS_05730 631381 631190 gene locus_tag LOCUS_05740 gene rpmB 631381 631190 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854974.1 protein_id gnl|my_center|LOCUS_05740 631511 632152 gene locus_tag LOCUS_05750 gene rpe 631511 632152 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858571.1 protein_id gnl|my_center|LOCUS_05750 632162 632950 gene locus_tag LOCUS_05760 632162 632950 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858535.1 protein_id gnl|my_center|LOCUS_05760 633006 634796 gene locus_tag LOCUS_05770 gene lepA 633006 634796 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002837927.1 protein_id gnl|my_center|LOCUS_05770 636732 634915 gene locus_tag LOCUS_05780 gene selB 636732 634915 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857930.1 protein_id gnl|my_center|LOCUS_05780 638053 636725 gene locus_tag LOCUS_05790 gene selA 638053 636725 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858009.1 protein_id gnl|my_center|LOCUS_05790 638159 638243 gene locus_tag LOCUS_t00060 638159 638243 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 638250 638324 gene locus_tag LOCUS_t00070 638250 638324 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 638436 639518 gene locus_tag LOCUS_05800 638436 639518 CDS product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063127.1 protein_id gnl|my_center|LOCUS_05800 639679 639515 gene locus_tag LOCUS_05810 639679 639515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 639893 639753 gene locus_tag LOCUS_05820 639893 639753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 639929 640954 gene locus_tag LOCUS_05830 639929 640954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 640958 641248 gene locus_tag LOCUS_05840 640958 641248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 641579 642019 gene locus_tag LOCUS_05850 641579 642019 CDS product CopD family copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338876.1 protein_id gnl|my_center|LOCUS_05850 642044 642733 gene locus_tag LOCUS_05860 642044 642733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 642803 643270 gene locus_tag LOCUS_05870 642803 643270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 643224 644552 gene locus_tag LOCUS_05880 643224 644552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 644914 645102 gene locus_tag LOCUS_05890 644914 645102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 645152 647416 gene locus_tag LOCUS_05900 645152 647416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 647449 647973 gene locus_tag LOCUS_05910 647449 647973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 648174 648004 gene locus_tag LOCUS_05920 648174 648004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 648504 648983 gene locus_tag LOCUS_05930 648504 648983 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516078.1 protein_id gnl|my_center|LOCUS_05930 649128 649469 gene locus_tag LOCUS_05940 649128 649469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 651215 649767 gene locus_tag LOCUS_05950 651215 649767 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857605.1 protein_id gnl|my_center|LOCUS_05950 651463 651215 gene locus_tag LOCUS_05960 651463 651215 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854647.1 protein_id gnl|my_center|LOCUS_05960 652670 651858 gene locus_tag LOCUS_05970 652670 651858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 653128 652751 gene locus_tag LOCUS_05980 653128 652751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 653778 653107 gene locus_tag LOCUS_05990 gene hsrA 653778 653107 CDS product homeostatic response regulator transcription factor HsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857553.1 protein_id gnl|my_center|LOCUS_05990 654541 653879 gene locus_tag LOCUS_06000 gene queC 654541 653879 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779268.1 protein_id gnl|my_center|LOCUS_06000 654608 655024 gene locus_tag LOCUS_06010 gene ybeY 654608 655024 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851664.1 protein_id gnl|my_center|LOCUS_06010 655040 655453 gene locus_tag LOCUS_06020 655040 655453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06020 655619 656050 gene locus_tag LOCUS_06030 655619 656050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06030 665853 656821 gene locus_tag LOCUS_06040 665853 656821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 667052 665994 gene locus_tag LOCUS_06050 667052 665994 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856044.1 protein_id gnl|my_center|LOCUS_06050 668061 667039 gene locus_tag LOCUS_06060 gene ruvB 668061 667039 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856258.1 protein_id gnl|my_center|LOCUS_06060 668750 668067 gene locus_tag LOCUS_06070 668750 668067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 669646 668849 gene locus_tag LOCUS_06080 gene panB 669646 668849 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062669.1 protein_id gnl|my_center|LOCUS_06080 669741 670101 gene locus_tag LOCUS_tm00010 669741 670101 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 670693 671433 gene locus_tag LOCUS_06090 670693 671433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 672045 671548 gene locus_tag LOCUS_06100 672045 671548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 672140 672616 gene locus_tag LOCUS_06110 gene mobB 672140 672616 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852644.1 protein_id gnl|my_center|LOCUS_06110 672657 673499 gene locus_tag LOCUS_06120 672657 673499 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864856.1 protein_id gnl|my_center|LOCUS_06120 673492 673698 gene locus_tag LOCUS_06130 673492 673698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 673708 675624 gene locus_tag LOCUS_06140 gene metG 673708 675624 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852639.1 protein_id gnl|my_center|LOCUS_06140 675625 676617 gene locus_tag LOCUS_06150 675625 676617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 676626 677030 gene locus_tag LOCUS_06160 676626 677030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 677078 677584 gene locus_tag LOCUS_06170 gene lolA 677078 677584 CDS product LolA-like outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853302.1 protein_id gnl|my_center|LOCUS_06170 678320 677634 gene locus_tag LOCUS_06180 678320 677634 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858390.1 protein_id gnl|my_center|LOCUS_06180 679151 678387 gene locus_tag LOCUS_06190 679151 678387 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851426.1 protein_id gnl|my_center|LOCUS_06190 679929 679165 gene locus_tag LOCUS_06200 679929 679165 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851318.1 protein_id gnl|my_center|LOCUS_06200 680507 679926 gene locus_tag LOCUS_06210 680507 679926 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851338.1 protein_id gnl|my_center|LOCUS_06210 680835 680500 gene locus_tag LOCUS_06220 680835 680500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 681796 680837 gene locus_tag LOCUS_06230 681796 680837 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864617.1 protein_id gnl|my_center|LOCUS_06230 682934 681786 gene locus_tag LOCUS_06240 682934 681786 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_06240 683575 682943 gene locus_tag LOCUS_06250 683575 682943 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020721.1 protein_id gnl|my_center|LOCUS_06250 683709 685583 gene locus_tag LOCUS_06260 gene rpoD 683709 685583 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852997.1 protein_id gnl|my_center|LOCUS_06260 686712 685966 gene locus_tag LOCUS_06270 gene pgeF 686712 685966 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014919.1 protein_id gnl|my_center|LOCUS_06270 687290 686676 gene locus_tag LOCUS_06280 687290 686676 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852828.1 protein_id gnl|my_center|LOCUS_06280 688257 687283 gene locus_tag LOCUS_06290 gene bioB 688257 687283 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016821.1 protein_id gnl|my_center|LOCUS_06290 688335 690257 gene locus_tag LOCUS_06300 gene mnmG 688335 690257 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864546.1 protein_id gnl|my_center|LOCUS_06300 690261 690482 gene locus_tag LOCUS_06310 690261 690482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 690503 691408 gene locus_tag LOCUS_06320 gene glyQ 690503 691408 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852069.1 protein_id gnl|my_center|LOCUS_06320 691421 692149 gene locus_tag LOCUS_06330 691421 692149 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852315.1 protein_id gnl|my_center|LOCUS_06330 692159 692863 gene locus_tag LOCUS_06340 692159 692863 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_06340 692863 694002 gene locus_tag LOCUS_06350 gene waaA 692863 694002 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852277.1 protein_id gnl|my_center|LOCUS_06350 693986 694732 gene locus_tag LOCUS_06360 693986 694732 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852134.1 protein_id gnl|my_center|LOCUS_06360 695903 695469 gene locus_tag LOCUS_06370 695903 695469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 696869 696036 gene locus_tag LOCUS_06380 696869 696036 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851372.1 protein_id gnl|my_center|LOCUS_06380 698160 696844 gene locus_tag LOCUS_06390 698160 696844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 700111 698171 gene locus_tag LOCUS_06400 700111 698171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 701142 700411 gene locus_tag LOCUS_06410 701142 700411 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851719.1 protein_id gnl|my_center|LOCUS_06410 701822 701139 gene locus_tag LOCUS_06420 gene pfs 701822 701139 CDS product aminodeoxyfutalosine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859787.1 protein_id gnl|my_center|LOCUS_06420 702748 701819 gene locus_tag LOCUS_06430 gene fabD 702748 701819 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851630.1 protein_id gnl|my_center|LOCUS_06430 703312 702752 gene locus_tag LOCUS_06440 703312 702752 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851661.1 protein_id gnl|my_center|LOCUS_06440 703623 704888 gene locus_tag LOCUS_06450 703623 704888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 705886 705068 gene locus_tag LOCUS_06460 705886 705068 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851738.1 protein_id gnl|my_center|LOCUS_06460 706352 705888 gene locus_tag LOCUS_06470 gene pal 706352 705888 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851617.1 protein_id gnl|my_center|LOCUS_06470 707671 706418 gene locus_tag LOCUS_06480 gene tolB 707671 706418 CDS product Tol-Pal system protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858647.1 protein_id gnl|my_center|LOCUS_06480 708547 707681 gene locus_tag LOCUS_06490 708547 707681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 708950 708552 gene locus_tag LOCUS_06500 708950 708552 CDS product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858790.1 protein_id gnl|my_center|LOCUS_06500 709528 708950 gene locus_tag LOCUS_06510 709528 708950 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854361.1 protein_id gnl|my_center|LOCUS_06510 709921 709529 gene locus_tag LOCUS_06520 gene atpC 709921 709529 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851752.1 protein_id gnl|my_center|LOCUS_06520 711331 709934 gene locus_tag LOCUS_06530 gene atpD 711331 709934 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852005.1 protein_id gnl|my_center|LOCUS_06530 712232 711342 gene locus_tag LOCUS_06540 gene atpG 712232 711342 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851834.1 protein_id gnl|my_center|LOCUS_06540 713759 712242 gene locus_tag LOCUS_06550 gene atpA 713759 712242 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851836.1 protein_id gnl|my_center|LOCUS_06550 714300 713770 gene locus_tag LOCUS_06560 714300 713770 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851861.1 protein_id gnl|my_center|LOCUS_06560 714817 714302 gene locus_tag LOCUS_06570 714817 714302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 715249 714827 gene locus_tag LOCUS_06580 715249 714827 CDS product FoF1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851812.1 protein_id gnl|my_center|LOCUS_06580 716171 715311 gene locus_tag LOCUS_06590 716171 715311 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851919.1 protein_id gnl|my_center|LOCUS_06590 716956 716168 gene locus_tag LOCUS_06600 716956 716168 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851697.1 protein_id gnl|my_center|LOCUS_06600 717588 716953 gene locus_tag LOCUS_06610 717588 716953 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858812.1 protein_id gnl|my_center|LOCUS_06610 718477 717569 gene locus_tag LOCUS_06620 gene fmt 718477 717569 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851657.1 protein_id gnl|my_center|LOCUS_06620 719245 718487 gene locus_tag LOCUS_06630 gene proB 719245 718487 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851769.1 protein_id gnl|my_center|LOCUS_06630 720285 719242 gene locus_tag LOCUS_06640 gene obgE 720285 719242 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851611.1 protein_id gnl|my_center|LOCUS_06640 720559 720365 gene locus_tag LOCUS_06650 720559 720365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 722657 721587 gene locus_tag LOCUS_06660 722657 721587 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851177.1 protein_id gnl|my_center|LOCUS_06660 724003 722654 gene locus_tag LOCUS_06670 gene thiC 724003 722654 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_06670 724576 724049 gene locus_tag LOCUS_06680 724576 724049 CDS product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858582.1 protein_id gnl|my_center|LOCUS_06680 726438 724906 gene locus_tag LOCUS_06690 gene purH 726438 724906 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853339.1 protein_id gnl|my_center|LOCUS_06690 727244 726516 gene locus_tag LOCUS_06700 727244 726516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842884.1 protein_id gnl|my_center|LOCUS_06700 728031 727234 gene locus_tag LOCUS_06710 gene djlA 728031 727234 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546924.1 protein_id gnl|my_center|LOCUS_06710 730244 728046 gene locus_tag LOCUS_06720 gene purL 730244 728046 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858406.1 protein_id gnl|my_center|LOCUS_06720 731527 730256 gene locus_tag LOCUS_06730 gene tviB 731527 730256 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_06730 732997 731636 gene locus_tag LOCUS_06740 732997 731636 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680980.1 protein_id gnl|my_center|LOCUS_06740 733745 732984 gene locus_tag LOCUS_06750 733745 732984 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207637.1 protein_id gnl|my_center|LOCUS_06750 734438 733755 gene locus_tag LOCUS_06760 734438 733755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 735532 734537 gene locus_tag LOCUS_06770 735532 734537 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221227.1 protein_id gnl|my_center|LOCUS_06770 736587 735529 gene locus_tag LOCUS_06780 736587 735529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 737557 736574 gene locus_tag LOCUS_06790 737557 736574 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865945.1 protein_id gnl|my_center|LOCUS_06790 738369 737554 gene locus_tag LOCUS_06800 738369 737554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 739556 738360 gene locus_tag LOCUS_06810 739556 738360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 740625 739549 gene locus_tag LOCUS_06820 740625 739549 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_06820 741518 740622 gene locus_tag LOCUS_06830 741518 740622 CDS product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599753.1 protein_id gnl|my_center|LOCUS_06830 742390 741515 gene locus_tag LOCUS_06840 gene htrB 742390 741515 CDS product lipid A biosynthesis lauroyl acyltransferase HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858051.1 protein_id gnl|my_center|LOCUS_06840 743842 742442 gene locus_tag LOCUS_06850 gene mnmE 743842 742442 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853397.1 protein_id gnl|my_center|LOCUS_06850 744566 743835 gene locus_tag LOCUS_06860 744566 743835 CDS product Jag N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853389.1 protein_id gnl|my_center|LOCUS_06860 746148 744550 gene locus_tag LOCUS_06870 gene yidC 746148 744550 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853384.1 protein_id gnl|my_center|LOCUS_06870 746686 746477 gene locus_tag LOCUS_06880 746686 746477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 746934 746800 gene locus_tag LOCUS_06890 746934 746800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 747081 748403 gene locus_tag LOCUS_06900 747081 748403 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906848.1 protein_id gnl|my_center|LOCUS_06900 748379 749005 gene locus_tag LOCUS_06910 748379 749005 CDS product DUF45 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858500.1 protein_id gnl|my_center|LOCUS_06910 749200 749544 gene locus_tag LOCUS_06920 749200 749544 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669967.1 protein_id gnl|my_center|LOCUS_06920 749600 749685 gene locus_tag LOCUS_t00080 749600 749685 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 750417 750614 gene locus_tag LOCUS_06930 750417 750614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 751873 751798 gene locus_tag LOCUS_t00090 751873 751798 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 752395 752015 gene locus_tag LOCUS_06940 752395 752015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 756557 752400 gene locus_tag LOCUS_06950 756557 752400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 758500 756677 gene locus_tag LOCUS_06960 gene uvrC 758500 756677 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864614.1 protein_id gnl|my_center|LOCUS_06960 758957 758487 gene locus_tag LOCUS_06970 758957 758487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 759132 760667 gene locus_tag LOCUS_06980 gene guaA 759132 760667 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853189.1 protein_id gnl|my_center|LOCUS_06980 760861 760992 gene locus_tag LOCUS_06990 760861 760992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 761155 762252 gene locus_tag LOCUS_07000 761155 762252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 762249 762977 gene locus_tag LOCUS_07010 762249 762977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842884.1 protein_id gnl|my_center|LOCUS_07010 762990 763190 gene locus_tag LOCUS_07020 762990 763190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 763278 763931 gene locus_tag LOCUS_07030 763278 763931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07030 763909 764649 gene locus_tag LOCUS_07040 763909 764649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07040 764613 765149 gene locus_tag LOCUS_07050 764613 765149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07050 765176 766717 gene locus_tag LOCUS_07060 765176 766717 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202573.1 protein_id gnl|my_center|LOCUS_07060 769029 767308 gene locus_tag LOCUS_07070 769029 767308 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005399340.1 protein_id gnl|my_center|LOCUS_07070 770767 769013 gene locus_tag LOCUS_07080 770767 769013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005399341.1 protein_id gnl|my_center|LOCUS_07080 770920 771912 gene locus_tag LOCUS_07090 770920 771912 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122904.1 protein_id gnl|my_center|LOCUS_07090 772074 772550 gene locus_tag LOCUS_07100 772074 772550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 773855 774994 gene locus_tag LOCUS_07110 773855 774994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 775196 775408 gene locus_tag LOCUS_07120 775196 775408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 775405 776922 gene locus_tag LOCUS_07130 775405 776922 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858826.1 protein_id gnl|my_center|LOCUS_07130 776924 778030 gene locus_tag LOCUS_07140 gene cydB 776924 778030 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851984.1 protein_id gnl|my_center|LOCUS_07140 778458 780398 gene locus_tag LOCUS_07150 778458 780398 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852425.1 protein_id gnl|my_center|LOCUS_07150 780401 781615 gene locus_tag LOCUS_07160 780401 781615 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858475.1 protein_id gnl|my_center|LOCUS_07160 781602 782390 gene locus_tag LOCUS_07170 781602 782390 CDS product HemK/PrmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858549.1 protein_id gnl|my_center|LOCUS_07170 782387 783028 gene locus_tag LOCUS_07180 782387 783028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 783025 784041 gene locus_tag LOCUS_07190 783025 784041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853393.1 protein_id gnl|my_center|LOCUS_07190 784119 784475 gene locus_tag LOCUS_07200 784119 784475 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207447.1 protein_id gnl|my_center|LOCUS_07200 785739 785218 gene locus_tag LOCUS_07210 gene infC 785739 785218 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851726.1 protein_id gnl|my_center|LOCUS_07210 787565 785736 gene locus_tag LOCUS_07220 gene thrS 787565 785736 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858701.1 protein_id gnl|my_center|LOCUS_07220 787816 788226 gene locus_tag LOCUS_07230 787816 788226 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017534.1 protein_id gnl|my_center|LOCUS_07230 789037 788867 gene locus_tag LOCUS_07240 789037 788867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 789923 789276 gene locus_tag LOCUS_07250 789923 789276 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852054.1 protein_id gnl|my_center|LOCUS_07250 791032 789920 gene locus_tag LOCUS_07260 gene rseP 791032 789920 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934663.1 protein_id gnl|my_center|LOCUS_07260 791513 792031 gene locus_tag LOCUS_07270 791513 792031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 792269 792994 gene locus_tag LOCUS_07280 792269 792994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 793021 793212 gene locus_tag LOCUS_07290 793021 793212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 793422 794297 gene locus_tag LOCUS_07300 793422 794297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 794349 794576 gene locus_tag LOCUS_07310 794349 794576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 794536 795501 gene locus_tag LOCUS_07320 794536 795501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 795746 796489 gene locus_tag LOCUS_07330 795746 796489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 796532 798178 gene locus_tag LOCUS_07340 796532 798178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 798295 799047 gene locus_tag LOCUS_07350 798295 799047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 799105 799344 gene locus_tag LOCUS_07360 799105 799344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 799313 800713 gene locus_tag LOCUS_07370 799313 800713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 800824 801570 gene locus_tag LOCUS_07380 800824 801570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 801567 802409 gene locus_tag LOCUS_07390 801567 802409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 802544 802825 gene locus_tag LOCUS_07400 802544 802825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 802943 803707 gene locus_tag LOCUS_07410 802943 803707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 803720 804586 gene locus_tag LOCUS_07420 803720 804586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 804721 805002 gene locus_tag LOCUS_07430 804721 805002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 805121 805885 gene locus_tag LOCUS_07440 805121 805885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 805907 806584 gene locus_tag LOCUS_07450 805907 806584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 807634 807071 gene locus_tag LOCUS_07460 gene pgsA 807634 807071 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812871.1 protein_id gnl|my_center|LOCUS_07460 808419 807634 gene locus_tag LOCUS_07470 808419 807634 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891889.1 protein_id gnl|my_center|LOCUS_07470 809315 808419 gene locus_tag LOCUS_07480 gene dapA 809315 808419 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852574.1 protein_id gnl|my_center|LOCUS_07480 810562 809318 gene locus_tag LOCUS_07490 810562 809318 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852436.1 protein_id gnl|my_center|LOCUS_07490 811618 810563 gene locus_tag LOCUS_07500 811618 810563 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852597.1 protein_id gnl|my_center|LOCUS_07500 813403 811688 gene locus_tag LOCUS_07510 813403 811688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858782.1 protein_id gnl|my_center|LOCUS_07510 814806 813400 gene locus_tag LOCUS_07520 gene cysS 814806 813400 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852611.1 protein_id gnl|my_center|LOCUS_07520 816190 814793 gene locus_tag LOCUS_07530 gene murJ 816190 814793 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611242.1 protein_id gnl|my_center|LOCUS_07530 816463 817566 gene locus_tag LOCUS_07540 816463 817566 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851140.1 protein_id gnl|my_center|LOCUS_07540 817563 818294 gene locus_tag LOCUS_07550 817563 818294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994578.1 protein_id gnl|my_center|LOCUS_07550 818297 819163 gene locus_tag LOCUS_07560 818297 819163 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947761.1 protein_id gnl|my_center|LOCUS_07560 819160 819711 gene locus_tag LOCUS_07570 819160 819711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 819712 820266 gene locus_tag LOCUS_07580 gene ruvA 819712 820266 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852492.1 protein_id gnl|my_center|LOCUS_07580 820280 821308 gene locus_tag LOCUS_07590 820280 821308 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852516.1 protein_id gnl|my_center|LOCUS_07590 822054 822641 gene locus_tag LOCUS_07600 822054 822641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 825119 823488 gene locus_tag LOCUS_07610 gene groL 825119 823488 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858047.1 protein_id gnl|my_center|LOCUS_07610 825398 825135 gene locus_tag LOCUS_07620 gene groES 825398 825135 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825273.1 protein_id gnl|my_center|LOCUS_07620 825623 826246 gene locus_tag LOCUS_07630 825623 826246 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068893.1 protein_id gnl|my_center|LOCUS_07630 826366 827430 gene locus_tag LOCUS_07640 gene cmeA 826366 827430 CDS product multidrug efflux RND transporter periplasmic adaptor subunit CmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858646.1 protein_id gnl|my_center|LOCUS_07640 827430 830594 gene locus_tag LOCUS_07650 gene cmeB 827430 830594 CDS product multidrug efflux RND transporter permease subunit CmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002872052.1 protein_id gnl|my_center|LOCUS_07650 830587 832035 gene locus_tag LOCUS_07660 gene cmeC 830587 832035 CDS product multidrug efflux transporter outer membrane subunit CmeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858696.1 protein_id gnl|my_center|LOCUS_07660 832504 832112 gene locus_tag LOCUS_07670 832504 832112 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853400.1 protein_id gnl|my_center|LOCUS_07670 833998 833642 gene locus_tag LOCUS_07680 gene rplS 833998 833642 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852307.1 protein_id gnl|my_center|LOCUS_07680 834696 833995 gene locus_tag LOCUS_07690 gene trmD 834696 833995 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868040.1 protein_id gnl|my_center|LOCUS_07690 835223 834693 gene locus_tag LOCUS_07700 gene rimM 835223 834693 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852323.1 protein_id gnl|my_center|LOCUS_07700 835458 835216 gene locus_tag LOCUS_07710 835458 835216 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852144.1 protein_id gnl|my_center|LOCUS_07710 835688 835461 gene locus_tag LOCUS_07720 gene rpsP 835688 835461 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852274.1 protein_id gnl|my_center|LOCUS_07720 837084 835750 gene locus_tag LOCUS_07730 gene ffh 837084 835750 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852163.1 protein_id gnl|my_center|LOCUS_07730 837839 837297 gene locus_tag LOCUS_07740 gene raiA 837839 837297 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016408.1 protein_id gnl|my_center|LOCUS_07740 838317 837853 gene locus_tag LOCUS_07750 838317 837853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 839228 838293 gene locus_tag LOCUS_07760 839228 838293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 839852 839241 gene locus_tag LOCUS_07770 839852 839241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 840675 839929 gene locus_tag LOCUS_07780 840675 839929 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858388.1 protein_id gnl|my_center|LOCUS_07780 840798 841436 gene locus_tag LOCUS_07790 840798 841436 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852961.1 protein_id gnl|my_center|LOCUS_07790 841446 843824 gene locus_tag LOCUS_07800 gene lon 841446 843824 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868636.1 protein_id gnl|my_center|LOCUS_07800 845283 844594 gene locus_tag LOCUS_07810 gene dut 845283 844594 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_07810 845333 845734 gene locus_tag LOCUS_07820 845333 845734 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098903.1 protein_id gnl|my_center|LOCUS_07820 846240 845746 gene locus_tag LOCUS_07830 gene luxS 846240 845746 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857890.1 protein_id gnl|my_center|LOCUS_07830 846366 847124 gene locus_tag LOCUS_07840 846366 847124 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_07840 847462 848043 gene locus_tag LOCUS_07850 gene cbiM 847462 848043 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_07850 848040 848486 gene locus_tag LOCUS_07860 848040 848486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 848483 849133 gene locus_tag LOCUS_07870 848483 849133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 849130 849777 gene locus_tag LOCUS_07880 849130 849777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546570.1 protein_id gnl|my_center|LOCUS_07880 849861 850802 gene locus_tag LOCUS_07890 849861 850802 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063973.1 protein_id gnl|my_center|LOCUS_07890 850812 852881 gene locus_tag LOCUS_07900 850812 852881 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_07900 852967 853857 gene locus_tag LOCUS_07910 gene accD 852967 853857 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851791.1 protein_id gnl|my_center|LOCUS_07910 853850 854305 gene locus_tag LOCUS_07920 853850 854305 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869860.1 protein_id gnl|my_center|LOCUS_07920 854315 854668 gene locus_tag LOCUS_07930 gene dksA 854315 854668 CDS product molecular chaperone DnaK suppressor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851949.1 protein_id gnl|my_center|LOCUS_07930 854679 855671 gene locus_tag LOCUS_07940 854679 855671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851806.1 protein_id gnl|my_center|LOCUS_07940 855704 856636 gene locus_tag LOCUS_07950 855704 856636 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851926.1 protein_id gnl|my_center|LOCUS_07950 857476 857090 gene locus_tag LOCUS_07960 857476 857090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 857616 858953 gene locus_tag LOCUS_07970 857616 858953 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853313.1 protein_id gnl|my_center|LOCUS_07970 860121 858955 gene locus_tag LOCUS_07980 gene dccS 860121 858955 CDS product two-component system sensor histidine kinase DccS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853219.1 protein_id gnl|my_center|LOCUS_07980 860773 860111 gene locus_tag LOCUS_07990 gene dccR 860773 860111 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_07990 861226 860783 gene locus_tag LOCUS_08000 861226 860783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 862108 861293 gene locus_tag LOCUS_08010 862108 861293 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857898.1 protein_id gnl|my_center|LOCUS_08010 862206 862946 gene locus_tag LOCUS_08020 862206 862946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 863616 863041 gene locus_tag LOCUS_08030 863616 863041 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858665.1 protein_id gnl|my_center|LOCUS_08030 863686 864516 gene locus_tag LOCUS_08040 gene galU 863686 864516 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851421.1 protein_id gnl|my_center|LOCUS_08040 864503 865720 gene locus_tag LOCUS_08050 864503 865720 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855462.1 protein_id gnl|my_center|LOCUS_08050 866937 866125 gene locus_tag LOCUS_08060 866937 866125 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214518.1 protein_id gnl|my_center|LOCUS_08060 867492 866995 gene locus_tag LOCUS_08070 gene bcp 867492 866995 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854561.1 protein_id gnl|my_center|LOCUS_08070 868517 867723 gene locus_tag LOCUS_08080 868517 867723 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891838.1 protein_id gnl|my_center|LOCUS_08080 869331 868510 gene locus_tag LOCUS_08090 869331 868510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891839.1 protein_id gnl|my_center|LOCUS_08090 870275 869376 gene locus_tag LOCUS_08100 870275 869376 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864655.1 protein_id gnl|my_center|LOCUS_08100 870601 870954 gene locus_tag LOCUS_08110 870601 870954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 870938 871666 gene locus_tag LOCUS_08120 870938 871666 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851750.1 protein_id gnl|my_center|LOCUS_08120 872687 871728 gene locus_tag LOCUS_08130 872687 871728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_08130 873331 872684 gene locus_tag LOCUS_08140 873331 872684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_08140 874494 873328 gene locus_tag LOCUS_08150 874494 873328 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_08150 874762 874487 gene locus_tag LOCUS_08160 874762 874487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 875849 874755 gene locus_tag LOCUS_08170 875849 874755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 877204 876104 gene locus_tag LOCUS_08180 gene nusA 877204 876104 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858478.1 protein_id gnl|my_center|LOCUS_08180 877366 877608 gene locus_tag LOCUS_08190 877366 877608 CDS product HP0268 family nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859022.1 protein_id gnl|my_center|LOCUS_08190 877641 878894 gene locus_tag LOCUS_08200 gene miaB 877641 878894 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858634.1 protein_id gnl|my_center|LOCUS_08200 878875 879513 gene locus_tag LOCUS_08210 878875 879513 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867614.1 protein_id gnl|my_center|LOCUS_08210 879570 880313 gene locus_tag LOCUS_08220 879570 880313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 881288 880293 gene locus_tag LOCUS_08230 gene tilS 881288 880293 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851521.1 protein_id gnl|my_center|LOCUS_08230 882570 881269 gene locus_tag LOCUS_08240 gene rimO 882570 881269 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851299.1 protein_id gnl|my_center|LOCUS_08240 883393 882572 gene locus_tag LOCUS_08250 gene panC 883393 882572 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264323.1 protein_id gnl|my_center|LOCUS_08250 883503 884597 gene locus_tag LOCUS_08260 gene prfB 883503 884597 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851475.1 protein_id gnl|my_center|LOCUS_08260 884611 884934 gene locus_tag LOCUS_08270 884611 884934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 884944 885396 gene locus_tag LOCUS_08280 884944 885396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 885740 886333 gene locus_tag LOCUS_08290 885740 886333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 886323 886577 gene locus_tag LOCUS_08300 886323 886577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 888133 887780 gene locus_tag LOCUS_08310 gene rplT 888133 887780 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851731.1 protein_id gnl|my_center|LOCUS_08310 888424 888233 gene locus_tag LOCUS_08320 gene rpmI 888424 888233 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851822.1 protein_id gnl|my_center|LOCUS_08320 888593 889336 gene locus_tag LOCUS_08330 gene dapF 888593 889336 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851173.1 protein_id gnl|my_center|LOCUS_08330 890947 889433 gene locus_tag LOCUS_08340 890947 889433 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980887.1 protein_id gnl|my_center|LOCUS_08340 891677 890940 gene locus_tag LOCUS_08350 gene pssA 891677 890940 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853992.1 protein_id gnl|my_center|LOCUS_08350 893605 891674 gene locus_tag LOCUS_08360 gene ftsH 893605 891674 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852796.1 protein_id gnl|my_center|LOCUS_08360 894522 893608 gene locus_tag LOCUS_08370 894522 893608 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852657.1 protein_id gnl|my_center|LOCUS_08370 894992 894636 gene locus_tag LOCUS_08380 894992 894636 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852408.1 protein_id gnl|my_center|LOCUS_08380 895118 896116 gene locus_tag LOCUS_08390 gene pheS 895118 896116 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852567.1 protein_id gnl|my_center|LOCUS_08390 896113 898431 gene locus_tag LOCUS_08400 gene pheT 896113 898431 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002915726.1 protein_id gnl|my_center|LOCUS_08400 898428 899702 gene locus_tag LOCUS_08410 gene aroA 898428 899702 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852577.1 protein_id gnl|my_center|LOCUS_08410 899692 900519 gene locus_tag LOCUS_08420 899692 900519 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852585.1 protein_id gnl|my_center|LOCUS_08420 900842 902515 gene locus_tag LOCUS_08430 900842 902515 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852520.1 protein_id gnl|my_center|LOCUS_08430 902533 904110 gene locus_tag LOCUS_08440 gene serA 902533 904110 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852643.1 protein_id gnl|my_center|LOCUS_08440 904838 904470 gene locus_tag LOCUS_08450 904838 904470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852445.1 protein_id gnl|my_center|LOCUS_08450 906271 905081 gene locus_tag LOCUS_08460 906271 905081 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852744.1 protein_id gnl|my_center|LOCUS_08460 906364 906636 gene locus_tag LOCUS_08470 gene yajC 906364 906636 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002786346.1 protein_id gnl|my_center|LOCUS_08470 906629 908209 gene locus_tag LOCUS_08480 gene secD 906629 908209 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857963.1 protein_id gnl|my_center|LOCUS_08480 908209 909180 gene locus_tag LOCUS_08490 gene secF 908209 909180 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858025.1 protein_id gnl|my_center|LOCUS_08490 909190 909531 gene locus_tag LOCUS_08500 909190 909531 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383778.1 protein_id gnl|my_center|LOCUS_08500 909541 911982 gene locus_tag LOCUS_08510 gene leuS 909541 911982 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852890.1 protein_id gnl|my_center|LOCUS_08510 911979 912503 gene locus_tag LOCUS_08520 gene lptE 911979 912503 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852685.1 protein_id gnl|my_center|LOCUS_08520 912500 913675 gene locus_tag LOCUS_08530 912500 913675 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891906.1 protein_id gnl|my_center|LOCUS_08530 913659 914465 gene locus_tag LOCUS_08540 913659 914465 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852904.1 protein_id gnl|my_center|LOCUS_08540 914462 917422 gene locus_tag LOCUS_08550 914462 917422 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858240.1 protein_id gnl|my_center|LOCUS_08550 917409 918227 gene locus_tag LOCUS_08560 917409 918227 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852748.1 protein_id gnl|my_center|LOCUS_08560 918294 919085 gene locus_tag LOCUS_08570 gene ymdB 918294 919085 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_08570 919078 919728 gene locus_tag LOCUS_08580 919078 919728 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887243.1 protein_id gnl|my_center|LOCUS_08580 920542 920781 gene locus_tag LOCUS_08590 920542 920781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 921282 921163 gene locus_tag LOCUS_08600 921282 921163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 922630 922394 gene locus_tag LOCUS_08610 922630 922394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 923233 922982 gene locus_tag LOCUS_08620 923233 922982 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853093.1 protein_id gnl|my_center|LOCUS_08620 926539 923639 gene locus_tag LOCUS_r00010 926539 923639 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 927470 927237 gene locus_tag LOCUS_08630 927470 927237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 927963 927754 gene locus_tag LOCUS_08640 927963 927754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 929057 928008 gene locus_tag LOCUS_08650 929057 928008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08650 929288 929133 gene locus_tag LOCUS_08660 929288 929133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 929970 929894 gene locus_tag LOCUS_t00100 929970 929894 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 930131 930056 gene locus_tag LOCUS_t00110 930131 930056 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 931941 930435 gene locus_tag LOCUS_r00020 931941 930435 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 933016 932942 gene locus_tag LOCUS_t00120 933016 932942 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 933122 933048 gene locus_tag LOCUS_t00130 933122 933048 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 933258 933332 gene locus_tag LOCUS_t00140 933258 933332 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 934208 933528 gene locus_tag LOCUS_08670 934208 933528 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_08670 934344 935057 gene locus_tag LOCUS_08680 934344 935057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 935575 937614 gene locus_tag LOCUS_08690 935575 937614 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857880.1 protein_id gnl|my_center|LOCUS_08690 937628 938149 gene locus_tag LOCUS_08700 937628 938149 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002778842.1 protein_id gnl|my_center|LOCUS_08700 938214 939644 gene locus_tag LOCUS_08710 938214 939644 CDS product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857894.1 protein_id gnl|my_center|LOCUS_08710 939641 940921 gene locus_tag LOCUS_08720 939641 940921 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864393.1 protein_id gnl|my_center|LOCUS_08720 940911 942032 gene locus_tag LOCUS_08730 940911 942032 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851556.1 protein_id gnl|my_center|LOCUS_08730 942032 942718 gene locus_tag LOCUS_08740 942032 942718 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860103.1 protein_id gnl|my_center|LOCUS_08740 942740 943222 gene locus_tag LOCUS_08750 942740 943222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 943698 943934 gene locus_tag LOCUS_08760 943698 943934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 943921 946023 gene locus_tag LOCUS_08770 gene feoB 943921 946023 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865443.1 protein_id gnl|my_center|LOCUS_08770 946034 946177 gene locus_tag LOCUS_08780 946034 946177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 946472 946657 gene locus_tag LOCUS_08790 946472 946657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 947669 946869 gene locus_tag LOCUS_08800 947669 946869 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853353.1 protein_id gnl|my_center|LOCUS_08800 948660 947884 gene locus_tag LOCUS_08810 948660 947884 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002836742.1 protein_id gnl|my_center|LOCUS_08810 949261 948647 gene locus_tag LOCUS_08820 gene thiE 949261 948647 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763279.1 protein_id gnl|my_center|LOCUS_08820 949766 949254 gene locus_tag LOCUS_08830 949766 949254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 950516 949776 gene locus_tag LOCUS_08840 950516 949776 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776584.1 protein_id gnl|my_center|LOCUS_08840 951259 950531 gene locus_tag LOCUS_08850 951259 950531 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858785.1 protein_id gnl|my_center|LOCUS_08850 951833 951252 gene locus_tag LOCUS_08860 951833 951252 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856709.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08860 952077 953183 gene locus_tag LOCUS_08870 952077 953183 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980072.1 protein_id gnl|my_center|LOCUS_08870 953190 953747 gene locus_tag LOCUS_08880 953190 953747 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853153.1 protein_id gnl|my_center|LOCUS_08880 954606 954094 gene locus_tag LOCUS_08890 954606 954094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 955426 954749 gene locus_tag LOCUS_08900 955426 954749 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584046.1 protein_id gnl|my_center|LOCUS_08900 958211 955530 gene locus_tag LOCUS_08910 958211 955530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 959080 958517 gene locus_tag LOCUS_08920 gene fdh3B 959080 958517 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851264.1 protein_id gnl|my_center|LOCUS_08920 962003 959091 gene locus_tag LOCUS_08930 962003 959091 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891941.1 transl_except (pos:complement(961467..961469),aa:Sec) note codon on position 179 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_08930 962209 962015 gene locus_tag LOCUS_08940 962209 962015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 962361 963635 gene locus_tag LOCUS_08950 962361 963635 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002873165.1 protein_id gnl|my_center|LOCUS_08950 964412 963564 gene locus_tag LOCUS_08960 964412 963564 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852725.1 protein_id gnl|my_center|LOCUS_08960 965419 964409 gene locus_tag LOCUS_08970 965419 964409 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852617.1 protein_id gnl|my_center|LOCUS_08970 966524 965412 gene locus_tag LOCUS_08980 966524 965412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 967893 966511 gene locus_tag LOCUS_08990 gene pgmL 967893 966511 CDS product phosphoglucosamine mutase PgmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891933.1 protein_id gnl|my_center|LOCUS_08990 967982 968662 gene locus_tag LOCUS_09000 967982 968662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 968659 969228 gene locus_tag LOCUS_09010 968659 969228 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852711.1 protein_id gnl|my_center|LOCUS_09010 969491 969369 gene locus_tag LOCUS_09020 969491 969369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 970890 970231 gene locus_tag LOCUS_09030 970890 970231 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851903.1 protein_id gnl|my_center|LOCUS_09030 971299 970892 gene locus_tag LOCUS_09040 971299 970892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 972175 971363 gene locus_tag LOCUS_09050 gene pstS 972175 971363 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545952.1 protein_id gnl|my_center|LOCUS_09050 972278 973294 gene locus_tag LOCUS_09060 gene pstS 972278 973294 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965256.1 protein_id gnl|my_center|LOCUS_09060 973400 974251 gene locus_tag LOCUS_09070 gene pstC 973400 974251 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545177.1 protein_id gnl|my_center|LOCUS_09070 974251 975102 gene locus_tag LOCUS_09080 gene pstA 974251 975102 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546243.1 protein_id gnl|my_center|LOCUS_09080 975112 975897 gene locus_tag LOCUS_09090 gene pstB 975112 975897 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546432.1 protein_id gnl|my_center|LOCUS_09090 975890 976336 gene locus_tag LOCUS_09100 975890 976336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 976324 976989 gene locus_tag LOCUS_09110 976324 976989 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860529.1 protein_id gnl|my_center|LOCUS_09110 976983 978332 gene locus_tag LOCUS_09120 976983 978332 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852536.1 protein_id gnl|my_center|LOCUS_09120 978658 979506 gene locus_tag LOCUS_09130 gene htpX 978658 979506 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189409.1 protein_id gnl|my_center|LOCUS_09130 979710 980417 gene locus_tag LOCUS_09140 gene cas6 979710 980417 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986678.1 protein_id gnl|my_center|LOCUS_09140 980418 982052 gene locus_tag LOCUS_09150 980418 982052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 982045 982938 gene locus_tag LOCUS_09160 982045 982938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 982935 983648 gene locus_tag LOCUS_09170 982935 983648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 983636 986014 gene locus_tag LOCUS_09180 983636 986014 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_09180 986011 986493 gene locus_tag LOCUS_09190 gene cas4 986011 986493 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_09190 986502 986909 gene locus_tag LOCUS_09200 986502 986909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09200 986927 987502 gene locus_tag LOCUS_09210 986927 987502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09210 987499 987792 gene locus_tag LOCUS_09220 987499 987792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 988018 992727 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attttgctataacaaattttgtattgaaat 993081 992803 gene locus_tag LOCUS_09230 993081 992803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 993407 993093 gene locus_tag LOCUS_09240 993407 993093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09240 993951 993517 gene locus_tag LOCUS_09250 993951 993517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 994287 993952 gene locus_tag LOCUS_09260 994287 993952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 994876 995646 gene locus_tag LOCUS_09270 994876 995646 CDS product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852826.1 protein_id gnl|my_center|LOCUS_09270 995643 996176 gene locus_tag LOCUS_09280 995643 996176 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002831613.1 protein_id gnl|my_center|LOCUS_09280 997440 997057 gene locus_tag LOCUS_09290 gene ruvX 997440 997057 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852281.1 protein_id gnl|my_center|LOCUS_09290 998246 997440 gene locus_tag LOCUS_09300 998246 997440 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002874287.1 protein_id gnl|my_center|LOCUS_09300 999294 998230 gene locus_tag LOCUS_09310 999294 998230 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002873647.1 protein_id gnl|my_center|LOCUS_09310 1000317 999295 gene locus_tag LOCUS_09320 gene ilvC 1000317 999295 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858483.1 protein_id gnl|my_center|LOCUS_09320 1000447 1001241 gene locus_tag LOCUS_09330 1000447 1001241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1001238 1003163 gene locus_tag LOCUS_09340 1001238 1003163 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891871.1 protein_id gnl|my_center|LOCUS_09340 1003156 1004142 gene locus_tag LOCUS_09350 1003156 1004142 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891870.1 protein_id gnl|my_center|LOCUS_09350 1005399 1004359 gene locus_tag LOCUS_09360 1005399 1004359 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857587.1 protein_id gnl|my_center|LOCUS_09360 1005589 1006125 gene locus_tag LOCUS_09370 1005589 1006125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1006369 1007685 gene locus_tag LOCUS_09380 1006369 1007685 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015963.1 protein_id gnl|my_center|LOCUS_09380 1007685 1008797 gene locus_tag LOCUS_09390 1007685 1008797 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948943.1 protein_id gnl|my_center|LOCUS_09390 1013329 1010429 gene locus_tag LOCUS_r00030 1013329 1010429 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1013896 1014540 gene locus_tag LOCUS_09400 gene sodB 1013896 1014540 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494629.1 protein_id gnl|my_center|LOCUS_09400 1014587 1015201 gene locus_tag LOCUS_09410 1014587 1015201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1015258 1015962 gene locus_tag LOCUS_09420 1015258 1015962 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851668.1 protein_id gnl|my_center|LOCUS_09420 1016076 1016405 gene locus_tag LOCUS_09430 gene secG 1016076 1016405 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851915.1 protein_id gnl|my_center|LOCUS_09430 1016471 1017028 gene locus_tag LOCUS_09440 gene frr 1016471 1017028 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864198.1 protein_id gnl|my_center|LOCUS_09440 1017922 1018230 gene locus_tag LOCUS_09450 1017922 1018230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1018178 1019878 gene locus_tag LOCUS_09460 1018178 1019878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1019971 1020945 gene locus_tag LOCUS_09470 1019971 1020945 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023287.1 protein_id gnl|my_center|LOCUS_09470 1021293 1021652 gene locus_tag LOCUS_09480 1021293 1021652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1021653 1021973 gene locus_tag LOCUS_09490 1021653 1021973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1021973 1022251 gene locus_tag LOCUS_09500 1021973 1022251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1022229 1022591 gene locus_tag LOCUS_09510 1022229 1022591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1022588 1024678 gene locus_tag LOCUS_09520 1022588 1024678 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390606.1 protein_id gnl|my_center|LOCUS_09520 1024665 1024874 gene locus_tag LOCUS_09530 1024665 1024874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1025181 1026161 gene locus_tag LOCUS_09540 gene hlyD 1025181 1026161 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097481.1 protein_id gnl|my_center|LOCUS_09540 1026158 1027783 gene locus_tag LOCUS_09550 1026158 1027783 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975722.1 protein_id gnl|my_center|LOCUS_09550 1027780 1028874 gene locus_tag LOCUS_09560 1027780 1028874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061626.1 protein_id gnl|my_center|LOCUS_09560 1028871 1029911 gene locus_tag LOCUS_09570 1028871 1029911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946398.1 protein_id gnl|my_center|LOCUS_09570 1029911 1030618 gene locus_tag LOCUS_09580 gene ung 1029911 1030618 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851931.1 protein_id gnl|my_center|LOCUS_09580 1031007 1031699 gene locus_tag LOCUS_09590 1031007 1031699 CDS product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857885.1 protein_id gnl|my_center|LOCUS_09590 1031692 1033053 gene locus_tag LOCUS_09600 gene gdhA 1031692 1033053 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289187.1 protein_id gnl|my_center|LOCUS_09600 1033088 1033945 gene locus_tag LOCUS_09610 1033088 1033945 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102669.1 protein_id gnl|my_center|LOCUS_09610 1035149 1034730 gene locus_tag LOCUS_09620 1035149 1034730 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851998.1 protein_id gnl|my_center|LOCUS_09620 1035070 1035243 gene locus_tag LOCUS_09630 1035070 1035243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1035641 1036507 gene locus_tag LOCUS_09640 1035641 1036507 CDS product menaquinone biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857964.1 protein_id gnl|my_center|LOCUS_09640 1036512 1037282 gene locus_tag LOCUS_09650 1036512 1037282 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858257.1 protein_id gnl|my_center|LOCUS_09650 1038134 1037967 gene locus_tag LOCUS_09660 1038134 1037967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1038638 1038222 gene locus_tag LOCUS_09670 1038638 1038222 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948464.1 protein_id gnl|my_center|LOCUS_09670 1039041 1038640 gene locus_tag LOCUS_09680 1039041 1038640 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272757.1 protein_id gnl|my_center|LOCUS_09680 1040122 1039127 gene locus_tag LOCUS_09690 1040122 1039127 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_09690 1041282 1040125 gene locus_tag LOCUS_09700 gene arsB 1041282 1040125 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 protein_id gnl|my_center|LOCUS_09700 1041566 1041255 gene locus_tag LOCUS_09710 gene arsR 1041566 1041255 CDS product As(III)-sensing metalloregulatory transcriptional repressor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120603.1 protein_id gnl|my_center|LOCUS_09710 1042186 1041869 gene locus_tag LOCUS_09720 1042186 1041869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1045501 1042964 gene locus_tag LOCUS_09730 1045501 1042964 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968158.1 protein_id gnl|my_center|LOCUS_09730 1046347 1045532 gene locus_tag LOCUS_09740 1046347 1045532 CDS product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422392.1 protein_id gnl|my_center|LOCUS_09740 1046596 1046384 gene locus_tag LOCUS_09750 1046596 1046384 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889816.1 protein_id gnl|my_center|LOCUS_09750 1047349 1047125 gene locus_tag LOCUS_09760 1047349 1047125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1047563 1047327 gene locus_tag LOCUS_09770 1047563 1047327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09770 1047922 1047593 gene locus_tag LOCUS_09780 1047922 1047593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09780 1048251 1047919 gene locus_tag LOCUS_09790 1048251 1047919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09790 1049417 1048938 gene locus_tag LOCUS_09800 1049417 1048938 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870270.1 protein_id gnl|my_center|LOCUS_09800 1050860 1050279 gene locus_tag LOCUS_09810 1050860 1050279 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858675.1 protein_id gnl|my_center|LOCUS_09810 1051604 1050861 gene locus_tag LOCUS_09820 1051604 1050861 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851883.1 protein_id gnl|my_center|LOCUS_09820 1052560 1051604 gene locus_tag LOCUS_09830 gene moaA 1052560 1051604 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868437.1 protein_id gnl|my_center|LOCUS_09830 1052864 1052553 gene locus_tag LOCUS_09840 1052864 1052553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1053746 1052874 gene locus_tag LOCUS_09850 1053746 1052874 CDS product 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851905.1 protein_id gnl|my_center|LOCUS_09850 1054494 1053847 gene locus_tag LOCUS_09860 1054494 1053847 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853081.1 protein_id gnl|my_center|LOCUS_09860 1055267 1054524 gene locus_tag LOCUS_09870 1055267 1054524 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002819467.1 protein_id gnl|my_center|LOCUS_09870 1057705 1055264 gene locus_tag LOCUS_09880 1057705 1055264 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_09880 1058289 1057702 gene locus_tag LOCUS_09890 1058289 1057702 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852394.1 protein_id gnl|my_center|LOCUS_09890 1058926 1058291 gene locus_tag LOCUS_09900 1058926 1058291 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853724.1 protein_id gnl|my_center|LOCUS_09900 1059136 1059921 gene locus_tag LOCUS_09910 1059136 1059921 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073620.1 protein_id gnl|my_center|LOCUS_09910 1059942 1060682 gene locus_tag LOCUS_09920 gene modA 1059942 1060682 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064502.1 protein_id gnl|my_center|LOCUS_09920 1060672 1061064 gene locus_tag LOCUS_09930 1060672 1061064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1061061 1061915 gene locus_tag LOCUS_09940 1061061 1061915 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_09940 1061978 1062115 gene locus_tag LOCUS_09950 1061978 1062115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1062112 1062801 gene locus_tag LOCUS_09960 gene modB 1062112 1062801 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_09960 1062837 1062930 gene locus_tag LOCUS_t00150 1062837 1062930 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1070214 1063186 gene locus_tag LOCUS_09970 1070214 1063186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1071156 1070428 gene locus_tag LOCUS_09980 1071156 1070428 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695943.1 protein_id gnl|my_center|LOCUS_09980 1072960 1071134 gene locus_tag LOCUS_09990 gene mrdA 1072960 1071134 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852196.1 protein_id gnl|my_center|LOCUS_09990 1073316 1072957 gene locus_tag LOCUS_10000 1073316 1072957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1073870 1073412 gene locus_tag LOCUS_10010 1073870 1073412 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583314.1 protein_id gnl|my_center|LOCUS_10010 1074496 1073864 gene locus_tag LOCUS_10020 gene yihA 1074496 1073864 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852258.1 protein_id gnl|my_center|LOCUS_10020 1074966 1074493 gene locus_tag LOCUS_10030 1074966 1074493 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852252.1 protein_id gnl|my_center|LOCUS_10030 1075460 1074948 gene locus_tag LOCUS_10040 1075460 1074948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1075939 1075451 gene locus_tag LOCUS_10050 1075939 1075451 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858506.1 protein_id gnl|my_center|LOCUS_10050 1076508 1075936 gene locus_tag LOCUS_10060 gene hisB 1076508 1075936 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774805.1 protein_id gnl|my_center|LOCUS_10060 1077211 1076510 gene locus_tag LOCUS_10070 1077211 1076510 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852227.1 protein_id gnl|my_center|LOCUS_10070 1078232 1077267 gene locus_tag LOCUS_10080 1078232 1077267 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852087.1 protein_id gnl|my_center|LOCUS_10080 1079012 1078242 gene locus_tag LOCUS_10090 1079012 1078242 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858473.1 protein_id gnl|my_center|LOCUS_10090 1080617 1079097 gene locus_tag LOCUS_10100 1080617 1079097 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871805.1 protein_id gnl|my_center|LOCUS_10100 1081497 1080622 gene locus_tag LOCUS_10110 1081497 1080622 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858573.1 protein_id gnl|my_center|LOCUS_10110 1081700 1083454 gene locus_tag LOCUS_10120 gene aspS 1081700 1083454 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871806.1 protein_id gnl|my_center|LOCUS_10120 1083451 1084029 gene locus_tag LOCUS_10130 1083451 1084029 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858481.1 protein_id gnl|my_center|LOCUS_10130 1084264 1084782 gene locus_tag LOCUS_10140 gene ppa 1084264 1084782 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858521.1 protein_id gnl|my_center|LOCUS_10140 1085221 1085084 gene locus_tag LOCUS_10150 1085221 1085084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1086560 1085661 gene locus_tag LOCUS_10160 1086560 1085661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1087059 1086682 gene locus_tag LOCUS_10170 1087059 1086682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1087373 1087062 gene locus_tag LOCUS_10180 1087373 1087062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1087611 1087384 gene locus_tag LOCUS_10190 1087611 1087384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1089677 1087623 gene locus_tag LOCUS_10200 1089677 1087623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1090434 1089679 gene locus_tag LOCUS_10210 1090434 1089679 CDS product phage BR0599 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004094922.1 protein_id gnl|my_center|LOCUS_10210 1090999 1090427 gene locus_tag LOCUS_10220 1090999 1090427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1092042 1090996 gene locus_tag LOCUS_10230 1092042 1090996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1093012 1092035 gene locus_tag LOCUS_10240 1093012 1092035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1094160 1093012 gene locus_tag LOCUS_10250 1094160 1093012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1095005 1094163 gene locus_tag LOCUS_10260 1095005 1094163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1096602 1095010 gene locus_tag LOCUS_10270 1096602 1095010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1096772 1096599 gene locus_tag LOCUS_10280 1096772 1096599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1097404 1096904 gene locus_tag LOCUS_10290 1097404 1096904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1098329 1097415 gene locus_tag LOCUS_10300 1098329 1097415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1098934 1098347 gene locus_tag LOCUS_10310 1098934 1098347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1099259 1098921 gene locus_tag LOCUS_10320 1099259 1098921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1099491 1099252 gene locus_tag LOCUS_10330 1099491 1099252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1099792 1099484 gene locus_tag LOCUS_10340 1099792 1099484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1100144 1099782 gene locus_tag LOCUS_10350 1100144 1099782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1100453 1100145 gene locus_tag LOCUS_10360 1100453 1100145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1101154 1100504 gene locus_tag LOCUS_10370 1101154 1100504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1101358 1101200 gene locus_tag LOCUS_10380 1101358 1101200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1102098 1101358 gene locus_tag LOCUS_10390 1102098 1101358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1102371 1102844 gene locus_tag LOCUS_10400 1102371 1102844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1102841 1104343 gene locus_tag LOCUS_10410 gene terL 1102841 1104343 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003751157.1 protein_id gnl|my_center|LOCUS_10410 1104360 1105649 gene locus_tag LOCUS_10420 1104360 1105649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1105642 1106862 gene locus_tag LOCUS_10430 1105642 1106862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1106973 1107506 gene locus_tag LOCUS_10440 1106973 1107506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1108293 1107529 gene locus_tag LOCUS_10450 1108293 1107529 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146549050.1 protein_id gnl|my_center|LOCUS_10450 1108787 1108290 gene locus_tag LOCUS_10460 1108787 1108290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1109056 1108868 gene locus_tag LOCUS_10470 1109056 1108868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1109649 1109173 gene locus_tag LOCUS_10480 1109649 1109173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1109869 1109660 gene locus_tag LOCUS_10490 1109869 1109660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1110412 1109924 gene locus_tag LOCUS_10500 1110412 1109924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1110835 1110500 gene locus_tag LOCUS_10510 1110835 1110500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1111305 1110925 gene locus_tag LOCUS_10520 1111305 1110925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1111524 1111309 gene locus_tag LOCUS_10530 1111524 1111309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1112422 1111517 gene locus_tag LOCUS_10540 1112422 1111517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1113755 1112637 gene locus_tag LOCUS_10550 1113755 1112637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1114453 1113806 gene locus_tag LOCUS_10560 1114453 1113806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1114671 1114444 gene locus_tag LOCUS_10570 1114671 1114444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1114732 1115484 gene locus_tag LOCUS_10580 1114732 1115484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1115742 1116443 gene locus_tag LOCUS_10590 1115742 1116443 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387485.1 protein_id gnl|my_center|LOCUS_10590 1117687 1117067 gene locus_tag LOCUS_10600 1117687 1117067 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853752.1 protein_id gnl|my_center|LOCUS_10600 1119005 1117698 gene locus_tag LOCUS_10610 1119005 1117698 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880611.1 protein_id gnl|my_center|LOCUS_10610 1119853 1119005 gene locus_tag LOCUS_10620 gene nfo 1119853 1119005 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795638.1 protein_id gnl|my_center|LOCUS_10620 1120281 1119850 gene locus_tag LOCUS_10630 1120281 1119850 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858715.1 protein_id gnl|my_center|LOCUS_10630 1120651 1120388 gene locus_tag LOCUS_10640 gene rpsR 1120651 1120388 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853032.1 protein_id gnl|my_center|LOCUS_10640 1121284 1120664 gene locus_tag LOCUS_10650 1121284 1120664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1121731 1121294 gene locus_tag LOCUS_10660 gene rpsF 1121731 1121294 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865739.1 protein_id gnl|my_center|LOCUS_10660 1123068 1121965 gene locus_tag LOCUS_10670 gene dapE 1123068 1121965 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854067.1 protein_id gnl|my_center|LOCUS_10670 1123668 1123069 gene locus_tag LOCUS_10680 1123668 1123069 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858199.1 protein_id gnl|my_center|LOCUS_10680 1124659 1123808 gene locus_tag LOCUS_10690 1124659 1123808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1126806 1124671 gene locus_tag LOCUS_10700 1126806 1124671 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853182.1 protein_id gnl|my_center|LOCUS_10700 1127486 1126803 gene locus_tag LOCUS_10710 1127486 1126803 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957597.1 protein_id gnl|my_center|LOCUS_10710 1129717 1127483 gene locus_tag LOCUS_10720 1129717 1127483 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853186.1 protein_id gnl|my_center|LOCUS_10720 1130132 1129707 gene locus_tag LOCUS_10730 1130132 1129707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1131378 1130125 gene locus_tag LOCUS_10740 gene purD 1131378 1130125 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853212.1 protein_id gnl|my_center|LOCUS_10740 1132864 1131659 gene locus_tag LOCUS_10750 1132864 1131659 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869039.1 protein_id gnl|my_center|LOCUS_10750 1132980 1133723 gene locus_tag LOCUS_10760 gene fabG 1132980 1133723 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858551.1 protein_id gnl|my_center|LOCUS_10760 1133776 1134015 gene locus_tag LOCUS_10770 gene acpP 1133776 1134015 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854831.1 protein_id gnl|my_center|LOCUS_10770 1134025 1135239 gene locus_tag LOCUS_10780 1134025 1135239 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858574.1 protein_id gnl|my_center|LOCUS_10780 1135241 1136179 gene locus_tag LOCUS_10790 gene accA 1135241 1136179 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858530.1 protein_id gnl|my_center|LOCUS_10790 1136874 1137386 gene locus_tag LOCUS_10800 1136874 1137386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10800 1137391 1138167 gene locus_tag LOCUS_10810 1137391 1138167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10810 1139965 1138220 gene locus_tag LOCUS_10820 1139965 1138220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1141783 1140032 gene locus_tag LOCUS_10830 1141783 1140032 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199580.1 protein_id gnl|my_center|LOCUS_10830 1143887 1141953 gene locus_tag LOCUS_10840 gene betT 1143887 1141953 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130624425.1 protein_id gnl|my_center|LOCUS_10840 1144000 1144200 gene locus_tag LOCUS_10850 gene rpmE 1144000 1144200 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_10850 1144201 1145025 gene locus_tag LOCUS_10860 gene rsmI 1144201 1145025 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851893.1 protein_id gnl|my_center|LOCUS_10860 1145056 1145736 gene locus_tag LOCUS_10870 gene rlmB 1145056 1145736 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851944.1 protein_id gnl|my_center|LOCUS_10870 1145729 1146640 gene locus_tag LOCUS_10880 1145729 1146640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1146641 1147669 gene locus_tag LOCUS_10890 1146641 1147669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1147681 1148886 gene locus_tag LOCUS_10900 1147681 1148886 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851675.1 protein_id gnl|my_center|LOCUS_10900 1148886 1150154 gene locus_tag LOCUS_10910 1148886 1150154 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851705.1 protein_id gnl|my_center|LOCUS_10910 1150159 1150497 gene locus_tag LOCUS_10920 1150159 1150497 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851874.1 protein_id gnl|my_center|LOCUS_10920 1150559 1150876 gene locus_tag LOCUS_10930 gene trxA 1150559 1150876 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851800.1 protein_id gnl|my_center|LOCUS_10930 1150943 1151881 gene locus_tag LOCUS_10940 gene trxB 1150943 1151881 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851648.1 protein_id gnl|my_center|LOCUS_10940 1151972 1153615 gene locus_tag LOCUS_10950 1151972 1153615 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857979.1 protein_id gnl|my_center|LOCUS_10950 1153605 1154162 gene locus_tag LOCUS_10960 1153605 1154162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1154648 1155256 gene locus_tag LOCUS_10970 gene pyrE 1154648 1155256 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851820.1 protein_id gnl|my_center|LOCUS_10970 1156801 1155548 gene locus_tag LOCUS_10980 gene serS 1156801 1155548 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858681.1 protein_id gnl|my_center|LOCUS_10980 1157029 1157247 gene locus_tag LOCUS_10990 gene infA 1157029 1157247 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781436.1 protein_id gnl|my_center|LOCUS_10990 1157537 1157920 gene locus_tag LOCUS_11000 gene rpsM 1157537 1157920 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800121.1 protein_id gnl|my_center|LOCUS_11000 1157924 1158316 gene locus_tag LOCUS_11010 gene rpsK 1157924 1158316 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779544.1 protein_id gnl|my_center|LOCUS_11010 1158338 1158964 gene locus_tag LOCUS_11020 gene rpsD 1158338 1158964 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851551.1 protein_id gnl|my_center|LOCUS_11020 1158977 1159993 gene locus_tag LOCUS_11030 1158977 1159993 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851403.1 protein_id gnl|my_center|LOCUS_11030 1159990 1160346 gene locus_tag LOCUS_11040 gene rplQ 1159990 1160346 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851332.1 protein_id gnl|my_center|LOCUS_11040 1161978 1160791 gene locus_tag LOCUS_11050 1161978 1160791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1163894 1161984 gene locus_tag LOCUS_11060 gene tkt 1163894 1161984 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858130.1 protein_id gnl|my_center|LOCUS_11060 1164752 1163898 gene locus_tag LOCUS_11070 1164752 1163898 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851379.1 protein_id gnl|my_center|LOCUS_11070 1165066 1164740 gene locus_tag LOCUS_11080 1165066 1164740 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851172.1 protein_id gnl|my_center|LOCUS_11080 1165414 1165070 gene locus_tag LOCUS_11090 gene panD 1165414 1165070 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142250.1 protein_id gnl|my_center|LOCUS_11090 1165622 1165428 gene locus_tag LOCUS_11100 1165622 1165428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1166848 1165628 gene locus_tag LOCUS_11110 1166848 1165628 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865460.1 protein_id gnl|my_center|LOCUS_11110 1167736 1167092 gene locus_tag LOCUS_11120 1167736 1167092 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851780.1 protein_id gnl|my_center|LOCUS_11120 1168748 1167726 gene locus_tag LOCUS_11130 1168748 1167726 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851758.1 protein_id gnl|my_center|LOCUS_11130 1170224 1168764 gene locus_tag LOCUS_11140 gene nuoN 1170224 1168764 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904307.1 protein_id gnl|my_center|LOCUS_11140 1171744 1170221 gene locus_tag LOCUS_11150 1171744 1170221 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159928.1 protein_id gnl|my_center|LOCUS_11150 1173586 1171754 gene locus_tag LOCUS_11160 gene nuoL 1173586 1171754 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851310.1 protein_id gnl|my_center|LOCUS_11160 1173891 1173586 gene locus_tag LOCUS_11170 gene nuoK 1173891 1173586 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579761.1 protein_id gnl|my_center|LOCUS_11170 1174415 1173888 gene locus_tag LOCUS_11180 1174415 1173888 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864418.1 protein_id gnl|my_center|LOCUS_11180 1175010 1174408 gene locus_tag LOCUS_11190 gene nuoI 1175010 1174408 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851456.1 protein_id gnl|my_center|LOCUS_11190 1176014 1175019 gene locus_tag LOCUS_11200 gene nuoH 1176014 1175019 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851149.1 protein_id gnl|my_center|LOCUS_11200 1178289 1176007 gene locus_tag LOCUS_11210 1178289 1176007 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891945.1 protein_id gnl|my_center|LOCUS_11210 1178956 1178291 gene locus_tag LOCUS_11220 1178956 1178291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1179183 1178953 gene locus_tag LOCUS_11230 1179183 1178953 CDS product NADH-ubiquinone oxidoreductase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819168.1 protein_id gnl|my_center|LOCUS_11230 1180406 1179180 gene locus_tag LOCUS_11240 gene nuoD 1180406 1179180 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864417.1 protein_id gnl|my_center|LOCUS_11240 1181194 1180406 gene locus_tag LOCUS_11250 1181194 1180406 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864416.1 protein_id gnl|my_center|LOCUS_11250 1181703 1181194 gene locus_tag LOCUS_11260 1181703 1181194 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851253.1 protein_id gnl|my_center|LOCUS_11260 1182074 1181685 gene locus_tag LOCUS_11270 1182074 1181685 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183543.1 protein_id gnl|my_center|LOCUS_11270 1182170 1183855 gene locus_tag LOCUS_11280 1182170 1183855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1183858 1184625 gene locus_tag LOCUS_11290 1183858 1184625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1184641 1185678 gene locus_tag LOCUS_11300 1184641 1185678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1185678 1185863 gene locus_tag LOCUS_11310 1185678 1185863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1185863 1186540 gene locus_tag LOCUS_11320 1185863 1186540 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065208821.1 protein_id gnl|my_center|LOCUS_11320 1186524 1187474 gene locus_tag LOCUS_11330 gene virB9 1186524 1187474 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976329.1 protein_id gnl|my_center|LOCUS_11330 1187467 1188678 gene locus_tag LOCUS_11340 1187467 1188678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1188687 1188854 gene locus_tag LOCUS_11350 1188687 1188854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1188858 1189844 gene locus_tag LOCUS_11360 gene virB11 1188858 1189844 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264003.1 protein_id gnl|my_center|LOCUS_11360 1189841 1190602 gene locus_tag LOCUS_11370 1189841 1190602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1190592 1192568 gene locus_tag LOCUS_11380 1190592 1192568 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108653168.1 protein_id gnl|my_center|LOCUS_11380 1192565 1192990 gene locus_tag LOCUS_11390 1192565 1192990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1192987 1193676 gene locus_tag LOCUS_11400 1192987 1193676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1193676 1194602 gene locus_tag LOCUS_11410 1193676 1194602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1194620 1195420 gene locus_tag LOCUS_11420 1194620 1195420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1195433 1196776 gene locus_tag LOCUS_11430 1195433 1196776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1196788 1198938 gene locus_tag LOCUS_11440 1196788 1198938 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235749.1 protein_id gnl|my_center|LOCUS_11440 1198949 1199386 gene locus_tag LOCUS_11450 1198949 1199386 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942768.1 protein_id gnl|my_center|LOCUS_11450 1199397 1200212 gene locus_tag LOCUS_11460 1199397 1200212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1200294 1206647 gene locus_tag LOCUS_11470 1200294 1206647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1206754 1207041 gene locus_tag LOCUS_11480 1206754 1207041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1207038 1207922 gene locus_tag LOCUS_11490 1207038 1207922 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284311.1 protein_id gnl|my_center|LOCUS_11490 1208019 1208198 gene locus_tag LOCUS_11500 1208019 1208198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1208182 1208427 gene locus_tag LOCUS_11510 1208182 1208427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1208444 1208929 gene locus_tag LOCUS_11520 1208444 1208929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1208901 1209908 gene locus_tag LOCUS_11530 1208901 1209908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1209992 1210555 gene locus_tag LOCUS_11540 1209992 1210555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1210589 1211125 gene locus_tag LOCUS_11550 1210589 1211125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1211218 1211442 gene locus_tag LOCUS_11560 1211218 1211442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1212743 1211493 gene locus_tag LOCUS_11570 1212743 1211493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1213293 1212736 gene locus_tag LOCUS_11580 1213293 1212736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1213475 1215097 gene locus_tag LOCUS_11590 1213475 1215097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1215667 1215110 gene locus_tag LOCUS_11600 1215667 1215110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1215980 1215660 gene locus_tag LOCUS_11610 1215980 1215660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1216434 1216003 gene locus_tag LOCUS_11620 1216434 1216003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1217350 1217060 gene locus_tag LOCUS_11630 1217350 1217060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1219298 1217472 gene locus_tag LOCUS_11640 1219298 1217472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1219655 1219302 gene locus_tag LOCUS_11650 1219655 1219302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1220361 1219657 gene locus_tag LOCUS_11660 1220361 1219657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1220594 1220358 gene locus_tag LOCUS_11670 1220594 1220358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1221007 1220591 gene locus_tag LOCUS_11680 1221007 1220591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1222015 1221020 gene locus_tag LOCUS_11690 1222015 1221020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1222653 1222012 gene locus_tag LOCUS_11700 1222653 1222012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1223813 1222695 gene locus_tag LOCUS_11710 1223813 1222695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1224794 1225951 gene locus_tag LOCUS_11720 1224794 1225951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1226172 1227797 gene locus_tag LOCUS_11730 1226172 1227797 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853102.1 protein_id gnl|my_center|LOCUS_11730 1227787 1229361 gene locus_tag LOCUS_11740 gene recJ 1227787 1229361 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853146.1 protein_id gnl|my_center|LOCUS_11740 1229411 1229977 gene locus_tag LOCUS_11750 gene efp 1229411 1229977 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855210.1 protein_id gnl|my_center|LOCUS_11750 1230061 1231149 gene locus_tag LOCUS_11760 gene ribD 1230061 1231149 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891948.1 protein_id gnl|my_center|LOCUS_11760 1231279 1231821 gene locus_tag LOCUS_11770 gene nrfH 1231279 1231821 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891930.1 protein_id gnl|my_center|LOCUS_11770 1231839 1233512 gene locus_tag LOCUS_11780 1231839 1233512 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123116.1 protein_id gnl|my_center|LOCUS_11780 1233898 1234122 gene locus_tag LOCUS_11790 1233898 1234122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1235400 1234432 gene locus_tag LOCUS_11800 1235400 1234432 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864239.1 protein_id gnl|my_center|LOCUS_11800 1235951 1235397 gene locus_tag LOCUS_11810 gene mobA 1235951 1235397 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795288.1 protein_id gnl|my_center|LOCUS_11810 1237213 1235954 gene locus_tag LOCUS_11820 gene leuC 1237213 1235954 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_11820 1237271 1238584 gene locus_tag LOCUS_11830 1237271 1238584 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864240.1 protein_id gnl|my_center|LOCUS_11830 1238626 1239387 gene locus_tag LOCUS_11840 1238626 1239387 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869557.1 protein_id gnl|my_center|LOCUS_11840 1239381 1240460 gene locus_tag LOCUS_11850 gene dxr 1239381 1240460 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864243.1 protein_id gnl|my_center|LOCUS_11850 1240457 1241455 gene locus_tag LOCUS_11860 gene tsaD 1240457 1241455 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864246.1 protein_id gnl|my_center|LOCUS_11860 1243246 1242020 gene locus_tag LOCUS_11870 gene nspC 1243246 1242020 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858431.1 protein_id gnl|my_center|LOCUS_11870 1243319 1243540 gene locus_tag LOCUS_11880 1243319 1243540 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857949.1 protein_id gnl|my_center|LOCUS_11880 1243542 1243976 gene locus_tag LOCUS_11890 1243542 1243976 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781229.1 protein_id gnl|my_center|LOCUS_11890 1244418 1244011 gene locus_tag LOCUS_11900 1244418 1244011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1245583 1244483 gene locus_tag LOCUS_11910 gene aroC 1245583 1244483 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851463.1 protein_id gnl|my_center|LOCUS_11910 1247301 1245871 gene locus_tag LOCUS_11920 1247301 1245871 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_11920 1248545 1247298 gene locus_tag LOCUS_11930 1248545 1247298 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854063.1 protein_id gnl|my_center|LOCUS_11930 1249930 1248542 gene locus_tag LOCUS_11940 gene gltX 1249930 1248542 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858284.1 protein_id gnl|my_center|LOCUS_11940 1250009 1250842 gene locus_tag LOCUS_11950 1250009 1250842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1251882 1250899 gene locus_tag LOCUS_11960 gene purM 1251882 1250899 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851320.1 protein_id gnl|my_center|LOCUS_11960 1251956 1252561 gene locus_tag LOCUS_11970 gene coaE 1251956 1252561 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243282.1 protein_id gnl|my_center|LOCUS_11970 1252536 1253354 gene locus_tag LOCUS_11980 gene dapF 1252536 1253354 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851173.1 protein_id gnl|my_center|LOCUS_11980 1254432 1253815 gene locus_tag LOCUS_11990 1254432 1253815 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986312.1 protein_id gnl|my_center|LOCUS_11990 1254932 1254459 gene locus_tag LOCUS_12000 gene ybaK 1254932 1254459 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723804.1 protein_id gnl|my_center|LOCUS_12000 1255687 1254929 gene locus_tag LOCUS_12010 gene map 1255687 1254929 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858416.1 protein_id gnl|my_center|LOCUS_12010 1256952 1255687 gene locus_tag LOCUS_12020 gene secY 1256952 1255687 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864789.1 protein_id gnl|my_center|LOCUS_12020 1257353 1256952 gene locus_tag LOCUS_12030 gene rplO 1257353 1256952 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851292.1 protein_id gnl|my_center|LOCUS_12030 1257804 1257364 gene locus_tag LOCUS_12040 gene rpsE 1257804 1257364 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779428.1 protein_id gnl|my_center|LOCUS_12040 1258170 1257814 gene locus_tag LOCUS_12050 gene rplR 1258170 1257814 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851411.1 protein_id gnl|my_center|LOCUS_12050 1258716 1258180 gene locus_tag LOCUS_12060 gene rplF 1258716 1258180 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851302.1 protein_id gnl|my_center|LOCUS_12060 1259187 1258792 gene locus_tag LOCUS_12070 gene rpsH 1259187 1258792 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851353.1 protein_id gnl|my_center|LOCUS_12070 1259382 1259197 gene locus_tag LOCUS_12080 1259382 1259197 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851478.1 protein_id gnl|my_center|LOCUS_12080 1259929 1259384 gene locus_tag LOCUS_12090 gene rplE 1259929 1259384 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851453.1 protein_id gnl|my_center|LOCUS_12090 1260163 1259933 gene locus_tag LOCUS_12100 1260163 1259933 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779437.1 protein_id gnl|my_center|LOCUS_12100 1260531 1260163 gene locus_tag LOCUS_12110 gene rplN 1260531 1260163 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779438.1 protein_id gnl|my_center|LOCUS_12110 1260782 1260531 gene locus_tag LOCUS_12120 gene rpsQ 1260782 1260531 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851549.1 protein_id gnl|my_center|LOCUS_12120 1260978 1260793 gene locus_tag LOCUS_12130 gene rpmC 1260978 1260793 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851566.1 protein_id gnl|my_center|LOCUS_12130 1261390 1260965 gene locus_tag LOCUS_12140 gene rplP 1261390 1260965 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779441.1 protein_id gnl|my_center|LOCUS_12140 1262088 1261393 gene locus_tag LOCUS_12150 gene rpsC 1262088 1261393 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851138.1 protein_id gnl|my_center|LOCUS_12150 1262420 1262091 gene locus_tag LOCUS_12160 1262420 1262091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1262711 1262430 gene locus_tag LOCUS_12170 gene rpsS 1262711 1262430 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851509.1 protein_id gnl|my_center|LOCUS_12170 1263541 1262711 gene locus_tag LOCUS_12180 gene rplB 1263541 1262711 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825501.1 protein_id gnl|my_center|LOCUS_12180 1263824 1263543 gene locus_tag LOCUS_12190 1263824 1263543 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851441.1 protein_id gnl|my_center|LOCUS_12190 1264440 1263826 gene locus_tag LOCUS_12200 gene rplD 1264440 1263826 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851146.1 protein_id gnl|my_center|LOCUS_12200 1265012 1264437 gene locus_tag LOCUS_12210 gene rplC 1265012 1264437 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864792.1 protein_id gnl|my_center|LOCUS_12210 1265334 1265023 gene locus_tag LOCUS_12220 gene rpsJ 1265334 1265023 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779353.1 protein_id gnl|my_center|LOCUS_12220 1266577 1265654 gene locus_tag LOCUS_12230 1266577 1265654 CDS product DUF234 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852402.1 protein_id gnl|my_center|LOCUS_12230 1266589 1267890 gene locus_tag LOCUS_12240 1266589 1267890 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864147.1 protein_id gnl|my_center|LOCUS_12240 1268155 1267919 gene locus_tag LOCUS_12250 1268155 1267919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1269101 1269025 gene locus_tag LOCUS_t00160 1269101 1269025 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1269262 1269187 gene locus_tag LOCUS_t00170 1269262 1269187 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1271072 1269566 gene locus_tag LOCUS_r00040 1271072 1269566 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1272637 1271999 gene locus_tag LOCUS_12260 1272637 1271999 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646910.1 protein_id gnl|my_center|LOCUS_12260 1273799 1272639 gene locus_tag LOCUS_12270 1273799 1272639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1274287 1273787 gene locus_tag LOCUS_12280 1274287 1273787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1274472 1277282 gene locus_tag LOCUS_12290 gene uvrA 1274472 1277282 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858721.1 protein_id gnl|my_center|LOCUS_12290 1277358 1277516 gene locus_tag LOCUS_12300 1277358 1277516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1277464 1277664 gene locus_tag LOCUS_12310 1277464 1277664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1278133 1277882 gene locus_tag LOCUS_12320 1278133 1277882 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853093.1 protein_id gnl|my_center|LOCUS_12320 1278718 1278458 gene locus_tag LOCUS_12330 1278718 1278458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1279386 1278715 gene locus_tag LOCUS_12340 1279386 1278715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1280130 1279495 gene locus_tag LOCUS_12350 1280130 1279495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1280647 1281741 gene locus_tag LOCUS_12360 1280647 1281741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1281752 1282807 gene locus_tag LOCUS_12370 1281752 1282807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1282810 1283901 gene locus_tag LOCUS_12380 1282810 1283901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1287795 1284895 gene locus_tag LOCUS_r00050 1287795 1284895 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1288310 1289521 gene locus_tag LOCUS_12390 1288310 1289521 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852026.1 protein_id gnl|my_center|LOCUS_12390 1290265 1289996 gene locus_tag LOCUS_12400 1290265 1289996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12400 1290726 1290262 gene locus_tag LOCUS_12410 1290726 1290262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12410 1291165 1290743 gene locus_tag LOCUS_12420 1291165 1290743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12420 1292053 1291292 gene locus_tag LOCUS_12430 1292053 1291292 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706646.1 protein_id gnl|my_center|LOCUS_12430 1292344 1292078 gene locus_tag LOCUS_12440 1292344 1292078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1293294 1292479 gene locus_tag LOCUS_12450 gene kdsA 1293294 1292479 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858652.1 protein_id gnl|my_center|LOCUS_12450 1294197 1293304 gene locus_tag LOCUS_12460 1294197 1293304 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891853.1 protein_id gnl|my_center|LOCUS_12460 1294297 1295679 gene locus_tag LOCUS_12470 gene der 1294297 1295679 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858744.1 protein_id gnl|my_center|LOCUS_12470 1295669 1296181 gene locus_tag LOCUS_12480 1295669 1296181 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904001.1 protein_id gnl|my_center|LOCUS_12480 1296185 1296688 gene locus_tag LOCUS_12490 1296185 1296688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1296700 1297677 gene locus_tag LOCUS_12500 gene trpS 1296700 1297677 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858719.1 protein_id gnl|my_center|LOCUS_12500 1299813 1298755 gene locus_tag LOCUS_12510 1299813 1298755 CDS product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891852.1 protein_id gnl|my_center|LOCUS_12510 1300400 1300035 gene locus_tag LOCUS_12520 1300400 1300035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12520 1300533 1300360 gene locus_tag LOCUS_12530 1300533 1300360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12530 1301455 1300523 gene locus_tag LOCUS_12540 1301455 1300523 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_12540 1303689 1302697 gene locus_tag LOCUS_12550 1303689 1302697 CDS product iron-sulfur cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002840050.1 protein_id gnl|my_center|LOCUS_12550 1304893 1303703 gene locus_tag LOCUS_12560 1304893 1303703 CDS product NifS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858709.1 protein_id gnl|my_center|LOCUS_12560 1305549 1304965 gene locus_tag LOCUS_12570 gene folE 1305549 1304965 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851990.1 protein_id gnl|my_center|LOCUS_12570 1306489 1305866 gene locus_tag LOCUS_12580 1306489 1305866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1306796 1306584 gene locus_tag LOCUS_12590 gene rpsU 1306796 1306584 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780697.1 protein_id gnl|my_center|LOCUS_12590 1308072 1306861 gene locus_tag LOCUS_12600 1308072 1306861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891847.1 protein_id gnl|my_center|LOCUS_12600 1308348 1308082 gene locus_tag LOCUS_12610 1308348 1308082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1308796 1308326 gene locus_tag LOCUS_12620 gene moaC 1308796 1308326 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851725.1 protein_id gnl|my_center|LOCUS_12620 1309117 1309530 gene locus_tag LOCUS_12630 1309117 1309530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852445.1 protein_id gnl|my_center|LOCUS_12630 1309523 1310497 gene locus_tag LOCUS_12640 1309523 1310497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1311161 1310916 gene locus_tag LOCUS_12650 1311161 1310916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1311043 1311684 gene locus_tag LOCUS_12660 1311043 1311684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1312000 1312812 gene locus_tag LOCUS_12670 1312000 1312812 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930369.1 protein_id gnl|my_center|LOCUS_12670 1313638 1312955 gene locus_tag LOCUS_12680 gene pyrF 1313638 1312955 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858700.1 protein_id gnl|my_center|LOCUS_12680 1314030 1313635 gene locus_tag LOCUS_12690 gene nusB 1314030 1313635 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824771.1 protein_id gnl|my_center|LOCUS_12690 1314502 1314032 gene locus_tag LOCUS_12700 gene ribE 1314502 1314032 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854278.1 protein_id gnl|my_center|LOCUS_12700 1315679 1314489 gene locus_tag LOCUS_12710 gene nhaA 1315679 1314489 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704638.1 protein_id gnl|my_center|LOCUS_12710 1316206 1315763 gene locus_tag LOCUS_12720 gene hemJ 1316206 1315763 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854237.1 protein_id gnl|my_center|LOCUS_12720 1316955 1316239 gene locus_tag LOCUS_12730 1316955 1316239 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819827.1 protein_id gnl|my_center|LOCUS_12730 1318134 1317574 gene locus_tag LOCUS_12740 1318134 1317574 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_12740 1318990 1318145 gene locus_tag LOCUS_12750 1318990 1318145 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671202.1 protein_id gnl|my_center|LOCUS_12750 1320346 1319018 gene locus_tag LOCUS_12760 1320346 1319018 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851723.1 protein_id gnl|my_center|LOCUS_12760 1321183 1320605 gene locus_tag LOCUS_12770 gene purN 1321183 1320605 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864335.1 protein_id gnl|my_center|LOCUS_12770 1322637 1321165 gene locus_tag LOCUS_12780 1322637 1321165 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954017.1 protein_id gnl|my_center|LOCUS_12780 1324151 1322634 gene locus_tag LOCUS_12790 1324151 1322634 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851902.1 protein_id gnl|my_center|LOCUS_12790 1324657 1324148 gene locus_tag LOCUS_12800 gene def 1324657 1324148 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851936.1 protein_id gnl|my_center|LOCUS_12800 1325247 1324660 gene locus_tag LOCUS_12810 gene clpP 1325247 1324660 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806309.1 protein_id gnl|my_center|LOCUS_12810 1326560 1325247 gene locus_tag LOCUS_12820 gene tig 1326560 1325247 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851938.1 protein_id gnl|my_center|LOCUS_12820 1328447 1326654 gene locus_tag LOCUS_12830 1328447 1326654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1328853 1328662 gene locus_tag LOCUS_12840 1328853 1328662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1330888 1328840 gene locus_tag LOCUS_12850 1330888 1328840 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858655.1 protein_id gnl|my_center|LOCUS_12850 1331517 1330885 gene locus_tag LOCUS_12860 1331517 1330885 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851887.1 protein_id gnl|my_center|LOCUS_12860 1332738 1331527 gene locus_tag LOCUS_12870 1332738 1331527 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858151.1 protein_id gnl|my_center|LOCUS_12870 1334027 1332735 gene locus_tag LOCUS_12880 1334027 1332735 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857990.1 protein_id gnl|my_center|LOCUS_12880 1334106 1334726 gene locus_tag LOCUS_12890 gene rdgB 1334106 1334726 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853680.1 protein_id gnl|my_center|LOCUS_12890 1335189 1334770 gene locus_tag LOCUS_12900 1335189 1334770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1336558 1335341 gene locus_tag LOCUS_12910 1336558 1335341 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_12910 1337109 1336555 gene locus_tag LOCUS_12920 1337109 1336555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1338502 1337111 gene locus_tag LOCUS_12930 1338502 1337111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1340808 1338502 gene locus_tag LOCUS_12940 gene gyrB 1340808 1338502 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858833.1 protein_id gnl|my_center|LOCUS_12940 1341889 1340819 gene locus_tag LOCUS_12950 gene dnaN 1341889 1340819 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858808.1 protein_id gnl|my_center|LOCUS_12950 1343335 1342022 gene locus_tag LOCUS_12960 gene dnaA 1343335 1342022 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858822.1 protein_id gnl|my_center|LOCUS_12960 1343465 1343941 gene locus_tag LOCUS_12970 gene ruvC 1343465 1343941 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891952.1 protein_id gnl|my_center|LOCUS_12970 1343938 1344708 gene locus_tag LOCUS_12980 1343938 1344708 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262133.1 protein_id gnl|my_center|LOCUS_12980 1344705 1345232 gene locus_tag LOCUS_12990 1344705 1345232 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861198.1 protein_id gnl|my_center|LOCUS_12990 1345652 1345278 gene locus_tag LOCUS_13000 1345652 1345278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1346131 1345649 gene locus_tag LOCUS_13010 gene lspA 1346131 1345649 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921378.1 protein_id gnl|my_center|LOCUS_13010 1347464 1346124 gene locus_tag LOCUS_13020 gene glmM 1347464 1346124 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860288.1 protein_id gnl|my_center|LOCUS_13020 1347815 1348861 gene locus_tag LOCUS_13030 gene recA 1347815 1348861 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851424.1 protein_id gnl|my_center|LOCUS_13030 1348861 1350108 gene locus_tag LOCUS_13040 gene eno 1348861 1350108 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851519.1 protein_id gnl|my_center|LOCUS_13040 1348891 1348986 gene locus_tag LOCUS_t00180 1348891 1348986 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1350105 1350392 gene locus_tag LOCUS_13050 1350105 1350392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1350389 1351075 gene locus_tag LOCUS_13060 gene cgpA 1350389 1351075 CDS product glycoprotein CgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851387.1 protein_id gnl|my_center|LOCUS_13060 1351764 1351219 gene locus_tag LOCUS_13070 gene tpx 1351764 1351219 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880278.1 protein_id gnl|my_center|LOCUS_13070 1351885 1352151 gene locus_tag LOCUS_13080 1351885 1352151 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858971.1 protein_id gnl|my_center|LOCUS_13080 1352153 1352680 gene locus_tag LOCUS_13090 1352153 1352680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851410.1 protein_id gnl|my_center|LOCUS_13090 1352731 1353663 gene locus_tag LOCUS_13100 1352731 1353663 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851174.1 protein_id gnl|my_center|LOCUS_13100 1353722 1354321 gene locus_tag LOCUS_13110 gene yedF 1353722 1354321 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851218.1 protein_id gnl|my_center|LOCUS_13110 1354318 1355454 gene locus_tag LOCUS_13120 gene selD 1354318 1355454 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077409355.1 protein_id gnl|my_center|LOCUS_13120 1355889 1355725 gene locus_tag LOCUS_13130 1355889 1355725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1356089 1357426 gene locus_tag LOCUS_13140 1356089 1357426 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112847.1 protein_id gnl|my_center|LOCUS_13140 1359485 1358457 gene locus_tag LOCUS_13150 gene miaA 1359485 1358457 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851982.1 protein_id gnl|my_center|LOCUS_13150 1360880 1360008 gene locus_tag LOCUS_13160 1360880 1360008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1361526 1360873 gene locus_tag LOCUS_13170 gene dccR 1361526 1360873 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_13170 1362537 1361566 gene locus_tag LOCUS_13180 gene nrfD 1362537 1361566 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073772.1 protein_id gnl|my_center|LOCUS_13180 1363096 1362530 gene locus_tag LOCUS_13190 1363096 1362530 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073773.1 protein_id gnl|my_center|LOCUS_13190 1364147 1363107 gene locus_tag LOCUS_13200 1364147 1363107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13200 1365382 1364147 gene locus_tag LOCUS_13210 1365382 1364147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13210 1365563 1367224 gene locus_tag LOCUS_13220 gene ilvD 1365563 1367224 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853088.1 protein_id gnl|my_center|LOCUS_13220 1367466 1367627 gene locus_tag LOCUS_13230 1367466 1367627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1368466 1367669 gene locus_tag LOCUS_13240 1368466 1367669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1368925 1368641 gene locus_tag LOCUS_13250 1368925 1368641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1369317 1369859 gene locus_tag LOCUS_13260 1369317 1369859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1370503 1369883 gene locus_tag LOCUS_13270 gene thyX 1370503 1369883 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853111.1 protein_id gnl|my_center|LOCUS_13270 1370664 1370828 gene locus_tag LOCUS_13280 1370664 1370828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1371277 1372737 gene locus_tag LOCUS_13290 1371277 1372737 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903237.1 protein_id gnl|my_center|LOCUS_13290 1374314 1373016 gene locus_tag LOCUS_13300 1374314 1373016 CDS product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864082.1 protein_id gnl|my_center|LOCUS_13300 1374655 1376463 gene locus_tag LOCUS_13310 gene typA 1374655 1376463 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859745.1 protein_id gnl|my_center|LOCUS_13310 1377806 1377552 gene locus_tag LOCUS_13320 1377806 1377552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1378621 1378043 gene locus_tag LOCUS_13330 1378621 1378043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13330 1379626 1378811 gene locus_tag LOCUS_13340 gene peb4 1379626 1378811 CDS product peptidylprolyl isomerase PEB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852119.1 protein_id gnl|my_center|LOCUS_13340 1381328 1380567 gene locus_tag LOCUS_13350 1381328 1380567 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853086.1 protein_id gnl|my_center|LOCUS_13350 1382301 1381342 gene locus_tag LOCUS_13360 1382301 1381342 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_13360 1383262 1382303 gene locus_tag LOCUS_13370 1383262 1382303 CDS product COG2958 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804194.1 protein_id gnl|my_center|LOCUS_13370 1385308 1383275 gene locus_tag LOCUS_13380 1385308 1383275 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864793.1 protein_id gnl|my_center|LOCUS_13380 1386101 1385292 gene locus_tag LOCUS_13390 gene rsmA 1386101 1385292 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853083.1 protein_id gnl|my_center|LOCUS_13390 1386179 1386937 gene locus_tag LOCUS_13400 gene hisF 1386179 1386937 CDS product imidazoleglycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880088.1 protein_id gnl|my_center|LOCUS_13400 1386934 1387461 gene locus_tag LOCUS_13410 1386934 1387461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923009.1 protein_id gnl|my_center|LOCUS_13410 1387458 1388534 gene locus_tag LOCUS_13420 gene rlmN 1387458 1388534 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864795.1 protein_id gnl|my_center|LOCUS_13420 1389203 1389424 gene locus_tag LOCUS_13430 1389203 1389424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1390666 1389830 gene locus_tag LOCUS_13440 1390666 1389830 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891825.1 protein_id gnl|my_center|LOCUS_13440 1390813 1392141 gene locus_tag LOCUS_13450 gene purB 1390813 1392141 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865088.1 protein_id gnl|my_center|LOCUS_13450 1392204 1392767 gene locus_tag LOCUS_13460 1392204 1392767 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761174.1 protein_id gnl|my_center|LOCUS_13460 1392927 1393967 gene locus_tag LOCUS_13470 1392927 1393967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1393960 1394907 gene locus_tag LOCUS_13480 1393960 1394907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1394895 1395887 gene locus_tag LOCUS_13490 1394895 1395887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1395868 1396755 gene locus_tag LOCUS_13500 1395868 1396755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1397055 1397402 gene locus_tag LOCUS_13510 1397055 1397402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1398977 1397739 gene locus_tag LOCUS_13520 1398977 1397739 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157499.1 protein_id gnl|my_center|LOCUS_13520 1400464 1398974 gene locus_tag LOCUS_13530 gene putP 1400464 1398974 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687602.1 protein_id gnl|my_center|LOCUS_13530 1402847 1400466 gene locus_tag LOCUS_13540 1402847 1400466 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865087.1 protein_id gnl|my_center|LOCUS_13540 1403054 1403827 gene locus_tag LOCUS_13550 1403054 1403827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1408094 1404651 gene locus_tag LOCUS_13560 1408094 1404651 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857980.1 protein_id gnl|my_center|LOCUS_13560 1410832 1408205 gene locus_tag LOCUS_13570 gene polA 1410832 1408205 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858644.1 protein_id gnl|my_center|LOCUS_13570 1411072 1413162 gene locus_tag LOCUS_13580 1411072 1413162 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860421.1 protein_id gnl|my_center|LOCUS_13580 1414194 1413880 gene locus_tag LOCUS_13590 1414194 1413880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1415108 1414191 gene locus_tag LOCUS_13600 1415108 1414191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1416064 1415570 gene locus_tag LOCUS_13610 1416064 1415570 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891887.1 protein_id gnl|my_center|LOCUS_13610 1416846 1416061 gene locus_tag LOCUS_13620 gene napH 1416846 1416061 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891886.1 protein_id gnl|my_center|LOCUS_13620 1417601 1416846 gene locus_tag LOCUS_13630 gene napG 1417601 1416846 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852504.1 protein_id gnl|my_center|LOCUS_13630 1420366 1417604 gene locus_tag LOCUS_13640 gene napA 1420366 1417604 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852404.1 protein_id gnl|my_center|LOCUS_13640 1421376 1420447 gene locus_tag LOCUS_13650 gene pdxA 1421376 1420447 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075036.1 protein_id gnl|my_center|LOCUS_13650 1422146 1421373 gene locus_tag LOCUS_13660 1422146 1421373 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853163.1 protein_id gnl|my_center|LOCUS_13660 1422197 1423051 gene locus_tag LOCUS_13670 1422197 1423051 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853555.1 protein_id gnl|my_center|LOCUS_13670 1423061 1423501 gene locus_tag LOCUS_13680 1423061 1423501 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858625.1 protein_id gnl|my_center|LOCUS_13680 1423542 1426289 gene locus_tag LOCUS_13690 1423542 1426289 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245018.1 protein_id gnl|my_center|LOCUS_13690 1427760 1426333 gene locus_tag LOCUS_13700 gene glnA 1427760 1426333 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858636.1 protein_id gnl|my_center|LOCUS_13700 1428546 1427983 gene locus_tag LOCUS_13710 1428546 1427983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1429887 1428622 gene locus_tag LOCUS_13720 gene porA 1429887 1428622 CDS product group 1 major outer membrane porin protein PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891919.1 protein_id gnl|my_center|LOCUS_13720 1432148 1430175 gene locus_tag LOCUS_13730 gene uvrB 1432148 1430175 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855027.1 protein_id gnl|my_center|LOCUS_13730 1432225 1432458 gene locus_tag LOCUS_13740 1432225 1432458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1432455 1432691 gene locus_tag LOCUS_13750 1432455 1432691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1432688 1433155 gene locus_tag LOCUS_13760 1432688 1433155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1433471 1433352 gene locus_tag LOCUS_13770 1433471 1433352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1434205 1433753 gene locus_tag LOCUS_13780 1434205 1433753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1434405 1434202 gene locus_tag LOCUS_13790 1434405 1434202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1434946 1434395 gene locus_tag LOCUS_13800 gene rsmG 1434946 1434395 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853035.1 protein_id gnl|my_center|LOCUS_13800 1435508 1434927 gene locus_tag LOCUS_13810 gene ribA 1435508 1434927 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853056.1 protein_id gnl|my_center|LOCUS_13810 1435574 1436551 gene locus_tag LOCUS_13820 gene hemB 1435574 1436551 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852925.1 protein_id gnl|my_center|LOCUS_13820 1436563 1437483 gene locus_tag LOCUS_13830 gene argF 1436563 1437483 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858026.1 protein_id gnl|my_center|LOCUS_13830 1437483 1437953 gene locus_tag LOCUS_13840 1437483 1437953 CDS product DUF2603 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853412.1 protein_id gnl|my_center|LOCUS_13840 1437953 1439311 gene locus_tag LOCUS_13850 gene hemN 1437953 1439311 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853363.1 protein_id gnl|my_center|LOCUS_13850 1440003 1439629 gene locus_tag LOCUS_13860 1440003 1439629 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964577.1 protein_id gnl|my_center|LOCUS_13860 1441043 1440246 gene locus_tag LOCUS_13870 gene hcpA 1441043 1440246 CDS product Sel1-like repeat protein HcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901420.1 protein_id gnl|my_center|LOCUS_13870 1442293 1441115 gene locus_tag LOCUS_13880 1442293 1441115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1443608 1442388 gene locus_tag LOCUS_13890 1443608 1442388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1443769 1445079 gene locus_tag LOCUS_13900 gene murC 1443769 1445079 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891904.1 protein_id gnl|my_center|LOCUS_13900 1445076 1445426 gene locus_tag LOCUS_13910 1445076 1445426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1445423 1447624 gene locus_tag LOCUS_13920 1445423 1447624 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891903.1 protein_id gnl|my_center|LOCUS_13920 1450157 1447908 gene locus_tag LOCUS_13930 gene bamA 1450157 1447908 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851708.1 protein_id gnl|my_center|LOCUS_13930 1450233 1451063 gene locus_tag LOCUS_13940 1450233 1451063 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_13940 1451129 1452490 gene locus_tag LOCUS_13950 1451129 1452490 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858680.1 protein_id gnl|my_center|LOCUS_13950 1452537 1453421 gene locus_tag LOCUS_13960 gene lpxC 1452537 1453421 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859351.1 protein_id gnl|my_center|LOCUS_13960 1453452 1453883 gene locus_tag LOCUS_13970 1453452 1453883 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851789.1 protein_id gnl|my_center|LOCUS_13970 1453893 1454771 gene locus_tag LOCUS_13980 gene thrB 1453893 1454771 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002888538.1 protein_id gnl|my_center|LOCUS_13980 1454791 1454994 gene locus_tag LOCUS_13990 1454791 1454994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1454984 1457728 gene locus_tag LOCUS_14000 gene infB 1454984 1457728 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864659.1 protein_id gnl|my_center|LOCUS_14000 1457725 1458087 gene locus_tag LOCUS_14010 gene rbfA 1457725 1458087 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002778650.1 protein_id gnl|my_center|LOCUS_14010 1458080 1458502 gene locus_tag LOCUS_14020 gene rimP 1458080 1458502 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800873.1 protein_id gnl|my_center|LOCUS_14020 1458687 1458762 gene locus_tag LOCUS_t00190 1458687 1458762 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1458800 1458884 gene locus_tag LOCUS_t00200 1458800 1458884 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1458896 1458972 gene locus_tag LOCUS_t00210 1458896 1458972 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1459082 1459156 gene locus_tag LOCUS_t00220 1459082 1459156 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1459228 1460427 gene locus_tag LOCUS_14030 gene tuf 1459228 1460427 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855271.1 protein_id gnl|my_center|LOCUS_14030 1460476 1460646 gene locus_tag LOCUS_14040 gene rpmG 1460476 1460646 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002793551.1 protein_id gnl|my_center|LOCUS_14040 1460663 1460738 gene locus_tag LOCUS_t00230 1460663 1460738 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1460753 1460932 gene locus_tag LOCUS_14050 gene secE 1460753 1460932 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854985.1 protein_id gnl|my_center|LOCUS_14050 1460942 1461472 gene locus_tag LOCUS_14060 gene nusG 1460942 1461472 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851098.1 protein_id gnl|my_center|LOCUS_14060 1461492 1461914 gene locus_tag LOCUS_14070 gene rplK 1461492 1461914 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779452.1 protein_id gnl|my_center|LOCUS_14070 1461969 1462670 gene locus_tag LOCUS_14080 gene rplA 1461969 1462670 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854928.1 protein_id gnl|my_center|LOCUS_14080 1462771 1463244 gene locus_tag LOCUS_14090 gene rplJ 1462771 1463244 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858610.1 protein_id gnl|my_center|LOCUS_14090 1463258 1463632 gene locus_tag LOCUS_14100 gene rplL 1463258 1463632 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858569.1 protein_id gnl|my_center|LOCUS_14100 1463721 1467860 gene locus_tag LOCUS_14110 gene rpoB 1463721 1467860 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891860.1 protein_id gnl|my_center|LOCUS_14110 1467853 1472382 gene locus_tag LOCUS_14120 gene rpoC 1467853 1472382 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858508.1 protein_id gnl|my_center|LOCUS_14120 1472407 1472805 gene locus_tag LOCUS_14130 1472407 1472805 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170794.1 protein_id gnl|my_center|LOCUS_14130 1472895 1473269 gene locus_tag LOCUS_14140 gene rpsL 1472895 1473269 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002782934.1 protein_id gnl|my_center|LOCUS_14140 1473341 1473811 gene locus_tag LOCUS_14150 gene rpsG 1473341 1473811 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779471.1 protein_id gnl|my_center|LOCUS_14150 1473821 1475896 gene locus_tag LOCUS_14160 gene fusA 1473821 1475896 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779472.1 protein_id gnl|my_center|LOCUS_14160 1478209 1477163 gene locus_tag LOCUS_14170 gene ansB 1478209 1477163 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262105.1 protein_id gnl|my_center|LOCUS_14170 1478602 1478357 gene locus_tag LOCUS_14180 1478602 1478357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1479536 1478613 gene locus_tag LOCUS_14190 1479536 1478613 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195333.1 protein_id gnl|my_center|LOCUS_14190 1480177 1479533 gene locus_tag LOCUS_14200 1480177 1479533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1480248 1480796 gene locus_tag LOCUS_14210 1480248 1480796 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_14210 1481207 1481120 gene locus_tag LOCUS_t00240 1481207 1481120 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1481305 1481232 gene locus_tag LOCUS_t00250 1481305 1481232 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1481396 1481307 gene locus_tag LOCUS_t00260 1481396 1481307 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1481491 1481417 gene locus_tag LOCUS_t00270 1481491 1481417 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1483158 1482370 gene locus_tag LOCUS_14220 1483158 1482370 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891854.1 protein_id gnl|my_center|LOCUS_14220 1484099 1483158 gene locus_tag LOCUS_14230 1484099 1483158 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864776.1 protein_id gnl|my_center|LOCUS_14230 1485432 1484185 gene locus_tag LOCUS_14240 1485432 1484185 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858710.1 protein_id gnl|my_center|LOCUS_14240 1486934 1485435 gene locus_tag LOCUS_14250 gene lysS 1486934 1485435 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858694.1 protein_id gnl|my_center|LOCUS_14250 1487401 1486934 gene locus_tag LOCUS_14260 1487401 1486934 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854230.1 protein_id gnl|my_center|LOCUS_14260 1488067 1487411 gene locus_tag LOCUS_14270 1488067 1487411 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858643.1 protein_id gnl|my_center|LOCUS_14270 1489152 1488067 gene locus_tag LOCUS_14280 1489152 1488067 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417568.1 protein_id gnl|my_center|LOCUS_14280 1489457 1489164 gene locus_tag LOCUS_14290 gene gatC 1489457 1489164 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858734.1 protein_id gnl|my_center|LOCUS_14290 1489572 1490141 gene locus_tag LOCUS_14300 1489572 1490141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1490138 1491154 gene locus_tag LOCUS_14310 1490138 1491154 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858656.1 protein_id gnl|my_center|LOCUS_14310 1491144 1491476 gene locus_tag LOCUS_14320 1491144 1491476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1491463 1492083 gene locus_tag LOCUS_14330 1491463 1492083 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864777.1 protein_id gnl|my_center|LOCUS_14330 1492083 1492691 gene locus_tag LOCUS_14340 gene hisG 1492083 1492691 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881046.1 protein_id gnl|my_center|LOCUS_14340 1494745 1493291 gene locus_tag LOCUS_14350 gene pyk 1494745 1493291 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858708.1 protein_id gnl|my_center|LOCUS_14350 1496196 1494850 gene locus_tag LOCUS_14360 1496196 1494850 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854402.1 protein_id gnl|my_center|LOCUS_14360 1496326 1496874 gene locus_tag LOCUS_14370 1496326 1496874 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964937.1 protein_id gnl|my_center|LOCUS_14370 1496912 1497214 gene locus_tag LOCUS_14380 1496912 1497214 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089812.1 protein_id gnl|my_center|LOCUS_14380 1499220 1497655 gene locus_tag LOCUS_14390 1499220 1497655 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411694.1 protein_id gnl|my_center|LOCUS_14390 1500075 1499239 gene locus_tag LOCUS_14400 1500075 1499239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1500934 1500173 gene locus_tag LOCUS_14410 1500934 1500173 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851821.1 protein_id gnl|my_center|LOCUS_14410 1501650 1500931 gene locus_tag LOCUS_14420 1501650 1500931 CDS product plasminogen-binding N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852692.1 protein_id gnl|my_center|LOCUS_14420 1501772 1502932 gene locus_tag LOCUS_14430 1501772 1502932 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852845.1 protein_id gnl|my_center|LOCUS_14430 1502943 1504307 gene locus_tag LOCUS_14440 gene mgtE 1502943 1504307 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389748.1 protein_id gnl|my_center|LOCUS_14440 1504292 1504882 gene locus_tag LOCUS_14450 1504292 1504882 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119978.1 protein_id gnl|my_center|LOCUS_14450 1506464 1505259 gene locus_tag LOCUS_14460 1506464 1505259 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241220.1 protein_id gnl|my_center|LOCUS_14460 1506893 1506546 gene locus_tag LOCUS_14470 1506893 1506546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1506901 1507089 gene locus_tag LOCUS_14480 1506901 1507089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1507357 1507911 gene locus_tag LOCUS_14490 1507357 1507911 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_14490 1507913 1509268 gene locus_tag LOCUS_14500 1507913 1509268 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_14500 1509319 1511148 gene locus_tag LOCUS_14510 1509319 1511148 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_14510 1511269 1511535 gene locus_tag LOCUS_14520 gene rpsT 1511269 1511535 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851317.1 protein_id gnl|my_center|LOCUS_14520 1511536 1512603 gene locus_tag LOCUS_14530 gene prfA 1511536 1512603 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851189.1 protein_id gnl|my_center|LOCUS_14530 1513900 1513010 gene locus_tag LOCUS_14540 1513900 1513010 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808885.1 protein_id gnl|my_center|LOCUS_14540 1515185 1513905 gene locus_tag LOCUS_14550 1515185 1513905 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853398.1 protein_id gnl|my_center|LOCUS_14550 1516861 1515479 gene locus_tag LOCUS_14560 1516861 1515479 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852810.1 protein_id gnl|my_center|LOCUS_14560 1517132 1516878 gene locus_tag LOCUS_14570 1517132 1516878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1517800 1517129 gene locus_tag LOCUS_14580 gene rnc 1517800 1517129 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851153.1 protein_id gnl|my_center|LOCUS_14580 1518229 1517804 gene locus_tag LOCUS_14590 gene rnhA 1518229 1517804 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851277.1 protein_id gnl|my_center|LOCUS_14590 1519226 1518207 gene locus_tag LOCUS_14600 1519226 1518207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851401.1 protein_id gnl|my_center|LOCUS_14600 1519284 1520930 gene locus_tag LOCUS_14610 1519284 1520930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1520927 1521910 gene locus_tag LOCUS_14620 1520927 1521910 CDS product MnmA/TRMU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851386.1 protein_id gnl|my_center|LOCUS_14620 1521956 1522090 gene locus_tag LOCUS_14630 1521956 1522090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1522191 1522451 gene locus_tag LOCUS_14640 1522191 1522451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1522552 1523016 gene locus_tag LOCUS_14650 1522552 1523016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1523613 1523744 gene locus_tag LOCUS_14660 1523613 1523744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1525050 1524583 gene locus_tag LOCUS_14670 1525050 1524583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1529138 1525587 gene locus_tag LOCUS_14680 gene nifJ 1529138 1525587 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851382.1 protein_id gnl|my_center|LOCUS_14680 1529866 1529213 gene locus_tag LOCUS_14690 1529866 1529213 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851542.1 protein_id gnl|my_center|LOCUS_14690 1530934 1529933 gene locus_tag LOCUS_14700 gene cadF 1530934 1529933 CDS product fibronectin-binding outer membrane protein CadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851185.1 protein_id gnl|my_center|LOCUS_14700 1531419 1531030 gene locus_tag LOCUS_14710 gene rpsI 1531419 1531030 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851459.1 protein_id gnl|my_center|LOCUS_14710 1531847 1531422 gene locus_tag LOCUS_14720 gene rplM 1531847 1531422 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779321.1 protein_id gnl|my_center|LOCUS_14720 1532042 1532118 gene locus_tag LOCUS_t00280 1532042 1532118 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1533534 1532332 gene locus_tag LOCUS_14730 gene murD 1533534 1532332 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858617.1 protein_id gnl|my_center|LOCUS_14730 1534497 1533538 gene locus_tag LOCUS_14740 gene mraY 1534497 1533538 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858494.1 protein_id gnl|my_center|LOCUS_14740 1534681 1536144 gene locus_tag LOCUS_14750 gene gpmI 1534681 1536144 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858599.1 protein_id gnl|my_center|LOCUS_14750 1537337 1536609 gene locus_tag LOCUS_14760 1537337 1536609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1537855 1537334 gene locus_tag LOCUS_14770 1537855 1537334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1538035 1538110 gene locus_tag LOCUS_t00290 1538035 1538110 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1538127 1538203 gene locus_tag LOCUS_t00300 1538127 1538203 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1538271 1538344 gene locus_tag LOCUS_t00310 1538271 1538344 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1538394 1538484 gene locus_tag LOCUS_t00320 1538394 1538484 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1539123 1539198 gene locus_tag LOCUS_t00330 1539123 1539198 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1539234 1539307 gene locus_tag LOCUS_t00340 1539234 1539307 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1540242 1539685 gene locus_tag LOCUS_14780 1540242 1539685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1540451 1540239 gene locus_tag LOCUS_14790 1540451 1540239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1540798 1540454 gene locus_tag LOCUS_14800 1540798 1540454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1541156 1540809 gene locus_tag LOCUS_14810 1541156 1540809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1541840 1541622 gene locus_tag LOCUS_14820 1541840 1541622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1542021 1542308 gene locus_tag LOCUS_14830 1542021 1542308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1543000 1542644 gene locus_tag LOCUS_14840 1543000 1542644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1543715 1542987 gene locus_tag LOCUS_14850 1543715 1542987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1544014 1543715 gene locus_tag LOCUS_14860 1544014 1543715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1544769 1544017 gene locus_tag LOCUS_14870 1544769 1544017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1544909 1544766 gene locus_tag LOCUS_14880 1544909 1544766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1545099 1544953 gene locus_tag LOCUS_14890 1545099 1544953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1546170 1545109 gene locus_tag LOCUS_14900 1546170 1545109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1546809 1546174 gene locus_tag LOCUS_14910 1546809 1546174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1547144 1546824 gene locus_tag LOCUS_14920 1547144 1546824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1548626 1547205 gene locus_tag LOCUS_14930 1548626 1547205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1549174 1548743 gene locus_tag LOCUS_14940 1549174 1548743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1549365 1549171 gene locus_tag LOCUS_14950 1549365 1549171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1550296 1549346 gene locus_tag LOCUS_14960 1550296 1549346 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106069164.1 protein_id gnl|my_center|LOCUS_14960 1550548 1551123 gene locus_tag LOCUS_14970 1550548 1551123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1551181 1551603 gene locus_tag LOCUS_14980 1551181 1551603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1552218 1551718 gene locus_tag LOCUS_14990 1552218 1551718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1552862 1552299 gene locus_tag LOCUS_15000 1552862 1552299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1554266 1553010 gene locus_tag LOCUS_15010 1554266 1553010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1554367 1554443 gene locus_tag LOCUS_t00350 1554367 1554443 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1554775 1555335 gene locus_tag LOCUS_15020 1554775 1555335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1556101 1557165 gene locus_tag LOCUS_15030 1556101 1557165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1559386 1557893 gene locus_tag LOCUS_15040 1559386 1557893 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227192.1 protein_id gnl|my_center|LOCUS_15040 1560851 1559442 gene locus_tag LOCUS_15050 gene aspA 1560851 1559442 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851742.1 protein_id gnl|my_center|LOCUS_15050 1562457 1561123 gene locus_tag LOCUS_15060 1562457 1561123 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858001.1 protein_id gnl|my_center|LOCUS_15060 1562897 1562457 gene locus_tag LOCUS_15070 gene accB 1562897 1562457 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853623.1 protein_id gnl|my_center|LOCUS_15070 1563253 1563825 gene locus_tag LOCUS_15080 gene dcd 1563253 1563825 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854086.1 protein_id gnl|my_center|LOCUS_15080 1563822 1565891 gene locus_tag LOCUS_15090 gene topA 1563822 1565891 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851268.1 protein_id gnl|my_center|LOCUS_15090 1565884 1566426 gene locus_tag LOCUS_15100 1565884 1566426 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250569.1 protein_id gnl|my_center|LOCUS_15100 1566423 1567586 gene locus_tag LOCUS_15110 1566423 1567586 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855678.1 protein_id gnl|my_center|LOCUS_15110 1567652 1568959 gene locus_tag LOCUS_15120 1567652 1568959 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851494.1 protein_id gnl|my_center|LOCUS_15120 1568959 1569744 gene locus_tag LOCUS_15130 1568959 1569744 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868269.1 protein_id gnl|my_center|LOCUS_15130 1570531 1570788 gene locus_tag LOCUS_15140 1570531 1570788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1570840 1571190 gene locus_tag LOCUS_15150 1570840 1571190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1571421 1571257 gene locus_tag LOCUS_15160 1571421 1571257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1571790 1571560 gene locus_tag LOCUS_15170 gene yedF 1571790 1571560 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855447.1 protein_id gnl|my_center|LOCUS_15170 1573666 1571837 gene locus_tag LOCUS_15180 1573666 1571837 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016265.1 protein_id gnl|my_center|LOCUS_15180 1573883 1573668 gene locus_tag LOCUS_15190 1573883 1573668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15190 1574287 1573910 gene locus_tag LOCUS_15200 1574287 1573910 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_15200 1575290 1574664 gene locus_tag LOCUS_15210 1575290 1574664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1579099 1575458 gene locus_tag LOCUS_15220 gene dnaE 1579099 1575458 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852165.1 protein_id gnl|my_center|LOCUS_15220 1579244 1580944 gene locus_tag LOCUS_15230 1579244 1580944 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225623.1 protein_id gnl|my_center|LOCUS_15230 1580956 1588305 gene locus_tag LOCUS_15240 1580956 1588305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1588295 1588648 gene locus_tag LOCUS_15250 1588295 1588648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1588812 1589438 gene locus_tag LOCUS_15260 1588812 1589438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1589438 1589992 gene locus_tag LOCUS_15270 1589438 1589992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1590030 1591304 gene locus_tag LOCUS_15280 1590030 1591304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1591475 1591840 gene locus_tag LOCUS_15290 1591475 1591840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1592091 1592321 gene locus_tag LOCUS_15300 1592091 1592321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1592311 1592793 gene locus_tag LOCUS_15310 1592311 1592793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1593193 1593450 gene locus_tag LOCUS_15320 1593193 1593450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1593566 1593970 gene locus_tag LOCUS_15330 1593566 1593970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1594061 1594399 gene locus_tag LOCUS_15340 1594061 1594399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1594469 1595311 gene locus_tag LOCUS_15350 1594469 1595311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1595308 1595784 gene locus_tag LOCUS_15360 1595308 1595784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1595817 1596245 gene locus_tag LOCUS_15370 1595817 1596245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1596238 1596750 gene locus_tag LOCUS_15380 1596238 1596750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1596783 1597211 gene locus_tag LOCUS_15390 1596783 1597211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1597204 1597731 gene locus_tag LOCUS_15400 1597204 1597731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1597764 1597931 gene locus_tag LOCUS_15410 1597764 1597931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1597918 1598265 gene locus_tag LOCUS_15420 1597918 1598265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116963198.1 protein_id gnl|my_center|LOCUS_15420 1598322 1598561 gene locus_tag LOCUS_15430 1598322 1598561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1598563 1598958 gene locus_tag LOCUS_15440 1598563 1598958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1598930 1599223 gene locus_tag LOCUS_15450 1598930 1599223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1599326 1599640 gene locus_tag LOCUS_15460 1599326 1599640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1600114 1600389 gene locus_tag LOCUS_15470 1600114 1600389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1602983 1600497 gene locus_tag LOCUS_15480 1602983 1600497 CDS product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891848.1 protein_id gnl|my_center|LOCUS_15480 1603557 1602997 gene locus_tag LOCUS_15490 1603557 1602997 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851702.1 protein_id gnl|my_center|LOCUS_15490 1604574 1604038 gene locus_tag LOCUS_15500 1604574 1604038 CDS product DUF5384 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755164.1 protein_id gnl|my_center|LOCUS_15500 1605103 1604585 gene locus_tag LOCUS_15510 1605103 1604585 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669402.1 protein_id gnl|my_center|LOCUS_15510 1605718 1607224 gene locus_tag LOCUS_r00060 1605718 1607224 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1607528 1607603 gene locus_tag LOCUS_t00360 1607528 1607603 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1607689 1607765 gene locus_tag LOCUS_t00370 1607689 1607765 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1608395 1609522 gene locus_tag LOCUS_15520 1608395 1609522 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963780.1 protein_id gnl|my_center|LOCUS_15520 1609519 1609887 gene locus_tag LOCUS_15530 1609519 1609887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1610023 1612284 gene locus_tag LOCUS_15540 1610023 1612284 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_15540 1612322 1612936 gene locus_tag LOCUS_15550 gene plsY 1612322 1612936 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854681.1 protein_id gnl|my_center|LOCUS_15550 1612936 1613250 gene locus_tag LOCUS_15560 1612936 1613250 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854273.1 protein_id gnl|my_center|LOCUS_15560 1614070 1613288 gene locus_tag LOCUS_15570 1614070 1613288 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_15570 1614133 1615392 gene locus_tag LOCUS_15580 1614133 1615392 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852318.1 protein_id gnl|my_center|LOCUS_15580 1615389 1615883 gene locus_tag LOCUS_15590 gene purE 1615389 1615883 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852194.1 protein_id gnl|my_center|LOCUS_15590 1618167 1616686 gene locus_tag LOCUS_15600 1618167 1616686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1619464 1618691 gene locus_tag LOCUS_15610 gene thiD 1619464 1618691 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948480.1 protein_id gnl|my_center|LOCUS_15610 1620894 1619461 gene locus_tag LOCUS_15620 1620894 1619461 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693417.1 protein_id gnl|my_center|LOCUS_15620 1621510 1620905 gene locus_tag LOCUS_15630 1621510 1620905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1622276 1621602 gene locus_tag LOCUS_15640 1622276 1621602 CDS product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211607.1 protein_id gnl|my_center|LOCUS_15640 1622632 1622273 gene locus_tag LOCUS_15650 1622632 1622273 CDS product DUF4810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215846.1 protein_id gnl|my_center|LOCUS_15650 1623302 1622643 gene locus_tag LOCUS_15660 1623302 1622643 CDS product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172134.1 protein_id gnl|my_center|LOCUS_15660 1625071 1624070 gene locus_tag LOCUS_15670 1625071 1624070 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858639.1 protein_id gnl|my_center|LOCUS_15670 1626069 1625077 gene locus_tag LOCUS_15680 gene plsX 1626069 1625077 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858645.1 protein_id gnl|my_center|LOCUS_15680 1626217 1626071 gene locus_tag LOCUS_15690 gene rpmF 1626217 1626071 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858674.1 protein_id gnl|my_center|LOCUS_15690 1626586 1626230 gene locus_tag LOCUS_15700 1626586 1626230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1626993 1626580 gene locus_tag LOCUS_15710 gene ndk 1626993 1626580 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858685.1 protein_id gnl|my_center|LOCUS_15710 1627363 1627079 gene locus_tag LOCUS_15720 1627363 1627079 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858671.1 protein_id gnl|my_center|LOCUS_15720 1627567 1629141 gene locus_tag LOCUS_15730 gene pckA 1627567 1629141 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853265.1 protein_id gnl|my_center|LOCUS_15730 1629116 1630495 gene locus_tag LOCUS_15740 1629116 1630495 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693022.1 protein_id gnl|my_center|LOCUS_15740 1630467 1631849 gene locus_tag LOCUS_15750 gene argH 1630467 1631849 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891895.1 protein_id gnl|my_center|LOCUS_15750 1631846 1632481 gene locus_tag LOCUS_15760 1631846 1632481 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858312.1 protein_id gnl|my_center|LOCUS_15760 1632517 1634061 gene locus_tag LOCUS_15770 1632517 1634061 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016590.1 protein_id gnl|my_center|LOCUS_15770 1634330 1635745 gene locus_tag LOCUS_15780 1634330 1635745 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093056.1 protein_id gnl|my_center|LOCUS_15780 1635742 1636725 gene locus_tag LOCUS_15790 1635742 1636725 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107917.1 protein_id gnl|my_center|LOCUS_15790 1636718 1637854 gene locus_tag LOCUS_15800 gene wecB 1636718 1637854 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203393.1 protein_id gnl|my_center|LOCUS_15800 1637858 1639072 gene locus_tag LOCUS_15810 gene wecC 1637858 1639072 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791918.1 protein_id gnl|my_center|LOCUS_15810 1639209 1640411 gene locus_tag LOCUS_15820 1639209 1640411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1640399 1641775 gene locus_tag LOCUS_15830 1640399 1641775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1641802 1642947 gene locus_tag LOCUS_15840 1641802 1642947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1642940 1643638 gene locus_tag LOCUS_15850 1642940 1643638 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048101.1 protein_id gnl|my_center|LOCUS_15850 1643803 1644249 gene locus_tag LOCUS_15860 1643803 1644249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1645536 1645186 gene locus_tag LOCUS_15870 1645536 1645186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 1645763 1645533 gene locus_tag LOCUS_15880 1645763 1645533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1646553 1646380 gene locus_tag LOCUS_15890 1646553 1646380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1647652 1647401 gene locus_tag LOCUS_15900 1647652 1647401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1647792 1648028 gene locus_tag LOCUS_15910 1647792 1648028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1648765 1648025 gene locus_tag LOCUS_15920 1648765 1648025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1649540 1648842 gene locus_tag LOCUS_15930 1649540 1648842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1649679 1649554 gene locus_tag LOCUS_15940 1649679 1649554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1649833 1649663 gene locus_tag LOCUS_15950 1649833 1649663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1650074 1649823 gene locus_tag LOCUS_15960 1650074 1649823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1650291 1650061 gene locus_tag LOCUS_15970 1650291 1650061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1651888 1650677 gene locus_tag LOCUS_15980 1651888 1650677 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101723.1 protein_id gnl|my_center|LOCUS_15980 1652423 1652349 gene locus_tag LOCUS_t00380 1652423 1652349 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1652993 1652920 gene locus_tag LOCUS_t00390 1652993 1652920 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1653129 1653284 gene locus_tag LOCUS_15990 1653129 1653284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1653603 1653679 gene locus_tag LOCUS_t00400 1653603 1653679 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1654409 1655107 gene locus_tag LOCUS_16000 1654409 1655107 CDS product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864286.1 protein_id gnl|my_center|LOCUS_16000 1655117 1655500 gene locus_tag LOCUS_16010 1655117 1655500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1655841 1656026 gene locus_tag LOCUS_16020 1655841 1656026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1656659 1657777 gene locus_tag LOCUS_16030 1656659 1657777 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123234.1 protein_id gnl|my_center|LOCUS_16030 1657877 1658803 gene locus_tag LOCUS_16040 gene ilvE 1657877 1658803 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851928.1 protein_id gnl|my_center|LOCUS_16040 1658812 1659891 gene locus_tag LOCUS_16050 1658812 1659891 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858687.1 protein_id gnl|my_center|LOCUS_16050 1659921 1660676 gene locus_tag LOCUS_16060 gene hisIE 1659921 1660676 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124735.1 protein_id gnl|my_center|LOCUS_16060 1661427 1663526 gene locus_tag LOCUS_16070 1661427 1663526 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244161.1 protein_id gnl|my_center|LOCUS_16070 1663519 1664823 gene locus_tag LOCUS_16080 1663519 1664823 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_16080 1664896 1665066 gene locus_tag LOCUS_16090 1664896 1665066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1665084 1666571 gene locus_tag LOCUS_16100 1665084 1666571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1666555 1667235 gene locus_tag LOCUS_16110 1666555 1667235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1668235 1669530 gene locus_tag LOCUS_16120 1668235 1669530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1676362 1669625 gene locus_tag LOCUS_16130 1676362 1669625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1679951 1676559 gene locus_tag LOCUS_16140 1679951 1676559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1680854 1679985 gene locus_tag LOCUS_16150 1680854 1679985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1682987 1680954 gene locus_tag LOCUS_16160 1682987 1680954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1683499 1683071 gene locus_tag LOCUS_16170 1683499 1683071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1684444 1683524 gene locus_tag LOCUS_16180 1684444 1683524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1684859 1684512 gene locus_tag LOCUS_16190 1684859 1684512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1685773 1684898 gene locus_tag LOCUS_16200 1685773 1684898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1686835 1685873 gene locus_tag LOCUS_16210 1686835 1685873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1688022 1687132 gene locus_tag LOCUS_16220 1688022 1687132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1688980 1688108 gene locus_tag LOCUS_16230 1688980 1688108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1689852 1689091 gene locus_tag LOCUS_16240 1689852 1689091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1690279 1689938 gene locus_tag LOCUS_16250 1690279 1689938 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198807.1 protein_id gnl|my_center|LOCUS_16250 1690780 1690406 gene locus_tag LOCUS_16260 gene acpS 1690780 1690406 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857939.1 protein_id gnl|my_center|LOCUS_16260 1691269 1690781 gene locus_tag LOCUS_16270 1691269 1690781 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869004.1 protein_id gnl|my_center|LOCUS_16270 1692013 1691279 gene locus_tag LOCUS_16280 1692013 1691279 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780603.1 protein_id gnl|my_center|LOCUS_16280 1692120 1692317 gene locus_tag LOCUS_16290 1692120 1692317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1692310 1694469 gene locus_tag LOCUS_16300 gene copA 1692310 1694469 CDS product copper-translocating P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002875419.1 protein_id gnl|my_center|LOCUS_16300 1695487 1695017 gene locus_tag LOCUS_16310 1695487 1695017 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852552.1 protein_id gnl|my_center|LOCUS_16310 1695593 1698145 gene locus_tag LOCUS_16320 1695593 1698145 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852522.1 protein_id gnl|my_center|LOCUS_16320 1698200 1699129 gene locus_tag LOCUS_16330 1698200 1699129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1699367 1701052 gene locus_tag LOCUS_16340 1699367 1701052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1701678 1701754 gene locus_tag LOCUS_t00410 1701678 1701754 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1701759 1701834 gene locus_tag LOCUS_t00420 1701759 1701834 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1701842 1701918 gene locus_tag LOCUS_t00430 1701842 1701918 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1701930 1702006 gene locus_tag LOCUS_t00440 1701930 1702006 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1702015 1702089 gene locus_tag LOCUS_t00450 1702015 1702089 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1702585 1702929 gene locus_tag LOCUS_16350 1702585 1702929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1703068 1703895 gene locus_tag LOCUS_16360 1703068 1703895 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16360 1704086 1704286 gene locus_tag LOCUS_16370 1704086 1704286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1704298 1704732 gene locus_tag LOCUS_16380 1704298 1704732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1704978 1705478 gene locus_tag LOCUS_16390 1704978 1705478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1705489 1705818 gene locus_tag LOCUS_16400 1705489 1705818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1705815 1706261 gene locus_tag LOCUS_16410 1705815 1706261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1706443 1706264 gene locus_tag LOCUS_16420 1706443 1706264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1706637 1706915 gene locus_tag LOCUS_16430 1706637 1706915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1707112 1707621 gene locus_tag LOCUS_16440 1707112 1707621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 1707698 1708777 gene locus_tag LOCUS_16450 1707698 1708777 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_16450 1709388 1709185 gene locus_tag LOCUS_16460 1709388 1709185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence2 2305 698 gene locus_tag LOCUS_16470 2305 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2610 2302 gene locus_tag LOCUS_16480 2610 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence3 407 290 gene locus_tag LOCUS_r00070 407 290 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8